The ‘Higher-ness’ of ‘Further-ness’ in HFE: Organising at the HFE Interface
Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI,...
-
Upload
theresa-mcdonald -
Category
Documents
-
view
217 -
download
2
Transcript of Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI,...
Does (HFE) hemochromatosis exist in India?
Rakesh Aggarwal Department of Gastroenterology
SGPGI, Lucknow
Hemochromatosis
A progressive increase in body iron content, leading to systemic iron loading of parenchymal cells (particularly hepatocytes) and, eventually, to organ disease.
Iron homeostasis in humans
Pietrangelo. New Engl J Med 2004; 350: 2383-97.
Hemochromatosis: Types
• Primary
• Secondary– Parenteral iron overload
• RBCs• Iron
– Anemias
– Chronic liver disease (esp alcohol)
Hemochromatosis
Pietrangelo. New Engl J Med 2004; 350: 2383-97.
HFE gene frequency in Caucasians
Population sample
Country Sample size
Prevalence of C282
homozygotes
Allele frequenc
y
Electoral roll New Zealand 1,064 1 in 213 6.9%
Field survey Australia 3,011 1 in 188 7.3%
Primary care USA 4,865 1 in 405 5.0%
Health clinic USA 41,038 1 in 270 6.1%
Primary care USA/Canada 20,130 1 in 322 5.6%
Harrison SA, Bacon BR. J Hepatol 2003; 38: S14-S23.
C282Y HFE mutation: Indian population
Study City Number of
subjects
Number of
Y alleles
Number of total
alleles
% of Y
allelles
Kaur, 2003 Delhi 116 *1 232 0.4
Thakur, 2004 Delhi 134 0 268 0.0
Garewal, 2005 Chandigarh 60 0 120 0.0
Panigrahi, 2006 Delhi 74 0 148 0.0
Dhillon, 2007 Chandigarh 100 0 200 0.0
Dhillon, 2007 Chandigarh 80 0 160 0.0
Agarwal, 2007 Lucknow 421 0 842 0.0
Jain, 2011 Lucknow 502 0 1004 0.0
Total 1 2974 0.034* PCR using sequence-specific primers
HFE C282Y: Indian Thallassemics
Study City Number of
subjects
Number of
Y alleles
Number of total
alleles
% of Y
allelles
Kaur, 2003 Delhi 75 *6 150 4.0
Garewal, 2005 Chandigarh 215 0 430 0.0
Agarwal, 2006 Lucknow 147 0 294 0.0
Agarwal, 2007 Lucknow 308 0 616 0.0
Sharma, 2007 Delhi 63 0 126 0.0
Total 6 1616 0.371* PCR using sequence-specific primers
HFE C282Y: Indian liver disease patients
Study City Number of
subjects
Number of
Y alleles
Number of total
alleles
% of Y
allelles
Thakur, 2004 Delhi 249 0 498 0.0
Duseja, 2005** Chandigarh 16 0 32 0.0
Agarwal, 2006 Lucknow 65 0 130 0.0
Panigrahi, 2006*** Delhi 31 0 62 0.0
Dhillon, 2007 Chandigarh 236 0 472 0.0
Jain, 2011 Lucknow 496 *1 992 0.1
Total 1 2186 0.046* PCR-RFLP** Non-alcoholic steatohepatitis*** With transferrin saturation >45%
H63D HFE mutation in Indian population
Study City Number of
subjects
Number of
Y alleles
Number of total
alleles
% of Y
allelles
Kaur, 2003 Delhi 116 20 232 8.6
Panigrahi, 2006 Delhi 74 6 148 4.1
Dhillon, 2007 Chandigarh 100 13 200 6.5
Dhillon, 2007 Chandigarh 80 6 160 3.8
Agarwal, 2007 Lucknow 421 47 842 5.6
Jain, 2011 Lucknow 502 46 1004 4.6
Total 138 2586 5.3
HFE H63D: Thallassemia / Liver disease
Study City Number of
subjects
Number of
Y alleles
Number of total
alleles
% of Y
allelles
Thallassemia
Kaur, 2003 Delhi 75 19 150 12.7
Agarwal, 2007 Lucknow 308 49 616 8.0
Sharma, 2007 Delhi 63 8 126 6.3
Total 76 892 8.5Chronic liver disease
Duseja, 2005 Chandigarh 16 4 32 12.5
Panigrahi, 2006 Delhi 31 8 62 12.9
Dhillon, 2007 Chandigarh 236 36 472 7.6
Jain, 2011 Lucknow 496 60 992 6.0
Total 108 1558 6.9
Indian liver disease patients: Fe overload
Author N Findings
Thakur 249 24 (9.6%) had transferrin saturation >60%
Duseja 31 Only 1/23 (5%) had transferrin saturation >45%;
Liver biopsy in 16: none had 3+/4+ Perl stain
Dhillon 236 Only 17 (7.2%) had iron overload
Jain 496 Only 13 (2.6%) had iron overload
Indian patients with iron overload
Shukla et al. Natl Med J India 2006; 19: 20-3.
Indian patients with iron overload
Shukla et al. Natl Med J India 2006; 19: 20-3.
Indian patients with iron overload
Shukla et al. Natl Med J India 2006; 19: 20-3.
Shukla et al. Natl Med J India 2006; 19: 20-3.
Indian patients with iron overload
PCR-RFLP for C282Y
• HFE gene– None of the 5 patients had C282Y mutation– One had homozygous H63D mutation– None had previously known splice site
mutations– Four had a IVS2+4 T/C change
• HAMP gene (Hepcidin)– None had G71A or IVS2+1(-G) mutation
• SLC11A3 gene (Ferroportin)– None had G71A or IVS2+1(-G) mutation
Indian patients with iron overload
Shukla et al. Natl Med J India 2006; 19: 20-3.
1 2 3 4 5 6
3 4 52 61
GTATGTGGAGAGGGGGCAAGG
GTATGTGGAGAGGGGGCAAGG
GTACGTCGAGAGGGGGCAAGG
GTAYGTGGAGAGGGGGCAAGG
GTACGTCGAGAGGGGGCAAGG
GTAYGTGGAGAGGGGGCAAGG
Z92910.1
Patient #1
Patient #2
Patient #3
Patient #4
Patient #5 Y = T or C
Splice site
Intron
Exon
Indian patients with iron overload
Shukla et al. Natl Med J India 2006; 19: 20-3.
Other data from the Indian subcontinent
Family Origin Onset age
Protein Exon AA change
A Bangladesh 19 Hemojuvelin 3 C80Y
B Pakistan 26 Hemojuvelin 3 G99R
C Pakistan 11 Hemojuvelin 3 G99R
D Pakistan 23 Hemojuvelin 3 P192L
E Pakistan 32 Hemojuvelin 3 L194P
F Sri Lanka 17 Hemojuvelin 4 A343fsX23
G Pakistan 21 Hepcidin 2 R42Sfs
H Thailand 38 Ferroportin 7 C326Y
Lok et al. Blood 2009; 114: 20-5.
Hemochromatosis in India: Summary
• Iron overload Occasional
• C282Y mutation Very infrequent
• C282Y HFE disease Extremely rare