Vol. 175, No. 9

Alterations of Highly Conserved Residues in the RegulatoryDomain of Nitrogen Regulator I (NtrC) of Escherichia coli

JOHN B. MOORE,t SHENG-PING SHIAU, AND LAWRENCE J. REITZER*

Program in Molecular and Cell Biology, University of Texas at Dallas,P.O. Box 830688, Richardson, Texas 75083-0688

Received 9 November 1992/Accepted 18 February 1993

Transcription of many nitrogen-regulated (Ntr) genes requires the phosphorylated form of nitrogenregulator I (NRI, or NtrC), which binds to sites that are analogous to eukaryotic enhancers. A highly conservedregulatory domain contains the site of phosphorylation and controls the function of NRI. We analyzed theeffects of substitutions in highly conserved residues that are part of the active site of phosphorylation of NRIin Escherichia coli. Fourteen substitutions of aspartate 54, the site of phosphorylation, impaired the responseto nitrogen deprivation. Only one of these variants, NRI D-54-->E (NRI-D54E), could significantly stimulatetranscription from ginAP2, the major promoter of the gInALG operon. Cells with this variant grew witharginine as a nitrogen source. Experiments with purified components showed that unphosphorylated NR,-D54Estimulated transcription. In contrast, substitutions at aspartate 11 were not as deleterious as those at aspartate54. Finally, we showed that NRI-K103R, in which arginine replaces the absolutely conserved lysine, isfunctionally active and efficiently phosphorylated. This substitution appears to stabilize the phosphoaspartateof NRI. The differences between our results and those from study of homologous proteins suggest that theremay be significant differences in the way highly conserved residues participate in the transition to the activatedstate.

Nitrogen regulator I (NR,) is an essential activator forgenes of the Ntr (nitrogen-regulated) regulon (18). The modelsystem for Ntr genes has been theglnALG operon. NR,, theglnG product, controls transcription from all three promot-ers ofglnALG (8, 27). NRI, in either its active conformationor its inactive conformation, represses expression initiatedfrom two minor promoters, glnAp1 and glnLp. The phos-phorylated form of NR, stimulates transcription fromglnAp2, the major promoter during nitrogen-limited growth(8, 21). NR, can be phosphorylated either by NRII, an

NRI-specific protein kinase (13, 21), or by acetylphosphatein a strain without NRII (7). Carbamoylphosphate, in theabsence of NR,,, can stimulate NRI-dependent transcriptionwith purified components (7), presumably by phosphorylat-ing NR,.

Transcription from glnAp2 requires RNA polymerasecomplexed to the minor sigma subunit, a (8, 11). Activa-tion requires a contact between RNA polymerase and DNA-bound NRI-phosphate (30, 42). NR,-phosphate can stimulatetranscription from sites that can be placed over 1,000 bpfrom the start site of transcription (23, 28, 45). In otherwords, these sites are analogous to eukaryotic enhancers.Activation appears to require cooperative binding of twomolecules of NR, to DNA (47). In addition to a contact withRNA polymerase, transcription from glnAp2 also requiresNR,-dependent hydrolysis ofATP (46). The ATPase activityof NRI is cooperative with respect to NR, concentration (46)and may require DNA binding (1).The various activities of NR, are contained within three

domains. The site of phosphorylation, aspartate 54, is withina regulatory domain (residues 1 to 120) with a high degree of

* Corresponding author. Electronic mail address: REITZER@UTDALLAS.EDU.

t Present address: Department of Microbiology and MolecularGenetics, University of California, Los Angeles, Los Angeles, CA90024.

homology to a family of proteins called response regulators(3, 39). A central domain (residues 140 to 380) contains thenucleotide-binding site and presumably interacts with RNApolymerase (9, 10). A carboxy-terminal domain (residues 400to 468) contains residues implicated in DNA binding (6) anddimerization (35).Two-component regulatory systems consist of environ-

mentally responsive protein kinases and response regulators(3, 39). The latter are highly homologous over a 120-residueregion (3, 39). Response regulators also exhibit functionalsimilarities. Purified CheA, the protein kinase for the re-

sponse regulator CheY, can phosphorylate NR,, and NRIIcan phosphorylate CheY (22). Aspartate 57 of CheY and theanalogous aspartate 54 of NR, are sites of phosphorylation(32, 33). The active site of phosphorylation for CheY, theonly response regulator for which a structure is known, is onthe carboxy edge of a P-sheet (38, 44). The residues thatconstitute this active site are analogous to aspartate 11,aspartate 54, and lysine 103 of NR,. The latter two residuesare absolutely conserved among response regulators. Theconserved aspartates of CheY have been proposed to forman acid pocket that binds Mg2+ (17, 44). Structural analysesshow that the conserved lysine interacts with residues in theacid pocket (38, 44). Phosphorylation of CheY has beenproposed to reposition the conserved lysine so that it inter-acts with the phosphate moiety of phosphoaspartate. Thisinteraction may stabilize the activated state of CheY (16, 44).

In this paper, we describe the effects of substitutions ofthree highly conserved residues within the regulatory do-main of NRI that are probably part of the active site ofphosphorylation. We characterized strains with 14 differentsubstitutions of aspartate 54 and analyzed four purified NR,variants. We also characterized two variants with differentsubstitutions of aspartate 11 and a variant with an arginine-for-lysine 103 substitution.

(This work was submitted by J. B. Moore in partial

2692

JOURNAL OF BACTERIOLOGY, May 1993, P. 2692-27010021-9193/93/052692-10$02.00/0Copyright X 1993, American Society for Microbiology

on March 14, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

VALTERATIONS IN REGULATORY DOMAIN OF NRI 2693

TABLE 1. Strains and plasmids

Strain or Genotype or Source orplasmid description reference

BL21(XDE3) hsdS gal (I(lacUVSp-gene 1 [of 40phage T7])

DH5a F- +80AlacZAM15 A(lacZYA- BRLUargF)U169 deoR recAl endl41hsdRl7(rK- MK-) supE44 thi-1gyrA96 reL41

LR1(XglnlO5-1) W3110 glnGlO::TnS 1('glnAp2- 34lacZ)

SPS1 LR1(XglnlO5-1) glnD99::TnlO 34W3110 laclq lacL8 IN(rrnD-rrnE)1 34YMC10 A(lacZYA-argF)U169 endAl 2

hsdRl7(rK- MK ) supE44 thi-1YMC11 YMC10 AglnALG2000 2pCB5 Derivative of pT7-7 containing This study

(D(+10-glnG)pLysE Contains gene for T7 lysozyme, 41

which inhibits T7 RNApolymerase

pSP37 4(lacUVSp-glnG3100) Ampr 34, 35

a BRL, Bethesda Research Laboratories.

fulfillment of the requirements for the degree of Ph.D. fromthe Molecular and Cell Biology Program, University ofTexas at Dallas, Richardson, Tex.).

MATERIALS AND METHODS

Cell growth and assay of glutamine synthetase. Nitrogen-rich, minimal medium contained W salts (31), 0.4% glucose,0.2% glutamine, and 0.2% (NH4)2SO4. Nitrogen-limited min-imal medium was the same, except that (NH4)2SO4 was

omitted. For plasmid-containing cells, 100 ,ug of ampicillinper ml was included in media. The growth and harvesting ofcells for enzymatic assays and the assay for glutamine

synthetase have been described previously (31). One unit ofenzyme activity is 1 nmol of product per min per mg ofprotein. The biosynthetic activity of glutamine synthetasedepends on the degree of covalent adenylylation. Under theconditions of the assay, modified glutamine synthetase andunmodified glutamine synthetase have the same enzymaticactivity.

Strains and plasmids. The genotypes of strains and plas-mids used in this study are listed in Table 1. Our referenceglnG+ strain was LR1/pSP37, which contains glnG3100.This allele contains a 2-amino-acid insertion outside theregulatory domain. The phenotype of LR1/pSP37 is identicalto that of a comparable strain with a completely wild-typeginG allele. Detailed descriptions of the construction ofglnGalleles with site-specific alterations are presented in Table 2.

Site-directed mutagenesis. Oligonucleotide-directed muta-genesis was performed on double-stranded plasmid DNA byone of two different procedures (14, 19). The syntheticoligonucleotides used to construct specific lesions are de-scribed in Table 3. All mutant plasmids were initiallyscreened for the addition or loss of a unique restrictionendonuclease site. For example, the screen for plasmidswithglnG3101 andglnG3102 was acquisition of a unique Sallsite, which was encoded by primer 2 (Table 3). After thisinitial screening, plasmids were digested with HaeIII, whichcuts the parental plasmid, pSP37, at 15 sites. The fragmentswere analyzed after electrophoresis in a 5% polyacrylamidegel. By this method, it was possible to detect small insertionsor deletions. Mutant plasmids with no obvious alterationswere sequenced by using the Sequenase 2.0 kit of UnitedStates Biochemical Corporation. Short fragments of DNAfrom the mutant ginG alleles were subcloned into an unmu-tagenized pSP37 for physiological studies or pCB5 for sub-sequent overexpression and purification of the NRI variants.The final constructs of most plasmids were obtained aftersubcloning between unique Asp718 and SmaI sites, whichcover glnG between codons 1 and 58.

TABLE 2. Site-specific mutations

Primer used forAllele Lesion Change Parental allele or source construction'

glnG3100 None None pSP37 NAbglnG3101 D11F GAT--+TTC glnG3100 2glnG3102 D1lT GAT--ACC glnG3100 2glnG3103 D54G GAT- yGGG glnG3100 3glnG3104 D54A GGG--)GCG glnG3103 3glnG3105 D54C GGG-->TGT glnG3103 6glnG3106 D54E GGG- GAA glnG3103 4glnG3107 D54H GGG-'CAA glnG3103 3glnG3108 D54K GGG--AAG glnG3103 4glnG3109 D54L GGG--1TTG glnG3103 3glnG3110 D54N GGG--+AAT glnG3103 5glnG3111 D54P GGG- CCC glnG3103 3glnG3112 D54Q GGG--CAG glnG3103 7glnG3113 D54S GGG-*TCA glnG3103 3glnG3114 D54T GGG-.ACC glnG3103 3glnG3115 D54V GGG--+GTf glnG3103 3glnG3116 D54Y GGG-*TAT glnG3103 3glnG3117 K103R AAA-*CGG glnG3100 8glnG3118 D11T-K1O3R C glnG3102 and glnG3117 NAglnG3119 D54E-K1O3R c glnG3106 and glnG3117 NAglnG3120 D54G-K1O3R - glnG3103 and glnG3117 NA

a See Table 3.b NA, not applicable.c For changes in the doubly altered glnG, see changes in the corresponding singly altered alleles.

VOL. 175, 1993

on March 14, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

2694 MOORE ET AL.

TABLE 3. Oligonucleotides

Primer Sequence" Comment

1 CCACTGCTTCATCGATAT For sequencing2 GGAACTATCG(AGC)(N)GTCGACTACCC D11X; complementary to RNA; creation of a Sail site changes

codon 10 from GAT to GAC (both code for aspartate)3 CATCCCGGGCATACGGATNNNTGAAAGCAGC D54X; complementary to RNA; creation of a SmaI site changes

codon 58 from CCG to CCC (both code for proline)4 GGGCATACGGATTT(CTG)TGAAAGCAGC D54Q, -E, Kb5 CCCGGGCATACGGAT(AG)(AT)7TGAAAGCAGC D54I, -Nb6 CCCGGGCATACGGAT(AGC)C(AG)TGAAAGCAGC D54C, -W, -Rb7 CCCGGGCATACGGAT(TC)TOTGAAAGCAG D54Qb8 GATTATCTGCCCCGGCCGTTTGATATC K103R; RNA-like sequence; creation of an EagI site changes

codon 103 from AAA (lysine) to CGG (arginine)a 5' to 3'. Nucleotides in boldface are part of the restriction site created. Italicized nucleotides indicate changes in the region of interest. The bases in

parentheses indicate designed redundancies. For example, for primer 2, (AGC) means the eleventh base was A, G, or C.b See comment for primer 3.

Overproduction and purification of NRI variants. NRIvariants were purified from BL21(XDE3)/pLysE cells (40,41) containing pCB5 or its mutant derivatives. BL21(XDE3)contains the lac promoter fused to a gene coding for T7 RNApolymerase. Plasmid pCB5, a derivative of pT7-7 (43),contains wild-type ginG under the control of the phage T7gene 10 promoter and Shine-Dalgarno sequence. (The con-struction of pCB5 will be described elsewhere.) MutantglnGalleles were subcloned into pCB5 by swapping PflMI-EcoRIfragments, which encompass ginG from codon 17 to beyondits 3' end. Induction by IPTG (isopropyl-3-D-thiogalactopy-ranoside) results in overexpression of NRI. Cells wereinoculated into 10 ml of Luria-Bertani broth supplementedwith 0.4% glucose, 0.2% glutamine, 25 ,ug of chloramphen-icol per ml, and 50 to 60 ,ug of ampicillin per ml and weregrown at 30°C with aeration. When cells reached late expo-nential phase, the culture was poured into a 6-liter flaskcontaining 600 ml of the same medium and incubated at 30°Cwith aeration. When cells reached a density of 4 x 108 to 5x 108 cells per ml, IPTG was added to a final concentrationof 1 mM. The cultures were incubated for an additional 3 h.The cells were collected by centrifugation and stored at-20°C. Two 1-ml samples were taken from the culture, oneimmediately before induction and one prior to harvesting.Soluble lysates of these samples were electrophoresed intoan sodium dodecyl sulfate (SDS)-8% polyacrylamide gel toascertain whether the induction had worked. When theinduction was successful, NRI was clearly visible in crudeextracts.NR, variants were purified by a modification of a previ-

ously described procedure (26). The steps through ammo-nium sulfate precipitation were performed as describedpreviously, except that NRI was precipitated with 40%ammonium sulfate instead of 35%. The supernatant wasdiscarded, and the pellet was gently resuspended in 20 to 40ml of HD (20 mM HEPES [N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid] [pH 7.5], 1 mM dithiothreitol) buffer.This mixture was loaded onto a 6-ml heparin agarose col-umn. The column was washed with 60 to 100 ml of HDbuffer. Protein was eluted with an HD-buffered, linear gra-dient from 0 to 0.8 M KCl, and 5-ml fractions were collected.Fractions were checked for NR, by polyacrylamide gelelectrophoresis (PAGE). The NRI-containing fractions werepooled, and NRI was precipitated with 40% ammoniumsulfate. The pellets were resuspended in 1 to 5 ml of HDbuffer containing 1 mM EDTA and 40% glycerol and dia-lyzed against three separate 500-ml volumes of the same

mixture. For NR, D-54--T (NRI-D54T), 150 mM KCl wasadded to the dialysis buffer to prevent precipitation. Evenwith this salt, precipitation was still evident. These small-scale preparations yielded 1 to 3 mg of NRI that was greaterthan 90% pure by visual inspection of a stained gel.

Phosphorylation of NRI in vitro. Protein phosphorylationreactions were performed in two steps and were essentiallypulse-chase experiments. For the first step, 125 nM NRII and5 ,uCi of undiluted [_y-32P]ATP (7,000 Ci/mmol) in lx tran-scription buffer (21) were incubated at 37°C in 25 ,ul for 5min. Then, 25 ti1 of lx transcription buffer containing NR,and unlabeled ATP (final concentration, 0.8 mM) was added,and the incubation was continued at 37°C. After 10 and 20min, 25-pl aliquots were removed, mixed with an equalvolume of ice-cold stop mix, and placed on ice. The stop mixwas 0.5% sodium pyrophosphate, 5% glycerol, and 1.8xSDS-PAGE sample buffer (20). The samples were thenloaded onto an SDS-8% polyacrylamide gel and electro-phoresed. After the bromophenol blue dye reached thebottom of the gel, the gel was exposed to Kodak XAR-11X-ray film for 8 to 20 h at -70°C.

Immunological assay of NR,. Immunological detection ofNRI has been described previously (35).

Transcription of gInAp2 with purified components. Tran-scription with purified components was performed essen-tially as described by Ninfa and Magasanik (21). Core RNApolymerase was purchased from Epicentre Technologies.Partially purified o5r was the generous gift of AlexanderNinfa (Wayne State University). We also purified a5' asdescribed elsewhere (11). The same results were obtainedwith both preparations. NRII was purified as describedpreviously (24). The DNA template was supercoiled pTH8(11), which contains a strong transcriptional terminator 308bases downstream from the start site of transcription fromglnAp2.The transcription reaction was performed in three steps.

Step 1 allowed binding of components to DNA. The buffercontained 50 mM Tris-HCI (pH 7.5), 100 mM KCl, 10 mMMgCl2, 1 mM dithiothreitol, and 0.1 mM EDTA. The othercomponents and their final concentrations were as follows:10 nM pTH8, 100 nM core RNA polymerase, 300 nM cra4,100 or 200 nM NR,, as indicated, and when appropriate, 200nM NRII. These components were mixed in a total volume of17.5 ,ul and incubated at 37°C for 10 min. Step 2 involvedaddition of 2.5 pl of ATP (final concentration, 4 mM) and,when indicated, either carbamoylphosphate or ddATP (finalconcentrations, 10 and 0.8 mM, respectively). This mixture

J. BACTERIOL.

on March 14, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

ALTERATIONS IN REGULATORY DOMAIN OF NRI 2695

TABLE 4. Characteristics of gInG' and mutant strainsa

GS activity (U) in cells grown in': Growth with the following sole nitrogen sourced:

NRI N-limiting N-rich Protein stability'medium medium Arginine Alanine NH4+ Aspartate

Wild typee 4,670 715 (3) 260± 62 (3) + + + + +K103R 4,490 ± 210 (2) 655 ± 35 (2) + + + + +D54E 900 250 (5) 370 ± 59 (3) + -/+ + + +

D1lT 690 33 (2) 120 2 (2) -/+ - -/+ + +D54G-K1O3R 450± 67 (2) 200 1 (2) ND - - + +D54E-K1O3R 335 ± 55 (2) 150 ± 10 (2) ND - -/+ + +D54Y 250 25 (3) 46 2 (4) + - - + +D11F 230 0.5 (2) 47 4 (2) + - - -/+ +D54P 175 5 (2) 275 5 (2) - - - + +D54S 156± 14 (2) 280 0 (2) - - - + +None 150 ± 35 (7) 250 ± 27 (4) NA - - + +

D54K 103 28 (3) 60 6 (2) + - - -/+ +D54T 95 ± 18 (4) 30 ± 2 (2) + - - -/+ -/+D54N 50 ± 15 (4) 15 ± 2 (2) + - - -/+ -/+D11T-K1O3R 30 ± 7 (2) 78 ± 7 (2) ND - - -/+ -/+

D54C 22 ± 6 (2) 15 ± 2 (2) ND - - - -D54G <20 (2) 12 ± 2 (2) + - - - -D54Q 19 ± 2 (2) <7 (2) ND - - - -D54V <16 (2) <12 (2) ND - - - -D54A <10 (2) <10 (2) ND - - - -D54H <10 (2) <10 (2) ND - - - -D54L <10 (2) 8 ± 1 (2) ND - - - -

a All strains are derivatives of LR1/pSP37, except for the cells without NRI, which are LR1/pBR322.b Nitrogen-limiting medium contains 0.2% glutamine as the sole nitrogen source. All mutants can grow in this medium. Nitrogen-rich medium contains both

0.2% glutamine and 0.2% (NH4)2SO4. The values are specific activities ± standard deviations, with the number of determinations in parentheses. For values withonly two determinations, the standard deviation is equivalent to the range. Although most mutants could not grow in many nitrogen-limited media, all mutantscould grow in one special nitrogen-limited medium, in which glutamine was the sole source of nitrogen. In wild-type cells, growth with glutamine as a nitrogensource induces glutamine synthetase (GS) from gl1nAp2. However, even glutamine auxotrophs (when glnAp2 is inactive and glnAp4 is repressed) or cells withoutNR1 can grow in this medium.

C Data for the assay whose results are shown in Fig. 1. +, level of antigen comparable to that for cells with wild-type NRI; -/+, detectably less NRI than thelevel observed for the reference strain, LR1/pSP37; -, no detectable NRI; ND, not determined; NA, not applicable.

d Cells were grown with the indicated sole source of nitrogen at 0.2% on agar plates. +, growth not detectably different from that of LR1/pSP37; -/+, slowergrowth; -, no growth.

Wild-type NRI is encoded by pSP37.

was incubated for 17 min to allow formation of open com-

plexes. For the third step, 5 jtl of a labeling mixturecontaining heparin (final concentration, 150 jug/ml), 0.5 mMCTP, 0.5 mM UTP, 0.1 mM unlabeled GTP, and 10 piCi of[a-32P]GTP (650 Ci/mmol) was added and the incubation at370C was continued for an additional 12 min. Reactions werestopped by addition of an equal volume of 50 mM EDTA,350 mM NaCl, and 100 pug of tRNA per ml. Protein was

removed by phenol extraction. The RNA was precipitatedwith ethanol, subjected to electrophoresis in a 4% poly-acrylamide-7 M urea gel, and detected by autoradiography.

RESULTSPhenotypes of reference strains. Our purpose was to ana-

lyze the effects of alterations of aspartate 11, aspartate 54,and lysine 103 of NR,. Analysis of the phenotypes of strainswith these alterations would be complicated if ginG were

expressed from the glnALG operon. NR,, the ginG product,regulates transcription from all three promoters of theoperon. To eliminate this difficulty, we utilized strains inwhich the only functional ginG gene was expressed from a

plasmid. Our reference ginG' strain was LR1/pSP37 (35),which contains a fusion of the lacUV5 promoter toglnG3100. Our reference ginG strain was LR1/pBR322,which lacks NR,.

We characterized our mutants for (i) ginA expression, (ii)the steady-state level of NRI polypeptide, and (iii) growthwith arginine, alanine, ammonia, or aspartate as the solenitrogen source. For nitrogen-limited cells of LR1/pSP37,ginA is transcribed from the ginAp2 promoter. The mostsensitive measure of transcription from ginAp2 is assay ofglutamine synthetase (the product of chromosomal ginA)from nitrogen-limited cells grown without IPTG (34, 37).Compared with a completely wild-type strain for this growthcondition, LR1/pSP37 has slightly less NRI but 50% more

glutamine synthetase (37). One factor that contributes to thesteady-state level of glutamine synthetase is the inhibition ofginA expression by increasing the concentration of NR, (37).Since all assays were performed for cells grown with a

slightly lower concentration of NR, than that in a wild-typestrain, this inhibition should have only a minimal effect, ifany, on ginA expression.We further characterized the phenotypes of our reference

strains to determine the validity of their use for analysis ofsite-specific alterations. Nitrogen-limited cells of LR1/pSP37have 18 times more glutamine synthetase than cells grown innitrogen-rich medium (Table 4). This result indicates thatginA expression responds to the quality of the nitrogensource (Table 4). In the absence of NRI (that is, in cells withLR1/pBR322), ginA is transcribed from the NR,-repressible

VOL. 175, 1993

on March 14, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

2696 MOORE ETAL.J.BTEOL

w 0 W z A. cn04 a v a a a a0 7Z kn5 04 (A Q 0 0 0 = 01 2 3 4 5 6 7 8 9 10

.0I- 4 ".

11 12 13 14 15 16 17 18

FIG. 1. Immunological assay of NR1. Plasmid-containing cells of

LR1 were grown with 1 mM IPTG to a density of about 5 x 108 cells

ml-'. The substitutions within NR1 are indicated. WT (lanes 1 and

11), cells containing pSP37. Cells without NR, (lanes 2 and 12)contained pBR322 instead of a glnG-encoding plasmid. Lane 3 was

loaded with 100 ng of purified NRI, which was used as a standard

(STD); lane 4 was empty. All cells, except for the extract loaded into

lane 18, were grown in nitrogen-rich medium (see Materials and

Methods). Cells for the extract in lane 18 were grown in nitrogen-limited medium. Forty micrograms of cellular protein was loaded

into each lane except that containing purified NRI.

glnAp1 promoter. Glutamine synthetase from nitrogen-lim-ited cells of LR1/pBR322 was 4% of that from LR1/pSP37(Table 4). Expression above this level unambiguously estab-

lishes transcription from glnAp2To assess whether NR, lability could account for the

phenotypes of our mutants, we characterized most strains

with a single alteration in ginG for NR, polypeptide by an

immunological assay. This measurement was made for cells

grown with 1 mM IPTG (in contrast to other experimentsdescribed in this paper). Figure 1 shows that NR, is detect-

able in our reference glnG' strain (lanes 1 and 11) but absent

from the ginG strain (lanes 2 and 12). We interpret the results

of this assay as providing only a qualitative indication of NR,concentration; a slight quantitative instability would be

undetectable by this method and may have a profound effect

on cells with much lower NR,.LR1/pSP37 grown without IPTG can utilize arginine,

alanine, or other compounds as sole nitrogen sources. In

other words, LR1/pSP37 has an Ntr' phenotype. LR1/

pBR322 grew with either ammonia or aspartate as a nitrogensource. These cells are glutamine prototrophs because of

transcription from glnApl. (It was a surprise that LR1/

pBR322 grew with aspartate as a nitrogen source. The

degradation of aspartate will be the subject of a future

article.) However, such cells cannot utilize either arginine oralanine and are, therefore, Ntr-. In summary, our glnG'reference strain and a completely wild-type strain have verysimilar phenotypes. Furthermore, the use of cells with aginG allele on a plasmid minimizes complications due toautogenous regulation.

Phenotypes of strains with substitutions of aspartate 54. Wecharacterized strains with 14 different substitutions of aspar-tate 54 of NR,, the site of phosphorylation. Table 4 summa-rizes these results, which are ordered by the level of glu-tamine synthetase from nitrogen-limited cells.Only two mutants, those with either NR,-D54E or NR1-

D54Y, had more glutamine synthetase than cells withoutNR1. Glutamine synthetase in cells with NR,-D54E (900 U)was six times higher than that in LR1/pBR322 (150 U).Although this strain had only 20% of the glutamine syn-thetase compared with a comparable glnG ' strain (4,670 U),the mutant was Ntr+. In contrast, the NR,-D54Y mutant wasNtr- and utilized the same nitrogen sources as a strainwithout NR1. In nitrogen-limited cells with NR1-D54Y, glu-tamine synthetase (250 U) was only 67% higher than in aginG null mutant. However, the phenotype of this mutantdiffered from that of a ginG null mutant. For cells withNR,-D54Y grown in nitrogen-rich medium, glutamine syn-thetase (46 U) was much lower than that from the ginG nullmutant (250 U). This result implies that NR1-D54Y repressedtranscription from the glnAp1 promoter. In addition, NRr-D54Y is easily detectable in cells grown in either nitrogen-limited medium or nitrogen-rich medium (Fig. 1, lanes 14 and18) and is, therefore, a stable protein. The purification andcharacterization of NR,-D54E and NR,-D54Y are describedbelow.

Mutants with substitution of proline or serine for aspartate54 had a phenotype indistinguishable from that of cellswithout NRI (Table 4). Therefore, it is not surprising thatNR,-D54P and NR,-D54S were not detectable in cell extracts(Fig. 1, lanes 9 and 10).When alanine, cysteine, glycine, histidine, leucine, glu-

tamine, or valine replaced aspartate 54, cells had extremelylow or undetectable levels of glutamine synthetase. Thesemutants were glutamine auxotrophs (Gln-) (Table 4). Glu-tamine auxotrophy results from the absence of transcriptionfrom glnAP2 and NR1-dependent repression of glnApl. Thecomplete repression of glnAp1 implies the synthesis of astable protein. The detection of NRI-D54G in extracts (Fig.1, lane 6) confirmed this conclusion.

Cells with NR,-D54K, NR,-D54N, or NRI-D54T had lowbut detectable glutamine synthetase (Table 4). Such cellsgrew slowly with either ammonia or aspartate as the solenitrogen source (Table 4). These cells became glutamineauxotrophs when the intracellular concentration of theseNR, variants was increased by adding 0.1 or 1.0 mM IPTG tothe growth medium. Therefore, the phenotype of thesestrains results from the absence of transcription from glnAP2and incomplete repression of glnApl. The level of NR,polypeptide was similar to that in the reference glnG strain(Fig. 1, lanes 7, 8, and 13).

Phenotypes of strains with aspartate 11 substitutions. Wecharacterized only two mutants with substitutions of aspar-tate 11, and both were Ntr- (Table 4). In cells with NR,-D11F, nitrogen limitation induced a fivefold increase inglutamine synthetase, although the level of glutamine syn-thetase was only about 50% higher than that in cells withoutNRI. NRj-D11F was stable (Fig. 1, lane 15). In cells withNR1-D11T, nitrogen deprivation resulted in a sixfold in-crease in glutamine synthetase; the level of glutamine syn-

J. BACTERIOL.

on March 14, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

ALTERATIONS IN REGULATORY DOMAIN OF NRI 2697

TABLE 5. Effect of mutations in ginD on regulation ofginA expressiona

GS activity (U)NRI

glnD+ ginD mutant

Wild type 4,670 ± 715 (3) 647 ± 16 (3)K103R 4,490 ± 210 (2) 2,740 ± 157 (4)D54E 900 ± 250 (5) 755 ± 5 (2)D1lT 690 ± 33 (2) 120 ± 8 (2)D54Y 250 ± 25 (3) 138 ± 18 (2)None 150 ± 35 (7) 124 ± 7 (4)

a See Table 4, footnote b, for a description of the nitrogen-limited mediumused for cell growth and Table 2 for the plasmids used as the sources of NRI.These plasmids were in either LR1 (glnG glnD+) or SPS1 (glnG ginD). Thevalues for glutamine synthetase (GS) are specific activities ± standarddeviations, with the number of determinations in parentheses.

thetase was four times higher than that in a ginG strain butequaled only 15% of the glutamine synthetase level in acomparable ginG' strain. Nonetheless, these results unam-biguously establish that NRj-D11T stimulates transcriptionfrom glnAp2. Unexpectedly, there was less NR,-DllT inthese cells than NR, in comparably grown cells with wild-type NRI, suggesting that NR,-DllT was less stable (Fig. 1,lane 16).Replacement of arginine for lysine 103. Lysine 103 is

absolutely conserved among response regulators (39). Theinteraction between this conserved lysine and phosphoas-partate has been proposed to stabilize the active conforma-tion of CheY, a response regulator homologous to NR, (16).We examined the effect of an arginine-for-lysine 103 substi-tution to determine whether this alteration had a similareffect on NR,. A strain with NRI-K103R grew on the samenitrogen sources as a comparable glnG+ strain (Table 4).NR,-K1O3R induced glutamine synthetase to the same levelas wild-type NRI during nitrogen starvation. However, NR,-K103R-containing cells grown in nitrogen-rich medium had2.5 times more glutamine synthetase than that from cellswith a wild-type ginG allele.We also examined the effect of the D54E, D54G, and DilT

substitutions in combination with K103R (Table 4). Alldouble mutants were Ntr-. Glutamine synthetase in cellswith a D11T-K1O3R or D54E-K1O3R double substitution waslower than that in cells with a DllT, D54E, or K103R singlesubstitution. Curiously, cells with NR,-D54G-K1O3R hadthree times more glutamine synthetase than cells withoutNRI. In other words, the K103R substitution partially sup-pressed the D54G substitution.

Regulation of glnA in DllT, D54Y, D54E, and K103Rmutants. We examined the regulation of glnA in single-substitution mutants that had more glutamine synthetasethan LR1/pBR322. The mutant glnG alleles were placed in aglnD mutant strain, and glutamine synthetase in nitrogen-limited cells was assayed (Table 5). Compared with glnD+glnG+ cells, glnD glnG+ cells have less glutamine syn-thetase, because NRII will stimulate the dephosphorylationof NR,-phosphate (29) (Table 5). Therefore, if the glnDmutation affects glutamine synthetase in a strain with an NRIvariant, then we could conclude that NR,,-dependent phos-phorylation regulates glnA expression. In cells with eitherwild-type NRI or NRj-D11T, the mutation in ginD dimin-ished glutamine synthetase sevenfold. In contrast, in cellswith NR,-D54E or NR,-K1O3R, the ginD mutation resultedin only slightly less glutamine synthetase. In other words,wild-type NRI and NR,-DllT were more sensitive to NRII-

dependent dephosphorylation than NRI-D54E and NRI-K103R.There is a 2.5-fold difference in glutamine synthetase for

the NRI-D54E mutant between nitrogen-limited cells andnitrogen-rich cells (Table 4). In wild-type cells, NRII con-trols the magnitude and speed of the response of ginAtranscription to shifts in nitrogen availability (27). WithoutNRII-dependent regulation, cells do respond to nitrogenstarvation, but the response is slow. To determine the speedof this residual regulation and whether this regulation is NRI1dependent, we examined the response of cells with eitherwild-type NRI or NRI-D54E to sudden nitrogen deprivation(Fig. 2). Cells with wild-type NRI responded rapidly tonitrogen starvation, whereas cells with NRI-D54E did notappear to respond. (We do not consider the fluctuations inglutamine synthetase for cells with NR,-D54E to be signifi-cant. The initial drop in glutamine synthetase was not seen inother experiments.) In summary, there is no evidence thatNRII regulates NR,-D54E-dependent activation.

Purification and characterization of NRI-D54E, NRI-D54N,NRI-D54T, and NR,-D54Y. We purified NRI-D54E, NRI-D54N, NRI-D54T, NRI-D54Y, and wild-type NR, after over-production from a phage T7 expression system. NRI-D54E,NRI-D54N, and NRI-D54Y were purified without difficulty.However, purification of NR,-D54T required the presence of150 mM KCl to hinder precipitation. Aggregation of NRI-D54T dimers in vivo could account for the inability ofNRI-D54T to completely repress the glnAp1 promoter. Aquantitative mobility shift assay demonstrated that NRI-D54N and NRI-D54E bound to DNA as well as wild-typeNRI (36).We examined the phosphorylation of these purified NRI

variants by NRII. NRII did not detectably phosphorylateNR,-D54T or NR,-D54Y (Fig. 3), even though threonine andtyrosine are potentially phospho-accepting residues. NRI-D54E and NRI-D54N were detectably phosphorylated, al-though to only about 2% of the level observed with wild-typeNRI. NRI-D54E stimulated dephosphorylation of NRII-phosphate to a greater extent than the other variants, al-though not as well as wild-type NRI. These results suggestthat NRI-D54E is phosphorylated but that the phosphoryla-tion is less stable than that of wild-type NRI-phosphate.NR,-D54E and NRI-D54Y were tested for their abilities to

stimulate transcription with purified components, becausecells with these variants had more glutamine synthetase thancells without NRI (Table 4). We did not detect NR,-D54Y-dependent transcription from ginAp2 with or without phos-phorylating agents (Fig. 4). However, it is possible that theability of purified NRI-D54Y to stimulate transcription isbelow the detection limit of a complex transcription assay.In contrast, purified NR,-D54E could stimulate transcriptionfrom ginAp2. This transcription did not require NRII orcarbamoylphosphate (Fig. 4). NRII or carbamoylphosphateactually inhibited NRI-D54E-dependent transcription. Theseresults should be contrasted with those for wild-type NRI,for which transcription required either NRII-dependentphosphorylation or phosphorylation by carbamoylphosphate(Fig. 4). Wild-type NRI-phosphate activated transcriptionbetter than NR,-D54E (Fig. 4). This result correlates wellwith our results for whole cells (Table 4) and implies that thereconstituted system reflects results in vivo reasonably well.

DISCUSSION

Substitutions at aspartate 54, the site of phosphorylation.As would be expected for the site of phosphorylation,

VOL. 175, 1993

on March 14, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

2698 MOORE ET AL.

700 1wild-type NRI

600 -

500 1

400 1-

NRi-D54E300 F-

200 1-

100 -

0 100 200 300

Minutes after addition of 0.1% alanineFIG. 2. Response of cells with wild-type NRI or NRI-D54E to sudden nitrogen deprivation. LR1/pSP37 (wild-type NRI) or isogenic cells

containing NRI-D54E were grown in 75 ml of minimal medium with W salts, 0.4% glucose, 0.2% (NH4)2SO4, and appropriate antibiotics withaeration at 30'C. When cells reached a density of about 2 x 108 cells ml-', 10% alanine was added to a final concentration of 0.1%. Thisconcentration of alanine has been shown to induce glutamine synthetase (GS) even in ammonia-containing medium (25). AginG mutant failsto grow in such medium (25). Alanine was added at time zero (arrows). Ten-milliliter aliquots were removed at the indicated times and assayedfor glutamine synthetase. The drop in glutamine synthetase activity for cells with NR,-D54E after addition of alanine was not seen in a repeatof this experiment.

substitutions at aspartate 54 of NRI were always detrimental.Thirteen of the 14 substitutions of aspartate 54 resulted in anNtr- phenotype and cells that could not significantly induceglutamine synthetase (Table 4). All of the nonconservativehydrophobic substitutions (alanine, glycine, leucine, ty-rosine, and valine) of aspartate 54 resulted in stable variantsthat completely repressed glnAp1 and resulted in glutamineauxotrophy. In other words, these variants bound tightly toDNA. The mechanism that accounts for this rough correla-tion cannot be determined with certainty. However, if thestructures of CheY and the regulatory domain of NRI aresimilar, then there will be a hydrogen bond between aspar-tate 10 and aspartate 54 of NR,, which is the last bondbetween P-strands 1 and 3 (44). It is possible that hydropho-bic substitutions at aspartate 54 limit solvent accessibility,

NRi - p

NRII -4

1 2 3 4 5 6 7 8 9 10 11 12WT D54Y D54N D54E D54T none

FIG. 3. NRII-dependent phosphorylation of NRI. The purifiedNRI variants were phosphorylated as described in Materials andMethods. Odd lanes and even lanes, 10- and 20-min reactions,respectively. The concentration of NRI was 4 ,uM, except forNRI-D54T, whose concentration was 1 ,uM. WT, wild type.

stabilize this hydrogen bond, and thereby stabilize theP-sheet, which is the central feature of CheY.The one substitution of the site of phosphorylation that

resulted in cells with an Ntr+ phenotype was glutamate foraspartate. However, even this mutant was defective, be-cause it responded slowly to changes in nitrogen availability(Fig. 2). Our results show that unphosphorylated NR,-D54Ecan stimulate transcription from glnAp2 (Fig. 4). Unexpect-edly, phosphorylating agents (NRIJ or carbamoylphosphate)inhibited NRI-D54E-dependent transcription (Fig. 4). De-spite the possibility of phosphorylation, we conclude thatNRI-D54E is not significantly phosphorylated in vivo, be-cause three different conditions that have enormous effectson the degree of phosphorylation of wild-type NR, had noeffect on ginA expression in cells with NRI-D54E (Tables 4and 5 and Fig. 3). In addition to NRI-D54E, NRI-D54G-K103R, which is unlikely to be phosphorylated, also stimu-lated ginA expression. A possible explanation for the activ-ities of these variants is that the changes lowered the energybarrier between the active and inactive conformations. If so,then a fraction of these variant molecules may assume anactivated conformation in the absence of phosphorylation.Three variants, NRI-D54K, NR,-D54N, and NRI-D54T,

could not activate transcription from glnAp2 and could notcompletely repress glnAp1 in vivo (Table 4). The inability tocompletely repress ginAp1 may result from either structuralinstability or diminished specific binding to DNA. Theaggregation of purified NRI-D54T could account for dimin-ished binding. However, it is more difficult to account for the

J. BACTERIOL.

on March 14, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

ALTERATIONS IN REGULATORY DOMAIN OF NRI 2699

AddATP -- --

CP ----

NR11 + + + +

NRI c W F

12 3 4

B

-

567

C

N -4 N

8 9 10 11 12

396-

285

250

230-

FIG. 4. Transcription with purified components. Transcriptionfrom glnAp2 results in a transcript of 308 bases. Details of thereactions are described in Materials and Methods. The nanomolarconcentrations of NR, are indicated. (A) Transcription from glnAp2in the presence of NRII; (B) results of carbamoylphosphate-depen-dent activation in the absence of NR,,; (C) results of transcription inthe absence of either NR,, or carbamoylphosphate. The purpose ofthe ddATP is to promote open complex formation as previouslydescribed (45). Numbers represent the location of single-strandedDNAs with the indicated number of bases. WT, wild type.

phenotype of NR,-D54N. Purified NR,-D54N bound to DNAas well as wild-type NR, (36). A qualitative immunologicalassay suggests that the NRI polypeptide from these mutantsgrown with 1 mM IPTG was as stable as wild-type NRI (Fig.1, lanes 7, 8, and 13). Instability of NR,-D54N that is belowthe detection limit of the immunological assay could accountfor this phenotype. (Remember that the growth phenotypeand the level of glutamine synthetase were determined forcells grown without IPTG, but the assay for stability wasdetermined for cells grown with 1 mM IPTG.) A morecomplex alternative postulates that cooperative binding ofNR, to two high-affinity sites is required for completerepression of glnApl. Our DNA-binding assay would notdetect a defect in cooperative binding.

Substitutions of aspartate 11. Substitutions of aspartate 11were not invariably as deleterious as those of aspartate 54.Glutamine synthetase could be induced in cells with NRI-DilT (Table 4). This result is sufficient to establish thatNR,-DllT stimulates transcription from glnAp2. The re-sponse to nitrogen starvation (Table 4) and the response to aginD mutation, which implies regulation by NR,, (Table 5),strongly suggest that NR1-D11T is phosphorylated.NRI-K103R and the stability of phosphorylation. The sub-

stitution of arginine for lysine 103, which is absolutelyconserved, only subtly affected the response to nitrogenstarvation. NRI-dependent glnA expression in vivo washigher with NR,-K1O3R than with wild-type NRI underconditions that should result in the dephosphorylation of

NR,-phosphate: growth in nitrogen-rich medium (Table 4)and growth in aginD mutant (Table 5). These results suggestthat NRI-K103R is readily phosphorylated but that thephosphorylation is more stable than that for wild-type NRI.An analogous substitution in CheY also resulted in stabili-zation of phosphoaspartate (16). These results strongly sug-gest that the highly conserved lysine and the arginine sub-stitution have similar roles in the autophosphatase activitiesof both NRI and CheY. In other words, the autophosphataseactivity in most response regulators may involve the sameinteractions between the highly conserved lysine and otherconserved residues.Comparison with other response regulators. Substitutions

similar to those described in this work destroyed the re-sponses controlled by the homologous response regulators,CheY, VirG, and OmpR (4, 5, 12). There are two importantexceptions: NRI-D54E and NRI-K103R. The NRI variantsare still functional, unlike the analogous CheY variants.Furthermore, cells with NRI-D54E or NRI-K103R wereNtr+, whereas the analogous substitutions in CheY resultedin a defect in chemotaxis. Two explanations could accountfor this phenotypic difference. First, CheY is a monomer,but NRI is a dimer, which tetramerizes during transcriptionalactivation (47). The higher orders of structure of NR, mayminimize the effects of some structural perturbations. Alter-natively, the phenotypic difference may be a consequence ofthe different functions of phosphorylation in CheY and NRI.The regulatory domain of NR, appears to inhibit the activityof the central domain, which interacts with RNA polymeraseand stimulates transcription (15). When the regulatory do-main of NRI is phosphorylated, the inhibition is relieved.The regulatory domain may play no further role in transcrip-tional activation. If so, then minor alterations in the phos-phorylated regulatory domain of NR, would not affect acti-vation. In contrast, phosphorylated CheY directly interactswith CheZ and a protein of the flagellar motor (39). Minoralterations in CheY structure may profoundly affect theseprotein-protein interactions. Therefore, despite commonmechanisms of phosphotransfer and autodephosphorylation,the ways in which the conserved lysine and interactingresidues participate in the transcription to the phosphoryla-tion-induced active state may differ significantly.

ACKNOWLEDGMENTS

This work was supported by Public Health Service research grantGM38877 from the National Institute of General Medical Sciences toL.J.R.We are grateful to Catherine Bailey for editorial assistance and

preparation of the figures and tables and to M. Ann Harris and JillWadas for preparation of the manuscript.

REFERENCES

1. Austin, S., and R. Dixon. 1992. The prokaryotic enhancerbinding protein NtrC has an ATPase activity which is phosphor-ylation and DNA dependent. EMBO J. 11:2219-2228.

2. Backman, K., Y.-M. Chen, and B. Magasanik. 1981. Physicaland genetic characterization of the glnA-glnG region of theEschenchia coli chromosome. Proc. Natl. Acad. Sci. USA78:3743-3747.

3. Bourret, R. B., K. A. Borkovich, and M. I. Simon. 1991. Signaltransduction pathways involving protein phosphorylation inprokaryotes. Annu. Rev. Biochem. 60:401-441.

4. Bourret, R. B., J. F. Hess, and M. I. Simon. 1990. Conservedaspartate residues and phosphorylation in signal transduction bythe chemotaxis protein CheY. Proc. Natl. Acad. Sci. USA

VOL. 175, 1993

on March 14, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

2700 MOORE ET AL.

87:41-45.5. Brissette, R. E., K. Tsung, and M. Inouye. 1991. Suppression of

a mutation in OmpR at the putative phosphorylation center by amutant EnvZ protein in Eschenchia coli. J. Bacteriol. 173:601-608.

6. Contreras, A., and M. Drummond. 1988. The effect on thefunction of the transcriptional activator NtrC from Klebsiellapneumoniae of mutations in the DNA-recognition helix. NucleicAcids Res. 16:4025-4039.

7. Feng, J., M. R. Atkinson, W. McCleary, J. B. Stock, B. L.Wanner, and A. J. Ninfa. 1992. Role of phosphorylated meta-bolic intermediates in the regulation of glutamine synthetasesynthesis in Escherichia coli. J. Bacteriol. 174:6061-6070.

8. Hirschman, J., P.-K. Wong, K. Sei, J. Keener, and S. Kustu.1985. Products of nitrogen regulatory genes ntrA and ntrC ofenteric bacteria activate ginA transcription in vitro: evidencethat the ntrA product is a cr factor. Proc. Natl. Acad. Sci. USA82:7525-7529.

9. Huala, E., and F. M. Ausubel. 1989. The central domain ofRhizobium meliloti NifA is sufficient to activate transcriptionfrom the R. meliloti nifH promoter. J. Bacteriol. 171:3354-3365.

10. Huala, E., J. Stitger, and F. M. Ausubel. 1992. The centraldomain of Rhizobium leguminosarum DctD functions indepen-dently to activate transcription. J. Bacteriol. 174:1428-1431.

11. Hunt, T. P., and B. Magasanik. 1985. Transcription of ginA bypurified Escherichia coli components: core RNA polymeraseand the products ofglnF,glnG, and glnL. Proc. Natl. Acad. Sci.USA 82:8453-8457.

12. Jin, S., R. K. Prusti, T. Roitsch, R. G. Ankenbauer, and E. W.Nester. 1990. Phosphorylation of the VirG protein of Agrobac-terium tumefaciens by the autophosphorylated VirA protein:essential role in biological activity of VirG. J. Bacteriol. 172:4945-4950.

13. Keener, J., and S. Kustu. 1988. Protein kinase and phosphopro-tein phosphatase activities of nitrogen regulatory proteinsNTRB and NTRC of enteric bacteria: roles of the conservedN-terminal domain of NTRC. Proc. Natl. Acad. Sci. USA85:4976-4980.

14. Kunkel, T. A., J. D. Roberts, and R. A. Zakour. 1987. Rapid andefficient site-specific mutagenesis without phenotypic selection.Methods Enzymol. 154:367-382.

15. Kustu, S., E. Santero, J. Keener, D. Popham, and D. Weiss.1989. Expression of 54 (ntrA)-dependent genes is probablyunited by a common mechanism. Microbiol. Rev. 53:367-376.

16. Lukat, G. S., B. H. Lee, J. M. Mottonen, A. M. Stock, and J. B.Stock. 1991. Roles of the highly conserved aspartate and lysineresidues in the response regulator of bacterial chemotaxis. J.Biol. Chem. 266:8348-8354.

17. Lukat, G. S., A. M. Stock, and J. B. Stock. 1990. Divalent metalion binding to the CheY protein and its significance to phos-photransfer in bacterial chemotaxis. Biochemistry 29:5436-5442.

18. Magasanik, B., and F. C. Neidhardt. 1987. Regulation of carbonand nitrogen utilization, p. 1318-1325. In F. C. Neidhardt, J. L.Ingraham, K. B. Low, B. Magasanik, M. Schaecter, and H. E.Umbarger (ed.), Escherichia coli and Salmonella typhimurium:cellular and molecular biology. American Society for Microbi-ology, Washington, D.C.

19. Mandecki, W. 1986. Oligonucleotide-directed double-strandbreak repair in plasmids of Escherichia coli: a method forsite-specific mutagenesis. Proc. Natl. Acad. Sci. USA 83:7177-7181.

20. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

21. Ninfa, A., and B. Magasanik. 1986. Covalent modification of theglnG product, NR,, by the glnL product, NRII, regulatestranscription of the glnALG operon in Eschenichia coli. Proc.Natl. Acad. Sci. USA 83:5909-5913.

22. Ninfa, A. J., E. G. Ninfa, A. N. Lupas, A. Stock, B. Magasanik,and J. Stock. 1988. Crosstalk between bacterial chemotaxissignal transduction proteins and the regulators of transcriptionof the Ntr regulon: evidence that nitrogen assimilation and

chemotaxis are controlled by a common phosphotransfer mech-anism. Proc. Natl. Acad. Sci. USA 85:5492-5496.

23. Ninfa, A. J., L. J. Reitzer, and B. Magasanik. 1987. Initiation oftranscription at the bacterial glnAp2 promoter by purified E. colicomponents is facilitated by enhancers. Cell 50:1039-1046.

24. Ninfa, A. J., S. Ueno-Nishio, T. P. Hunt, B. Robustell, and B.Magasanik. 1986. Purification of nitrogen regulator II, the prod-uct of the glnL (ntrB) gene of Escherichia coli. J. Bacteriol.168:1002-1004.

25. Reitzer, L. J. Unpublished observation.26. Reitzer, L. J., and B. Magasanik. 1983. Isolation of the nitrogen

assimilation regulator, NRI, the product of the glnG gene ofEscherichia coli. Proc. Natl. Acad. Sci. USA 80:5554-5558.

27. Reitzer, L. J., and B. Magasanik. 1985. Expression of glnA inEschenichia coli is regulated at tandem promoters. Proc. Natl.Acad. Sci. USA 82:1979-1983.

28. Reitzer, L. J., and B. Magasanik. 1986. Transcription ofginA inE. coli is stimulated by activator bound to sites far from thepromoter. Cell 45:785-792.

29. Reitzer, L. J., and B. Magasanik. 1987. Ammonia assimilationand the biosynthesis of glutamine, glutamate, aspartate, aspar-agine, L-alanine, and D-alanine, p. 302-320. In F. C. Neidhardt,J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaecter, andH. E. Umbarger (ed.), Escherichia coli and Salmonella typh-imurium: cellular and molecular biology. American Society forMicrobiology, Washington, D.C.

30. Reitzer, L. J., B. Movsas, and B. Magasanik. 1989. Activation ofglnA transcription by nitrogen regulator I (NRI)-phosphate inEscherichia coli: evidence for a long-range physical interactionbetween NRI-phosphate and RNA polymerase. J. Bacteriol.171:5512-5522.

31. Rothstein, D. M., G. Pahel, B. Tyler, and B. Magasanik. 1980.Regulation of expression from theglnA promoter ofEschenchiacoli in the absence of glutamine synthetase. Proc. Natl. Acad.Sci. USA 77:7372-7376.

32. Sanders, D. A., B. L. Gillece-Castro, A. L. Burlingame, andD. E. Koshland. 1992. Phosphorylation site of NtrC, a proteinphosphatase whose covalent intermediate activates transcrip-tion. J. Bacteriol. 174:5117-5122.

33. Sanders, D. A., B. L. Gillece-Castro, A. M. Stock, A. L.Burlingame, and D. E. Koshland. 1989. Identification of the siteof phosphorylation of the chemotaxis response regulator pro-tein, CheY. J. Biol. Chem. 264:21770-21778.

34. Schneider, B. L., S.-P. Shiau, and L. J. Reitzer. 1991. Role ofmultiple environmental stimuli in control of transcription from anitrogen-regulated promoter in Escherichia coli with weak or noactivator-binding sites. J. Bacteriol. 173:6355-6363.

35. Shiau, S.-P., P. Chen, and L. J. Reitzer. 1993. Effect ofinsertions and deletions in glnG (ntrC) of Escherichia coli onnitrogen regulator I-dependent DNA binding and transcriptionalactivation. J. Bacteriol. 175:190-199.

36. Shiau, S.-P., and L. J. Reitzer. Unpublished observation.37. Shiau, S.-P., B. L. Schneider, W. Gu, and L. J. Reitzer. 1992.

Role of nitrogen regulator I (NtrC), the transcriptional activatorof ginA in enteric bacteria, in reducing expression of glnAduring nitrogen-limited growth. J. Bacteriol. 174:179-185.

38. Stock, A. M., J. M. Mottonen, J. B. Stock, and C. E. Schutt.1989. Three-dimensional structure of CheY, the response regu-lator of bacterial chemotaxis. Nature (London) 337:745-749.

39. Stock, J. B., A. J. Ninfa, and A. M. Stock. 1989. Proteinphosphorylation and regulation of adaptive responses in bacte-ria. Microbiol. Rev. 53:450-490.

40. Studier, F. W., and B. Moffatt. 1986. Use of bacteriophage T7RNA polymerase to direct selective high-level expression ofcloned genes. J. Mol. Biol. 189:113-130.

41. Studier, F. W., A. H. Rosenberg, J. J. Dunn, and J. W.Dubendorif. 1990. Use of T7 RNA polymerase to direct expres-sion of cloned genes. Methods Enzymol. 185:60-89.

42. Su, W., S. Porter, S. Kustu, and H. Echols. 1990. DNA-loopingand enhancer activity: association between DNA-bound NtrCactivator and RNA polymerase at the bacterial glnA promoter.Proc. Natl. Acad. Sci. USA 87:5504-5508.

43. Tabor, S., and C. C. Richardson. 1985. A bacteriophage T7

J. BACTERIOL.

on March 14, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

ALTERATIONS IN REGULATORY DOMAIN OF NRI 2701

RNA polymerase/promoter system for controlled exclusive ex-pression of specific genes. Proc. NatI. Acad. Sci. USA 82:1074-1078.

44. Volz, K., and P. Matsumura. 1991. Crystal structure of Esche-richia coli CheY refined at 1.7-A resolution. J. Biol. Chem.266:15511-15519.

45. Wedel, A., D. S. Weiss, D. Popham, P. Droge, and S. Kustu.1990. A bacterial enhancer functions to tether a transcriptionalactivator near a promoter. Science 248:486-490.

46. Weiss, D. S., J. Batut, K. E. Klose, J. Keener, and S. Kustu.1991. The phosphorylated form of the enhancer-binding proteinNTRC has an ATPase activity that is essential for activation oftranscription. Cell 67:155-167.

47. Weiss, V., F. Claverie-Martin, and B. Magasanik. 1992. Phos-phorylation of nitrogen regulator I of Escherchia coli inducesstrong cooperative binding to DNA essential for activation oftranscription. Proc. Natl. Acad. Sci. USA 89:5088-5092.

VOL. 175, 1993

on March 14, 2018 by guest

http://jb.asm.org/

Dow

nloaded from