Downloaded from //ec.asm.org/content/eukcell/early/2014/06/10/EC.00061-14.full.pdfsuz as template...

1

BEM46 Shows Eisosomal Localization and Association with Tryptophan-1 Derived Auxin Pathway in Neurospora crassa 2 3 K. Kollath-Leiß, C. Bönniger, P. Sardar, F. Kempken1 4 5 Abteilung Botanische Genetik und Molekularbiologie 6 Botanisches Institut und Botanischer Garten 7 Olshausenstr. 40 8 24098 Kiel 9 Germany 10 Phone: +49 431 880 4274 11 Fax: +49 431 880 4248 12 1 author for correspondence: [email protected] 13 14 15 16 17 18 19 20 21 22 23 24 25 26

EC Accepts, published online ahead of print on 13 June 2014Eukaryotic Cell doi:10.1128/EC.00061-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.

on March 22, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

2

Abstract 27 BEM46 proteins are evolutionary conserved, but their functions remain elusive. We 28 previously reported that the BEM46 protein in Neurospora crassa is targeted to the ER, and 29 is essential for ascospore germination. In the present study, we established a bem46 knock-30 out strain of N. crassa. This Δbem46 mutant exhibited ascospore germination lower than wild 31 type, but much higher than the previously characterized bem46-overexpressing and RNAi 32 lines. Reinvestigation of the RNAi transformants revealed two types of alternative spliced 33 bem46 mRNA, with expression of either type leading to loss of ascospore germination. Our 34 results indicated that the phenotype was not due to bem46 mRNA downregulation or loss, 35 but caused by the alternative spliced mRNAs and their encoded peptides. Using the N. 36 crassa ortholog of the eisosomal protein PILA from Aspergillus nidulans, we further 37 demonstrated co-localization of BEM46 with eisosomes. Employing the yeast two-hybrid 38 system, we identified a single interaction partner: the anthranilate synthase component two 39 (trp-1). This interaction was confirmed in vivo by a split-YFP approach. The ∆trp-1 mutant 40 showed reduced ascospore germination and increased indole production, and we used 41 bioinformatic tools to identify a putative auxin biosynthetic pathway. The involved genes 42 exhibited varying transcriptional regulation among the different bem46 transformant and 43 mutant strains. We also investigated the strains’ indole production in different developmental 44 stages. Our findings suggested that indole biosynthesis gene regulation was influenced by 45 bem46 overexpression. Furthermore, we uncovered evidence of co-localization of BEM46 46 with the neutral amino acid transporter MTR. 47 48


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

3

Introduction 49 The bud emergence 46 (BEM46) protein is conserved across the eukaryotic kingdom (1), 50 and the molecular evolution of members of the BEM46 family has recently been described in 51 detail (2). Our group demonstrated that while the majority of eukaryotic genomes include a 52 single copy of bem46, vertebrates possess several paralogs, originated through duplication 53 events. 54

Studies in various model organisms have revealed limited data regarding BEM46 55 function. The bem46 gene of Schizosaccharomyces pombe is reportedly a suppressor of the 56 bem1/bud5 double mutant of Saccharomyces cerevisiae (1), which shows defects in cell 57 polarization and budding (3, 4). BEM1 is a scaffold protein that interacts with BUD1 (5), actin 58 (6), CDC42 (7), and BUD5 (3, 8) and it is reportedly required for the positioning of a protein 59 complex involved in bud formation (3). BUD5 is a GDP–GTP exchange factor for BUD1, and 60 is necessary for bud site selection (8). The bem46 homolog of bakers’ yeast (YNL320W) is 61 not essential (9). Two-hybrid approaches in Drosophila melanogaster have shown that the 62 BEM46 homolog interacts with the RAPSYNOID protein (10), which is a putative GDP–GTP 63 exchange factor for a Gα protein, and is involved in controlling asymmetrical cell division 64 (11). Wavy growth 2 (wav2) is the BEM46 homolog in Arabidopsis thaliana, and a knock-out 65 mutant shows short-pitch waves related to root development (12). WAV2 is a common 66 regulator involved in suppressing root bending caused by cell file rotation enhancement in 67 response to touch stimuli, light, and gravity (13). The protein is mainly expressed in young 68 seedlings and roots of adult plants, with subcellular localization in the plasma membrane and 69 in compartment membranes (13). 70

All BEM46 proteins belong to an α–β hydrolase superfamily, characterized by the α–β 71 hydrolase domain (14), comprising a β-sheet core of five to eight strands connected by α-72 helices. The α–β hydrolase domain is also found in several enzymes with diverse 73 phylogenetic backgrounds, catalytic functions, and substrate specificities (15). The ESTHER 74 database includes over 30,000 members of this superfamily (16, 17). 75

76


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

4

Despite these hints, the exact function of BEM46 remains elusive. Therefore, bem46 77 is considered one of the top ten known genes encoding a protein with unknown function (18, 78 19). Previous results suggest that BEM46 may play a role in signal transduction or in 79 maintaining cell polarity. Fungal hyphae serve as a model system for polarized growth (20); 80 therefore, we have investigated the BEM46 protein of the ascomycete Neurospora crassa. 81 We previously reported that BEM46 in N. crassa is localized to the perinuclear endoplasmic 82 reticulum, and in patches near the plasma membrane (21), as detected based on an unusual 83 ER retention signal at the C-terminal end of the protein (2). Transcript overexpression and 84 downregulation each leads to loss of ascospore germination. Using bioinformatic tools, we 85 also previously predicted the native protein structure, which included an essential catalytic 86 triad (2). 87

In the present study, we show that BEM46 in N. crassa is part of the fungal eisosome, 88 and is an interacting partner of the anthranilate synthase. We also demonstrate co-89 localization of BEM46 with the putative tryptophan transporter MTR. Our present data 90 indicate an influence of BEM46 on the auxin biosynthesis pathway of the fungus, and we use 91 bioinformatics tools to predict a putative auxin biosynthesis pathway in N. crassa. 92 Furthermore, we demonstrate that alternative splicing of the bem46 transcript is responsible 93 for loss of ascospore germination in the bem46 RNAi lines. 94 95


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

5

MATERIALS AND METHODS 96 Strains. The present study used the following Neurospora crassa strains from the Fungal 97 Genetics Stock Center (FGSC; Kansas City, USA): FGSC #9718 [∆mus-51::bar, mat a], 98 FGSC #9719 [∆mus-52::bar, mat a], FGSC #6103 [his-3 (Y234M723), mat A], FGSC #9716 99 [his-3 (Y234M723), mat a], FGSC #20870 [∆trp-1 (NCU00200.2), mat a], and FGSC # [∆trp-1 100 (NCU00200.2), mat A]. Fungi were cultivated on Vogel’s minimal medium (22). All presently 101 used expression vectors carrying fusion constructs were transformed into the histidine 102 auxotrophic strains FGSC #6103 and #9716; therefore, these strains served as “wild type” in 103 control experiments. Strains carrying auxotrophic markers were grown on media 104 supplemented with the required amino acids. For crosses, fungi were plated on 105 Westergaard’s medium (23). In the co-localization studies, heterokaryon formation was 106 carried out as previously described (24). 107

For the propagation of vector constructs under standard culture conditions, we used 108 E. coli strain XL-Blue1 [recA1, endA1, gyrA96, thi-1, hsdR17, supE44, relA1, lac F'proAB 109 lacIqZΔM15 Tn10 (Tetr); Stratagene, La Jolla]. For the propagation of RNAi constructs, we 110 used E. coli strain SURE [e14−, (McrA−), D(mcrCB-hsdSMR-mrr)171, endA1, supE44, thi-1, 111 gyrA96, relA1, lac, recB, recJ, sbcC, umuC::Tn5, (Kanr), uvrC, F' proAB lacIqZDM15 Tn10 112 (Tetr); Stratagene, Heidelberg]. 113

DNA and RNA isolation. DNA isolation was performed as previously described (25). 114 Briefly, mycelia were ground under liquid nitrogen and transferred into lysis buffer (10 mM 115 Tris-HCl, 1 mM EDTA, 100 mM NaCl, and 2% SDS, pH 8.0), followed by phenol extraction. 116 Subsequently, the aqueous phase was incubated with 100 µg RNase A, followed by an 117 additional phenol extraction and ethanol precipitation. Bacterial plasmid DNA was isolated 118 using NucleoSpin reagent kits (Macherey-Nagel, Düren). Plasmids were isolated from yeast 119 according to standard procedure (26). 120

RNA was isolated from mycelium as previously published (27). Vegetative mycelia of 121 Neurospora crassa strains were grown for three days in liquid Vogel’s minimal medium with 122


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

6

5.8 mM saccharose. For strain FGSC #6103, 1 mM L-Histidine was added to the medium. 123 The mycelia were ground and cooled with liquid nitrogen. 124

Gel electrophoresis, blotting, and hybridization. Agarose gel electrophoresis, 125 Southern and northern blotting, and DNA–DNA and DNA–RNA hybridization were performed 126 as previously described (28). A decaprime kit (Ambion, Austin) was used to label 20–30 ng of 127 template DNA with 32P-αdCTP. MBBL DNA markers (Bielefeld) were used to determine size 128 in DNA gel electrophoresis. 129 PCR and RT-PCR amplification. PCR was performed as previously described (21). 130 For qRT-PCR, isolated nucleic acids were treated with DNase (Roche Diagnostics, 131 Mannheim, Germany) following the manufacturer’s recommendations. As a control for the 132 success of DNase treatment, PCR was also performed using primers CB2480/1 133 (TACTTCACCGCCAGAAGTC/TGCGGAGGGTGAAAGAAGAG) for the housekeeping gene 134 L6_rRNA. 135

Oligonucleotides used for quantitative real-time PCR were synthesized by Eurofins 136 MWG Operon (Ebersberg, Germany). Isolated and DNase-treated RNA (100 ng) was used 137 as template and mixed with the QuantiTect SYBRgreen RT Kit (Qiagen, Hilden, Germany). 138 The recommended program from Qiagen was modified to use an annealing temperature of 139 58°C. Quantitative real-time PCR was performed in a 7300 Real-Time PCR System (Life 140 Technologies™, Darmstadt, Germany). For each gene of interest, we calculated the fold 141 change in comparison to the housekeeping gene tub2, and by using the 2−ΔΔCt-method (29). 142 Statistical analysis was accomplished using SigmaPlot 12. 143

Transformation and transformant analysis. Previously described methods were 144 used for cloning and E. coli transformation (28) and for N. crassa transformation (30, 31). All 145 cloning and transformation experiments were conducted in accordance with the requirements 146 of the German gene technology law (GenTG). 147

Microscopy. For the germination assays, ejected ascospores were harvested and 148 incubated for 90 min in 500 µl sterile water at 60°C to inactivate contaminating macroconidia. 149


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

7

Ascospore concentrations were adjusted to 4 × 103 spores/ml. All light microscopy was 150 performed using a Zeiss Axiophot-Mikroskop equipped with a SONY 3CCD digital camera. 151 Confocal fluorescence analysis was performed using a confocal laser scanning microscope 152 (Leica, TCS SP5). Fusion constructs containing eGFP, eYFP, or tRFP were excited with 488 153 nm, 514 nm, or 543 nm, respectively, and emission was detected at 500–550 nm, 520–550 154 nm, and 570–620 nm. Images were analyzed using the Leica LAS AF Lite Software. Fungi 155 were cultivated for microscopy as previously described (32). 156

Vector construction. The construction of the vectors pMM529 (bem46 157 overexpressing vector), pMM532 (bem46 RNAi vector), pMM536 (bem46::egfp-fusion-158 vector), and pUH280 (vector used for bem46 RIP mutation assay) was previously described 159 (21). In the supplemental material, Fig. S1 presents a schematic representation of all other 160 vectors used and Table S1 lists the sequences of the oligonucleotides used in the present 161 work. Vectors used for the yeast two-hybrid approach are described below. 162

The vectors pKK790 and pKK791 were used in the bimolecular fluorescence 163 complementation assay. pKK790 consists of the bem46 ORF and the eyfp c-terminal 164 sequence (33), amplified in two steps by overlapping extension PCR. In the first step, the 165 bem46 ORF was created using the oligonucleotides KK2212 and KK2332. In parallel, the 166 eyfp c-terminal sequence was amplified using the oligonucleotides KK2331 and KK2215. In 167 the second step, both fragments were united in a PCR reaction using the oligonucleotides 168 KK2212 and KK2215. The fusion construct was ligated in an expression vector under control 169 of the ccg1 promoter. 170

The vector pKK791 contains the trp1 ORF (amplified by KK2333 and KK2334) cloned 171 to the eyfp n-terminal sequence (amplified by KK2335 and KK2336) (33). The frame was 172 corrected in an in vitro deletion step using the oligonucleotides KK2388 and KK2389. For 173 eisosomal localization studies, we created the vector pJQ771—comprising the sequence 174 encoding the N. crassa PILA homolog (NCU07495) amplified by KK2347 and KK2348, fused 175 to trfp amplified by KK2350 and KK2349 (34). Expression of this fusion construct was 176


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

8

controlled by the ccg1 promoter. The final frame was corrected by in vitro deletion using 177 JQ2413 and JQ2414. 178

Three additional expression vectors with egfp fusion constructs under the control of 179 the ccg1 promoter were also created. The vector pCB779 contains the 0.5-kb-long 180 alternative splice product of bem46, amplified using the oligonucleotides KK2433 and 181 KK2434. The gene sequence encoding the MTR homolog in N. crassa (NCU006619.5) was 182 generated by PCR with the oligonucleotides CB2562 and CB2563, using N. crassa genomic 183 DNA as template. The required restriction sites for directed ligation into the final vector 184 pCB794 were added in a subsequent PCR reaction with the oligonucleotides CB2508 and 185 CB2514. 186

Construction of the N. crassa ∆bem46 mutant. A ∆bem46 mutant strain was 187 generated according to previously described procedures (35). Vector construction is 188 described in Fig. S1 in the supplementary material. The final vector carries the full-length hph 189 ORF under control of the Aspergillus nidulans trpC promoter (amplified by FK547/548) and 190 the Neurospora crassa arg2 terminator (amplified by FK541/542), flanked by 1.0- to 1.3-kb-191 long fragments down- and upstream of the bem46 genomic DNA sequence (amplified by 192 AS944/945 and AS946/947, respectively). The resulting vector pHS606 was transformed into 193 Neurospora crassa FGSC #9718 and #9719 strains by electroporation following standard 194 protocols (30, 31). Transformants were selected on Vogel’s minimal medium with 5.8 mM 195 saccharose, supplemented with 200 µg/ml hygromycin B. Homokaryotic ∆bem46 strains 196 were obtained by isolation of single microconidia, and tested for homologous single-copy 197 integration of the transformation cassette by Southern blot hybridization. Homokaryotic 198 transformants free of the mus mutation were generated by crossing with the histidine 199 auxotrophic strains FGSC #6103 and #9716. 200

Sequence analysis. All sequence analyses were performed by Eurofins MWG 201 Operon (Ebersberg) and GATC Biotech (Konstanz). 202


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

9

Yeast Two-Hybrid. To identify proteins putatively interacting with BEM46, we applied 203 the yeast two-hybrid approach (36, 37), performed using the MatchmakerTM GAL4 Two-204 Hybrid System 3 (Clontech, Mountain View) according to standard protocols. The following 205 yeast strains were utilized: Saccharomyces cerevisiae AH109 (MATa, trp1-901, leu2-3, 112, 206 ura3-52, his3-200, gal4D, gal80D, LYS2::GAL1UAS-GAL1TATA-HIS3, GAL2UAS-207 GAL2TATA-ADE2,URA3::MEL1UAS-MEL1 TATA-lacZ; Clontech, Mountain View) and 208 Saccharomyces cerevisiae Y187 (MATa, ura3-52, his3-200, ade2-101, trp1-901, leu2-3, 112, 209 gal4D, met–, gal80D, URA3::GAL1UAS-GAL1TATA-lacZ; Clontech, Mountain View). Fig. S1 210 in the supplementary material depicts the vectors. The bait vector (pEH646) was generated 211 by cloning the bem46 cDNA (which was amplified by the oligonucleotides EH1132 and 212 EH1133) into the vector pGBKT7 (Clontech, Mountain View) in frame with the GAL4 DNA-213 binding domain. The prey vector carried a N. crassa cDNA bank (provided by S. Seiler, 214 Göttingen) cloned into the vector pGADT7 (Clontech, Mountain View), containing the GAL4 215 transcription activation domain. 216

Yeast transformation was performed by electroporation. First, 50 µl of 217 electrocompetent Saccharomyces cell suspension was mixed with 100 ng DNA, and kept on 218 ice for 5 min. Subsequently, the cells were transferred into a cold electroporation cuvette 219 (Gene Pulser Cuvette; BioRad, Munich) and transformation was performed in a Gene 220 PulserTM (BioRad, Munich) at 200 Ω and 25 µF with 1.5 kV. Directly after transformation, 1 221 ml of 4°C 1 M sorbitol was added, and the mixture was incubated at room temperature for 5 222 min. Finally, 100 µl of the sample was plated on solid medium, and the plates were incubated 223 at 30°C until colony development. 224

Putative positive colonies were identified on selective minimal medium 225 (SD/−Ade/−His/−Leu/−Trp), and the putative interaction was confirmed using the X-α-226 galactosidase assay. Colonies were plated on selective minimal medium supplemented with 227 80 mg/L X-α-Gal. After incubation at 30°C for 8 days, blue colonies were further tested for 228 their β-galactosidase activity in a colony-lift filter assay (38). 229


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

10

Plant material, growth conditions, and GUS assay. The GUS assay was 230 performed with transgenic 5-day-old Arabidopsis thaliana (ecotype Col-0) seedlings carrying 231 the synthetic auxin response element DR5 (39) coupled to the GUS reporter gene. In these 232 plants, the glucuronidase activity is auxin dependent. Seed sterilization was performed with 233 96% ethanol following standard procedure (40). Plants were grown on solidified half-strength 234 MS nutrient medium (41) containing 1% sucrose, at 25°C for seven days under long-day 235 conditions. Subsequently, five to ten seedlings were incubated with either H2O, 100 µM IAA, 236 or germinated ascospores of N. crassa. Histochemical GUS assay was performed as 237 previously described (40). 238

Indole extraction, and qualitative and quantitative analysis. To determine indole 239 production, fungi were cultivated in Vogel’s minimal liquid medium supplemented with 0.5 240 mM tryptophan (incubation at 25°C and 180 rpm in darkness). Samples were collected at 241 various time-points and were either centrifuged at 7000 g for 15 min, or filtered through one 242 layer of WhatmanTM paper to remove fungal residue. Supernatant was collected and pH 243 was adjusted to 2.8 with 10% HCl. 244

Quantitative determination of total indole content was performed using the Salkowski 245 method (42, 43). In a light-protected tube, 500 µl Salkowski reagent was mixed with equal 246 volume of the collected supernatant. The probes were incubated at 30°C for 15 min, followed 247 by determination of the absorbance at 540 nm. Standard curves were prepared from serial 248 dilutions of a 100 mM IAA stock solution. 249

Indoles were qualitatively analyzed by TLC. After pH adjustment, aliquots of the 250 supernatant were extracted by addition of a double volume of ethyl acetate, followed by 251 vigorous shaking for 10 min. After phase separation, the ethyl acetate fraction was collected 252 in light-protected tubes, the solvent was evaporated, and the solid indole-containing residue 253 was dissolved in 30 µl methanol. Samples were spotted onto silica gel plates (TLC Silica gel 254 60 F254; Merck, Darmstadt), and developed with ethyl acetate:isopropanol:ammonia solution 255 (45:35:20). Subsequently, the plates were dried, stained with van Ehmann’s reagent (44), 256


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

11

and heated to 90°C until spots were clearly visible. We applied 1 mM each of IAA and 257 tryptophan solutions as standards. 258


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

12

RESULTS 259 bem46 knock-out mutant. We previously demonstrated Neurospora crassa BEM46 protein 260 localization in the ER and in areas near the plasma membrane, and loss of ascospore 261 germination in Bem46 RNAi and overexpressing transformants (21). To confirm the bem46 262 mutant phenotype, here we established a bem46 knock-out strain by replacing the bem46 263 gene with the hph gene encoding hygromycin B resistance using a mus-51/52 mutant 264 provided by the Fungal Genetic Stock Center. Fig. S2 in the supplementary material shows 265 how we successfully generated several bem46 knock-outs. These knock-outs exhibited 266 normal vegetative growth and produced micro- and macroconidia. Ascospore germination 267 was somewhat reduced compared to in the wild type (Fig. 1); however, the phenotype was 268 much weaker than that of the RNAi or overexpressing transformants, which exhibit no 269 ascospore germination. 270 Alternative splicing of the bem46 transcript. This unexpected discrepancy 271 between the knock-out mutant and the RNAi or overexpressing transformants could have 272 been caused by nonspecific downregulation of some other RNA, but there was no evidence 273 of any such occurrence (21). It was also possible that alternate RNAs accumulated in the 274 RNAi transformant, as alternative splicing has been reported for a number of N. crassa 275 transcripts (45). To investigate this possibility, we performed RT-PCR with oligonucleotides 276 located at the beginning and end of the bem46 open reading frame to generate full-length 277 cDNA. RT-PCR amplification from wild-type and RNAi strains was performed using RNA 278 isolated from submerged grown mycelium and macroconidia. The bem46 full-length amplicon 279 was somewhat reduced in RNAi from mycelium, and strongly reduced in RNA from 280 macroconidia (Fig. 2A). More importantly, both RNA samples from the RNAi transformant 281 produced additional amplicons—including a 1.2-kb amplicon that was slightly larger than that 282 from wild type and, in one sample, a smaller amplicon of about 0.5 kb. 283

These amplicons were eluted from the gel and sequenced. Fig. 2B shows a 284 schematic view of the sequencing data, which provided direct evidence of alternative 285 splicing. The small 0.5-kb amplicon resembled an alternative spliced form that was missing 286


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

13

exon three. The larger 1.2-kb transcript still contains the first intron, suggesting a case of 287 intron retention, which is an frequent alternative splicing event in fungi (45). Neither transcript 288 would encode the full-length bem46 protein. Assuming that translation was initiated at the 289 same AUG start codon used for translation in the wild-type sequence, the 1.2-kb mRNA 290 could encode a 40-amino acid truncated BEM46, and the 0.5-kb mRNA could encode a 123-291 amino acid truncated BEM46 protein. Both truncated proteins would include the same N-292 terminus as in the 320-amino acid full-length BEM46 protein. The alternative spliced RNAs 293 were cloned into a suitable vector under control of the cfp promoter (46), and the products 294 were transformed into N. crassa using homologous recombination at the his-3 locus (47). 295 Ascospore germination of transformants was compared to that of wild type, bem46 RNAi, 296 overexpressing, and knock-out strains. Expression of each type of truncated BEM46 caused 297 complete loss of ascospore germination (Fig. 1), suggesting a possible inhibitory effect of 298 truncated BEM46, which could be due to incorrect cellular localization (see below), or wrong 299 or incomplete structure. 300 BEM46 co-localizes with the eisosomal PILA homolog protein. BEM46 localizes 301 to the perinuclear ER and to spots near the plasma membrane (21), which are not actin 302 patches (48). Microscopic analyses showed that these spots did not reform within 15 minutes 303 of investigation (Fig. 3A). Fungal eisosomes are reportedly stable protein complexes 304 connected to the plasma membrane (49). Thus, we investigated potential co-localization of 305 BEM46 with the Neurospora crassa homolog of PILA (NCU07495), which has been 306 described as an eisosomal core protein in Aspergillus nidulans (50). After identification using 307 a bioinformatics approach, the full-length coding sequence of the PILA homolog was coupled 308 to the reporter gene trfp under control of the ccg1 promoter. We subsequently performed 309 transformation in N. crassa, and selected homokaryotic lines expressing the pilA:trfp reporter 310 gene construct. A heterokaryon comprising a transformant expressing BEM46 coupled to 311 eGFP was investigated by confocal laser scanning microscopy. The BEM46::eGFP protein 312 showed co-localization with the PILA::tRFP protein in germinating macroconidia of N. crassa 313 (Fig. 3B). 314


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

14

Subcellular localization of the truncated BEM46 protein encoded by the 0.5-kb 315 alternative spliced fragment. We also analyzed the subcellular localization of the truncated 316 protein encoded by the small (0.5-kb) alternative spliced product of bem46. To this end, the 317 cDNA fragment was joined to the egfp reporter gene under control of the ccg1 promoter. The 318 full-length BEM46 protein contains an unusual ER retention signal (2), which leads to the 319 localization of the full-length protein to the perinuclear ER. The alternative splicing event 320 results in a 123-amino acid protein lacking the amino acids for the retention signal. The 321 confocal microscopic image in Fig. 3C shows the subcellular localizations of the 0.5-322 kb::eGFP and PILA::tRFP proteins. As expected, the small peptide did not localize to the 323 perinuclear ER, but was found in several small spots close to the plasma membrane, similar 324 to the spots observed for the full-length BEM46. However, most of these patches showed no 325 co-localization with the eisosomal PILA protein. 326

The anthranilate synthase component II is an interaction partner of BEM46. 327 Using yeast two-hybrid analysis, we identified about 100 proteins specifically interacting with 328 BEM46 (Fig. 4). Plasmid isolation and sequencing revealed that all analyzed plasmids 329 contained one of four cDNA fragments from the same gene sequence, encoding the 330 anthranilate synthase component II or trp-1 gene (51). Among these four cDNAs (Fig. 4B), 331 the two smaller ones encoded only the F-domain, which resembles an N-(5′-phosphoribosyl) 332 anthranilate isomerase. As these cDNAs enabled specific two-hybrid interaction with the 333 BEM46 protein, it is likely that the F-domain is sufficient for protein–protein interaction with 334 BEM46. A bimolecular fluorescence complementation assay (33) was used to confirm the in 335 vivo interaction of BEM46 and anthranilate synthase (Fig. 5). 336

The ∆trp1 mutant. Our above-described results indicated a link between BEM46 and 337 the tryptophan biosynthesis pathway. Tryptophan reportedly may act as a signal molecule 338 and inhibit conidial anastomosis tube fusion in N. crassa (52), and is also an important 339 precursor for secondary metabolites and plant hormones, such as auxin (53, 54), which is 340 produced in both plants and in fungi (55). 341


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

15

Further investigation revealed that the Δtrp-1 strain (FGSC #20870/20871) showed 342 single ascospores developing no directed hyphae, but rather growing bubble-like structures 343 at the point of germination (Fig. 6A, blue arrow), similar to those observed in the bem46 344 RNAi line (21). Compared to in the wild-type ascospore, germination in the Δtrp-1 strain was 345 reduced to about 50% (Fig. 6C), with conidia germinating earlier and building longer young 346 hyphae. Since indole-acetic acid reportedly promotes conidial germination and elongation of 347 young hyphae (56–59), we tested whether the observed phenotypic effect might be caused 348 by auxin. In the medium, we determined the indole content released by germinating 349 conidiospores. Indeed, the Δtrp-1 mutant produced ten-fold higher amounts of indoles 350 compared to the wild-type strain when supplemented with 0.5 mM tryptophan (Fig. 6E). 351 Determination of the indole content produced by ascospores revealed no differences (Fig. 352 6D). 353

A pathway for indole production in N. crassa. Auxin production has been long 354 known to occur in filamentous fungi (60, 61), and has also been recently reported in 355 symbiotic and phytopathogenic fungi (e.g., 62). Several pathways have been suggested for 356 auxin production in plants, but not all are confirmed (54). The most studied such pathway is 357 the IPA pathway (63), in which the main enzymes are tryptophan aminotransferase (TAM), 358 indole-3-pyruvate decarboxylase (IPD), and indole-3-acetaldehyde dehydrogenase (IAD). 359 Previous studies (60, 64) have shown the presence of TAM1 and IAD1 in Ustilago maydis. 360 Here we used bioinformatic tools to identify the entire set of ortholog genes for the IPA 361 pathway in N. crassa: NCU09166.7 (tam1), NCU02397.7 (ipd), and NCU03415 (iad1). (see 362 Fig. S3) 363 Regulation of transcription of the auxin biosynthetic pathway in the bem46 364 transformant and mutant strains of N. crassa. We investigated the expressions of tam1, 365 ipd, and iad1 among the wild-type, bem46 mutant, and different transformant strains. Fig. 7 366 shows the quantitative RT-PCR results for mRNA of these genes. The first gene of the 367 pathway (tam1) was significantly downregulated in the bem46 knock-out (NcT411) and 368 knock-down (NcT289) strains. Interestingly, overexpression of the 0.5-kb alternative spliced 369


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

16

fragment (NcT419) had the same effect. The overexpressing line (NcT288) showed no 370 altered regulation of the tam1 gene, but was the only strain to show altered regulation of the 371 ipd gene (three-fold upregulation). The last gene of the pathway, iad1, was upregulated in all 372 investigated strains, except for the 0.5-kb fragment-expressing line. Expression of iad1 was 373 more than 10-fold higher in the bem46-overexpressing strain. 374

Indole production of the bem46 transformant and mutant strains compared to 375 the wild type. Fig. 8 shows data indicating auxin production in N. crassa, which had been 376 observed earlier too (65). Transgenic Arabidopsis thaliana plants expressing the DR5::GUS 377 fusion protein (39, 66) were incubated with water (Fig. 8A), 100 µM IAA (Fig. 8B), and 378 germinating wild-type ascospores (Fig. 8Ci–ii). Seedlings incubated with either IAA or 379 germinating ascospores showed positive staining for β-glucuronidase in cotyledon tips. 380 Because the expression of the fusion protein is auxin dependent, our data provide indirect 381 evidence for auxin production of germinating ascospores. Next, auxin was directly detected 382 by thin-layer chromatography (Fig. 8D). Fig. 9 shows the auxin concentrations in growth 383 medium from germinating macro conidia and germinating ascospores. Auxin concentrations 384 did not significantly differ in four-day-old mycelium, but we observed significant differences 385 between the germinating macroconidia in different strains. Compared to wild type, 386 overexpression of the full-length bem46 gene under control of the ccg-1 promoter did not 387 increase auxin concentration; however, the bem46 knock-out and RNAi lines showed 388 significantly increased auxin concentration. Auxin production was also investigated during 389 ascospore germination (Fig. 9B). Compared to wild type, no significant differences were 390 observed in the bem46 knock-out and RNAi strains, but the overexpressing lines showed 391 reduced indole production of germinating ascospores. 392

Investigating the indole production of germinating macroconidia also revealed 393 differences in the time-flow of macroconidia germination and in the rate of hyphal elongation. 394 The micrographs in Fig. 9C show that most wild-type macroconidia germinated after five 395 hours, while macroconidia of bem46-overexpressing lines germinated later. Macroconidia 396 from bem46 knock-outs germinated within five hours and produced longer germ tubes than 397


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

17

the wild type. Determining the growth rate of young hyphae within the first four days after 398 germination (Fig. 9D) clearly showed strongly inhibited hyphae elongation in the bem46-399 overexpression strain. In contrast, the knock-out and RNAi strains showed growth rates 400 somewhat higher than the wild type. 401 The MTR protein of N. crassa: a specific tryptophan transporter. The H+-driven 402 tryptophan and tyrosine permease TAT2 (YOL020W) of Saccharomyces cerevisiae is 403 reportedly localized in eisosomes (67). MTR (NCU06619) is a neutral amino acid transport 404 protein (68, 69) that we identified as the TAT2 homolog in N. crassa. We used qRT-PCR to 405 analyze MTR expression in the different bem46 transformant and mutant strains. Fig. 10A 406 shows a four-fold higher upregulation of the gene in the bem46-overexpression strain 407 (NcT288) compared to wild type. The subcellular localization of MTR was studied using a trfp 408 reporter gene construct. Fig. 10B shows the protein’s localization in the perinuclear ER and 409 in several additional small spots. The tRFP-coupled MTR protein showed co-localization with 410 the BEM46::eGFP protein in swollen and germinating macro conidiospores, and in mature 411 hyphae. 412 413 on M

arch 22, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

http://ec.asm.org/

18

DISCUSSION 414 BEM46 interacts with the anthranilate synthase. Here we identified the anthranilate 415 synthase encoded by the trp1 gene (51, 70) as an interacting partner of BEM46 in N. crassa. 416 This result was unexpected since, in other model organisms, BEM46 interacts with proteins 417 involved in developing/maintaining polar growth (10, 13, 71). Phenotypic analyses of the N. 418 crassa trp-1 mutant showed reduced ascospore germination, with spores developing the 419 same loss-of-polarity phenotype as described in the Δbem46 mutant (21). These results 420 suggested a situation similar to that in the model organism A. thaliana, where mutations in 421 the asa1 gene encoding anthranilate synthase result in a wavy root growth phenotype (72). 422 The same phenotype was observed in the bem46 homolog (wavy growth 2) knock-out 423 mutant (13). However, IAA was unable to rescue the wavy root phenotype in A. thaliana (72); 424 thus, we considered that BEM46 might influence polar growth through an effect on IAA 425 biosynthesis in the fungus. We observed that conidiospores of the ∆trp-1 mutant germinated 426 earlier and developed longer young hyphae than the wild type. The same effects were 427 previously reported following external addition of IAA in N. crassa (56, 59). Therefore, we 428 investigated the auxin biosynthesis and indole production of the different N. crassa bem46 429 mutant and transformant strains. 430

Auxin biosynthesis in Neurospora crassa and its connection to BEM46. 431 Although it is not widely known, auxin biosynthesis in fungi was already reported many 432 decades ago (61). This includes N. crassa (55, 65), and studies which investigated the 433 effects of externally applied auxins (58, 59). However, we only discovered this information 434 following our present analyses of indole production in N. crassa wild-type, bem46 knock-out, 435 RNAi, and overexpression lines. Recent research has mainly focused on the auxin 436 production of phytopathogenic fungi, e.g., Ustilago maydis, Fusarium species, or 437 Colletotrichum gloeosporioides (60, 62, 73–75). In these phytopathogenic fungi, auxin is 438 believed to affect host plant growth. In N. crassa, IAA at a concentration of 10−6 M enhanced 439 the conidia germination rate after two hours of incubation (56). At higher concentrations, an 440 inhibitory effect was shown. It was earlier reported (57) that IAA removed the “conidial 441


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

19

density effect” (76), and 10−6 M auxin reportedly induces elongation of young hyphae 442 germinating from conidia, while higher concentrations are inhibitory (59). 443

Here, using bioinformatics tools, we have presented evidence for a tryptophan-444 dependent IAA biosynthesis pathway in N. crassa. We showed that the expressions of the 445 three genes involved in this pathway (tam1, ipd, and iad) were altered in the different bem46 446 transformants and mutant strains, indicating a connection between bem46 and auxin 447 biosynthesis in the fungi. However, the effects of auxin and its connection to bem46 appear 448 to vary throughout different developmental stages of N. crassa. In germinating conidiospores, 449 bem46 downregulation led to iad1 overexpression and higher indole production, resulting in 450 earlier conidia germination and increased hyphal elongation. Interestingly, bem46 451 overexpression also led to very high iad1 expression. While indole content did not differ 452 compared to the wild type, conidia germination was delayed and hyphal elongation strongly 453 reduced, which may result from negative regulation, since high levels of IAA are inhibitory. 454

We further detected co-localization of BEM46 with the neutral amino acid transporter 455 MTR. BEM46 may act at the crossing point between tryptophan synthesis and uptake. 456 Indeed, mtr expression was significantly higher in the bem46-overexpressing strain, which 457 may lead to high internal levels of indole, resulting in the above-described inhibitory effects. 458 The indole production of vegetative mycelia of bem46 transformant and mutant strains didn’t 459 significantly differ compared to the wild type; however, the expressions of genes involved in 460 the putative auxin biosynthesis pathway were affected. It is possible that the indole content is 461 additionally regulated by inactivation of the end product, as described in A. thaliana (77). 462 bem46 alternative splicing. In multicellular organisms, alternative splicing is a 463 mechanism by which gene expression is regulated on the mRNA level (78). Alternative 464 splicing can affect the transcriptome both quantitatively and qualitatively, e.g., by degradation 465 of alternative spliced forms over the NMD pathway (79, 80). Such changes on the transcript 466 level can potentially affect almost all areas of protein function (78). The transcript isoforms 467 can be translated into various proteins with different sequences and/or domain arrangements 468 (81). The resulting truncated proteins can act as dominant negative regulators of the 469


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

20

authentic protein (82). Alternative splicing itself can be regulated by riboswitches or by 470 different environmental cues (83, 84), thus making alternative splicing a flexible tool that 471 allows better adaptation to environment (85). Alternative splicing also occurs in ascomycetes, 472 although at a significant lower rate than in mammals (45). In N. crassa, 162 of 9733 protein 473 coding genes exhibit evidence of alternative splicing. The most common form of alternative 474 splicing in fungi is intron retention (45). 475

In the present study, we identified 0.5- and 1.2-kb-long alternative spliced bem46 476 fragments that encoded truncated proteins of 123 and 40 amino acids, respectively. There 477 are two main reasons to assume that these are alternative splicing products rather than 478 splicing intermediates. First, if they were splicing intermediates, the fragments would have 479 been detected in the wild-type strains, but this was not the case in our investigations. 480 Second, the fragment sequences were not simple combination of exons; the 1.2-kb product 481 resulted from intron retention (the most common method of alternative splicing in fungi), 482 while the 0.5-kb product showed a completely unusual splicing pattern that didn’t match any 483 splicing intermediate. The alternative spliced fragments accumulated in the bem46 RNAi 484 lines (21), which exhibited no ascospore germination. Since overexpression of both full-485 length and truncated BEM46 protein still led to loss of ascospore germination, it is possible 486 that the alternative spliced fragments (or rather the translated truncated proteins) act as 487 dominant competitors of the full-length protein. This would explain how overexpression of the 488 small fragments leads to the same effect as overexpression of the full-length protein, i.e., the 489 inhibition of ascospore germination. 490

It remains unknown how BEM46 may influence the mechanism of ascospore 491 germination. Indole production was reduced in the ascospores from strains overexpressing 492 either the full-length or truncated BEM46 proteins. Hence, it is possible that BEM46 directly 493 affects indole production, which negatively influences the ascospore germination. However, 494 indole production of the RNAi and knock-out strains did not significantly differ from that of the 495 wild type. With the knock-out strain, a considerable amount of ascospore will normally 496 germinate, and even in the RNAi strain, one out of a few thousand ascospores may 497


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

21

germinate (21). It is possible that indole production of these germinated spores could falsify 498 the measurement of indole content. This may also explain the relatively high standard 499 deviation found for indole production of these strains. Alternatively, the effect of the truncated 500 BEM46 proteins may be caused by its apparently different cellular localization. 501

The presently described qRT-PCR studies were focused on the ipd pathway, which 502 was identified using a bioinformatic approach. However, additional biosynthetic pathways for 503 indole production may also be relevant. Ongoing bioinformatic analyses indicate the potential 504 presence of several possible auxin biosynthetic pathways in N. crassa (Sardar, in 505 preparation), some of which may share the last aldehyde dehydrogenase encoded by iad. 506 The co-existence of different pathways resulting in the same final product may enable 507 precise regulation of the internal auxin level, which is preferable considering the fact that the 508 effect of auxin is concentration dependent. Phytosphingosine treatment—which induces 509 programmed cell death in N. crassa—strongly upregulates iad1, and slightly upregulates 510 bem46 expression (86). This could suggest the involvement of the two gene products in 511 general stress response reactions. 512

The determination of germination and hyphal elongation is a critical point in the life of 513 an ascomycete, and is strongly dependent on the variable environment of the fungus. 514 Therefore, flexible and effective regulation of these processes is required. It appears possible 515 that one aspect of this mechanism may include regulation of the internal indole level of the 516 fungus, which results from uptake as well as intracellular production. Our present results 517 indicate that BEM46 may act at the crossing point of this regulation. 518 519 ACKNOWLEDGEMENTS 520 We thank H. Schmidt and J. Quintanilla (Kiel) for technical assistance. We thank S. Seiler 521 (Freiburg) for providing an N. crassa cDNA library, A. Lichius (Vienna) for the Lifeact-RFP 522 vector, U. Kück (Bochum) for providing split-YFP vectors and also for critical discussion. We 523 are grateful to the Fungal Genetics Stock Center for providing Neurospora strains, as well as 524 to the “Labor für Molekulare Biowissenschaften”, and the “Zentralen Mikroskopie” of the 525


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

22

Christian-Albrechts-University for use of equipment. This publication is dedicated to Karl 526 Esser on the occasion of his 90th birthday for his lifetime contributions to fungal genetics. 527


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

23

REFERENCES 528 1. Valencik M, Pringle J. 1995. Schizosaccharomyces pombe bem1/ bud5 suppressor 529

(bem46) mRNA. In. EMBL database, Access. number U29892. 530 2. Kumar A, Kollath-Leiß K, Kempken F. 2013. Characterization of bud emergence 46 531

(BEM46) protein: sequence, structural, phylogenetic and subcellular localization 532 analyses. Biochem. Biophys. Res. Commun. 438:526–32. 533

3. Cabib E, Drgonova J, Drgon T. 1998. Role of small G proteins in yeast cell 534 polarization and wall biosynthesis. Annu. Rev. Biochem. 67:307–333. 535

4. Madden K, Snyder M. 1998. Cell polarity and morphogenesis in budding yeast. Annu. 536 Rev. Microbiol. 52:687–744. 537

5. Park HO, Bi E, Pringle JR, Herskowitz I. 1997. Two active states of the Ras-related 538 Bud1/Rsr1 protein bind to different effectors to determine yeast cell polarity. Proc. 539 Natl. Acad. Sci. U. S. A. 94:4463–8. 540

6. Chenevert J, Corrado K, Bender A, Pringle J, Herskowitz I. 1992. A yeast gene 541 (BEM1) necessary for cell polarization whose product contains two SH3 domains. 542 Nature 356:77–79. 543

7. Irazoqui JE, Gladfelter AS, Lew DJ. 2003. Scaffold-mediated symmetry breaking by 544 Cdc42p. Nat. Cell Biol. 5:1062–70. 545

8. Chant J, Corrado K, Pringle JR, Herskowitz I. 1991. Yeast BUD5 , encoding a 546 putative GDP-GTP exchange factor , is necessary for bud site selection and interacts 547 with bud formation gene BEM1. Cell 65:1213–1224. 548

9. Giaever G, Chu AM, Ni L, Connelly C, Riles L, Véronneau S, Dow S, Lucau-Danila 549 A, Anderson K, André B, Arkin AP, Astromoff A, El-Bakkoury M, Bangham R, 550


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

24

Benito R, Brachat S, Campanaro S, Curtiss M, Davis K, Deutschbauer A, Entian 551 K-D, Flaherty P, Foury F, Garfinkel DJ, Gerstein M, Gotte D, Güldener U, 552 Hegemann JH, Hempel S, Herman Z, Jaramillo DF, Kelly DE, Kelly SL, Kötter P, 553 LaBonte D, Lamb DC, Lan N, Liang H, Liao H, Liu L, Luo C, Lussier M, Mao R, 554 Menard P, Ooi SL, Revuelta JL, Roberts CJ, Rose M, Ross-Macdonald P, 555 Scherens B, Schimmack G, Shafer B, Shoemaker DD, Sookhai-Mahadeo S, 556 Storms RK, Strathern JN, Valle G, Voet M, Volckaert G, Wang C, Ward TR, 557 Wilhelmy J, Winzeler E a, Yang Y, Yen G, Youngman E, Yu K, Bussey H, Boeke 558 JD, Snyder M, Philippsen P, Davis RW, Johnston M. 2002. Functional profiling of 559 the Saccharomyces cerevisiae genome. Nature 418:387–91. 560

10. Giot L, Bader JS, Brouwer C, Chaudhuri A, Kuang B, Li Y, Hao YL, Ooi CE, 561 Godwin B, Vitols E, Vijayadamodar G, Pochart P, Machineni H, Welsh M, Kong Y, 562 Zerhusen B, Malcolm R, Varrone Z, Collis a, Minto M, Burgess S, McDaniel L, 563 Stimpson E, Spriggs F, Williams J, Neurath K, Ioime N, Agee M, Voss E, Furtak 564 K, Renzulli R, Aanensen N, Carrolla S, Bickelhaupt E, Lazovatsky Y, DaSilva a, 565 Zhong J, Stanyon C a, Finley RL, White KP, Braverman M, Jarvie T, Gold S, 566 Leach M, Knight J, Shimkets RA, McKenna MP, Chant J, Rothberg JM. 2003. A 567 protein interaction map of Drosophila melanogaster. Science 302:1727–36. 568

11. Parmentier ML, Woods D, Greig S, Phan PG, Radovic A, Bryant P, O’Kane CJ. 569 2000. Rapsynoid/partner of inscuteable controls asymmetric division of larval 570 neuroblasts in Drosophila. J. Neurosci. 20:RC84. 571

12. Okada K, Shimura Y. 1990. Reversible root tip rotation in Arabidopsis seedlings 572 induced by obstacle-touching stimulus. Science 250:274–6. 573

13. Mochizuki S, Harada A, Inada S, Sugimoto-Shirasu K, Stacey N. 2005. The 574 Arabidopsis WAVY GROWTH 2 protein modulates root bending in response to 575 environmental stimuli. Plant Cell 17:537–547. 576


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

25

14. Ollis DL, Cheah E, Cyglerl M, Dijkstra B, Frolow F, Franken SM, Harel M, 577 Remington SJ, Silman I, Schragl J, Sussman JL, Goldmans A. 1992. The α / β 578 hydrolase fold. Protein Eng. 5:197–211. 579

15. Nardini M, Dijkstra BW. 1999. α / β Hydrolase fold enzymes: the family keeps 580 growing. Curr. Opin. Struct. Biol. 9:732–737. 581

16. Lenfant N, Hotelier T, Velluet E, Bourne Y, Marchot P, Chatonnet A. 2013. 582 ESTHER, the database of the α/β-hydrolase fold superfamily of proteins: tools to 583 explore diversity of functions. Nucleic Acids Res. 41:D423–9. 584

17. Hotelier T, Renault L, Cousin X, Negre V, Marchot P, Chatonnet A. 2004. 585 ESTHER, the database of the alpha/beta-hydrolase fold superfamily of proteins. 586 Nucleic Acids Res. 32:D145–7. 587

18. Galperin MY, Koonin E V. 2004. “Conserved hypothetical” proteins: prioritization of 588 targets for experimental study. Nucleic Acids Res. 32:5452–63. 589

19. Galperin MY, Koonin E V. 2010. From complete genome sequence to “complete” 590 understanding? Trends Biotechnol. 28:398–406. 591

20. Fischer R, Zekert N, Takeshita N. 2008. Polarized growth in fungi-interplay between 592 the cytoskeleton, positional markers and membrane domains. Mol. Microbiol. 68:813–593 26. 594

21. Mercker M, Kollath-Leiß K, Allgaier S, Weiland N, Kempken F. 2009. The BEM46-595 like protein appears to be essential for hyphal development upon ascospore 596 germination in Neurospora crassa and is targeted to the endoplasmic reticulum. Curr 597 Genet 55:151–161. 598


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

26

22. Vogel HJ. 1956. A convenient growth medium for Neurospora (Medium N). Microbiol. 599 Genet. Bull. 13:42–43. 600

23. Westergaard M, Mitchell HK. 1947. Neurospora V. A synthetic medium favoring 601 sexual reproduction. Amer. J. Bot. 34:573–577. 602

24. Fleissner A, Diamond S, Glass NL. 2009. The Saccharomyces cerevisiae PRM1 603 homolog in Neurospora crassa is involved in vegetative and sexual cell fusion events 604 but also has postfertilization functions. Genetics 181:497–510. 605

25. Borges MI, Azevedo MO, Bonatelli R, Felipe MSS, Astolfi-Filho S. 1990. A 606 practical method for preparation of total DNA from filamentous fungi. Fungal Genet. 607 Newsl. 37:10. 608

26. Hoffman CS, Winston F. 1987. A ten-minute DNA preparation from yeast efficiently 609 releases autonomous plasmids for trausformation of Escherichia coli. Gene 57:267–610 272. 611

27. Kempken F, Kück U. 1996. Restless, an active Ac-like transposon from the fungus 612 Tolypocladium inflatum: structure, expression, and alternative RNA splicing. Mol Cell 613 Biol 16:6563–6572. 614

28. Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning. A laboratory manual. 615 Cold Spring Harbor Lab Press. 616

29. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-617 time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402–8. 618

30. Margolin B, Freitag M, Selker EU. 1997. Improved plasmids for gene targeting at the 619 his-3 locus of Neurospora crassa by electroporation. Fungal Genet. Newsl. 44:34–36. 620


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

27

31. Margolin B, Freitag M, Selker EU. 2000. Improved plasmids for gene targeting at the 621 his-3 locus of Neurospora crassa by electroporation: correction. Fungal Genet. Newsl. 622 47:112. 623

32. Hickey PC, Swift SR, Roca MG, Read ND. 2004. Live-cell imaging of filamentous 624 fungi using vital fluorescent dyes. In Methods in Microbiology. Vol. 34. Microbial 625 Imaging (ed. By T. Savidge C. Pothoulakis) , pp. 63-87. Elsevier: Amsterdam 626

33. Hoff B, Kück U. 2005. Use of bimolecular fluorescence complementation to 627 demonstrate transcription factor interaction in nuclei of living cells from the filamentous 628 fungus Acremonium chrysogenum. Curr. Genet. 47:132–8. 629

34. Berepiki A, Lichius A, Shoji J-Y, Tilsner J, Read ND. 2010. F-actin dynamics in 630 Neurospora crassa. Eukaryot. Cell 9:547–57. 631

35. Colot H V., Gyungsoon P, Turner GE, Ringelberg C, Crew CM, Litvinkova L, 632 Weiss RL, Borkovich KA, Dunlap JC. 2006. A high-throughput gene knockout 633 procedure for Neurospora reveals functions for multiple transcription factors. Proc. 634 Natl. Acad. Sci. U. S. A. 103:10352–10357. 635

36. Chien CT, Bartel PL, Sternglanz R, Fields S. 1991. The two-hybrid system: a 636 method to identify and clone genes for proteins that interact with a protein of interest. 637 Proc. Natl. Acad. Sci. U. S. A. 88:9578–82. 638

37. Fields S, Song O. 1989. A novel genetic system to detect protein-protein interactions. 639 Nature 340:245–246. 640

38. Breeden L, Nasmyth K. 1985. Regulation of the Yeast HO Gene. Cold Spring Harb. 641 Symp. Quant. Biol. 50:643–650. 642


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

28

39. Ulmasov T, Murfett J, Hagen G, Guilfoyle TJ. 1997. Aux/lAA proteins repress 643 expression of reporter genes containing natural and highly active synthetic auxin 644 response elements. Plant Cell 9:1963–1971. 645

40. Weigel D, Glazebrook J. 2002. Arabidopsis: A laboratory manual. Cold Spring Harbor 646 Lab Press. 647

41. Murashige T, Skoog F. 1962. A revised medium for rapid growth and bio assays with 648 tobacco tissue cultures. Physiol. Plant. 15:473–497. 649

42. Glickmann E, Dessaux Y. 1995. A critical examination of the specificity of the 650 salkowski reagent for indolic compounds produced by phytopathogenic bacteria. Appl. 651 Environ. Microbiol. 61:793–6. 652

43. Gordon SA, Weber RP. 1950. Colorimetric estimation of indole acetic acid. Plant 653 Physiol. 26:192–195. 654

44. Ehmann A. 1977. The van URK-Salkowski reagent - a sensitive and specific 655 chromogenic reagent for silica gel thin-layer chromatographic detection and 656 identification of indole derivatives. J. Chromatogr. 132:267–276. 657

45. Kempken F. 2013. Alternative splicing in ascomycetes. Appl. Microbiol. Biotechnol. 658 97:4235–41. 659

46. Temporini ED, Alvarez ME, Mautino MR, Folco HD, Rosa AL. 2004. The 660 Neurospora crassa cfp promoter drives a carbon source-dependent expression of 661 transgenes in filamentous fungi. J. Appl. Microbiol. 96:1256–64. 662

47. Aramayo R, Metzenberg RL. 1996. Gene replacements at the his-3 locus of 663 Neurospora crassa. Fungal Genet Newsl 43:9–13. 664


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

29

48. Kolláth-Leiß K, Kempken F. 2012. Bem46-Homologe: bekannte Proteine mit 665 unbekannter Funktion. Biospektrum 18:251–253. 666

49. Walther TC, Brickner JH, Aguilar PS, Bernales S, Pantoja C, Walter P. 2006. 667 Eisosomes mark static sites of endocytosis. Nature 439:998–1003. 668

50. Vangelatos I, Roumelioti K, Gournas C, Suarez T, Scazzocchio C, 669 Sophianopoulou V. 2010. Eisosome organization in the filamentous ascomycete 670 Aspergillus nidulans. Eukaryot. Cell 9:1441–54. 671

51. Walker MS, DeMoss JA. 1986. Organization of the functional domains of anthranilate 672 synthase from Neurospora crassa. Limited proteolysis studies. J. Biol. Chem. 673 261:16073–7. 674

52. Fischer-Harman V, Jackson KJ, Muñoz A, Shoji J, Read ND. 2012. Evidence for 675 tryptophan being a signal molecule that inhibits conidial anastomosis tube fusion 676 during colony initiation in Neurospora crassa. Fungal Genet. Biol. 49:896–902. 677

53. Radwanski ER, Last RL. 1995. Tryptophan biosynthesis and metabolism: 678 Biochemical and molecular genetics. Plant Cell 7:921–934. 679

54. Mano Y, Nemoto K. 2012. The pathway of auxin biosynthesis in plants. J. Exp. Bot. 680 63:2853–72. 681

55. Gruen HE. 1959. Auxins and fungi. Ann Rev Plant Physiol 10:405–440. 682 56. Nakamura T, Kawanabe Y, Takiyama E, Takahashi N. 1978. Effects of auxin and 683

gibberellin on conidial germination in Neurospora crassa 19:705–709. 684 57. Nakamura T, Tomita K, Kawanabe Y. 1982. Effect of auxin and gibberellin on 685

conidial germination in Neurospora crassa II. “ Conidial density effect ” and auxin 686 23:1363–1369. 687


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

30

58. Nakamura T, Saotome M, Murayamaz T. 1988. Effects of auxin and gibberellin on 688 conidial germination and elongation of young hyphae in a cyclic 3’:5' adenosine 689 monophosphate-dependent protein kinase mutant of Neurospora crassa 207:201–690 207. 691

59. Tomita K, Murayama T, Nakamura T. 1984. Effects of auxin and gibberellin on 692 elongation of young hyphae in Neurospora crassa. Plant Cell Physiol. 25:355–358. 693

60. Basse CW, Lottspeich F, Steglich W, Kahmann R. 1996. Two potential indole-3-694 acetaldehyde dehydrogenases in the phytopathogenic fungus Ustilago maydis. Eur. J. 695 Biochem. 242:648–56. 696

61. Grün EH. 1959. Auxin and fungi. Annu. Rev. Plant Physiol. 10:405–440. 697 62. Tsavkelova E, Oeser B, Oren-Young L, Israeli M, Sasson Y, Tudzynski B, Sharon 698

A. 2012. Identification and functional characterization of indole-3-acetamide-mediated 699 IAA biosynthesis in plant-associated Fusarium species. Fungal Genet. Biol. 49:48–57. 700

63. Mashiguchi K, Tanaka K, Sakai T, Sugawara S, Kawaide H, Natsume M. 2011. 701 The main auxin biosynthesis pathway in Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 702 108:18512–18517. 703

64. Zuther K, Mayser P, Hettwer U, Wu W, Spiteller P, Kindler BLJ, Karlovsky P, 704 Basse CW, Schirawski J. 2008. The tryptophan aminotransferase Tam1 catalyses 705 the single biosynthetic step for tryptophan-dependent pigment synthesis in Ustilago 706 maydis. Mol. Microbiol. 68:152–72. 707

65. Tomita K, Kitsuwa T, Murayama T and Nakamura T, 1987. Identification of Indol-3-708 acetic acid in Neurospora crassa. Agric. Biol. Chem. 51:2633–2634. 709

66. Pozhvanov GA., Shavarda AL, Medvedev SS. 2013. Quantitative analysis of IAA in 710 DR5::GUS transgenic Arabidopsis plants. Russ. J. Plant Physiol. 60:431–436. 711


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

31

67. Grossmann G, Malinsky J, Stahlschmidt W, Loibl M, Weig-Meckl I, Frommer WB, 712 Opekarová M, Tanner W. 2008. Plasma membrane microdomains regulate turnover 713 of transport proteins in yeast. J. Cell Biol. 183:1075–88. 714

68. Stadler DR. 1966. Genetic control of the uptake of amino acids in Neurospora. 715 Genetics 54:677–685. 716

69. Stadler DR. 1967. Suppressors of amino acid uptake mutants of Neurospora. 717 Genetics 57:935–942. 718

70. Walker MS, DeMoss JA. 1983. Purification and characterization of the trifunctional 719 beta-subunit of anthranilate synthase from Neurospora crassa. J. Biol. Chem. 720 258:3571–5. 721

71. Mercker M, Kollath-Leiss K, Allgaier S, Weiland N, Kempken F. 2009. The BEM46-722 like protein appears to be essential for hyphal development upon ascospore 723 germination in Neurospora crassa and is targeted to the endoplasmic reticulum. Curr. 724 Genet. 55:151–61. 725

72. Rutherford R, Gallois P, Masson PH. 1998. Mutations in Arabidopsis thaliana genes 726 involved in the tryptophan biosynthesis pathway affect root waving on tilted agar 727 surfaces. Plant J. 16:145–54. 728

73. Reineke G, Heinze B, Schirawski J, Buettner H, Kahmann R, Basse CW. 2008. 729 Indole-3-acetic acid (IAA) biosynthesis in the smut fungus Ustilago maydis and its 730 relevance for increased IAA levels in infected tissue. Mol. Plant Pathol. 9:339–355. 731

74. Robinson M, Riov J, Sharon A. 1998. Indole-3-acetic acid biosynthesis in 732 Colletotrichum gloeosporioides f. sp. aeschynomene. Appl. Environ. Microbiol. 733 64:5030–2. 734


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

32

75. Kulkarni GB, Sanjeevkumar S, Kirankumar B, Santoshkumar M, Karegoudar TB. 735 2013. Indole-3-acetic acid biosynthesis in Fusarium delphinoides strain GPK, a causal 736 agent of wilt in chickpea. Appl. Biochem. Biotechnol. 169:1292–305. 737

76. Schmit JC, Brody S. 1976. Biochemical genetics of Neurospora crassa conidial 738 germination. Bacteriol. Rev. 40:1–41. 739

77. Woodward AW, Bartel B. 2005. Auxin: regulation, action, and interaction. Ann. Bot. 740 95:707–35. 741

78. Roy B, Haupt LM, Griffiths LR. 2013. Review: Alternative splicing (AS) of genes as 742 an approach for generating protein complexity. Curr. Genomics 14:182–94. 743

79. McGlincy NJ, Smith CWJ. 2008. Alternative splicing resulting in nonsense-mediated 744 mRNA decay: what is the meaning of nonsense? Trends Biochem. Sci. 33:385–93. 745

80. Nicholson P, Mühlemann O. 2010. Cutting the nonsense: the degradation of PTC-746 containing mRNAs. Biochem. Soc. Trans. 38:1615–20. 747

81. Syed NH, Kalyna M, Marquez Y, Barta A, Brown JWS. 2012. Alternative splicing in 748 plants-coming of age. Trends Plant Sci. 17:616–23. 749

82. Seo PJ, Kim MJ, Ryu J-Y, Jeong E-Y, Park C-M. 2011. Two splice variants of the 750 IDD14 transcription factor competitively form nonfunctional heterodimers which may 751 regulate starch metabolism. Nat. Commun. 2:303. 752

83. Leal J, Squina FM, Freitas JS, Silva EM, Ono CJ, Martinez-Rossi NM, Rossi A. 753 2009. A splice variant of the Neurospora crassa hex-1 transcript, which encodes the 754 major protein of the Woronin body, is modulated by extracellular phosphate and pH 755 changes. FEBS Lett. 583:180–4. 756


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

33

84. Brunner M, Diernfellner A. 2006. How temperature affects the circadian clock of 757 Neurospora crassa. Chronobiol. Int. 23:81–90. 758

85. Kazan K. 2003. Alternative splicing and proteome diversity in plants: the tip of the 759 iceberg has just emerged. Trends Plant Sci. 8:468–71. 760

86. Videira A, Kasuga T, Tian C, Lemos C, Castro A, Glass NL. 2009. Transcriptional 761 analysis of the response of Neurospora crassa to phytosphingosine reveals links to 762 mitochondrial function. Microbiology 155:3134–41. 763

764


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

34

FIGURE LEGENDS 765 766 FIG 1 Ascospore germination of different N. crassa strains, with germination rates expressed 767 in relation to that of the wild-type strain (100%). wt: FGSC #6013 × FGSC #9016; OE: 768 overexpression transformant strain; ko: knock-out mutant strain; RNAi: RNAi directed knock-769 down transformant strain; 0.5 kb: transformant strain containing the 0.5-kb-long alternative 770 spliced product of bem46; 1.2 kb: transformant strain containing the 1.2-kb-long alternative 771 spliced product of bem46. Strains were crossed with histidine auxotrophic strains FGSC 772 #6103 and 9716. Statistical analysis was accomplished with SigmaPlot12. Two asterisks 773 indicate a p-value <0.01. 774 775 FIG 2 Alternative splicing of bem46 in N. crassa. (A) RT-PCR amplification of different 776 alternative spliced bem46 fragments, using cDNA from different strains and tissues as 777 template. In addition to the full-length cDNA (0.9-kb) sequence, two alternative fragments 778 (1.2 kb and 0.5 kb; black and white arrows) were amplified using bem46-specific 779 oligonucleotides. myc.: mycelium; mcon: macroconidia; wt: wild-type strain; RNAi: bem46 780 knock-down strain. (B) Schematic presentation of different spliced products of bem46. The 781 bem46 genomic DNA sequence consists of four exons divided by three introns (DNA). In 782 most cases, splicing resulted in a 0.9-kb mRNA fragment (spliced mRNA). Two other bem46 783 mRNA variations were generated by alternative splicing, i.e., 1.2 kb (retains intron 1) and 0.5 784 kb in (using 5´alternate splice site of intron 3) RNAi line). Exons shown as grey and introns 785 as black rectangles. The intron 3 resulting from using an alternate 5´ site is shown as a black 786 rectangle with with borders. 787 788 FIG 3 Subcellular localization of BEM46 and its derivates. (A) Confocal laser scanning 789 microscopy (CLSM) images of a swollen macroconidiospore from a strain overexpressing the 790 BEM46::eGFP fusion protein, observed over 15 minutes. The time-point of each shot is 791 presented, with 0 sec indicating the start of the investigation. (B) CLSM images of 792


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

35

germinating macroconidiospores of a heterokaryon overexpressing both BEM46::eGFP and 793 PIlA::tRFP fusion proteins. (C) CLSM images of germinating macroconidiospores of a 794 heterokaryon overexpressing both 0.5kb::eGFP and PIlA::tRFP fusion proteins. merge: 795 overlay of eGFP and tRFP fluorescence. 796 797 FIG 4 Yeast two-hybrid approach. (A) Control experiment, confirming the interaction between 798 BEM46 (bait) and the anthranilate synthase (prey) in a colony expressing cDNA-1 (see Fig. 799 4B). pGBkT7 and pGADT7empty expression vectors used in the yeast two-hybrid system. 800 (B) Schematic presentation of the four cDNA fragments (cDNA1–4) that encode putative 801 interacting partners of BEM46, as identified by the yeast two-hybrid approach. All fragments 802 belong to the same trp-1 gene, encoding the β-subunit of the anthranilate synthase complex 803 II. G, C, and F are subdomains of the anthranilate synthase. 804 805 FIG 5 Bimolecular fluorescence complementation assay. (A) N. crassa transformant strain 806 overexpressing the BEM46 protein coupled with the C-terminal portion of the eYFP protein. 807 (B) N. crassa transformant strain overexpressing the putative interaction partner (anthranilate 808 synthase; AS; identified by yeast two-hybrid approach) fused to the N-terminal portion of the 809 eYFP protein. (C) Macroconidia of N. crassa strains overexpressing both BEM46::eYFP-C 810 and AS::eYFP-N vectors. (i) CLSM images (ii,) Calculated bright fields. 811 812 FIG 6 Analysis of the ∆trp1 strain (FGSC #20870/20871). (A) Bright field images of single 813 germinating ascospores of the trp1 knock-out strain. The blue arrow indicates an ascospore 814 developing the typical loss-of-polarity phenotype that has been formerly reported for the 815 bem46 transformants (21). (B) Wild-type germination. (C) Ascospore germination rate of the 816 ∆trp-1 mutant compared to wild type. (D, E) Indole production of germinating ascospores and 817 conidiospores, respectively, compared to the wild type. 818 819


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

36

FIG 7 qRT-PCR results showing the relative expressions of the three genes involved in a 820 putative auxin biosynthesis pathway of N. crassa, evaluated in different bem46 transformant 821 and mutant strains. The transcript quantities were calculated relative to the housekeeping 822 gene tub2. NcT288: bem46-overexpressing strain; NcT289: bem46 RNAi strain; NcT411: 823 bem46 knock-out strain; NcT419: strain overexpressing the 0.5-kb bem46 alternative spliced 824 fragment. 825 826 FIG 8 (A–C) Bright field images of Arabidopsis thaliana seedlings expressing the auxin-827 responsive DR5::GUS fusion construct, incubated with water as negative control (A), indole 828 acetic acid as positive control (B), or germinating ascospores of N. crassa wild type (C). (D) 829 Thin-layer chromatographic separation of indole acetic acid from culture medium on a silica 830 plate. IAA: indole acetic acid; M: medium incubated without fungus; wt: medium incubated 831 with wild-type N. crassa; bem46-ko: medium incubated with N. crassa bem46 knock-out 832 mutant. 833 834 FIG 9 Indole production of bem46 mutant and transformant strains. (A–B) Whole indole 835 content produced by germinating conidiospores (A) and ascospores (B). Whole indole 836 content of the medium relative to the wild type (=1). (C) Bright field images of germinating 837 conidiospores, incubated for 4 h at 30°C on agar plates with Vogel’s minimal medium. 838 Macroconidia of the wild-type (wt), knock-out (ko), knock-down (RNAi), and overexpressing 839 (OE) strains. (D) Hyphal elongation of the bem46 transformant and mutant strains. The 840 elongation rate is defined as the growth distance (cm) in one day. 841 842 FIG 10 MTR is a putative tryptophan transporter. (A) qRT-PCR results showing the relative 843 expression of the mtr gene in different bem46 transformant and mutant strains of N. crassa. 844 The transcript quantities were calculated relative to the housekeeping gene tub2. NcT288: 845 bem46-overexpressing strain; NcT289: bem46 RNAi strain; NcT411: bem46 knock-out strain; 846 NcT419: strain overexpressing the 0.5-kb bem46 alternative spliced fragment (B) Co-847


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

37

localization of MTR and BEM46 fusion proteins. CLSM images of macroconidiospores and 848 germinating macroconidiospores of heterokaryon overexpressing both MTR::tRFP and 849 BEM46::eGFP proteins. 850


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

Downloaded from //ec.asm.org/content/eukcell/early/2014/06/10/EC.00061-14.full.pdfsuz as template...

Documents

Transcript of Downloaded from //ec.asm.org/content/eukcell/early/2014/06/10/EC.00061-14.full.pdfsuz as template...