Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI,...

20
Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow

Transcript of Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI,...

Page 1: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow.

Does (HFE) hemochromatosis exist in India?

Rakesh Aggarwal Department of Gastroenterology

SGPGI, Lucknow

Page 2: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow.

Hemochromatosis

A progressive increase in body iron content, leading to systemic iron loading of parenchymal cells (particularly hepatocytes) and, eventually, to organ disease.

Page 3: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow.

Iron homeostasis in humans

Pietrangelo. New Engl J Med 2004; 350: 2383-97.

Page 4: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow.

Hemochromatosis: Types

• Primary

• Secondary– Parenteral iron overload

• RBCs• Iron

– Anemias

– Chronic liver disease (esp alcohol)

Page 5: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow.

Hemochromatosis

Pietrangelo. New Engl J Med 2004; 350: 2383-97.

Page 6: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow.

HFE gene frequency in Caucasians

Population sample

Country Sample size

Prevalence of C282

homozygotes

Allele frequenc

y

Electoral roll New Zealand 1,064 1 in 213 6.9%

Field survey Australia 3,011 1 in 188 7.3%

Primary care USA 4,865 1 in 405 5.0%

Health clinic USA 41,038 1 in 270 6.1%

Primary care USA/Canada 20,130 1 in 322 5.6%

Harrison SA, Bacon BR. J Hepatol 2003; 38: S14-S23.

Page 7: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow.

C282Y HFE mutation: Indian population

Study City Number of

subjects

Number of

Y alleles

Number of total

alleles

% of Y

allelles

Kaur, 2003 Delhi 116 *1 232 0.4

Thakur, 2004 Delhi 134 0 268 0.0

Garewal, 2005 Chandigarh 60 0 120 0.0

Panigrahi, 2006 Delhi 74 0 148 0.0

Dhillon, 2007 Chandigarh 100 0 200 0.0

Dhillon, 2007 Chandigarh 80 0 160 0.0

Agarwal, 2007 Lucknow 421 0 842 0.0

Jain, 2011 Lucknow 502 0 1004 0.0

Total 1 2974 0.034* PCR using sequence-specific primers

Page 8: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow.

HFE C282Y: Indian Thallassemics

Study City Number of

subjects

Number of

Y alleles

Number of total

alleles

% of Y

allelles

Kaur, 2003 Delhi 75 *6 150 4.0

Garewal, 2005 Chandigarh 215 0 430 0.0

Agarwal, 2006 Lucknow 147 0 294 0.0

Agarwal, 2007 Lucknow 308 0 616 0.0

Sharma, 2007 Delhi 63 0 126 0.0

Total 6 1616 0.371* PCR using sequence-specific primers

Page 9: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow.

HFE C282Y: Indian liver disease patients

Study City Number of

subjects

Number of

Y alleles

Number of total

alleles

% of Y

allelles

Thakur, 2004 Delhi 249 0 498 0.0

Duseja, 2005** Chandigarh 16 0 32 0.0

Agarwal, 2006 Lucknow 65 0 130 0.0

Panigrahi, 2006*** Delhi 31 0 62 0.0

Dhillon, 2007 Chandigarh 236 0 472 0.0

Jain, 2011 Lucknow 496 *1 992 0.1

Total 1 2186 0.046* PCR-RFLP** Non-alcoholic steatohepatitis*** With transferrin saturation >45%

Page 10: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow.

H63D HFE mutation in Indian population

Study City Number of

subjects

Number of

Y alleles

Number of total

alleles

% of Y

allelles

Kaur, 2003 Delhi 116 20 232 8.6

Panigrahi, 2006 Delhi 74 6 148 4.1

Dhillon, 2007 Chandigarh 100 13 200 6.5

Dhillon, 2007 Chandigarh 80 6 160 3.8

Agarwal, 2007 Lucknow 421 47 842 5.6

Jain, 2011 Lucknow 502 46 1004 4.6

Total 138 2586 5.3

Page 11: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow.

HFE H63D: Thallassemia / Liver disease

Study City Number of

subjects

Number of

Y alleles

Number of total

alleles

% of Y

allelles

Thallassemia

Kaur, 2003 Delhi 75 19 150 12.7

Agarwal, 2007 Lucknow 308 49 616 8.0

Sharma, 2007 Delhi 63 8 126 6.3

Total 76 892 8.5Chronic liver disease

Duseja, 2005 Chandigarh 16 4 32 12.5

Panigrahi, 2006 Delhi 31 8 62 12.9

Dhillon, 2007 Chandigarh 236 36 472 7.6

Jain, 2011 Lucknow 496 60 992 6.0

Total 108 1558 6.9

Page 12: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow.

Indian liver disease patients: Fe overload

Author N Findings

Thakur 249 24 (9.6%) had transferrin saturation >60%

Duseja 31 Only 1/23 (5%) had transferrin saturation >45%;

Liver biopsy in 16: none had 3+/4+ Perl stain

Dhillon 236 Only 17 (7.2%) had iron overload

Jain 496 Only 13 (2.6%) had iron overload

Page 13: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow.

Indian patients with iron overload

Shukla et al. Natl Med J India 2006; 19: 20-3.

Page 14: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow.

Indian patients with iron overload

Shukla et al. Natl Med J India 2006; 19: 20-3.

Page 15: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow.

Indian patients with iron overload

Shukla et al. Natl Med J India 2006; 19: 20-3.

Page 16: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow.

Shukla et al. Natl Med J India 2006; 19: 20-3.

Indian patients with iron overload

PCR-RFLP for C282Y

Page 17: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow.

• HFE gene– None of the 5 patients had C282Y mutation– One had homozygous H63D mutation– None had previously known splice site

mutations– Four had a IVS2+4 T/C change

• HAMP gene (Hepcidin)– None had G71A or IVS2+1(-G) mutation

• SLC11A3 gene (Ferroportin)– None had G71A or IVS2+1(-G) mutation

Indian patients with iron overload

Shukla et al. Natl Med J India 2006; 19: 20-3.

Page 18: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow.

1 2 3 4 5 6

3 4 52 61

GTATGTGGAGAGGGGGCAAGG

GTATGTGGAGAGGGGGCAAGG

GTACGTCGAGAGGGGGCAAGG

GTAYGTGGAGAGGGGGCAAGG

GTACGTCGAGAGGGGGCAAGG

GTAYGTGGAGAGGGGGCAAGG

Z92910.1

Patient #1

Patient #2

Patient #3

Patient #4

Patient #5 Y = T or C

Splice site

Intron

Exon

Indian patients with iron overload

Shukla et al. Natl Med J India 2006; 19: 20-3.

Page 19: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow.

Other data from the Indian subcontinent

Family Origin Onset age

Protein Exon AA change

A Bangladesh 19 Hemojuvelin 3 C80Y

B Pakistan 26 Hemojuvelin 3 G99R

C Pakistan 11 Hemojuvelin 3 G99R

D Pakistan 23 Hemojuvelin 3 P192L

E Pakistan 32 Hemojuvelin 3 L194P

F Sri Lanka 17 Hemojuvelin 4 A343fsX23

G Pakistan 21 Hepcidin 2 R42Sfs

H Thailand 38 Ferroportin 7 C326Y

Lok et al. Blood 2009; 114: 20-5.

Page 20: Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow.

Hemochromatosis in India: Summary

• Iron overload Occasional

• C282Y mutation Very infrequent

• C282Y HFE disease Extremely rare