Down-regulation of Cinnamoyl-CoA Reductase induces significant changes of lignin profiles in...

The Plant Journal (1998) 13(1), 71–83

Down-regulation of Cinnamoyl-CoA Reductase inducessignificant changes of lignin profiles in transgenic tobaccoplants

Joel Piquemal1, Catherine Lapierre2, Kate Myton1,

Ann O’Connell3, Wolfgang Schuch3,

Jacqueline Grima-Pettenati1,* and Alain-M. Boudet1

1Signaux et Messages Cellulaires chez les Vegetaux,

UMR CNRS-UPS no5546, Universite Paul Sabatier,

118 route de Narbonne, 31062 Toulouse cedex, France,2INRA Paris-Grignon, Laboratoire de chimie biologique

78 850 Thiverval Grignon, France, and3Zeneca Seeds, Plant Biotechnology Section, Jealott’s Hill

Research Station, Bracknell RG12 6EY, UK

Summary

Taking advantage of the recent characterization of the

cDNA encoding cinnamoyl-CoA reductase (CCR, E.C.

1.2.1.44) in Eucalyptus gunnii, antisense constructs have

been introduced in tobacco plants in order to down-

regulate this key enzyme of lignification. Primary trans-

formants exhibiting reduction in CCR activity were

obtained and a good correlation was observed between

the decrease in the steady state level of CCR mRNA and

the level of CCR activity. Lignin content and composition

were examined in the progeny of primary transformants

down-regulated for CCR activity and exhibiting one single

T-DNA integration locus. All CCR down-regulated lines

display common features, such as an orange brown colora-

tion of the xylem cell walls, an increase in the syringyl

over guaiacyl (S/G) ratio, and the presence of unusual

cell wall bound phenolics. Moreover, the less severely

depressed lines exhibited a normal phenotype and a very

slight reduction of the thioacidolysis yield, which is an

indication of the abundance of the β-O-4 linkages in lignin.

The new lignin profiles observed in these lines support a

role for CCR down-regulation in improving wood proper-

ties of forest trees used in the pulp industry. On the other

hand, the line with the most severely depressed CCR

activity exhibited a strong reduction in lignin content

together with altered development (reduced size, abnor-

mal morphology of the leaves, collapsed vessels). This

new lignin mutant offers an unique opportunity to explore

the various roles of lignins in plant development.

Introduction

The plant cell wall, which has long been considered a

largely inert structural entity, is now receiving increasing

Received 16 April 1997; revised 9 September 1997; accepted 18

September 1997.

*For correspondence (fax 133 6155 6210; e-mail [email protected]).

© 1998 Blackwell Science Ltd 71

attention due to a growing appreciation of its unique role

in plant development and survival (Bolwell, 1993; Carpita

et al., 1996; Roberts, 1990). Moreover, since plant cell walls

have a major impact on the utilization of plants by mankind,

a growing number of biotechnological strategies are dir-

ected towards introducing significant changes in their

composition and properties.

Lignins, a major component of secondary cell walls, are

heterogeneous tridimensional phenolic polymers resulting

from the oxidative polymerization of at least two of the

three following cinnamyl alcohols, also called monolignols:

p-coumaryl, coniferyl and sinapyl alcohols, giving rise to

hydroxyphenyl (H), guaiacyl (G) or syringyl (S) lignin types,

respectively. Their deposition occurs in the walls of certain

specialized cells such as tracheary elements leading to

dramatic variations in cell wall properties providing addi-

tional strength and water impermeability. These phenolic

compounds therefore play important roles in water and

nutrient conduction as well as in structural support. In

addition, lignins can be synthesized in response to various

environmental cues such as mechanical stress or pathogen

attacks (Vance et al., 1980). Lignins also participate in

more discrete processes which are important for correct

functioning of plant systems. For example, it has been

demonstrated recently that casparian strips which interrupt

the passive diffusion of ions across root apoplasts are

enriched in lignins (Schreiber, 1996). As outlined by Lewis

and Davin (1994), the ability to synthesize lignins has

undoubtedly been a decisive factor in the successful land

colonization by plants. Indeed, lignins are present in all

vascular plants including the most primitive tracheophytes,

the pteridophytes.

The presence of lignins in tree species has special indus-

trial significance since a large part of wood harvested is

processed for pulp and paper. Since lignins have a negative

impact on both pulp quality and yield, they are usually

removed from cellulose through chemical treatments

which are not only costly and energy consuming but also

environmentally hazardous. Therefore, the capability of

genetically altering commercially important tree species in

order to improve the delignification process is of consider-

able interest for the paper manufacturing industry. As

outlined by Sederoff et al. (1994), even small improvements

in the economies of wood processing will be valuable

because of the large scale of the industries.

One route of achieving this can be to alter lignin biosyn-

thesis in order to decrease the lignin content and/or to

72 Joel Piquemal et al.

modify the monomeric composition of the polymer, which

is also an important determinant of pulping characteristics

(Chiang et al., 1988).

As the first step committed to the lignin branch pathway,

cinnamoyl-CoA reductase (CCR) may be considered as a

potential control point regulating the carbon flux towards

lignins, and therefore its down-regulation could affect the

lignin content. Hitherto, this hypothesis could not be tested

due to the lack of a molecular probe for this enzyme. We

have recently cloned the first cDNA encoding CCR in our

target plant eucalyptus, a woody angiosperm of great

economic importance (Lacombe et al., 1997). This has

allowed the subsequent isolation of the corresponding

cDNA in tobacco (O’Connell et al., in preparation). Since

eucalyptus transformation is not yet a routine procedure

(Teulieres et al., 1994), and recent studies have shown the

utility of tobacco as a model plant for lignin genetic

engineering experiments, we have evaluated the effect of

CCR down-regulation in tobacco.

Here, we report that significant down-regulation of

tobacco CCR activity has been obtained through ectopic

expression of homologous antisense genes. All CCR down-

regulated tobacco plants exhibit an increased syringyl over

guaiacyl (S/G) ratio mainly due to a decrease in G units,

suggesting a potential improvement of lignin profiles in

terms of pulp making. Among the range of CCR-depleted

plants, the most inhibited one exhibits a dramatic reduction

of lignin content. The metabolic changes accompanying

this severe reduction of CCR activity induce several mor-

phological alterations. The characteristics of this new lignin

mutant demonstrate that a sufficient amount of lignins is

crucial for normal plant development.

Results

Construction of CCR antisense vectors

For downregulating CCR gene expression in tobacco we

used three different antisense constructs, depicted in

Figure 1. The full length homologous tobacco cDNA was

inserted in reverse orientation under the control of the

CaMV 35S promoter (Construct B).

The transcriptional activity of the CaMV 35S promoter

containing a duplicated 250 bp upstream enhancer

sequence (CaMV 35S DE) has been previously reported to

be higher than the CaMV 35S alone (Kay et al., 1987).

For this reason, two additional homologous antisense

constructs were made containing either the full length

cDNA (construct C) or the cDNA depleted of its 39 noncoding

region (construct D) under the control of this promoter.

CCR activity in antisense and control plants

Twenty to 27 independent transformants were regenerated

for each of the above constructs and, respectively, referred

© Blackwell Science Ltd, The Plant Journal, (1998), 13, 71–83

Figure 1. The CCR antisense constructs.

CaMV 35S: Cauliflower mosaic virus 35S RNA promoter; DE: double

enhancer; EuCCR: CCR cDNA of Eucalyptus gunnii; TobCCR: CCR cDNA of

tobacco; TpolyA: termination sequence of the CaMV 35S RNA; Tnos:

termination sequence of the nopaline synthase gene.

to as B-, C- and D-, followed by the number of the individual

transformant for each population.

Screening for CCR activity was performed on 6-week-

old in vitro plants. Since preliminary investigations have

shown that CCR activity was higher in stems compared to

leaves and petioles (data not shown), stem extracts were

used to assay CCR using feruloyl-CoA as a substrate. The

results are summarized in Figure 2. We first determined

the natural variability of CCR activity in two control popula-

tions. The first population contained 18 untransformed

plants, the second 10 plants transformed with a CAD

promoter-uidA gene fusion (described in Feuillet et al.,

1995). The mean and variance for these two populations

were very similar, indicating that transformation had no

effect on CCR activity. We subsequently pooled the values

into one single group, which was considered as the refer-

ence control population for which specific activity mean

6 standard deviation was 84.8 6 11.7 pkat.mg–1 protein

(Figure 2).

The data obtained for the different populations were

subjected to two-sample T-tests. The p-values obtained for

populations B, C and D (p-values of 8.4e–10; 1.8e–4; 7.8e–9,

respectively) showed that they differed significantly from

the control population at the 99% level. In these popula-

tions, a number of individuals were found with CCR activit-

ies lower than 60% of the average of the control population,

respectively, 7, 9 and 11 plants for constructs B, C and D.

In parallel, a population of transformants containing the

CCR eucalyptus antisense construct was analysed and

shown to be not significantly different from the control

population (data not shown).

Out of the populations B, C and D, seven transformants

were chosen with low CCR activity levels: two plants from

Down-regulation of cinnamoyl-CoA reductase in tobacco 73

Figure 2. CCR specific activity in control and in antisense transgenic plants (populations B, C, and D).

Enzyme activity was measured in 6-week-old, in vitro grown plantlets. The mean value of the control population is represented by a dashed line and the

two solid lines indicate the standard deviation. The name of the transformants selected for further analysis are indicated.

Figure 3. CCR specific activity in selected primary transformants after

transfer to the greenhouse (8-weeks-old).

The dashed line indicates the mean value of five control plants.

population B (B3 and B6), three from population C (C4, C9,

C15), and two from population D (D2 and D12). It is

significant to note that at this stage, four of these selected

plants (B3, B6, C4 and D2) exhibited an orange-brown

coloration of the xylem in the basal part of the stem when

the cortex was peeled off. However, plant D12, which

displayed the lowest CCR activity of population D, did not

show any xylem coloration.


Figure 4. RNA gel blot analysis of endogenous CCR gene and transgene

expression in total stem RNA of 2-month-old control and transgenic plants.

Total RNA was extracted from two control plants (CT1 and CT2) and from

seven selected transformants from populations B, C, and D, and hybridized

with (a) *an antisense 32P-labelled riboprobe complementary to the tobacco

CCR mRNA (1,3 Kb). (b) A sense 32P-labelled riboprobe complementary to

the antisense RNA. (c) A 32P-labelled cDNA corresponding to the 18S rRNA

from radish to quantify RNA on the blots.

*The extra-band detected at 1 Kb does not hybridize to the CCR messenger

RNA, but to the transcript of a gene not identified, expressed constitutively

and containing a sequence complementary to the polylinker region of the

Bluescript vector comprised between the T7promoter and the BamHI site.

CCR inhibition and steady-state levels of antisense and

messenger RNA

The seven selected individual plants displaying depressed

CCR activity were acclimatized in the glasshouse and tested

again for CCR activity (Figure 3). At this stage (2-months-

old), only plants B3, B6, D2 and C4 still showed a low CCR

activity. They also exhibited an orange-brown coloration

of the xylem ring. Transformant B3 had the most intense


Figure 5. Phenotype of the severely CCR-downregulated transformant B3

as compared to a control plant (CT).

Figure 6. Seeds of B3 plants as compared to control (CT).

(a) After the sterilization treatment: 159 in 10% chlorox solution and (b)

after phloroglucinol staining. Magnification: 340.


Figure 7. Patterns of xylem coloration in CCR-downregulated plants.

The cortex and phloem of the stem fragments have been peeled off.

Control plant (a); CCR-downregulated plants: B3 (b), B6 (c), C4 (d); CAD-

downregulated plant (e, line 50, Halpin et al., 1994). The orange-brown

coloration is restricted to the xylem ring (f), compare B3 stem section

(upper part) to control stem section (lower part)

Figure 9. UV fluorescence of lignin in stem cross sections of transformant

B3 (a) as compared to wild type (b). Magnification 3330.

Figure 10. Phloroglucinol staining of transverse stem section of

transformant B6 (a) as compared to control (b). Magnification 3250.

coloration and the lowest CCR activity (30% residual activ-

ity). On the other hand, some of the previously selected

plants (C9, C15) did not show continued reduction of CCR

activity and had levels comparable to the control values.

It is worth noting that coloration of the xylem was absent

in plants C9, C15, and even in transformant D12. At this

stage, the CCR activity in D12 was slightly reduced although

not as marked as in the in vitro stage.

Steady-state levels of endogenous and antisense RNAs

in the stems were analysed by Northern blot experiments

(Figure 4) using two types of probes with different specifi-

cities: (i) an antisense RNA probe corresponding to the 59

part (1087 bp) of the CCR tobacco cDNA specific for the


Figure 8. Transverse stem sections of CCR-downregulated plants.

The orange-brown coloration is associated with the xylem cell walls of transformants B6 (a) and B3 (b) as compared to wild type (c). Magnifications: (a)

3285; (b) 3375; (c) 3245.

Figure 11. Semi in vivo incorporation of hydroxycinnamic acids in fresh stem sections of a control plant.

Stem section of a wild type plant (a) after incorporation of sinapic acid (b) or ferulic acid (c). A cross stem section of a B3 plant is included for comparison

(d). Magnification 3125.

endogenous CCR messenger RNA and (ii) the correspond-

ing sense RNA probe to determine the level of tobacco

antisense CCR. Subsequent hybridization of the blots with

a probe to a constitutively expressed gene was performed

to ensure that the same quantity of total RNA had been

loaded for each sample.

Figure 4(a) presents the steady-state level of endogenous

CCR mRNA in the stems of the seven previously selected

primary transformants. All the transformants tested

showed decreased levels of the mRNA when compared to

control plants, except transformant C15. Plants B3, B6

and D2 exhibited the most severe reduction, whereas the

decrease was less marked for C4, C9 and D12. High levels

of antisense RNAs were found in stems of transformants

B3, C4, and D2, whereas in other transformants levels


were very low (C9, D12) or even undetectable (B6, C15)

(Figure 4b). Therefore, there is no clear correlation between

the amount of antisense RNA detected and the inhibition

of the resident messenger RNA. The antisense transcript

levels were also investigated in leaves where levels of CCR

mRNA are below the limit of detection. The antisense

transcripts were shown to accumulate to the same relative

extent as in stems (data not shown).

Altogether, these data suggest a good correlation

between the decrease in the steady-state level of CCR

mRNA, the level of CCR activity and the occurrence of

the orange-brown coloration in the xylem of the stem.

Thereafter, transformants B3, B6, C4, and D2 were selected

for further analysis. Transformant D12, which had the

most reduced CCR activity at the in vitro stage but only


maintained a slight reduction after acclimation, was also

selected although it did not display any coloration of

the xylem.

Morphology of plants with a reduced CCR activity and

histochemical analysis of stem sections

When grown in vitro there were no developmental differ-

ences among the primary transformants. After transfer to

the glasshouse, this was also the case for six of the seven

selected transformants (data not shown). However, one of

the transformants (B3) displayed an abnormal phenotype

(Figure 5). The general growth of the plant was affected; it

grew to two-thirds the size of the control plants, the leaves

were reduced in size and were stunted, exhibiting a spoon-

like shape (Figure 5). Leaves were also dark-green, mostly

around the veins with zones of discoloration in between.

Moreover, the flowering was delayed and in contrast to

control seeds, B3 seeds became white after the standard

sterilization treatment (Figure 6a) and lost their capabilities

to germinate. The seeds obtained from B3, in contrast to

the control seeds, did not show a red staining when treated

with phloroglucinol, a common stain for lignin (Figure 6b).

The coloration of the xylem ring that was observed at

the in vitro stage was maintained throughout the develop-

ment of glasshouse grown plants. Different intensities and

patterns of coloration were found, the most intense and

homogeneous coloration being observed in the most

severely depressed transformant B3 (Figure 7b and f). Most

of the other transformants exhibited a patchy coloration,

mainly localized in the upper part of the stem (trans-

formants B6 (Figure 7c) and D2, or in fine stripes

(transformant C4, Figure 7d). It is worth noting that the

orange-brown coloration of the CCR downregulated plants

was different from the reddish coloration of CAD antisense

tobacco plants (Figure 7e; Halpin et al., 1994; Yahiaoui

et al., 1997).

Hand-cut stem sections were made from 2-month-old

primary transformants grown in the glasshouse. As seen

in Figure 8 (a and b), the coloration was associated with

the cell walls of the xylem tissue. In transformant B3

exhibiting homogeneous xylem coloration (Figure 8b), the

vessels appeared semi-collapsed, with the cell walls appar-

ently buckling under mechanical stress (Figure 9a) as

compared to control vessels which exhibited a round-open

shape (Figure 9b). In the other selected transformants,

the deformation of the vessels also occurred (Figure 8a)

although it was less marked than in B3 (Figure 8b;

Figure 9a). In transformants exhibiting a patchy coloration

pattern, vessel collapse was always observed in coloured

xylem zones, whereas in noncoloured zones they main-

tained a normal shape (data not shown).

Lignins in stem sections were stained by the Wiesner

(phloroglucinol-HCl) and Maule reagents. Phloroglucinol


reacts with the hydroxycinnamaldehyde and benzaldehyde

groups present in lignin and the colour intensity generated

in this reaction roughly reflects total lignin content

(Monties, 1989). Staining, which is normally bright-red in

control xylem, was weaker in plants B6 (Figure 10a), D2,

C4 and particularly in plant B3, suggesting a decrease in

aldehydes and/or lignin content. The faint reaction to

pholoroglucinol staining was correlated with the orange-

brown coloured zones containing collapsed vessels. No

staining difference was detected between control and inhib-

ited plants with the Maule reagent which stains free syringyl

units, except for transformant B3. The staining intensity

was weaker on the xylem of plant B3 (data not shown),

indicating a decrease in the S units of the lignin polymer

and/or a decrease in the total lignin content.

Consistent with the dramatic changes observed in B3

xylem cell walls, the stems of transformant B3 were easier

to cut by hand with a razor blade than control stems. This

observation was supported by preliminary experiments

performed with a texture analyser, showing that 30%

less energy was required to break stem fragments of

transformant B3 than control (data not shown), thus imply-

ing that the xylem of B3 transformants was softer than

control xylem.

Determination of transgene loci number and subsequent

generation of hemizygous and homozygous lines

Selected transformants were characterized by Southern

blot experiments and segregation of kanamycin resistance

in their back-crossed and selfed progeny. The Southern

blot analyses revealed the presence of only one copy of

the T-DNA for B3 and B6, whereas two copies were found

for C4, D2 and D12. Segregation analysis indicated the

presence of one integration locus in transformants B3, B6,

D2 and D12 and two genetically linked loci for C4 (Table 1).

With regard to these data, plants B3, B6, D2 and D12,

which have integrated T-DNA at a single locus, were

selected for more in-depth analysis of their progeny.

Primary transformants B3 and D2 were back-crossed to

give hemizygous (B3H and D2H) and azygous plants. Plants

B3H and D2H exhibited the same phenotypic characteristics

as their parents while progeny lacking the transgene

showed no visible differences from wild type. Two homozy-

gous lines, B6–8 and D12–4, were also generated by selfing

transformants B6 and D12. At this stage, it is interesting

to note that although the primary transformant D12 did

not display any visible xylem coloration, its homozygous

progeny line D12–4 displayed a variegated pattern of col-

oration of the xylem. Therefore, in this case, doubling the

number of loci by selfing had a positive effect. Consistent

with this observation, we noticed that the phenotype of C4

selfed progeny (not studied in depth because of its complex

integration pattern) was more severe than the phenotype


Table 1. Inheritance of kanamycin resistance in progeny of five

independent primary transformants

Number of seedlings

Seed Resistant Sensitive Suggested χ2 Number

source ratio of loci

B3 3 self 289 89 3:1 0.43 ns 1a

B3 3 self 289 89 3:1 0.43 ns 1a

B3 3 wt 191 184 1:1 0.13 ns 1a

B6 3 self 294 83 3:1 1.78 ns 1a

B6 3 wt 214 184 1:1 2.26 ns 1a

C4 3 self 388 70 2*

C4 3 wt 198 94 2*

D2 3 self 359 111 3:1 0.47 ns 1a

D2 3 wt 255 225 1:1 1.87 ns 1a

D12 3 self 327 111 3:1 0.03 ns 1a

D12 3 wt 168 145 1:1 1.69 ns 1a

wt: wild type parent, Nicotiana tabacum cv Samsun NN. ns: values

not significantly different from expected ratio at 95% confidence.aValues for two loci are significantly different from expected ratio

at 95% confidence. *Genetical link between two loci.

of B3 hemizygous line, suggesting a gene-dosage effect.

Taken together, these data clearly show that the transgenes

were stably integrated in the plant genome and transmitted

to the progeny.

Lignin content and structure

The lignin content was measured from cell wall residue

(CWR) obtained by solvent extraction of the powdered

xylem tissue of control and antisense lines. This solvent

extraction removes soluble extraneous compounds that

might interfere with lignins during their gravimetric or

spectrometric determination (Dence, 1992). The proportion

of ethanol-soluble compounds in ground xylem was found

to be substantially higher in line B3H than in the control

plants (36% vs. 21% as weight percentage of the dry

material). This suggests that a greater proportion of the dry

B3H xylem corresponds to soluble components removed

during the extraction procedure, with a corresponding

decrease in the insoluble wall fraction. In contrast, the

other antisense lines behave similarly to the control with

regard to their extractive content.

As there is no method that can be regarded as totally

satisfactory for the determination of lignin, two methods

were used to evaluate the lignin content of transgenic lines

compared to the controls: the spectroscopic acetyl bromide

method (Iiyama and Wallis, 1990) and the gravimetric

Klason procedure (Dence, 1992). Lignin determinations

were carried out on different transgenic lines after 5 (B3H,

D2H) or 7 (B6–8, D12–4) weeks of growth in the glasshouse

(post-acclimation) and compared to analogous controls of

the same age (Table 2). The lignin content of line D2H was

slightly reduced but no differences could be detected


Table 2. Klason and acetyl bromide determinations of lignin

content in control and antisense lines

Line Klason lignin Acetyl bromide

(% weight) lignin (% weight)

(a) B3H 10.20 6 1.00 15.40 6 0.90

D2H 17.62 6 1.00 20.68 6 0.46

control 19.39 6 0.89 23.28 6 0.43

(b) B6-8 20.98 6 0.34 20.70 6 0.24

control 20.91 6 0.86 21.10 6 0.73

(c) D12-4 19.97 6 0.34 21.68 6 0.28

control 21.32 6 0.29 22.63 6 0.38

Measurement were performed on six to eight individual plants

for the same line. Data are means 6 standard error from at least

three measurements and are expressed as weight percentage of

CWR. Controls were either azygous (a) or untransformed (b,c)

plants. Sampling date was February, June and October for a, b,

and c, respectively, after 5 (a) or 7 weeks (b,c) of growth in the

glasshouse, post-acclimation.

between the other antisense lines (B6–8 and D12–4) and the

corresponding controls. In contrast, a dramatic reduction of

the lignin content in line B3H was observed, regardless of

the method used. Compared to the control, this reduction

reached 47% with the Klason method and 34% with the

acetyl bromide procedure.

Lignin structure was investigated by thioacidolysis

(Lapierre et al., 1986). This analytical depolymerization

selectively cleaves labile ether bonds interconnecting lignin

units, namely the β-O-4 linkages (Higuchi, 1990).The β-O-4

linked G or S lignin units specifically give rise to thioethyl-

ated monomers Ar-CHSEt-CHSEt-CH2SEt (with Ar 5 G or

S aromatic ring), with a high reaction yield. Accordingly,

the total yield and relative proportion of these monomers

closely reflect the amount and ring type of lignin units

involved in such labile ether bonds and are referred to as

uncondensed lignin units. Despite some differences in the

control lines, which may be due to the sampling date and/

or plant age, the chemical composition of lignin in the

antisense tobacco lines was found to be significantly affec-

ted when compared to the corresponding controls (Table 3).

In the transgenic plants, the thioacidolysis yield was

decreased and the greatest decrease was found in line B3H

(Table 3). Along with these changes, an alteration of the

lignin composition was found in all antisense lines, as

shown by the modification in the thioacidolysis S/G ratios.

The S/G increase observed in Table 3 predominantly

resulted from a reduction in β-O-4 linked G units, as shown

by the lower yield of thioacidolysis G monomers for lines

D2H (20% reduction) and B6–8 (28% reduction) relative to

the control lines. For the most severely affected line B3H,

there was a strong reduction of both G and S β-O-4 linked

units, with the reduction of G being twice as pronounced

(70% vs. 30% reduction for S units). The incorporation of

ferulic acid and, more surprisingly of sinapic acid, in the


Table 3. Lignin monomeric composition of CWR from antisense

and control tobacco plants. Thioacidolysis yields are expressed

in µmol.g–1 CWR (or µmol.g–1 klason lignin).

Line S 1 G (µmol.g–1) S (µmol.g–1) G (µmol.g–1) S/G

(a) B3H 63 6 11 (613) 38.9 23.7 1.64

D2H 214 6 11 (1213) 104.7 109.1 0.96

control 257 6 18 (1330) 108.5 148.6 0.76

(b) B6-8 276 6 40 (1316) 166.6 109.6 1.52

control 322 6 31 (1541) 170.9 151.26 1.13

Data are means 6 standard error. Measurements were

performed for five plants of the same line sampled after 5 (a) or

7 weeks (b) of growth in the glasshouse, (post-acclimation), in

February and June 1996, respectively. Controls are azygous (a)

or untransformed (b) plants.

wall of the transgenic line B3H was suggested from the

identification of their Michael addition products Ar-CHSEt-

CH2-COOH (with Ar 5 G or S aromatic ring) in the thioacido-

lysis mixture (Lapierre, 1993). Since thioacidolysis, aimed

at the cleavage of ether bonds, cannot quantitatively hydro-

lyse hydroxycinnamic esters, the quantitative evaluation

of these compounds was not attempted, in contrast to that

of the main G and S thioacidolysis monomers.

Transgenic lines contain unusual phenolic compounds

linked to the wall

Chemical analyses of the antisense lines B3H and B6–8

revealed another intriguing impact of the CCR downregul-

ation on the cell wall composition relative to the control

line. This feature was the occurrence of cell wall linked

phenolics released by a mild alkaline hydrolysis of the

CWR. The identity of these phenolics was systematically

determined by GC-MS of their silylated derivatives, as

compared to authentic compounds. A large part of the

alkali-released phenolics from CWR of line B3H was com-

posed of ferulic acid, and to a lower extent by sinapic acid.

Compared to line B3H, the amount of ferulic acid released

from the control on alkaline hydrolysis was approximately

10-fold lower, while sinapic acid was detected as a trace

component or not detected. The less severely depressed

line B6–8 showed intermediate behaviour. Acetosyringone

(4-hydroxy-3,5-dimethoxy-acetophenone) was also evident

among the phenolics released by alkaline hydrolysis in

noticeable amounts from B3H, in lower amounts from B6–

8, and detected as a trace component or not detected

from the control. Therefore, acetosyringone could also be

considered characteristic of CCR-downregulation although

we cannot determine at this point whether acetosyringone

is ester-linked to the walls or is a secondary product formed

from alkali-labile structures.

In order to investigate whether the incorporation of

hydroxycinnamic acids in transgenic lignins could be


responsible for the orange-brown coloration observed in

the CCR depressed lines, we performed semi-in vivo incorp-

oration of ferulic acid and sinapic acid in fresh stem

sections of a control untransformed plant (Figure 11b

and c). The staining observed in the young xylem after

incubating the sections overnight at 37°C with ferulic acid

(Figure 11c) was consistent with the coloration observed

when making dehydrogenation polymers (DHPs) in vitro

using ferulic acid and horseradish peroxidase. This staining

is close to the one observed in the xylem of CCR antisense

plants (Figure 11d) and totally different from the staining

observed after incorporation of sinapic acid (Figure 11b)

or of coniferaldehyde (Yahiaoui et al., 1997). The result

suggests that coloration of the xylem in CCR-antisense

plants could in part be due to an increase in ferulic acid

deposition in the walls.

Discussion

Relative efficiency of the different CCR antisense

constructs

Although the exact mechanisms of the antisense RNA

technology have not yet been fully elucidated, this

approach has been used with success to efficiently and

specifically reduce the expression of many plant genes

(for reviews see Van Blockland et al., 1993; Watson and

Grierson, 1993), including genes involved in lignin biosyn-

thesis (see Boudet and Grima-Pettenati, 1996; Campbell

and Sederoff, 1996 and references therein). Most of the

studies deal with strong and constitutive promoters, such

as the CaMV 35S. The transcriptional activity of the CaMV

35S promoter has been shown to be increasedm, by up to

10-fold, by the duplication of an enhancer region (Kay

et al., 1987). Although the two promoters (CaMV 35S, and

CaMV 35S DE) were used in our study, we did not observe

any significant difference in the efficiency of inhibition

of CCR activity in plants containing the same antisense

construct under the control of either the CaMV 35S or the

CaMV 35S DE promoter. Similarly, the use of the tobacco

CCR cDNA depleted of its untranslated region was shown

to be as efficient as the full length cDNA.

Plants with low CCR activity display an orange-brown

coloration of the xylem

Coloration of the xylem of CCR antisense lines indicates

major changes in cell wall composition. It is worth noting

that the coloration of the xylem seems to be a typical

feature of either naturally occurring mutants, or genetically

engineered mutants, and can be observed in response to

the defects of different lignification genes, although the

chemical determinant in each case may be different.

Indeed, a reddish coloration was observed as a con-


sequence of CAD downregulation in tobacco (Halpin et al.,

1994; Hibino et al., 1995; Yahiaoui et al., 1997) and poplar

(Baucher et al., 1996) and was reminiscent of the coloration

previously observed in maize and sorghum brown-midrib

mutants (Kuc and Nelson, 1964), and more recently in the

loblolly pine mutant containing a null CAD allele (MacKay

et al., 1995). The red coloration in the xylem of CAD

downregulated plants is likely due to a higher proportion of

conjugated cinnamaldehydes incorporated into the lignin

polymer (Baucher et al., 1996; Higuchi et al., 1994; Yahiaoui

et al., 1997). The coloration observed in CCR downregulated

plants is different from that observed in CAD or OMT

depleted plants (Van Doorsselaere et al., 1995). Our results

suggest that the colour may be due, at least in part, to an

incorporation of ferulic acid in the lignins.

Among the transgenic lines, the coloration was either

homogeneous in the stem or limited to defined zones. The

variegated coloration patterns are reminiscent of those

observed for CAD antisense poplar (Baucher et al., 1996)

and 4-Coumarate-CoA ligase (4 CL) antisense tobacco

plants (Kajita et al., 1996). As stressed by Van der Krol

et al. (1988), antisense genes are expressed in different

ways depending on the position of transgene insertion in

the genome. The efficiency of the antisense effect may also

depend on the transcriptional regulation of the endogenous

gene (Atanassova et al., 1995).

CCR downregulation induces significant qualitative

changes of lignins in transgenic tobacco

All transgenic lines studied, independent of their lignin

content, exhibited an unexpected increase in the S/G ratio,

resulting mainly from a decrease in G units. In all species

in which CCR has been purified the enzyme was able

to convert feruloyl-CoA and sinapoyl-CoA, with roughly

equivalent efficiencies (Goffner et al., 1994 and references

therein). Although genomic Southern blots performed

under stringent conditions revealed the presence of only

one gene in tobacco (J. Piquemal, unpublished observa-

tions), we cannot exclude the presence of an isoform

specific for sinapoyl-CoA, whose sequence could be suffi-

ciently divergent to be unaffected by the antisense gene.

Consistent with this hypothesis, a growing body of evid-

ence supports the idea of a specific pathway for the

synthesis of S units (Douglas et al., 1997). However, this

hypothesis cannot explain the large reduction in S units

observed in the most downregulated line B3H. On the

other hand, one should be aware that, in this study, the S

and G contents were determined by the thioacidolysis

method whose main targets are the β-O-4 linkages, and

therefore it may only partially reflect the total monomeric

composition of lignins.

Moreover, in severely CCR downregulated plants, the

thioacidolysis yield is decreased. The reduction in thioaci-


dolysis yield, expressed as a proportion of lignin content,

may be indicative of a lower content of uncondensed

structures in lignins which give rise to thioacidolysis

monomers and, conversely, of a higher content in carbon–

carbon condensed bonds which are not broken by thioaci-

dolysis. Alternatively, the efficiency of the thioacidolytic

β-O-4 cleavage could have been decreased by different

side-chain structures related to the incorporation of poten-

tial unusual monomeric units in the lignin of antisense

CCR lines. In addition, the most severely affected antisense

line B3H contained phenolic compounds linked to the

cell wall (ferulic and sinapic acids, acetosyringone). The

occurrence of cell wall linked ferulic acid in substantial

amounts is a specific feature of grasses, whereas it is

usually detected as a minor or trace wall component in

the xylem of dicotyledons, with the exception of some

Caryophyllales families (Hartley and Harris, 1981). The

occurrence of a substantial amount of sinapic acid in the

cell wall is still more confined to a few families (Bate-Smith,

1962). Accordingly, the significant amounts of bound ferulic

acid and, more remarkably, of bound sinapic acid in cell

walls of line B3H were viewed as a feature associated with

the severe downregulation of CCR. According to the present

results, the attachment mode of ferulic and sinapic acid to

the cell wall is through ester bonds, cleaved by mild

alkaline hydrolysis. Nevertheless, based on recent results

(Jacquet et al., 1995; Ralph et al., 1994), one cannot exclude

other modes of incorporation of these acids based on their

enzymatic dehydrogenation to phenoxy radicals. These

putative radicals are actually prone to participating in

a variety of ether and carbon–carbon interunit linkages,

resulting in the cross-linking of cell wall polymers and thus

in the strengthening of the lignocellulosic material. The

presence of these unusual wall-bound phenolics in the

xylem cell walls could result from a detoxification process

to counteract the accumulation of potentially toxic soluble

phenolics (Sanderman, 1992). The origin and biochemical

significance of acetosyringone released from the alkaline

hydrolysis of B3H remains to be elucidated.

Transformants with a moderate decrease in CCR activity

exhibit an overall modification of the lignin profiles which

is a priori favourable for the pulp industry since a high

proportion of S units usually indicates easier delignification

in kraft pulping (Chiang et al., 1988). Moreover, the thioaci-

dolysis yield indicative of the lignin content in labile ether

bonds, which are the main target for the kraft delignification

process, is not greatly affected. The potential improvement

of the technological properties of these transformants will

be tested in simulated kraft pulping experiments.

A sufficient amount of lignins is crucial for normal plant

development

Lignin mutants which have been characterized to date have

exhibited significant changes of their lignin composition


and/or a moderate decrease of their lignin content (see

Boudet and Grima-Pettenati, 1996; Campbell and Sederoff,

1996 and references therein). In this work, CCR gene

suppression allowed the characterization of a transgenic

line (B3H) showing a dramatic reduction of its lignin content

as compared to the control. The transgenic line B3H also

exhibited altered growth and development. Among the

selfed progeny of transformant C4 containing multiple

copies of the antisense transgene, homozygous plants

exhibited a similar altered phenotype (data not shown).

This phenotype is reminiscent of those of Phenylalanine

ammonia-lyase (PAL2) cosuppressed tobacco plants,

although less severe (Elkind et al., 1990). Indeed, PAL

catalyzes the first committed step to the phenylpropanoid

pathway and its downregulation affects the synthesis of a

wide range of phenolic compounds including flavonoids.

Some of the phenotypic modifications observed in this

new CCR lignin mutant are obviously a direct consequence

of the dramatic lignin depletion in the cell walls. Xylem

cell wall strength is altered as shown by a decrease in

stem mechanical resistance. Moreover, the vessels are

contorted, collapse inwards and are unable to withstand

the compressive forces generated by the transport of water

through the plant stem. These observations emphasize the

essential role of lignin in maintaining xylem cell wall

integrity (Smart and Amrhein, 1985). It is likely that the

collapse of the vessels may result in the dysfunction of

xylem sap transport and in abnormal physical interactions

between cells and tissues. To that extent, one of the

proposed roles of lignins is to waterproof the secondary

cell walls. These perturbations may affect the water supply

and consequently normal growth and plant morphology.

Altogether, these different observations suggest that a

substantial decrease in lignin content (almost half of the

normal concentration) is incompatible with normal devel-

opment. Higher plants have evolved in a terrestrial habitat

by reinforcing their cell walls through lignin deposition.

Despite significant potential variations in lignin concentra-

tion within a given species, a dramatic reduction in lignin

content induces detrimental effects. It will be interesting

in the future to determine to what extent higher plants

can tolerate lignin reduction without changes in their

development. Finally, the extent of lignin reduction compat-

ible with normal development must be determined, especi-

ally when considering the biotechnological objective of

decreasing lignin content.

On the other hand, we cannot exclude the possibility

that some of the phenotypic alterations observed in severe

CCR downregulation may be due to a decrease in low

molecular weight phenolics derived from monolignols,

such as lignins or dehydroconiferyl glucosides. The latter

have been shown to be involved in signal transduction of

cytokinin-mediated cell division (Teutonico et al., 1991). In

addition, a decrease in CCR activity is accompanied by the


accumulation of soluble phenolics (J.P. Biolley, personal

communication).

In addition to the potential economic interest of the

transformants exhibiting a normal phenotype, and whose

lignin profiles could be profitable for the pulp industry, the

downregulation of CCR highlights the chemical plasticity

of lignins and plant cell walls. It should allow us to

gain an insight into potential alternative pathways and

regulatory mechanisms in lignin synthesis. Furthermore,

the specific suppression of CCR induces a new carbon

partitioning between lignins and other phenolic carbon

sinks and could be exploited in the future for metabolic

engineering experiments aimed at optimizing soluble

phenolics profiles of plants for applied purposes (Dixon

et al., 1996). Finally, CCR lignin mutants exhibiting pheno-

typic changes provide novel research material for investiga-

ting the role of lignins in normal plant development and

in response to environmental stresses.

Experimental procedures

Construction of antisense vectors

All DNA recombinant techniques were performed essentially as

described by Sambrook et al. (1989). The antisense constructs

described below contain the cDNA encoding the tobacco CCR

(A. O’Connell et al., in preparation). This cDNA was obtained by

heterologous screening of a tobacco stem cDNA library con-

structed in λZapII, using the first CCR cDNA available (Eucalyptus

gunnii CCR cDNA, EMBL Database accession number X79566,

Lacombe et al., 1997). Construct B: A Plasmid pTobCCR was

digested by EcoRV and SmaI to isolate a 1.3 kb fragment corres-

ponding to full length tobacco cDNA. The fragment was inserted

into the SmaI site of the vector pSK Bluescript and the orientation

was determined by a SalI digestion. The resulting plasmid, named

pTob5CCR was digested by KpnI and BamHI, and the liberated

insert was cloned into pJRI (Smith et al., 1988), a pBin19 (Bevan,

1984) derived vector containing the CaMV 35S promoter (528 bp)

and the 39 terminator of the nopaline synthase gene to generate

construct B. Construct C: The plasmid pTob5CCR was digested by

HindIII-BamHI to isolate the full length cDNA (1.3Kb). The 1.3Kb

fragment was ligated into pLBR19, a pUC19 derived vector con-

taining the CaMV 35S promoter with a double enhancer and the

CaMV 35S termination sequence, kindly provided by Lise Jouanin

(INRA Versailles, France). A KpnI-BglII fragment carrying the pro-

moter, antisense CCR and terminator sequence was isolated and

inserted in the pBin19 vector to generate construct C. Construct

D: The plasmid pTobCCR was digested by EcoRI to isolate the

tobacco cDNA (1.1Kb) depleted of its 39 untranslated region. It

was inserted at EcoRI site of the pSK Bluescript vector and the

orientation was then determined by a NdeI-HindIII digestion. The

resulting plasmid was digested by HindIII-BamHI and the liberated

1.1 Kb fragment was then cloned into pLBR19. The promoter-

insert-terminator cassette was liberated by KpnI and BglII, and

cloned into pBin19, to generate construct D. The binary vectors

(B, C, D) were introduced in Agrobacterium tumefaciens strain

LBA4404 applying a freeze-thaw procedure (Holsters et al., 1978).

Plant transformation and regeneration

Tobacco (Nicotiana tabacum cv Samsun NN) was transformed by

a modification of the leaf-disk method (Horsch et al., 1985).


Kanamycin (Sigma) at 100 mg.ml –1 was used as a selective

agent during the in vitro regeneration, rooting and propagation

procedures. Calli formation and shoot differentiation were carried

out on MS medium supplemented with 6-benzylaminopurine

(Sigma) (1 mg.ml–1) and naphtalene acetic acid (Sigma)

(0.1 mg.ml –1). Rooting was obtained with MS medium. Carbenicil-

lin (Sigma) was used at 500 mg.ml –1 during the in vitro regenera-

tion procedure and at 200 mg.ml –1 during the rooting procedure,

then the concentration was reduced by twofold at each propaga-

tion step. Transformed plants were grown in vitro for 6 weeks

under a light–dark regime of 16 h (20–30 µE m–2 s–1, 27°C)/8 h

(27°C), then the basal part of the stem (3 cm) was assayed for

CCR activity, and the upper part was micropropagated under the

same conditions. Subcultured plantlets of the clones of interest

were transferred to compost and grown to maturity in the

greenhouse.

Hemizygous plants (B3H, D2H) were obtained as follows: at

flowering, one to two immature flower buds from transformant

B3 or D2 were emasculated and backcrossed by transfer of pollen

from a wild-type plant. To determine which plants inherited the

transgene, 30 plants of each progeny were analysed by the

polymerase chain reaction (PCR) using the – 20 universal primer

complementary to a sequence located upstream from the CaMV

35S promoter on the pBin19 vector and a primer corresponding

to a sequence in the 39 end of the coding region of the tobacco CCR

cDNA (5’aggtcaccttccaattccccta 39). These progeny represented a

1:1 segregating population of azygous (control) and hemizygous

antisense plants (B3H, D2H). The presence or absence of the

transgene was confirmed by a Southern blot analysis, using the

tobacco CCR cDNA as a probe, on six plants of each population.

Homozygous lines (B6–8, D12–4) were obtained by self-pollina-

tion of transformants B6 and D12, respectively. F1 seeds were

harvested and further selected on germination medium containing

kanamycin.

Enzyme assays

CCR assays were conducted on 6-week-old plantlets regenerated

in vitro and 2-month-old plants acclimatized in the glasshouse.

The bottom of the stem (2–3 cm high) was ground in liquid

nitrogen and the proteins were extracted at 4°C in Tris-HCl 0.1 M

pH 7.5, PEG 6000 2% (w/v), DTT 5 mM, PVPP 2% (w/v). The crude

extract was clarified twice by centrifugation (10 000 g 10 –1min)

at 4°C.

CCR activity was measured based on the method of Luderitz

and Grisebach (1981) using 50–60 µg of protein. Feruloyl-CoA was

chemically synthesized according to the procedure of Stockigt

and Zenk (1975) by H. Durand (laboratoire de synthese et physic-

ochimie organique, UPS, France). The protein concentration was

determined by the method of Bradford (1976) using the dye-

binding reagent that was supplied by Bio-Rad.

RNA analysis

Total RNA was isolated from 2 g of frozen material (either whole

stem or young upper leaves harvested from 2-month-old plants)

according to Dean et al. (1985). RNA samples (15 µg) were separ-

ated on formaldehyde/Agarose gels, transferred onto Nytran filters

(Schleicher & Schuell) and hybridized to randomly radiolabelled

RNA probes. 32P-labelled, single-stranded riboprobes were synthe-

sized from a 1087 bp tobacco CCR cDNA fragment cloned in the

pBluescriptSK vector using either T7 or T3 RNA polymerase

(Eurogentec, Belgium) to make probes that detected either sense


or antisense RNA. A cDNA corresponding to the 18S rRNA from

radish (kindly provided by Y. Meyer, CNRS Perpignan) was used

to quantify RNA on the blots. Pre-hybridization was performed in

5XDenhardt’s reagent (Ficoll 1 g.l–1, PVP 1 g.l–1, BSA 1 g.l–1), 50%

formamide, 5XSSPE (0.75 M NaCl, 50 mM NaH2PO4, 5 mM EDTA),

1% SDS, and 150 µg.ml–1 of sonicated and denatured salmon

sperm DNA during 4 h at 60°C. Hybridization was performed

overnight in the same solution containing only 3XDenhardt’s

reagent at 65°C.

Histochemical analysis

Phloroglucinol-HCl (Wiesner reaction; Speer, 1987) and Maule

(Iiyama and Pant, 1988) reactions were performed on handmade

stem sections of young tobacco plants. Incorporation of ferulic

and sinapic acid was performed by incubating sections with a

2.5 mM ferulic or sinapic acid solution in 100 mM phosphate buffer

(pH 7.0). Stained and unstained sections were observed using a

Leitz microscope and autofluorescence of phenolics was detected

on a microscope equipped with a fluorescence device using

340–380 nm excitation wavelength and 430 nm barrier filters in

conjunction with a Leitz 50 W HBO mercury burner.

Sample preparation and lignin analysis

Whole stems of control and transgenic lines were harvested at

comparable physiological stages and immediately frozen in liquid

nitrogen (7 weeks after acclimation corresponded to early flower-

ing for both transgenic lines studied and controls). After lyophyliz-

ation the woody xylem ring was manually removed from the pith

and epidermis, ball milled to a fine powder and sequentially

extracted with water, ethanol and toluene: ethanol (1:1 v/v) using

a modified soxhlet apparatus (Perstorff Instruments). The resulting

cell wall residue (CWR) was rinsed in acetone, dried and analysed

using a variety of methods. All the results shown, unless stated

otherwise, are the mean value obtained from five plants using

three replicates per method. Acetyl bromide lignin content was

determined by the method of Iiyama and Wallis (1990). The

lignin content was calculated by using 20 g–1.cm–1 as the specific

absorbance of acetyl bromide treated lignins (Halpin et al., 1994).

Klason lignin contents were determined using a micro Klason

technique (Whiting et al., 1981). Thioacidolysis was performed

according to the method of Lapierre et al. (1986).

Mild alkaline hydrolysis of the CWR

Transgenic and control cell wall residues (50 mg) were treated

with 2 M NaOH (12 ml) at 35°C under N2 for 2 h with magnetic

stirring. The mixture was filtered and the residue washed with

water. The filtrate obtained was acidified with 6 M HCl to pH 2–3 and

extracted with 3 3 30 ml CH2 CL2/ACOEt (1/1, v/v). The combined

organic extracts were dried (Na2SO4), evaporated under reduced

pressure and the final residue was dissolved in 1 ml CH2 CL2/

ACOEt. About 5 µl of the sample solution was silylated and

analysed by GC-MS as described previously (Lapierre et al., 1986).

Acknowledgments

We are grateful to A. Boudet and B. Atlan for performing lignin

analysis, B. Pollet for carrying out the GC-MS analysis, C. Guez

for excellent technical assistance, and M. Clemenz, M. Tamasloukh

and V. Vernoud for their help with transgenic plant analysis. We


are also indebted to H. Bailleres (CIRAD foret, Montpellier, France)

for his advice with the mechanical analysis of plants, A. Moisan

(INRA) for her help with statistical analysis of the results, and J.P.

Biolley (Universite de Pau) for communicating unpublished results.

The authors thank D. Goffner for her critical reading of the

manuscript and M. Seletti for reviewing the English version. J. P.

was supported by a doctoral fellowship from the Ministere de

l’Enseignement Superieur et de la Recherche.

The work was financially supported by the European Commis-

sion, DG XII, FAIR Programme (Contract n°FAIR-CT95–0424), the

Conseil Regional Midi Pyrenees, the Centre National de la Recher-

che Scientifique and the Universite Paul Sabatier (Toulouse).

References

Atanassova, R., Favet, N., Martz, F., Chabbert, B., Tollier, M.-T.,

Monties, B., Fritig, B. and Legrand, M. (1995) Altered lignin

composition in transgenic tobacco expressing O-

methyltransferase sequences in sense and antisense

orientation. Plant J. 8, 465–477.

Bate-Smith, E.C. (1962) The phenolic constituents of plants and

their taxonomic significance. J. Linn. Soc. (Bot.), 58, 95–173.

Baucher, M., Chabbert, B., Pilate, G. et al. (1996) Red xylem

and higher lignin extractability by down-regulating a cinnamyl

alcohol dehydrogenase in poplar. Plant Physiol. 112, 1479–1490.

Bevan, M. (1984) Binary Agrobacterium vectors for plant

transformation. Nucl. Acids Res. 12, 8711–8721.

Bolwell, G.P. (1993) Dynamic aspects of the plant extracellular

matrix. Int. Rev. Cytol. 146, 261–324.

Boudet, A.M. and Grima-Pettenati, J. (1996) Lignin genetic

engineering. Mol Breed, 2, 25–39.

Bradford, M.M. (1976) A rapid and sensitive method for the

quantitation of microgram quantities of protein utilizing the

principle of protein-dye binding. Anal. Biochem. 72, 248–254.

Campbell, M.M. and Sederoff, R. (1996) Variation in lignin content

and composition. Plant Physiol. 110, 3–13.

Carpita, N., MacCann, M. and Griffing, L.R. (1996) The plant

extracellular matrix: news from the cell’s frontier. Plant Cell, 8,

1451–1463.

Chiang, V.L., Puumala, R.J. and Takeuchi, H. (1988) Comparison

of softwood and hardwood kraft pulping. Tappi, 71, 173–176.

Dean, C., van den Elzen, P., Tamaki, S., Dunsmuir, P. and

Bedbrook, J. (1985) Differential expression of the eight genes

of the petunia ribulose bisphosphate carboxylase small subunit

multi-gene family. EMBO J. 4, 3055–3061.

Dence, C.W. (1992) The determination of lignin. In Methods in

Lignin Chemistry (Lin, S.Y. & Dence, C.W., eds). Berlin: Springer-

Verlag, pp. 31–70.

Dixon, R.A., Lamb, C.J., Masoud, S., Sewalt, V.J.H. and Paiva, N.L.

(1996) Metabolic engineering: prospects for crop improvement

through the genetic manipulation of phenylpropanoid

biosynthesis and defense responses – a review. Gene, 179,

61–71.

Douglas, C.J., Lee, D., Kyun Ro, D., Chapple, C. and Meyer, K.

(1997) Down-regulation of 4-coumarate:CoA ligase (4CL): Effect

on lignin composition and implications for the control. of

monolignol. biosynthesis. Second International Wood

Biotechnology Symposium, 10–12 March 1997, Canberra,

Australia.

Elkind, Y., Edwards, R., Mavandad, M., Hedrick, S.A., Ribak, O.,

Dixon, R.A. and Lamb, C.J. (1990) Abnormal plant development

and down-regulation of phenylpropanoid biosynthesis in

transgenic tobacco containing a heterologous phenylalanine

ammonia-lyase gene. Proc. Natl. Acad. Sci. USA, 87, 9057–9061.


Feuillet, C., Lauvergeat, V., Deswarte, C., Pilate, G., Boudet,

A.M. and Grima-Pettenati, J. (1995) Tissue- and cell-specific

expression of a cinnamyl alcohol dehydrogenase promoter in

transgenic poplar plants. Plant Mol. Biol. 27, 651–667.

Goffner, D., Campbell, M.M., Campargue, C., Clastre, M.,

Borderies, G., Boudet, A. and Boudet, A.M. (1994) Purification

and characterization of Cinnamoyl-CoA: NADP Oxidoreductase

in Eucalyptus gunnii. Plant Physiol. 106, 625–632.

Halpin, C., Knight, M.E., Foxon, G.A., Campbell, M.M., Boudet,

A.M., Boon, J.J., Chabbert, B., Tollier, M.-T. and Schuch, W.

(1994) Manipulation of lignin quality by down-regulation of

cinnamyl alcohol dehydrogenase. Plant J. 6, 339–350.

Hartley, R.D. and Harris, P.J. (1981) Phenolic constituents of the

cell walls of dicotyledons. Biochem. Syst. Ecol. 9, 189–203.

Hibino, T., Takabe, K., Kawazu, T., Shibata, D. and Higuchi, T.

(1995) Increase of cinnamaldehyde groups in lignin of transgenic

tobacco plants carrying and antisense gene for cinnamyl alcohol

dehydrogenase. Biosci. Biotech. Biochem. 59, 929–931.

Higuchi, T. (1990) Lignin biochemistry: biosynthesis and

biodegradation. Wood Sci. Technol. 24, 23–63.

Higuchi, T., Ito, T., Umezawa, T., Hibino, T. and Shibata, D. (1994)

Red-brown color of lignified tissues of transgenic plants with

antisense CAD gene: wine-red lignin from coniferyl aldehyde.

J. Biotech. 37, 151–158.

Holsters, M., de Waele, D., Depicker, A., Messens, E., Van

Montagu, M. and Schell, J. (1978) Transfection and

transformation of Agrobacterium tumefaciens. Mol. Gen. Genet.

163, 181–187.

Horsch, R.B., Fry, J.E., Hoffmann, N.L., Eichholtz, D., Rogers,

S.G. and Fraley, R.T. (1985) A simple and general method for

transferring genes into plants. Science, 227, 1229–1231.

Iiyama, K. and Pant, R. (1988) The mechanism of the Maule Colour

reaction. Introduction of methylated syringyl nuclei into soft-

wood lignin. Wood Sci. Technol. 22, 167–175.

Iiyama, K. and Wallis, A.F.A. (1990) Determination of lignin in

herbaceous plants by an improved acetyl bromide procedure.

J. Sci. Food Agric. 51, 145–161.

Jacquet, G., Pollet, B., Lapierre, C., Mhamdi, F. and Rolando, C.

(1995) New ether-linked ferulic acid-coniferyl alcohol dimers

identified in grass straws. J. Agric. Food Chem. 43, 2746–2751.

Kajita, S., Katayama, Y. and Omori, S. (1996) Alterations in the

biosynthesis of lignin in transgenic plants with chimeric genes

for 4-coumarate: Coenzyme A ligase. Plant Cell Physiol. 37,

957–965.

Kay, R., Chan, A., Daly, M. and Mc Pherson, J. (1987) Duplication

of CaMV35S promoter sequences creates a strong enhancer for

plant genes. Science, 236, 1299–1302.

Kuc, J. and Nelson, O.E. (1964) The abnormal lignins produced

by the Brown-Midrib mutants of Maize. Arch. Biochem. Biophys.

105, 103–113.

Lacombe, E., Hawkins, S., Van Doorsselaere, J., Piquemal, J.,

Goffner, D., Poeydomenge, O., Boudet, A.M. and Grima-

Pettenati, J. (1997) Cinnamoyl-CoA Reductase, the first

committed enzyme of the lignin branch biosynthetic pathway:

cloning, expression and phylogenetic relationships. Plant J. 11,

429–441.

Lapierre, C. (1993) Applications of new methods for the

investigation of lignin structure. In Forage Cell Wall Structure

and Digestibility (Jung et al., eds). Madison: American Society

of Agronomy, pp. 133–166.

Lapierre, C., Rolando, C. and Monties, B. (1986) Thioacidolysis of

poplar lignins: identification of monomeric syringyl products

and characterisation of guaiacyl syringyl lignin fractions.

Holzforschung, 40, 113–118.


Lewis, N.G. and Davin, L.B. (1994) Evolution of lignan and

neolignan biochemical pathways. In Evolution of Natural

Products (Nes, D., ed.). Washington DC: ACS Symposium Series,

562, 202–246.

Luderitz, T. and Grisebach, H. (1981) Enzymic synthesis of lignin

precursors. Comparison of Cinnamoyl-CoA reductase and

Cinnamyl Alcohol:NADP1 dehydrogenase from spruce (Picea

abies L.) and soybean (Glycine max L.). Eur. J. Biochem. 119,

115–124.

MacKay, J., O’Malley, D. and Sederoff, R. (1995) A null mutation

in CAD (cinnamyl alcohol dehydrogenase) and its effect in

phenolic metabolism in pine. IUFRO, Ghent, 26–30 September

1995.

Monties, B. (1989) Lignins. In Methods in Plant Biochemistry (Dey,

P.P. & Harborne, J.B., eds). London: Academic Press, pp. 113–157.

Ralph, J., Quideau, S., Grabber, J.H. and Hatfield, R.D. (1994)

Identification and synthesis of new ferulic acid dehydrodimers

present in grass cell walls. J. Chem. Soc. (Perkin trans.), 1,

3485–3498.

Roberts, K. (1990) Structures at the plant cell surface. Curr. Opin.

Cell Biol. 2, 920–928.

Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular

Cloning: A Laboratory Manual. Cold Spring Harbor, New York:

Cold Spring Harbor Laboratory Press.

Sanderman, H. (1992) Plant metabolism of xenobiotics. Trends in

Biochem. Sci. 17, 82–84.

Schreiber, L. (1996) Chemical composition of casparian strips

isolated from Clivia miniata Reg. roots: evidence for lignin.

Planta, 199, 596–601.

Sederoff, R., Campbell, M., O’Malley, D., Whetten, R. (1994) Genetic

regulation of lignin biosynthesis and the potential modification

of wood by genetic engineering in loblolly pine. In Genetic

Engineering of Plant Secondary Metabolism (Ellis, B.E et al.,

eds), New York: Plenum Press, pp. 313–355.

Smart, C.C. and Amrhein, N. (1985) The influence of lignification

on the development of vascular tissue in Vigna radiata L.

Protoplasma, 124, 87–95.

Smith, C.J.S., Watson, C.F., Ray, J., Bird, C.R., Morris, P.C.,


Schuch, W. and Grierson, D. (1988) Antisense RNA inhibition of

polygalacturonase gene expression in transgenic tomatoes.

Nature, 334, 724–726.

Speer, E.O. (1987) A method of retaining phloroglucinol proof

lignin. Stain Technol. 62, 279–280.

Stockigt, J. and Zenk, M.H. (1975) Chemical syntheses and

properties of hydroxycinnamoyl-Coenzyme A derivatives.

Z. Naturforsch. 30c, 352–358.

Teulieres, C., Marque, C. and Boudet, A.M. (1994) Genetic

transformation of Eucalyptus. In Biotechnology in Agriculture

and Forestry, Vol. 29 Plant Protoplasts and Genetic Engineering

(Bajaj, Y.P.S., ed.). Berlin: Springer-Verlag, pp. 289–306.

Teutonico, R.A., Dudley, M.W., Orr, J.D., Lynn, D.G. and Binns,

A.N. (1991) Activity and accumulation of cell division-promoting

phenolics in tobacco tissue cultures. Plant Physiol. 97, 288–297.

Van Blockland, R., de Lange, P., Mol, J.N.M. and Kooter, J.M.

(1993) Modulation of gene expression in plants by antisense

genes. In Antisense Research and Applications (Lebleu, B., ed.).

Boca Raton: CRC Press, pp. 125–148.

Van der Krol., A.R., Lenting, P.E., Veenstra, J., van der Meer, I.M.,

Koes, R.E., Gerats, A.G.M., Mol, J.N.M. and Stuitge, A.R. (1988)

An anti-sense chalcone synthase gene in transgenic plants

inhibits flower pigmentation. Nature, 333, 866–869.

Van Doorsselaere, J., Baucher, M., Chognot, E. et al. (1995) A

novel lignin in poplar trees with a reduced O-methyltransferase

activity. Plant J. 8, 855–864.

Vance, C.P., Kirk, T.K. and Sherwood, R.T. (1980) Lignification as

a mechanism of disease resistance. Ann. Rev. Phytopath. 18,

259–288.

Watson, C.F. and Grierson, R. (1993) Antisense RNA in plants. In

Transgenic Plants: Fundamentals and Applications (Hiatt, A.,

ed.), pp. 255–281.

Whiting, P., Favis, B.D., St-Germain, F.G.T. and Goring, D.A.I.

(1981) Fractional separation of middle lamella and secondary

tissue from spruce wood. J. Wood Chem. Technol. 1, 29–42.

Yahiaoui, N., Marque, C., Myton, K.E., Negrel, J. and Boudet,

A.M. (1997) Impact of different levels of cinnamyl alcohol

dehydrogenase down-regulation on lignins of transgenic

tobacco plants. Planta, in press.

Down-regulation of Cinnamoyl-CoA Reductase induces significant changes of lignin profiles in...

Documents

Transcript of Down-regulation of Cinnamoyl-CoA Reductase induces significant changes of lignin profiles in...