Downloaded from on April 21, 2020 by guest · 2019. 7. 16. · 33 there is a requirement to...

1

Peptidyl-prolyl isomerase, ppiB, is essential for proteome homeostasis and 1

virulence in Burkholderia pseudomallei 2

3

Nicole M. Bzdyl1, Nichollas E. Scott2, Isobel H. Norville3, Andrew E. Scott3, Timothy 4

Atkins3, Stanley Pang4, Derek S. Sarovich5, Geoffrey Coombs4,6, Timothy J. J. Inglis1,6,7, 5

Charlene M. Kahler1 and Mitali Sarkar-Tyson1 6

7

1Marshall Centre for Infectious Diseases Research and Training, School of Biomedical 8

Sciences, University of Western Australia, Perth, WA, Australia 9

2Department of Microbiology and Immunology, University of Melbourne at the Peter 10

Doherty Institute for Infection and Immunity, Parkville, VIC 3010 Australia 11

3Defence Science Technology Laboratory (Dstl), Porton Down, Salisbury, United 12

Kingdom 13

4School of Veterinary and Life Sciences, Murdoch University, Murdoch, Australia. 14

5GeneCology Research Centre, University of the Sunshine Coast, Sippy Downs, QLD, 15

Australia 16

6PathWest Laboratory Medicine WA, Perth, WA, Australia 17

7School of Medicine, University of Western Australia, Perth, WA, Australia 18

19

Correspondence Address: 20

IAI Accepted Manuscript Posted Online 22 July 2019Infect. Immun. doi:10.1128/IAI.00528-19Copyright © 2019 American Society for Microbiology. All Rights Reserved.

on Decem

ber 22, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

http://iai.asm.org/

2

Dr Mitali Sarkar-Tyson 21

Marshall Centre for Infectious Diseases Research and Training 22

School of Biomedical Sciences 23

University of Western Australia 24

Perth, WA, Australia 25

E-mail: [email protected] 26

Tel: +61 8 6457 4872 27

28

on Decem


.org/D

ownloaded from

http://iai.asm.org/

3

Abstract 29

Burkholderia pseudomallei is the causative agent of melioidosis, a disease endemic in 30

South-East Asia and northern Australia. Mortality rates in these areas are high even 31

with antimicrobial treatment, and there are few options for effective therapy. Therefore 32

there is a requirement to identify anti-bacterial targets for the development of novel 33

treatments. Cyclophilins are a family of highly conserved enzymes important in multiple 34

cellular processes. Cyclophilins catalyse the cis-trans isomerization of xaa-proline 35

bonds, a rate limiting step in protein folding which has been shown to be important for 36

bacterial virulence. B. pseudomallei encodes a putative cyclophilin B gene, ppiB, the 37

role of which was investigated. A mutant strain, BpsΔppiB, demonstrates impaired 38

biofilm formation and reduced motility. Macrophage invasion and survival assays 39

showed that although BpsΔppiB retained the ability to infect macrophages, it had 40

reduced survival and lacked the ability to spread cell-to-cell, indicating ppiB is essential 41

for B. pseudomallei virulence. This is reflected in the BALB/c mouse infection model 42

demonstrating the requirement of ppiB for in vivo disease dissemination and 43

progression. Proteomic analysis demonstrates that the loss of PpiB leads to pleiotropic 44

effects supporting the role of PpiB in maintaining proteome homeostasis. The loss of 45

PpiB leads to decreased abundance of multiple virulence determinants including 46

flagellar machinery and alterations in Type VI secretion system proteins. In addition, the 47

loss of ppiB leads to increased sensitivity towards multiple antibiotics including 48

meropenem and doxycycline, highlighting ppiB inhibition as a promising anti-virulence 49

target to both treat B. pseudomallei infections and increase antibiotic efficacy. 50

51

on Decem


.org/D

ownloaded from

http://iai.asm.org/

4

Introduction 52

Burkholderia pseudomallei is a Gram-negative soil saprophyte found in tropical and 53

sub-tropical areas around the world such as in South-East Asia and northern Australia 54

(1-3). It is the causative agent of melioidosis and has been reported in 45 countries with 55

a predicted global burden of 165,000 cases and 89,000 deaths annually (4). Melioidosis 56

can present as a variety of clinical syndromes ranging from non-healing skin lesions to 57

intra-abdominal abscesses to pneumonia and septicaemia (5), leading to difficulty in 58

prompt diagnosis particularly in non-endemic regions. Mortality rates vary depending on 59

geographic location with rates ranging from 14% in Darwin (5) to 49% in North-East 60

Thailand (6). Treatment of melioidosis is prolonged, consisting of two phases; a two-61

week intensive intravenous phase followed by a 3 to 6-month oral eradication phase (7, 62

8). Due to intrinsic resistance to antimicrobials (9) treatment of B. pseudomallei infection 63

can be further complicated by the limited number of viable antimicrobial alternatives. 64

Relapse of infection is common and is associated with increased mortality, particularly 65

in cases were treatment is unsuccessful or an incomplete course of antimicrobial 66

therapy is taken (10, 11). 67

B. pseudomallei infections can be difficult to overcome due to the bacterium encoding 68

for an array of defence mechanisms which enables successful survival in diverse 69

environments including inside mammalian host cells. The ability of B. pseudomallei to 70

form biofilms allows it to persist in the environment and has been implicated in infection 71

(12-14). B. pseudomallei encodes flagellin, important for disease dissemination and 72

virulence in BALB/c mouse infection models (15, 16). Intracellular survival is reliant on 73

B. pseudomallei rapidly escaping from the phagolysosome and establishing a replicative 74

on Decem


.org/D

ownloaded from

http://iai.asm.org/

5

niche in the cytosol of eukaryotic cells (17). The ability to escape into the cytosol is 75

dependent on multiple secretion systems which function to deliver specialised secreted 76

proteins known as effectors into the host which enhance bacterial survival and enable 77

the spread of B. pseudomallei into neighbouring cells (18). Three different Type-III 78

Secretion Systems (T3SS-1, -2, -3) are found in B. pseudomallei with only T3SS-3 79

required for full virulence in a hamster model of infection (17, 19-21). Following 80

phagosome escape and replication in the cytosol, expression of Type-VI Secretion 81

Systems (T6SS) is induced and is essential for in vivo virulence (22-24). A well-82

documented phenomena of B. pseudomallei is the formation of multinucleated giant 83

cells (MNGC). This formation has been attributed to the T6SS-5 (T6SS Cluster 1) 84

effector VgrG-5 which is required to stimulate cell fusion and leading to the spread of 85

infection (22, 25, 26). Six clusters of T6SS are found in B. pseudomallei with T6SS 86

Cluster 1, as defined by Shalom et al (24) as tss5, shown to play a role in the formation 87

of MNGC and cellular cytotoxicity (26, 27) Throughout this paper the Schell et al (28) 88

nomenclature for T6SS will be used . 89

90

Cyclophilins are part of the immunophilin superfamily, with bacteria generally encoding 91

two cyclophilin genes, ppiA and ppiB with one located in the cytoplasm and the other in 92

the periplasm or outer membrane respectively (29). Cyclophilins catalyse the cis-trans 93

isomerisation of xaa-proline bonds, a rate limiting step in protein folding, which is 94

required for proteome homeostasis (30, 31). Not only are cyclophilins required for 95

optimal protein folding but in multiple bacterial systems cyclophilins are important for 96

stress response and infectivity, suggesting a role in folding virulence factors. In Brucella 97

on Decem


.org/D

ownloaded from

http://iai.asm.org/

6

abortus the expression of both CypA and CypB become elevated during intracellular 98

infection with deletion of these genes resulting in virulence attenuation, reduced 99

intracellular survival and increased susceptibility to acidic and oxidative stress (32). 100

Further evidence of the role of cyclophilins in virulence is demonstrated in Legionella 101

pneumophila where the cyclophilin gene cyp18 is essential for optimal intracellular 102

survival in Acanthaemoba castellanii (33). Cyclophilins also play an important role in 103

biofilm formation with Escherichia coli ppiB shown to be a negative regulator of both 104

motility and biofilm formation, mutagenesis of E. coli ppiB results in hypermotility and 105

increased biofilm formation (34). The pleiotropic role of cyclophilins in bacteria is also 106

demonstrated in E. coli where interaction of PpiB with the protein, FtsZ, is important for 107

correct cell division, with deletion of ppiB resulting in aberrant cell division and formation 108

of filamentous cells (35). 109

110

B. pseudomallei encodes a ppiB gene, the role of which was investigated by 111

construction of a null mutant strain Bps∆ppiB. In vitro characterisation of Bps∆ppiB 112

demonstrates a loss of multiple virulence determinants including reduced motility and 113

biofilm production. Intracellular survival of Bps∆ppiB was significantly reduced with 114

bacteria confined within the macrophage cell, lacking the ability to spread cell-to-cell, 115

indicating ppiB is important for B. pseudomallei virulence. This is reflected in the BALB/c 116

mouse infection model in which BpsΔppiB was avirulent, demonstrating the important 117

role for ppiB in in vivo disease dissemination and progression. Proteomic analysis 118

confirms widespread alterations within BpsΔppiB, that are partially restored by 119

complementation of ppiB. Consistent with this, complementation restored 120

on Decem


.org/D

ownloaded from

http://iai.asm.org/

7

multinucleated cell formation and cell disruption. Finally, we demonstrate that loss of 121

ppiB leads to increased susceptibly to first-line treatment antibiotics such as 122

meropenem and doxycycline. Thus, this study shows the importance of ppiB for 123

virulence of B. pseudomallei and how disruption of proteome homeostasis may be 124

targeted to sensitize B. pseudomallei to antibiotic regimes. 125

126

Results 127

Deletion of ppiB gene in B. pseudomallei. 128

BPSL2246 (UnitProt Entry Q63SS5) encodes a putative cytoplasmic cyclophilin, ppiB 129

homologue in B. pseudomallei (Supplementary Fig 1). There is 66.3% and 57.7% 130

protein identity with cyclophilin B homologues from E. coli and L. pneumophila 131

respectively, with residues involved in enzymatic activity also being conserved 132

(Supplementary Fig 1) (36). To determine the role of ppiB in B. pseudomallei strain 133

K96243, the gene was deleted by construction of an in-frame null mutation strain, 134

Bps∆ppiB (37). Deletion of ppiB in Bps∆ppiB was confirmed by whole genome 135

sequencing. In comparison to the parent K96243, strain there was one additional SNP 136

in Bps∆ppiB that resulted in a missense mutation in rpoZ (RpoZLeu10Pro). No differences 137

in growth were observed between the BpsWT and Bps∆ppiB mutant strain in either 138

Luria Bertani broth or M9 minimal media (Supplementary Fig 2). 139

140

Bps∆ppiB can infect mouse murine macrophage cells in vitro but has reduced 141

intracellular numbers 6 and 9 hours post infection. 142

on Decem


.org/D

ownloaded from

http://iai.asm.org/

8

Mouse murine macrophages, J774.1 cells, were infected with either the wild-type or 143

Bps∆ppiB strain, bacteria were enumerated at various time points post infection (Fig 1). 144

There were no significant differences in the levels of adherence and invasion of 145

macrophages (data not shown). Significant differences in the numbers of intracellular 146

bacteria at 6 (14-fold, P-value 0.0159, Mann Whitney U-test) and 9 (36.8-fold, P-value 147

0.0159, Mann Whitney U-test) hours post infection were seen with Bps∆ppiB 148

demonstrating reduced survival and/or replication. At 12 hours Bps∆ppiB was able to 149

overcome the reduced growth phenotype showing similar levels of intracellular bacteria 150

to that of the BpsWT parental control. At 24 hours although the levels of intracellular 151

bacteria in both BpsWT and Bps∆ppiB appears to be similar, there was a substantial 152

reduction in cell cytotoxicity caused by Bps∆ppiB compared to BpsWT using LDH 153

cytotoxicity screening (Supplementary Fig 3). Together these results demonstrate 154

Bps∆ppiB has reduced growth and/or survival in macrophage cells. 155

156

ppiB is essential for in vivo infection 157

As in vitro results demonstrated a decrease in intracellular counts during early time 158

points the role of ppiB during infection was further investigated using the BALB/c mouse 159

infection model of B. pseudomallei. Groups of mice were challenged by the 160

intraperitoneal route with either BpsWT or BpsΔppiB (Fig 2A). At the end of the 161

experiment 100% of the animals challenged with Bps∆ppiB survived compared to 33% 162

in the group challenged with BpsWT (P-value 0.0183 by Log-rank (Mantel-Cox) test). 163

Disease progression was also monitored by measuring weight loss during the infection 164

on Decem


.org/D

ownloaded from

http://iai.asm.org/

9

study, all except two mice infected with BpsWT showed considerable weight loss (Fig 165

2B). In contrast, mice infected with BpsΔppiB demonstrated no weight loss throughout 166

the experiment (Figs 2C). The lungs, livers and spleens in survivors were enumerated 167

for bacteraemia, all were clear from infection at the conclusion of the experiment. This 168

demonstrates that ppiB is essential for B. pseudomallei to successfully establish in vivo 169

infection. 170

171

BpsΔppiB demonstrates reduced ability to form MNGC. 172

The in vitro cell infection study suggests BpsΔppiB is attenuated, in contrast the mouse 173

infection studies demonstrate that BpsΔppiB is avirulent. To investigate this in more 174

detail a complemented strain was constructed, BpsΔppiB/ppiB, and was further 175

characterised in macrophage cells. BpsWT, Bps∆ppiB, Bps∆ppiB/ppiB infected cells 176

were analysed by immunofluorescence microscopy 12 hours post infection. Fig 3A 177

shows that during a later time point of 12 hours post infection, macrophage cells 178

infected with BpsWT has multiple MNGC formations. In contrast, Bps∆ppiB infected 179

cells demonstrate a significant reduction in multinucleated giant cell (MNGC) formation, 180

although actin protrusions are still observed (Fig 3B). Complementation of ppiB 181

demonstrates restoration to a BpsWT phenotype (Fig 3C). Enumeration of nuclei within 182

multi-nucleated cells relative to mononucleated cells shows that there is a 67.4% 183

reduction in nuclei associated with MNGCs in macrophage monolayers infected with 184

Bps∆ppiB, this is significantly restored in the complemented strain, Bps∆ppiB/ppiB (Fig 185

on Decem


.org/D

ownloaded from

http://iai.asm.org/

10

3D), confirming the role of ppiB in the virulence of B. pseudomallei during intracellular 186

infection. 187

188

BpsΔppiB reveals marked changes in the proteome 189

To understand the changes driving the alterations in virulence, we analysed the 190

proteome of Bps∆ppiB, its complement Bps∆ppiB/ppiB and BpsWT strains. Using label 191

free based quantitative (LFQ) proteomics, we identified 2091 proteins with high 192

consistency observed across biological replicates as determined by Pearson 193

correlations (average: 0.95, Supplementary Fig 4). Consistent with the role of PpiB in 194

multiple cellular pathways, 734 proteins underwent statistically significant alterations 195

within the proteome of BpsΔppiB compared to BpsWT (Supplementary Table 1) with 196

these proteins predicted to be localized to multiple cellular compartments (Fig 4A). 197

Consistent with the loss of PpiB in BpsΔppiB, this protein demonstrated the largest fold 198

difference of -10.14 log2 within the proteome with the majority of altered proteins also 199

showing a decreased abundance in response to loss of PpiB (Fig 4B). Upon 200

complementation, PpiB levels were restored to 10% of the level of wild-type, yet 201

consistent with phenotypic assays, this led to restoration of proteins observed to 202

increase (Fig 4C) and decrease (Fig 4D) to near wild-type levels. Within the categories 203

of proteins that had reduced abundance upon the loss of PpiB, we observed alterations 204

in multiple proteins associated with motility, consistent with the reductions in BpsΔppiB 205

including BPSL3305 (CheW, -2.78587 log2, -log10(P-value): 4.38) and BPSL3301 206

(CheB1, -2.48162 log2, -log10(P-value): 6.03) as well as the flagellin (BPSL3319, FliC -207

on Decem


.org/D

ownloaded from

http://iai.asm.org/

11

3.38141 log2, -log10(P-value): 5.81). Again, consistent with phenotypic assay 208

complementation only partial restoration of these proteins occurred with FliC only 209

restored by 0.9 log2. Other changes observed in response to the loss of PpiB including 210

reduction in capsule-associated proteins BSPL2799 (WcbI, -1.32 log2, -log10(P-value): 211

4.30), BSPL2800 (WcbH, -0.47 log2, -log10(P-value): 1.36), BPSL2807 (WcbC, -0.36 212

log2, -log10(P-value): 1.61) (highlighted in green in Fig 4D) and BPSL2810 (ManC, 0.80 213

log2, -log10(P-value): 2.33), as well as increases in multiple components of the Type VI 214

T6SS-3 including BPSS2099 (TssC3, 4.49 log2, -log10(P-value): 3.38) and BPSS2098 215

(Hcp3, 3.99 log2, -log10(P-value): 4.28) (highlighted in blue in Fig 4B). A KEGG 216

pathway analysis was undertaken to determine what functional pathways were being 217

affected in Bps∆ppiB (Fig 5). Metabolism accounted for 268 of differentially present 218

proteins, with 170 being increased while 98 were decreased. Genetic Information 219

Processing, Signalling and Cellular Processes, and Environmental Information 220

Processing related proteins were a majority of proteins affected. In addition, many 221

hypothetical or unassigned proteins were also differentially present. 222

223

BpsΔppiB has decreased motility and biofilm formation under nutrient rich 224

conditions. 225

Motility of B. pseudomallei has been shown to be important for successful establishment 226

of in vitro and in vivo infections (15, 16). The motility of Bps∆ppiB was determined 227

using a swarming assay (Fig 6). The mean bacterial spread from the site of inoculation 228

of the BpsWT parental strain was 48.5 mm after 24 hours. In comparison the spread of 229

on Decem


.org/D

ownloaded from

http://iai.asm.org/

12

Bps∆ppiB was reduced to 24.5 mm (P-value 0.0022, Mann Whitney U-test), but was not 230

restored in the complemented strain, consistent with the partial restoration of motility 231

associated proteins levels as shown by the proteomics studies. This suggests a role for 232

PpiB in motility although further research is required to determine if this is a direct effect 233

on the flagellum or due to regulatory or sensory deficits. 234

235

Another important survival mechanism in the environment and potentially for 236

establishing a chronic infection is the ability to form a biofilm. BpsΔppiB demonstrates 237

significant attenuation in the formation of biofilms under nutrient rich conditions 238

compared to BpsWT (P-value 0.0022, Mann-Whitney U-test), again this was not 239

restored in the complemented strain (Fig 6B). 240

241

BpsΔppiB has greater susceptibility to antimicrobial and intracellular stresses. 242

The reduced survival of Bps∆ppiB under both in vitro and in vivo conditions may be a 243

consequence of incorrect folding of proteins involved in resistance to intracellular 244

stresses such as peroxide and acid tolerance. This was determined by minimum 245

inhibitory concentrations (MIC) of Bps∆ppiB to hydrogen peroxide and hydrochloric acid. 246

BpsΔppiB demonstrates greater sensitivity towards oxidative stress, with a significant 3-247

fold reduction in the MIC of hydrogen peroxide exposure compared to BpsWT, which is 248

partially restored in Bps∆ppiB/ppiB (Fig 7). There was however, no increased 249

susceptibility to acid stress perhaps reflected in the ability of Bps∆ppiB to survive in 250

cells (Supplementary Table 2). 251

on Decem


.org/D

ownloaded from

http://iai.asm.org/

13

252

B. pseudomallei is intrinsically resistant to antimicrobials which are cleared by active 253

efflux pumps (9). It is feasible that PpiB may be involved in protein folding of some efflux 254

pumps, as such the susceptibility to antimicrobials was investigated. In particular the 255

MIC to antimicrobials that are currently used for B. pseudomallei treatment was 256

determined (Table 1). BpsΔppiB displayed a 4-fold increase in susceptibility (128 257

µg/mL to 8 µg/mL) to the 3rd-generation cephalosporin ceftriaxone. B. pseudomallei is 258

intrinsically resistant to 3rd-generation cephalosporins, indicating that some mechanism 259

of resistance is being modulated by PpiB. There was a 2-fold decrease in resistance to 260

tetracycline (2 µg/mL to 0.5 µg/mL) and its derivative doxycycline (1 µg/mL to <0.25 261

µg/mL). Tetracyclines are involved in protein synthesis inhibition and the main 262

mechanism of resistance in B. pseudomallei is efflux out of the cell, confirming a 263

potential role for ppiB in the correct folding of efflux pumps. The complemented strain, 264

Bps∆ppiB/ppiB, partially restores resistance to those of wild type levels. 265

266

Discussion 267

Previous work has demonstrated that cyclophilin B plays a role in modulating virulence 268

in a number of bacterial species resulting in attenuation in vivo (32, 33, 38, 39). 269

Consistent with these studies we demonstrate that Cyclophilin B in B. pseudomallei 270

influences multiple virulence associated phenotypes with loss of the ppiB gene resulting 271

in complete attenuation in the BALB/c mouse infection model (Fig 2). Although most 272

work has focused on the role of cyclophilins in virulence, recently the direct interaction 273

on Decem


.org/D

ownloaded from

http://iai.asm.org/

14

of cyclophilin B with intracellular proteins important for bacterial growth and survival 274

such as DnaK, AccC and FtsZ has been reported (34, 35, 39-41). It is shown here that 275

B. pseudomallei deletion of ppiB leads to pleiotropic effects including stress intolerance, 276

reduction in motility and biofilm formation. Furthermore, the direct effect of ppiB loss on 277

the proteome homeostasis of B. pseudomallei has been defined. Key pathways 278

important for virulence modulation have been identified and disrupted, providing 279

evidence of the importance of PpiB in bacterial protein folding and overall virulence. 280

281

B. pseudomallei is able to infect a wide range of cells in order to survive and cause 282

disease (42). Infection of murine macrophages demonstrated that BpsΔppiB retained its 283

ability to adhere and invade macrophage cells with reduced survival 6 and 9 hours post 284

infection (Fig 1), with intracellular counts similar to the parental control reached by 12 285

hours. This delayed growth phenotype has been shown with the disruption of type VI/III 286

secretion systems and is important in cell-to-cell spread of B. pseudomallei (27, 43, 44). 287

BpsΔppiB is unable to effectively spread intracellularly as determined by 288

immunofluorescence and cause cell fusion into MNGC, with complementation studies 289

showing restoration of the BpsWT phenotype (Fig 3B). As seen 12 hours post-infection 290

BpsWT and the complemented strain BpsΔppiB/ppiB display marked bacterial 291

movement throughout the monolayer and cellular fusion into MNGC (Fig 3A and 3C). 292

Enumeration of nuclei also indicates a significant reduction in the formation of MNGC in 293

BpsΔppiB, which is restored in the complement BpsΔppiB/ppiB (Fig 3D). 294

Complementation is observed despite only a 10% restoration of PpiB protein levels, 295

demonstrating that even low levels of PpiB is sufficient to overcome some virulence 296

on Decem


.org/D

ownloaded from

http://iai.asm.org/

15

deficiencies, something which has been previously noted in Saccharomyces cerevisiae 297

(45). This lack of cell-to-cell spread is characteristic of various mutants of the T6SS 298

cluster-1 (26, 27, 46), in particular T6SS Cluster 1 mutants ∆hcp1 and ∆vgrG1 (26, 27). 299

It is hypothesized that PpiB is playing a role in either folding or regulating the expression 300

of Type VI Secretion Systems in B. pseudomallei. It is reported that T6SSs in B. 301

pseudomallei are kept under strict transcriptional control and are only induced upon 302

invasion of macrophages (24), yet despite this our proteomic data showed an increase 303

in BPSS2098 (Hcp-1, 1.10 log2, -log10(P-value): 3.05) and BPSS2099 (Tss-1, 4.06 log2, 304

-log10(P-value): 1.8), two proteins belonging to T6SS-3, a cluster which is usually not 305

expressed in nutrient media (27, 47). Interestingly BPSL3097 (-1.28 log2, -log10(P-306

value): 6.12), BPSL3099 (-0.87 log2, -log10(P-value): 2.89), BPSL3105 (-0.75 log2, -307

log10(P-value): 3.31), BPSL3106 (-0.51 log2, -log10(P-value): 2.45) and BPSl3108 (-308

0.82 log2, -log10(P-value): 4.37) were all decreased in BpsΔppiB. These belong to 309

T6SS Cluster 6 which has been shown to be the only T6SS expressed in nutrient media 310

(27). This again points to a dysregulation of transcriptional or translational control. 311

Additionally, a MarR-family regulator (BPSL3431) shown to be involved in regulation of 312

T6SS transcription was downregulated (-0.67 log2, -log10(P-value): 3.40) (48). This 313

indicates that T6SS proteins are escaping their tight transcriptional control in nutrient 314

media, and it is hypothesized the same is occurring upon infection in cells resulting in a 315

malfunctional T6SS and hence the loss of MNGC formation. Further assessment of the 316

transcriptome and proteome of BpsΔppiB upon invasion of macrophages would be 317

useful to verify if PpiB is playing a role at the transcriptional or translational level of 318

T6SS regulators or machinery. This also explains the clearance of infection in the 319

on Decem


.org/D

ownloaded from

http://iai.asm.org/

16

BALB/c mouse studies where no viable bacteria were recovered at the end of the 320

experiment demonstrating the essential role of PpiB and its potential as a novel anti-321

virulence target. 322

323

Motility and biofilm formation are important for establishing B. pseudomallei infection 324

(13, 15). Deletion of the flagellum, ΔfliC, has been shown to be important for virulence in 325

the BALB/c mouse infection model (15, 49). Here a decrease in the protein levels of 326

FliC (BPSL3319, -3.38 log2, -log10(P-value): 5.81) is observed, consistent with the 327

reduction in motility in BpsppiB with recent studies have demonstrated that PpiB from 328

Clostridioides difficle interacts with FliC using bacterial two-hybrid systems (50). 329

Furthermore, reduced levels of CheB1 (BPSL3301, -2.48 log2, -log10(P-value): 6.02) 330

and CheW (BPSL3305, -2.78 log2, -log10(P-value): 4.38) (Fig 6B), important for 331

chemotactic directed motility (51-54), may also contribute to the observed reduction in 332

motility. As BpsΔppiB only displayed a decrease in motility, not a complete loss, there is 333

potentially a dysregulation of the signal transduction pathways leading to a delay or 334

absence of appropriate signalling to begin movement, rather than elimination of the 335

flagellum in BpsΔppiB, although additional studies are required to validate this. Motility 336

has also been implicated as an important factor for biofilm production with ΔfliC mutants 337

showing a decrease in biofilm production (55). Transcriptomics have identified B. 338

pseudomallei genes important in biofilm formation (56) and of these genes flagged as 339

differentially regulated, 12 were present at opposing protein abundance in BpsΔppiB 340

possibly explaining the decrease in biofilm formation by BpsΔppiB (Fig 6B), with genes 341

on Decem


.org/D

ownloaded from

http://iai.asm.org/

17

such as universal stress proteins (BPSS0837, -1.16 log2, -log10(P-value): 4.66; 342

BPSS1140, -0.57 log2, -log10(P-value): 2.03), receptors (BPSS1742, -1.22 log2, -343

log10(P-value): 4.10) and efflux pumps (BPSL0816, 0.35 log2, -log10(P-value): 2.13) 344

being differentially expressed. This decrease in biofilm formation is in stark contrast to 345

what has been reported in E. coli where PpiB is a negative regulator of both biofilm and 346

motility with deletion of ppiB resulting in hypermotility and increased biofilm production 347

(34). This disparity may indicate different roles for PpiB in E. coli and B. pseudomallei, 348

but a lack of in vivo data with ΔppiB makes it difficult to determine the overall effect on 349

virulence. 350

351

Cyclophilin B in Gram-negatives are known to play a role in response to a variety of 352

stresses encountered during infection (32). B. pseudomallei is exposed to reactive 353

oxidising species within phagocytes, a natural defence mechanism for eukaryotic cells 354

(57), with loss of ppiB increasing the susceptibility to oxidative stress (Fig 7). Others 355

have shown that there are a variety of mechanisms by which B. pseudomallei responds 356

to and tolerates oxidative stress, with quorum sensing regulating gene expression of 357

genes important in protecting the cell against DNA damage as well as polyphosphate 358

kinases playing a role (55, 58, 59). Although none of these genes appear in the 359

proteomics screen, proteins involved in stress (BPSS0837 -1.3 log2, -log10(P-value): 360

3.63, BPSS1140 -0.57 log2, -log10(P-value): 2.03) and OmpR, an oxidative stress two-361

component system transcriptional regulator (BPSL2094, -0.53 log2, -log10(P-value): 362

2.69), are decreased and may play an as of yet unknown role in oxidative stress 363

on Decem


.org/D

ownloaded from

http://iai.asm.org/

18

response. These results indicate that other currently unknown mechanisms may exist to 364

combat oxidative stress and this warrants further investigation. 365

366

B. pseudomallei has a number of chromosomally encoded genes associated with 367

antimicrobial resistance and hence is intrinsically resistant to most antibiotics used to 368

treat serious infections (9). BpsΔppiB has increased susceptibility to ceftriaxone, 369

tetracycline and doxycycline, antibiotics currently used for treatment of melioidosis 370

(Table 1) (7, 8). Resistance to these antibiotics is shown to be moderated by 371

Resistance-Nodulation Division (RND) efflux pumps (60), of which B. pseudomallei 372

strain K96243 has 10 annotated within its genome, as well as by beta-lactamases (9, 373

61). Differences in the protein levels of the efflux pump components, AmrA (BPSL1804, 374

-1.66 log2, -log10(P-value): 2.98), BpeB (BPSL0815 0.2 log2, -log10(P-value): 1.97) and 375

OprB (BPSL2094, -0.53, -log10(P-value): 2.69), indicate that loss of PpiB may result in 376

malfunctioning pumps. It is hypothesized that deletion of ppiB results in a reduction of 377

the pump components, making ineffective pumps and restoring susceptibility to certain 378

antibiotics. 379

380

There are many reports on the pleiotropic effects that immunophilin proteins have in 381

cells, this study demonstrates that virtually every compartment within the cell displays 382

gross proteomic changes, especially those involved in metabolism and genetic 383

information processing (32, 34, 38, 50, 62). It has recently been shown by Rasch et al 384

(38) that proteins from the immunophilin family also have the ability to compensate one 385

on Decem


.org/D

ownloaded from

http://iai.asm.org/

19

another, in this case the macrophage infectivity potentiator (Mip) protein, belonging to 386

the FK506-binding protein family, is able to compensate for the loss of PpiB in L. 387

pneumophila (38). This compensatory effect has always been theorised, these studies 388

show that there is an increase in the protein levels of three immunophilin proteins, Mip 389

(BPSS1823, 0.98 log2, -log10(P-value): 2.42), PpiA (BPSL2245, 1.1 log2, -log10(P-390

value): 3.05) and SurA (BPSL0659, 0.53 log2, -log10(P-value): 2.53), whether these 391

proteins can compensate and to what degree for PpiB loss in B. pseudomallei requires 392

further investigation. 393

394

To conclude, PpiB in B. pseudomallei is essential for virulence with the deletion mutant 395

BpsΔppiB displaying pleiotropic effects on virulence determinants such as the flagella, 396

biofilm production and antimicrobial susceptibility. Infection of macrophages with 397

BpsΔppiB displayed a delayed growth phenotype and an inability to cause fulminant 398

disease in BALB/c mice. On closer investigation it was shown that this was due to 399

BpsΔppiB being unable to spread cell-to-cell and form MNGCs, indicating that 400

clearance of infection occurs in vivo. Whole cell proteomic analysis reveals marked 401

changes in the proteome including proteins previously shown to be important for cell-to-402

cell spread and virulence of B. pseudomallei and has also identified a plethora of new 403

proteins potentially playing an important role in infection. Although further work still 404

needs to be conducted to demonstrate the direct interactions of PpiB with its folding 405

partners, it is clear that PpiB is essential for the correct protein folding of virulence 406

determinants in B. pseudomallei, thus making it indispensable for virulence. 407

on Decem


.org/D

ownloaded from

http://iai.asm.org/

20

408

Materials and methods 409

Bacterial strains and growth conditions. The bacterial strains used in this study are 410

shown in Table 2. All bacterial strains were grown in Luria Bertani (LB) broth overnight 411

at 37°C with agitation unless stated otherwise. Antibiotics were used at final 412

concentrations of: ampicillin, 50 µg/ml; chloramphenicol, 30 µg/ml; kanamycin, 50 µg/ml. 413

414

Construction of in-frame deletion mutant of ppiB. Construction of B. pseudomallei 415

in-frame deletion mutants was performed using the technique previously described by 416

Logue et al (37). For ppiB a 449-bp upstream flanking region and a 403-bp downstream 417

flanking region were amplified by Polymerase Chain Reaction (PCR) from B. 418

pseudomallei K96243 genomic DNA (obtained using Qiagen Gentra Purgene 419

Yeast/Bact Kit) using the primer pairs ppiB_UP_F/ppiB_UP_R 420

(TCTAGATTCCATCGCGTGATCAAGGG/ AGATCTTGGTTCCTTCGATGGATGGG) 421

and ppiB_DN_F/ppiB_DN_R (AGATCTGGGATGTTGCAGGAGACACC/ 422

TCTAGATTGCCGAACGCGACGATG). Restriction sites were incorporated into the 423

primers to allow for the ligation of the flanks to one another (using BglII) and XbaI to 424

allow for the insertion of the joint flanks into the suicide plasmid, pDM4. Upon 425

construction of an upstream-downstream fragment and its subsequent ligation into 426

pDM4, the construct was transformed by heat shock into E. coli S17-1 λpir which were 427

made calcium competent, and selected for with the antibiotic chloramphenicol. 428

Following conjugation with B. pseudomallei K96243, merodiploid integrants that has 429

on Decem


.org/D

ownloaded from

http://iai.asm.org/

21

successfully integrated the upstream-downstream-pDM4 construct were identified using 430

double antibiotic selection of ampicillin/chloramphenicol. A merodiploid integrant was 431

plated onto LB agar lacking sodium chloride but containing 10 % sucrose. sacB counter-432

selection was used to select for the excision of the pDM4 backbone, resulting in an in-433

frame unmarked deletion. Colonies were subsequently screened for chloramphenicol 434

sensitivity and analysed by PCR to determine their phenotype; wild-type revertant or in-435

frame deletion mutant. Colonies determined to be in-frame deletion mutants had the site 436

of recombination sequenced (Sanger sequencing) to confirm a 492-bp deletion of ppiB. 437

The mutant strain, B. pseudomallei∆ppiB (BpsΔppiB) and the parent B. pseudomallei 438

K96243 strain was sequenced using Illumina MiSeq (Murdoch University, Perth, 439

Western Australia) or HiSeq2500 (Australian Genome Research Facility, Melbourne, 440

Australia) respectively. Whole genome sequencing data was aligned to the K96243 441

reference genome (versions NC_006350.1 [chromosome 1] and NC_006350.1 442

[chromosome 2]) and variants were identified using the SPANDx pipeline (62). 443

444

J774A.1 murine macrophage infection assay. J774A.1 murine macrophages were 445

seeded into a 24-well tissue culture treated plate at a concentration of 4 x 105 cells/mL 446

in Dulbecco’s modified eagle’s medium (DMEM) (Gibco) supplemented with a final 447

concentration of 1 % GlutaMAX (Gibco, Life Technologies) and 10 % heat-inactivated 448

fetal calf serum (Gibco, Life Technologies, Lot #1939338) and incubated for 20 hours at 449

37°C with 5 % CO2. B. pseudomallei strains were grown overnight at 37°C for 18 hrs 450

and adjusted in Leibovitz L-15 medium (Gibco) supplemented with 1 % GlutaMAX and 451

10 % heat-inactivated fetal calf serum to an absorbance between 0.35 and 0.4 at 580 452

on Decem


.org/D

ownloaded from

http://iai.asm.org/

22

nm using a PLP Colourimeter. Strains were serially diluted in L-15 medium and 1 mL of 453

bacteria was added to each well at a multiplicity of infection (MOI) of 10 and incubated 454

30 minutes at 37°C. To determine the exact starting inoculum at time of infection 455

bacteria were further serially diluted and plated on LB agar. Bacteria were aspirated off 456

the cell monolayer and infected cells were gently washed three times with PBS (Life 457

Technologies, autoclaved and filter sterilised) and then incubated with L-15 medium 458

containing 1 mg/mL kanamycin for a further 30 minutes at 37°C to kill extracellular 459

bacteria. The supernatant was removed and infected cells were then incubated with L-460

15 media containing 250 µg/mL kanamycin for 12 hours. At 0, 3, 6, 9 and 12 hours post-461

infection, cell monolayers were lysed with 1 mL MilliQ water and serially diluted in 1 mL 462

PBS and plated onto LB agar for bacterial enumeration. 463

464

Determination of Minimum Inhibitory Concentration (MIC) and susceptibility to 465

stress. Broth microdilutions were tested against a variety of antibiotic classes as 466

described in (63) with the following modifications. Strains were incubated overnight in 467

Mueller Hinton Broth (MHB) at 37°C. Overnight cultures were diluted 1:50 in fresh MHB 468

and were incubated at 37°C for 1 hour with agitation. Antibiotics were 2-fold serially 469

diluted across a 96-well plate in MHB with a final volume of 100 µL with an antibiotic 470

range of 256 to 0.25 μg/mL. Following bacterial incubation, 100 µL of each strain was 471

added to antibiotic containing media in a 96 well plate and incubated statically at 37°C 472

for 24 hours. Optical density of plates was read at an optical density of 590 nm using a 473

spectrophotometer (BioRad Xmark). The Minimum Inhibitory Concentration (MIC) was 474

on Decem


.org/D

ownloaded from

http://iai.asm.org/

23

called as the minimum antibiotic concentration needed to keep overnight growth to 475

under 20% of the unexposed bacterial growth control. 476

477

Motility assay. Assessment of motility was performed as described in (64). Briefly, B. 478

pseudomallei strains were incubated at 37°C overnight with agitation. One microliter of 479

overnight culture was stabbed into the middle of a 0.3 % motility agar using a sterile 480

inoculation loop and plates were incubated upright for 24 hours upon which the distance 481

of bacterial spread was measured. 482

483

Biofilm Forming Capacity Assay. Biofilm assays were performed according following 484

the methodology in (65) but with the following modifications. B. pseudomallei strains 485

were incubated overnight at 37°C with agitation. The following day 2% of overnight 486

culture (v/v) was inoculated into fresh media and incubated for a further 24 hours at 487

37°C with agitation. Overnight cultures (200µL) were added to a 96-well plate and 488

incubated for 3 hours at 37°C to allow for adhesion. Supernatant was gently aspirated to 489

avoid disturbing the adhered cells and fresh Luria Bertani Broth was added and 490

incubated at 37°C for a further 24 hours. Supernatant was aspirated and biofilms were 491

washed once with PBS and fresh LBB media added and incubated for a further 24 492

hours. On the final day supernatant was removed and biofilms were washed three times 493

with PBS before being fixed with methanol and allowed to air dry. Cells were stained 494

with 2 % crystal violet, with excess stain removed with running ddH2O and plates were 495

on Decem


.org/D

ownloaded from

http://iai.asm.org/

24

allowed to air dry. Dye bound to cells was solubilised with 33 % Glacial acetic acid and 496

the optical density was read at 590 nm on a spectrophotometer (BioRad X-Mark). 497

498

BALB/c murine infection model 499

Investigations involving animals were carried out according to the requirements of the 500

United Kingdom Animal (Scientific Procedures) Act 1986 under project licence PPL 501

30/3026. This project licence was approved following an ethical review by Dstl's Animal 502

Welfare and Ethical Review Body. Studies were performed using female BALB/cAnNCrl 503

mice (BALB/c; Charles River, UK) implanted with a subcutaneous Pico transponder 504

(Uno BV, Netherlands) to allow individual mice to be tracked through the study. On 505

arrival into containment level 3 animal facilities, mice were randomly allocated into 506

cages of five animals and acclimatised to their new surroundings for 5 days before any 507

procedures were performed. Animal husbandry practices and environmental conditions 508

during study were as described previously Scott et al (66). Challenges were performed 509

with B. pseudomallei K96243 prepared as described previously by Scott et al (66) and 510

delivered via the intraperitoneal route. Mice received 1.1 x 104 CFU B. pseudomallei 511

K96243 and 1.86 104 CFU Bps∆ppiB, 6 in each group. Mice were checked at least twice 512

daily following challenge and clinical signs for each mouse recorded for five weeks post‐513

infection. Humane end‐points were used throughout these studies to minimise suffering, 514

with culls performed via cervical dislocation at the end‐point. At the end of the study, 515

animals were culled and organs removed for enumeration of bacterial burden (lungs, 516

on Decem


.org/D

ownloaded from

http://iai.asm.org/

25

liver, spleen). These were homogenised through 40 μm sieves into PBS, serially diluted 517

and plated onto LB agar. 518

519

Complementation studies. 520

The open reading frame of BPSL2246 (ppiB) was amplified from genomic DNA of B. 521

pseudomallei K96243 using the primers ppiB_For/ppiB_Rev 522

(CTGCAGATGGTCGAACTGCATACG/CTGCAGGGACCACGACGGCCTTCT) and the 523

resulting product was ligated into pJR3XFLAG that incorporated a 3XFLAG tag on the 524

C-terminal end of the gene. This was then amplified with the primers 525

ppiB_pET_For/BamHI_stop_FLAG_Rev 526

(CATATGGTCGAACTGCATACGAAC/GGATCCTTACTTGTCATCGTCATCCTTAT). 527

The PCR product was inserted into the SmaI/BamHI restriction sites of pBBR1-MCS1. 528

The complementation construct was transformed into E. coli ST18 and conjugated into 529

Bps∆ppiB. Conjugates were selected on LB agar containing 30 μg/mL chloramphenicol. 530

In experiments the complemented mutant strain (Bps∆ppiB/ppiB) was grown in LB broth 531

containing 30 μg/mL chloramphenicol. 532

533

Immunofluorescence. J774A.1 macrophages (seeded at approximately 4 x 105 534

cells/well) were grown overnight on 13 mm round coverslips in a 24 well plate at 37°C 535

with 5% CO2. Macrophages were infected with B. pseudomallei strains at an MOI of 10 536

as described above in the J774.A1 murine macrophage infection assay. At 12 hours 537

post infection monolayers were washed 3 times with PBS for 5 minutes and fixed with 538

on Decem


.org/D

ownloaded from

http://iai.asm.org/

26

100 % methanol for 30 minutes, then washed 3 times with PBS for 5 minutes. 539

Monolayers were stained at room temperature using the following protocol. Monolayers 540

were blocked with 5 % (v/v) FCS/PBS for 2 hours to block non-specific binding and then 541

washed 3 times for 2 minutes each. Cells were incubated with anti-B. pseudomallei-LPS 542

at 1 µg/mL (1:100; Mab4VIH12) for 1 hour, after which they underwent 3 times 2 543

minutes washes. Monolayers were incubated with a secondary Anti-mouse-whole IgG-544

FITC (1:64; Sigma Aldrich) for 1 hour followed by three times 2-minute washes. Nuclei 545

were stained using Hoescht33258 (1:10,000; ThermoFisher Scientific) for 15 minutes 546

followed by 2 x 2 minute washes. Coverslips were mounted onto glass slides using 547

Prolong Gold Anti-Fade reagent (Invitrogen). Fluorescence microscopy was performed 548

using a Nikon Eclipse Ts2R microscope and images were acquired using the NIS-549

Elements software (Nikon). 550

551

Multinucleated Giant Cell enumeration (MNGC). Evaluation of MNCG formation was 552

conducted using fluorescently stained cell monolayers described above. Using 553

previously published metrics (67); 1000 nuclei per coverslip were counted and the 554

percentage of MNGC formation was calculated using the following equation; 555

MNGC (%)=number of nuclei within multinucleated cells

total nuclei counted X 100

556

Protein clean up and In-solution digestion. Cell preparations were solubilized in lysis 557

buffer (4 % SDS, 10 mM DTT, 100 mM Tris pH 8.5) by boiling for 10 minutes and the 558

on Decem


.org/D

ownloaded from

http://iai.asm.org/

27

protein content assess by BCA protein assay according to the manufacturer's 559

instruction. 100 ug of protein from each sample was acetone precipitated by mixing 4 560

volumes of ice-cold acetone with one volume of sample. Samples were precipitated 561

overnight at -20°C and then spun down at 4000 x g for 10 minutes at 4°C. The 562

precipitated protein pellets were resuspended with 80 % ice-cold acetone and 563

precipitated for an additional 4 hours at -20°C. Samples were spun down at 17000 x g 564

for 10 minutes at 4°C to collect precipitated protein, the supernatant was discarded and 565

excess acetone driven off at 65°C for 5 minutes. Dried protein pellets were resuspended 566

in 6 M urea, 2 M thiourea, 40 mM NH4HCO3 and reduced / alkylated prior to digestion 567

with Lys-C (1/200 w/w) then trypsin (1/50 w/w) overnight as previously described (68). 568

Digested samples were acidified to a final concentration of 0.5 % formic acid, desalted 569

with homemade C18 stage tips (69, 70), eluted with buffer B (80 % ACN, 0.1 % formic 570

acid) and bound peptides eluted with buffer B then dried. 571

572

LFQ based quantitative proteome LC-MS. Purified peptides were resuspended in 573

Buffer A* and separated using a two-column chromatography set up comprising a 574

PepMap100 C18 20 mm x 75 μm trap and a PepMap C18 500 mm x 75 μm analytical 575

column (ThermoFisher Scientific). Samples were concentrated onto the trap column at 5 576

μl/min for 5 mins and infused into an Orbitrap Elite™ Mass Spectrometer (ThermoFisher 577

Scientific) at 300 nl/min via the analytical column using a Dionex Ultimate 3000 UPLC 578

(ThermoFisher Scientific). 90 min gradients were run altering the buffer composition 579

from 1 % buffer B to 28 % B over 60 mins, then from 28 % B to 40 % B over 10 mins, 580

then from 40 % B to 100 % B over 2 mins, the composition was held at 100 % B for 3 581

on Decem


.org/D

ownloaded from

http://iai.asm.org/

28

mins, and then dropped to 3 % B over 5 mins and held at 3 % B for another 10 mins. 582

The Elite™ Mass Spectrometer was operated in a data-dependent mode automatically 583

switching between the acquisition of a single Orbitrap MS scan (120,000 resolution) 584

followed by 20 data-dependent CID MS-MS events (NCE 35) were allowed with 30 585

seconds dynamic exclusion enabled. 586

587

Mass spectrometry data analysis. Identification of proteins was accomplished using 588

MaxQuant (v1.5.3.1) (71). Searches were performed against the Burkholderia 589

pseudomallei strain K96243 (Uniprot proteome id UP000000605, downloaded 10-07-590

2018, 5,717 entries) proteomes with carbamidomethylation of cysteine set as a fixed 591

modification. Searches were performed with trypsin cleavage specificity allowing 2 592

miscleavage events and the variable modifications of oxidation of methionine and 593

acetylation of protein N-termini. The precursor mass tolerance was set to 20 parts-per-594

million (ppm) for the first search and 10 ppm for the main search, with a maximum false 595

discovery rate (FDR) of 1.0 % set for protein and peptide identifications. To enhance the 596

identification of peptides between samples the Match Between Runs option was 597

enabled with a precursor match window set to 2 minutes and an alignment window of 10 598

minutes. For label-free quantitation, the MaxLFQ option within Maxquant (72) was 599

enabled in addition to the re-quantification module. The resulting protein group output 600

was processed within the Perseus (v1.4.0.6) (73) analysis environment to remove 601

reverse matches and common protein contaminates prior. GO terms and associated 602

annotation was downloaded from Uniprot (Uniprot proteome id UP000000605, 603

downloaded 10-07-2018). For LFQ comparisons missing values were imputed using 604

on Decem


.org/D

ownloaded from

http://iai.asm.org/

29

Perseus and Pearson correlations visualized using Perseus and R. Determination of 605

significant changes was undertaken using a two-sample t-test within Perseus where 606

proteins were considered significant if the mean difference between groups was great 607

then or less than one-fold change and satisfied a Benjamini-Hochberg multiple 608

hypothesis corrected FDR of below 0.05 which corresponds to a -log10(P-value) of 1.73 609

or p-value of 0.018. The mass spectrometry proteomics data have been deposited to 610

the ProteomeXchange Consortium via the PRIDE (74) partner repository with the 611

dataset identifier PXD012956. 612

613

Statistical Analysis. All numerical results were analysed using Microsoft Excel 2010. 614

Statistical analyses performed using GraphPad Prism version 8.0. For growth curves, 615

motility, biofilm, MIC, intracellular infection and cell cytotoxicity assays, a Mann-Whitney 616

U-test was used to determine the difference between strains. The Log-rank (Mantel-617

Cox) test was used for the animal studies. A Student’s t-test was used for MNGC 618

formation. Significance is indicated as follows: *, P-value <0.05; **, P-value <0.01; ****, 619

P-value <0.0001. 620

621

Acknowledgements 622

NB was supported by an Australian Government Research Training Program 623

Scholarship. MST and TJJI were funded by NATO (SPF984835). This work was 624

partially supported by National Health and Medical Research Council of Australia 625

(NHMRC) project grants awarded to NES (APP1100164). We would like to thank the 626

on Decem


.org/D

ownloaded from

http://iai.asm.org/

30

Melbourne Mass Spectrometry and Proteomics Facility of The Bio21 Molecular Science 627

and Biotechnology Institute at The University of Melbourne for support, maintenance 628

and access to mass spectrometry infrastructure for proteomic analysis. We would like to 629

thank Dr Nathan Pavlos for providing an aliquot of Hoecsht33258 to use for the 630

immunofluorescence studies. We would also like to thank Dr Joshua Ramsay for 631

providing ST18 strain of E. coli used in conjugation as well as the plasmid pJR3XFLAG 632

to help with the construction of the complementation strain. 633

634

References 635

1. Dance DA. 2000. Ecology of Burkholderia pseudomallei and the interactions 636

between environmental Burkholderia spp. and human-animal hosts. Acta Trop 637

74:159-68. 638

2. Dance DA. 2000. Melioidosis as an emerging global problem. Acta Trop 74:115-639

9. 640

3. Currie BJ. 2008. Advances and remaining uncertainties in the epidemiology of 641

Burkholderia pseudomallei and melioidosis. Trans R Soc Trop Med Hyg 102:225-642

7. 643

4. Limmathurotsakul D, Golding N, Dance DA, Messina JP, Pigott DM, Moyes CL, 644

Rolim DB, Bertherat E, Day NP, Peacock SJ, Hay SI. 2016. Predicted global 645

distribution of Burkholderia pseudomallei and burden of melioidosis. Nat 646

Microbiol 1:15008. 647

on Decem


.org/D

ownloaded from

http://iai.asm.org/

31

5. Currie BJ, Ward L, Cheng AC. 2010. The epidemiology and clinical spectrum of 648

melioidosis: 540 cases from the 20 year Darwin prospective study. PLoS Negl 649

Trop Dis 4:e900. 650

6. Limmathurotsakul D, Chaowagul W, Chierakul W, Stepniewska K, Maharjan B, 651

Wuthiekanun V, White NJ, Day NP, Peacock SJ. 2006. Risk factors for recurrent 652

melioidosis in northeast Thailand. Clin Infect Dis 43:979-86. 653

7. Pitman MC, Luck T, Marshall CS, Anstey NM, Ward L, Currie BJ. 2015. 654

Intravenous therapy duration and outcomes in melioidosis: a new treatment 655

paradigm. PLoS Negl Trop Dis 9:e0003586. 656

8. Wiersinga WJ, Currie BJ, Peacock SJ. 2012. Melioidosis. N Engl J Med 657

367:1035-44. 658

9. Schweizer HP. 2012. Mechanisms of antibiotic resistance in Burkholderia 659

pseudomallei: implications for treatment of melioidosis. Future Microbiol 7:1389-660

99. 661

10. Sarovich DS, Webb JR, Pitman MC, Viberg LT, Mayo M, Baird RW, Robson JM, 662

Currie BJ, Price EP. 2018. Raising the Stakes: Loss of Efflux Pump Regulation 663

Decreases Meropenem Susceptibility in Burkholderia pseudomallei. Clinical 664

Infectious Diseases 67:243-250. 665

11. Currie BJ, Fisher DA, Howard DM, Burrow JNC, Lo D, Selva-nayagam S, Anstey 666

NM, Huffam SE, Snelling PL, Marks PJ. 2000. Endemic melioidosis in tropical 667

northern Australia: a 10-year prospective study and review of the literature. 668

Clinical Infectious Diseases 31:981-986. 669

on Decem


.org/D

ownloaded from

http://iai.asm.org/

32

12. Kamjumphol W, Chareonsudjai S, Chareonsudjai P, Wongratanacheewin S, 670

Taweechaisupapong S. 2013. Environmental factors affecting Burkholderia 671

pseudomallei biofilm formation. Southeast Asian J Trop Med Public Health 44:72-672

81. 673

13. Kunyanee C, Kamjumphol W, Taweechaisupapong S, Kanthawong S, 674

Wongwajana S, Wongratanacheewin S, Hahnvajanawong C, Chareonsudjai S. 675

2016. Burkholderia pseudomallei Biofilm Promotes Adhesion, Internalization and 676

Stimulates Proinflammatory Cytokines in Human Epithelial A549 Cells. PLoS 677

One 11:e0160741. 678

14. Panomket P, Wongsana P, Wanram S, Wongratanacheewin S. 2017. 679

Burkholderia pseudomallei biofilm plays a key role in chronic inflammation in 680

C57BL/6 mice. Southeast Asian J Trop Med Public Health 48:73-82. 681

15. Chua KL, Chan YY, Gan YH. 2003. Flagella are virulence determinants of 682

Burkholderia pseudomallei. Infect Immun 71:1622-9. 683

16. Chuaygud T, Tungpradabkul S, Sirisinha S, Chua KL, Utaisincharoen P. 2008. A 684

role of Burkholderia pseudomallei flagella as a virulent factor. Trans R Soc Trop 685

Med Hyg 102 Suppl 1:S140-4. 686

17. Stevens MP, Wood MW, Taylor LA, Monaghan P, Hawes P, Jones PW, Wallis 687

TS, Galyov EE. 2002. An Inv/Mxi-Spa-like type III protein secretion system in 688

Burkholderia pseudomallei modulates intracellular behaviour of the pathogen. 689

Mol Microbiol 46:649-59. 690

on Decem


.org/D

ownloaded from

http://iai.asm.org/

33

18. Willcocks SJ, Denman CC, Atkins HS, Wren BW. 2016. Intracellular replication of 691

the well-armed pathogen Burkholderia pseudomallei. Curr Opin Microbiol 29:94-692

103. 693

19. Stevens MP, Haque A, Atkins T, Hill J, Wood MW, Easton A, Nelson M, 694

Underwood-Fowler C, Titball RW, Bancroft GJ, Galyov EE. 2004. Attenuated 695

virulence and protective efficacy of a Burkholderia pseudomallei bsa type III 696

secretion mutant in murine models of melioidosis. Microbiology 150:2669-76. 697

20. Sun GW, Gan YH. 2010. Unraveling type III secretion systems in the highly 698

versatile Burkholderia pseudomallei. Trends Microbiol 18:561-8. 699

21. Warawa J, Woods DE. 2005. Type III secretion system cluster 3 is required for 700

maximal virulence of Burkholderia pseudomallei in a hamster infection model. 701

FEMS Microbiol Lett 242:101-8. 702

22. Allwood EM, Devenish RJ, Prescott M, Adler B, Boyce JD. 2011. Strategies for 703

Intracellular Survival of Burkholderia pseudomallei. Front Microbiol 2:170. 704

23. Pilatz S, Breitbach K, Hein N, Fehlhaber B, Schulze J, Brenneke B, Eberl L, 705

Steinmetz I. 2006. Identification of Burkholderia pseudomallei genes required for 706

the intracellular life cycle and in vivo virulence. Infect Immun 74:3576-86. 707

24. Shalom G, Shaw JG, Thomas MS. 2007. In vivo expression technology identifies 708

a type VI secretion system locus in Burkholderia pseudomallei that is induced 709

upon invasion of macrophages. Microbiology 153:2689-99. 710

25. Lennings J, West TE, Schwarz S. 2018. The Burkholderia Type VI Secretion 711

System 5: Composition, Regulation and Role in Virulence. Front Microbiol 712

9:3339. 713

on Decem


.org/D

ownloaded from

http://iai.asm.org/

34

26. Schwarz S, Singh P, Robertson JD, LeRoux M, Skerrett SJ, Goodlett DR, West 714

TE, Mougous JD. 2014. VgrG-5 is a Burkholderia type VI secretion system-715

exported protein required for multinucleated giant cell formation and virulence. 716

Infect Immun 82:1445-52. 717

27. Burtnick MN, Brett PJ, Harding SV, Ngugi SA, Ribot WJ, Chantratita N, Scorpio 718

A, Milne TS, Dean RE, Fritz DL, Peacock SJ, Prior JL, Atkins TP, Deshazer D. 719

2011. The cluster 1 type VI secretion system is a major virulence determinant in 720

Burkholderia pseudomallei. Infect Immun 79:1512-25. 721

28. Schell MA, Ulrich RL, Ribot WJ, Brueggemann EE, Hines HB, Chen D, Lipscomb 722

L, Kim HS, Mrázek J, Nierman WC. 2007. Type VI secretion is a major virulence 723

determinant in Burkholderia mallei. Molecular microbiology 64:1466-1485. 724

29. Dimou M, Venieraki A, Katinakis P. 2017. Microbial cyclophilins: specialized 725

functions in virulence and beyond. World Journal of Microbiology and 726

Biotechnology 33:164. 727

30. Lang K, Schmid FX, Fischer G. 1987. Catalysis of protein folding by prolyl 728

isomerase. Nature 329:268-70. 729

31. Zhu Y, Gong Y, Li A, Chen M, Kang D, Liu J, Yuan Y. 2018. Differential 730

Proteomic Analysis Reveals Protein Networks and Pathways that May Contribute 731

to Helicobacter pylori FKBP-Type PPIase-Associated Gastric Diseases. 732

Proteomics Clin Appl 12:e1700127. 733

32. Roset MS, Garcia Fernandez L, DelVecchio VG, Briones G. 2013. Intracellularly 734

induced cyclophilins play an important role in stress adaptation and virulence of 735

Brucella abortus. Infect Immun 81:521-30. 736

on Decem


.org/D

ownloaded from

http://iai.asm.org/

35

33. Schmidt B, Tradler T, Rahfeld JU, Ludwig B, Jain B, Mann K, Rucknagel KP, 737

Janowski B, Schierhorn A, Kullertz G, Hacker J, Fischer G. 1996. A cyclophilin-738

like peptidyl-prolyl cis/trans isomerase from Legionella pneumophila--739

characterization, molecular cloning and overexpression. Mol Microbiol 21:1147-740

60. 741

34. Skagia A, Zografou C, Vezyri E, Venieraki A, Katinakis P, Dimou M. 2016. 742

Cyclophilin PpiB is involved in motility and biofilm formation via its functional 743

association with certain proteins. Genes Cells 21:833-51. 744

35. Skagia A, Zografou C, Venieraki A, Fasseas C, Katinakis P, Dimou M. 2017. 745

Functional analysis of the cyclophilin PpiB role in bacterial cell division. Genes 746

Cells 22:810-824. 747

36. Walsh CT, Zydowsky LD, McKeon FD. 1992. Cyclosporin A, the cyclophilin class 748

of peptidylprolyl isomerases, and blockade of T cell signal transduction. Journal 749

of Biological Chemistry 267:13115-13118. 750

37. Logue CA, Peak IR, Beacham IR. 2009. Facile construction of unmarked deletion 751

mutants in Burkholderia pseudomallei using sacB counter-selection in sucrose-752

resistant and sucrose-sensitive isolates. J Microbiol Methods 76:320-3. 753

38. Rasch J, Unal CM, Klages A, Karsli U, Heinsohn N, Brouwer R, Richter M, 754

Dellmann A, Steinert M. 2019. Peptidyl-Prolyl-cis/trans-Isomerases Mip and PpiB 755

of Legionella pneumophila Contribute to Surface Translocation, Growth at 756

Suboptimal Temperature, and Infection. Infect Immun 87. 757

on Decem


.org/D

ownloaded from

http://iai.asm.org/

36

39. Dimou M, Venieraki A, Zografou C, Katinakis P. 2012. The cytoplasmic 758

cyclophilin from Azotobacter vinelandii interacts with phosphate acetyltransferase 759

isoforms enhancing their in vitro activity. Mol Biol Rep 39:4135-43. 760

40. Dimou M, Zografou C, Venieraki A, Katinakis P. 2012. Functional interaction of 761

Azotobacter vinelandii cytoplasmic cyclophilin with the biotin carboxylase subunit 762

of acetyl-CoA carboxylase. Biochem Biophys Res Commun 424:736-9. 763

41. Skagia A, Vezyri E, Sigala M, Kokkinou A, Karpusas M, Venieraki A, Katinakis P, 764

Dimou M. 2017. Structural and functional analysis of cyclophilin PpiB mutants 765

supports an in vivo function not limited to prolyl isomerization activity. Genes 766

Cells 22:32-44. 767

42. Jones AL, Beveridge TJ, Woods DE. 1996. Intracellular survival of Burkholderia 768

pseudomallei. Infect Immun 64:782-90. 769

43. Burtnick MN, Brett PJ, Nair V, Warawa JM, Woods DE, Gherardini FC. 2008. 770

Burkholderia pseudomallei type III secretion system mutants exhibit delayed 771

vacuolar escape phenotypes in RAW 264.7 murine macrophages. Infect Immun 772

76:2991-3000. 773

44. Burtnick MN, DeShazer D, Nair V, Gherardini FC, Brett PJ. 2010. Burkholderia 774

mallei cluster 1 type VI secretion mutants exhibit growth and actin polymerization 775

defects in RAW 264.7 murine macrophages. Infect Immun 78:88-99. 776

45. Gemmill TR, Wu X, Hanes SD. 2005. Vanishingly low levels of Ess1 prolyl-777

isomerase activity are sufficient for growth in Saccharomyces cerevisiae. J Biol 778

Chem 280:15510-7. 779

on Decem


.org/D

ownloaded from

http://iai.asm.org/

37

46. Toesca IJ, French CT, Miller JF. 2014. The Type VI secretion system spike 780

protein VgrG5 mediates membrane fusion during intercellular spread by 781

pseudomallei group Burkholderia species. Infect Immun 82:1436-44. 782

47. Bernard CS, Brunet YR, Gueguen E, Cascales E. 2010. Nooks and crannies in 783

type VI secretion regulation. J Bacteriol 192:3850-60. 784

48. Losada L, Shea AA, DeShazer D. 2018. A MarR family transcriptional regulator 785

and subinhibitory antibiotics regulate type VI secretion gene clusters in 786

Burkholderia pseudomallei. Microbiology 164:1196-1211. 787

49. Inglis TJJ, Rigby P, Robertson TA, Dutton NS, Henderson M, Chang BJ. 2000. 788

Interaction between Burkholderia pseudomallei and Acanthamoeba species 789

results in coiling phagocytosis, endamebic bacterial survival, and escape. 790

Infection and immunity 68:1681-1686. 791

50. Ünal CM, Karagöz MS, Berges M, Priebe C, de Acuña JMB, Wissing J, Jänsch L, 792

Jahn D, Steinert M. 2019. Pleiotropic Clostridioides difficile cyclophilin PpiB 793

controls cysteine-tolerance, toxin production, the central metabolism and multiple 794

stress responses. Frontiers in Pharmacology 10. 795

51. Parkinson JS, Parker SR, Talbert PB, Houts SE. 1983. Interactions between 796

chemotaxis genes and flagellar genes in Escherichia coli. J Bacteriol 155:265-74. 797

52. Ravid S, Matsumura P, Eisenbach M. 1986. Restoration of flagellar clockwise 798

rotation in bacterial envelopes by insertion of the chemotaxis protein CheY. Proc 799

Natl Acad Sci U S A 83:7157-61. 800

on Decem


.org/D

ownloaded from

http://iai.asm.org/

38

53. Rowsell EH, Smith JM, Wolfe A, Taylor BL. 1995. CheA, CheW, and CheY are 801

required for chemotaxis to oxygen and sugars of the phosphotransferase system 802

in Escherichia coli. J Bacteriol 177:6011-4. 803

54. Stock A, Chen T, Welsh D, Stock J. 1988. CheA protein, a central regulator of 804

bacterial chemotaxis, belongs to a family of proteins that control gene expression 805

in response to changing environmental conditions. Proc Natl Acad Sci U S A 806

85:1403-7. 807

55. Tunpiboonsak S, Mongkolrob R, Kitudomsub K, Thanwatanaying P, 808

Kiettipirodom W, Tungboontina Y, Tungpradabkul S. 2010. Role of a 809

Burkholderia pseudomallei polyphosphate kinase in an oxidative stress 810

response, motilities, and biofilm formation. J Microbiol 48:63-70. 811

56. Chin CY, Hara Y, Ghazali AK, Yap SJ, Kong C, Wong YC, Rozali N, Koh SF, 812

Hoh CC, Puthucheary SD, Nathan S. 2015. Global transcriptional analysis of 813

Burkholderia pseudomallei high and low biofilm producers reveals insights into 814

biofilm production and virulence. BMC Genomics 16:471. 815

57. Babior BM. 2000. Phagocytes and oxidative stress. The American Journal of 816

Medicine 109:33-44. 817

58. Loprasert S, Whangsuk W, Sallabhan R, Mongkolsuk S. 2004. DpsA protects the 818

human pathogen Burkholderia pseudomallei against organic hydroperoxide. Arch 819

Microbiol 182:96-101. 820

59. Lumjiaktase P, Diggle SP, Loprasert S, Tungpradabkul S, Daykin M, Camara M, 821

Williams P, Kunakorn M. 2006. Quorum sensing regulates dpsA and the 822

on Decem


.org/D

ownloaded from

http://iai.asm.org/

39

oxidative stress response in Burkholderia pseudomallei. Microbiology 152:3651-823

9. 824

60. Viktorov DV, Zakharova IB, Podshivalova MV, Kalinkina EV, Merinova OA, 825

Ageeva NP, Antonov VA, Merinova LK, Alekseev VV. 2008. High-level resistance 826

to fluoroquinolones and cephalosporins in Burkholderia pseudomallei and closely 827

related species. Trans R Soc Trop Med Hyg 102 Suppl 1:S103-10. 828

61. Holden MT, Titball RW, Peacock SJ, Cerdeno-Tarraga AM, Atkins T, Crossman 829

LC, Pitt T, Churcher C, Mungall K, Bentley SD, Sebaihia M, Thomson NR, Bason 830

N, Beacham IR, Brooks K, Brown KA, Brown NF, Challis GL, Cherevach I, 831

Chillingworth T, Cronin A, Crossett B, Davis P, DeShazer D, Feltwell T, Fraser A, 832

Hance Z, Hauser H, Holroyd S, Jagels K, Keith KE, Maddison M, Moule S, Price 833

C, Quail MA, Rabbinowitsch E, Rutherford K, Sanders M, Simmonds M, 834

Songsivilai S, Stevens K, Tumapa S, Vesaratchavest M, Whitehead S, Yeats C, 835

Barrell BG, Oyston PC, Parkhill J. 2004. Genomic plasticity of the causative 836

agent of melioidosis, Burkholderia pseudomallei. Proc Natl Acad Sci U S A 837

101:14240-5. 838

62. Sarovich DS, Price EP. 2014. SPANDx: a genomics pipeline for comparative 839

analysis of large haploid whole genome re-sequencing datasets. BMC Research 840

Notes 7:618. 841

63. Heine HS, England MJ, Waag DM, Byrne WR. 2001. In vitro antibiotic 842

susceptibilities of Burkholderia mallei (causative agent of glanders) determined 843

by broth microdilution and E-test. Antimicrob Agents Chemother 45:2119-21. 844

on Decem


.org/D

ownloaded from

http://iai.asm.org/

40

64. Norville IH, Harmer NJ, Harding SV, Fischer G, Keith KE, Brown KA, Sarkar-845

Tyson M, Titball RW. 2011. A Burkholderia pseudomallei macrophage infectivity 846

potentiator-like protein has rapamycin-inhibitable peptidylprolyl isomerase activity 847

and pleiotropic effects on virulence. Infect Immun 79:4299-307. 848

65. Taweechaisupapong S, Kaewpa C, Arunyanart C, Kanla P, Homchampa P, 849

Sirisinha S, Proungvitaya T, Wongratanacheewin S. 2005. Virulence of 850

Burkholderia pseudomallei does not correlate with biofilm formation. Microb 851

Pathog 39:77-85. 852

66. Scott AE, Christ WJ, George AJ, Stokes MG, Lohman GJ, Guo Y, Jones M, 853

Titball RW, Atkins TP, Campbell AS. 2016. Protection against experimental 854

melioidosis with a synthetic manno-heptopyranose hexasaccharide 855

glycoconjugate. Bioconjugate chemistry 27:1435-1446. 856

67. Kespichayawattana W, Rattanachetkul S, Wanun T, Utaisincharoen P, Sirisinha 857

S. 2000. Burkholderia pseudomallei induces cell fusion and actin-associated 858

membrane protrusion: a possible mechanism for cell-to-cell spreading. Infect 859

Immun 68:5377-84. 860

68. Scott NE, Parker BL, Connolly AM, Paulech J, Edwards AV, Crossett B, Falconer 861

L, Kolarich D, Djordjevic SP, Hojrup P, Packer NH, Larsen MR, Cordwell SJ. 862

2011. Simultaneous glycan-peptide characterization using hydrophilic interaction 863

chromatography and parallel fragmentation by CID, higher energy collisional 864

dissociation, and electron transfer dissociation MS applied to the N-linked 865

glycoproteome of Campylobacter jejuni. Mol Cell Proteomics 10:M000031-866

MCP201. 867

on Decem


.org/D

ownloaded from

http://iai.asm.org/

41

69. Ishihama Y, Rappsilber J, Mann M. 2006. Modular stop and go extraction tips 868

with stacked disks for parallel and multidimensional Peptide fractionation in 869

proteomics. J Proteome Res 5:988-94. 870

70. Rappsilber J, Mann M, Ishihama Y. 2007. Protocol for micro-purification, 871

enrichment, pre-fractionation and storage of peptides for proteomics using 872

StageTips. Nat Protoc 2:1896-906. 873

71. Cox J, Mann M. 2008. MaxQuant enables high peptide identification rates, 874

individualized p.p.b.-range mass accuracies and proteome-wide protein 875

quantification. Nat Biotechnol 26:1367-72. 876

72. Cox J, Hein MY, Luber CA, Paron I, Nagaraj N, Mann M. 2014. Accurate 877

proteome-wide label-free quantification by delayed normalization and maximal 878

peptide ratio extraction, termed MaxLFQ. Mol Cell Proteomics 13:2513-26. 879

73. Tyanova S, Temu T, Sinitcyn P, Carlson A, Hein MY, Geiger T, Mann M, Cox J. 880

2016. The Perseus computational platform for comprehensive analysis of 881

(prote)omics data. Nat Methods 13:731-40. 882

74. Perez-Riverol Y, Csordas A, Bai J, Bernal-Llinares M, Hewapathirana S, Kundu 883

DJ, Inuganti A, Griss J, Mayer G, Eisenacher M, Perez E, Uszkoreit J, Pfeuffer J, 884

Sachsenberg T, Yilmaz S, Tiwary S, Cox J, Audain E, Walzer M, Jarnuczak AF, 885

Ternent T, Brazma A, Vizcaino JA. 2019. The PRIDE database and related tools 886

and resources in 2019: improving support for quantification data. Nucleic Acids 887

Res 47:D442-D450. 888

75. Penfold RJ, Pemberton JM. 1992. An improved suicide vector for construction of 889

chromosomal insertion mutations in bacteria. Gene 118:145-146. 890

on Decem


.org/D

ownloaded from

http://iai.asm.org/

42

76. Thoma S, Schobert M. 2009. An improved Escherichia coli donor strain for 891

diparental mating. FEMS Microbiol Lett 294:127-32. 892

893

Figures 894

Figure 1. BpsΔppiB shows reduced intracellular survival in J774.A1 murine 895

macrophages. (A) Intracellular growth of BpsWT (●) and BpsΔppiB () in J774A.1 896

murine macrophages was infected at an MOI of 10 and intracellular counts taken at 0, 897

3, 6, 9 and 12. Graphs are the mean of five biological replicates with each having two 898

technical replicates. The error bars displaying the Standard Error of the Mean. * P-value 899

of 0.0159 by Mann-Whitney U-test. 900

901

Figure 2. BpsΔppiB is attenuated in the BALB/c mouse model of infection. (A) 902

BALB/c mice (n=6) were injected intraperitoneally with 1.1 x 104 CFU BpsWT (●) and 903

1.86 X 104 CFU of Bps∆ppiB (▲). * P-value 0.0183 by Log-rank test. Weight loss of 904

individual BALB/c mice (labelled 1 – 6) was monitored daily following intraperitoneal 905

infection as a measure of morbidity in (B) B.psWT and (C) B.psΔppiB. 906

907

Figure 3. BpsΔppiB demonstrates reduced formation of multinucleated giant cells 908

in J774 murine macrophages. Fluorescently stained monolayers infected with either 909

(A) BpsWT, (B) BpsΔppiB or (C) BpsΔppiB/ppiB. were stained with Anti-Bps-LPS-FITC 910

and nuclei are stained with Hoescht33258, bar indicates 14µM. (D) Percentage of nuclei 911

associated with a MNGC, BpsWT (●), BpsΔppiB () and BpsΔppiB/ppiB (■). Graphs 912

on Decem


.org/D

ownloaded from

http://iai.asm.org/

43

are the result of three biological repeats with each biological repeat containing two 913

technical repeats. 1000 nuclei were counted from each coverslip with them either being 914

part of a multinucleated cell or mononucleated and then the percentage of 915

multinucleated was calculated. * P-value 0.026 and ** P-value 0.0022 by Mann-Whitney 916

U-test. 917

918

Figure 4. Quantitative proteomic analysis of BpsWT vs BpsΔppiB. Label-free 919

quantification was undertaken to compare BpsΔppiB to BpsWT. A) Identified proteins 920

are presented as a volcano plot depicting mean label free quantitation (LFQ) intensity 921

ratios of BpsΔppiB versus BpsWT plotted against logarithmic t test p values from four 922

biological experiments of each strain. B) GO terms assigned localization of the 42 out 923

the 213 proteins which undergo statistically significant changes with localization 924

assignment. Only GO localization terms for groups with greater than 3 entries are 925

shown. Complementation of PpiB lead to restoration of proteins observed to (C) 926

increase and (D) decrease to near BpsWT levels. 927

928

Figure 5. KEGG Pathway analysis of proteins differentially present in BpsWT vs 929

BpsΔppiB. Proteins that were differentially present by proteomics (Supplementary 930

Table 1) were manually curated using the Kyoto Encyclopaedia of Genes and Genomes 931

(KEGG) database against the Burkholderia pseudomallei K96243 genome (entry 932

number T00203) and assigned a KEGG Orthology (KO). Proteins in red were increased 933

in BpsΔppiB relative to BpsWT, while proteins in blue were decreased. Numerous 934

on Decem


.org/D

ownloaded from

http://iai.asm.org/

44

proteins were predicted to be in other functional groups but only the highest KO was 935

taken down. 936

937

Figure 6. BpsΔppiB has significantly reduced motility and biofilm formation. (A) 938

Swarming motility of BpsWT (●), BpsΔppiB () and BpsΔppiB/ppiB (■) through 0.3 % 939

agarose plates. Values are the diameter of spread with readings taken at 24 hours post-940

inoculation. Results are of three biological replicates. ** P-value 0.0022 by Mann 941

Whitney U-test. (B) Biofilm forming capacity of BpsWT (●), BpsΔppiB () and 942

BpsΔppiB/ppiB (■) in nutrient LB broth. Biofilms were allowed to form over a 48 hour 943

period before being fixed with methanol and stained with crystal violet to determine 944

bacterial biomass. Crystal violet was solubilised with 33 % glacial acetic acid and optical 945

density was read with a spectrophotometer (BioRad Xmark) at 590 nm. Bars are 946

representative of the mean optical density with individual values plotted. Six biological 947

replicates with 6 technical repeats were conducted. ** P-value by Mann-Whitney U-test. 948

949

Figure 7. BpsΔppiB demonstrates greater sensitivity towards oxidative stress. 950

Survival of BpsWT (●), BpsΔppiB () and BpsΔppiB/ppiB (■) in increasing 951

concentrations of hydrogen peroxide. Values are the mean MIC of three biological 952

replicates. Concentrations are in µL/mL of 30% Hydrogen Peroxide (BioVar) solution. 953

MIC was determined by measuring the optical density (OD 590 nm) at 24 hours post 954

hydrogen peroxide exposure and MIC was called as the lowest concentration which 955

resulted in less than 20 % growth (dotted line) of the unexposed control on that plate. 956

on Decem


.org/D

ownloaded from

http://iai.asm.org/

45

957

Antibiotic BpsWT BpsΔppiB BpsΔppiB/ppiB

Ceftriaxone 128 8 16

Meropenem 2 0.5 1

Tetracycline 2 0.5 1

Doxycycline 1 <0.25 0.5

958

Table 1. Minimum Inhibitory Concentration (MIC) as determined by broth 959

microdilutions. Values are the mean MIC of three biological replicates. Concentrations 960

are in µg/mL for antibiotics. MIC was determined by measuring the optical density (OD 961

590 nm) at 24 hours post antibiotic exposure and MIC was called as the lowest 962

concentration which resulted in less than 20 % growth of the unexposed control on that 963

plate. 964

965

966

967

968

969

970

971

972

973

Strain or plasmid Genotype or description Source or

on Decem


.org/D

ownloaded from

http://iai.asm.org/

46

974

Table 2. Bacterial strains and plasmids used in this study 975

reference

Escherichia coli

TOP10® Chemically competent cloning strain Invitrogen

S17-1 λpir S17-1 with a λ prophage carrying the pir gene,

conjugal strain for the movement of pDM4

(75)

ST18 S17-1 λpirΔhemA, conjugal strain for the

movement of pBBR1-MCS1

(76)

Burkholderia pseudomallei

K96243 (WT) Clinical isolate Dstl, (61)

∆ppiB K96243 derivative; unmarked deletion ∆ppiB This study

∆ppiB/ppiB K96243 derivative; unmarked deletion ∆ppiB;

ppiB_3XFLAG_pBBR1-MCS1

This study

on Decem


.org/D

ownloaded from

http://iai.asm.org/

on Decem


.org/D

ownloaded from

http://iai.asm.org/

*

-5 0 5 10 15 20 25 30 35

12

14

16

18

20

22

Days post challenge

We

igh

t (g

)

1

2

3

4

5

6

-5 0 5 10 15 20 25 30 35

12

14

16

18

20

22

Days post challenge

We

igh

t (g

)

1

2

3

4

5

6

C

B

A

on Decem


.org/D

ownloaded from

http://iai.asm.org/

on Decem


.org/D

ownloaded from

http://iai.asm.org/

A B

C D

on Decem


.org/D

ownloaded from

http://iai.asm.org/

on Decem


.org/D

ownloaded from

http://iai.asm.org/

0 50 100 150 200 250

Metabolism

Environmental Information Processing

Signalling and Cellular Processes

Genetic Information Processing

Human Disease

Cellular Processes

Not Included in Pathway

Unassigned

Hypothetical Protein

Number of proteins

Increased Decreased

on Decem


.org/D

ownloaded from

http://iai.asm.org/

on Decem


.org/D

ownloaded from

http://iai.asm.org/

0.32 0.16 0.08 0.04 0.02 0.01 0.005 0.0025

0

20

40

60

80

100

Concentration (µL/mL)

% G

row

th

on Decem


.org/D

ownloaded from

http://iai.asm.org/

Downloaded from on April 21, 2020 by guest · 2019. 7. 16. · 33 there is a requirement to...

Documents

Transcript of Downloaded from on April 21, 2020 by guest · 2019. 7. 16. · 33 there is a requirement to...