Doctor of Philosophy היפוסוליפל רוטקוד · Doctor of Philosophy By Galia Oberkovitz...
-
Upload
nguyencong -
Category
Documents
-
view
218 -
download
2
Transcript of Doctor of Philosophy היפוסוליפל רוטקוד · Doctor of Philosophy By Galia Oberkovitz...
Thesis for the degree
Doctor of Philosophy
By Galia Oberkovitz
א" בתגובה לנזקים בדנBIDתפקיד הזרחון על החלבון
חבור לשם קבלת התואר דוקטור לפילוסופיה
מאת גליה אוברקוביץ
The role of ATM–mediated BID phosphorylation
in the DNA damage response
Advisor Prof. Atan Gross
May, 2010
Submitted to the Scientific Council of the Weizmann Institute of Science
Rehovot, Israel
ע"תש, יירא
מוגש למועצה המדעית של מכון ויצמן למדע
ישראל,רחובות
מנחה איתן גרוס 'פרופ
2
Table of contents
Table of contents ..........................................................................................................2
List of figures................................................................................................................4
Abbreviations ...............................................................................................................6
Abstract.........................................................................................................................7
Introduction..................................................................................................................9 Apoptosis ...................................................................................................................9
BCL-2 family ...........................................................................................................10
BID...........................................................................................................................13
The responses of cells to double-strand break DNA damage ..................................14
BCL-2 family members and the response to double-strand break DNA damage....14
BID and the DNA damage response........................................................................15
The objective of the research ....................................................................................18
Material and Methods ...............................................................................................19 Constructs ................................................................................................................19
List or primers: ....................................................................................................19
Tissue culture ...........................................................................................................20 hTERT transformation of primary MEFs ............................................................20 Generation of hTERT BID-/- stable clones expressing wtBID, NLS-BID or BID-ER.........................................................................................................................20 Preparation of activated B and T cells ................................................................21 Human cell lines and transient transfection ........................................................21 HeLa BID KD cells ..............................................................................................21
Cellular assays .........................................................................................................22 Radio-resistant DNA Synthesis assay (RDS) .......................................................22 Metaphase spreads assay.....................................................................................22 BrdU labeling and analysis .................................................................................22 Cell viability assay...............................................................................................23 Cell cycle assay....................................................................................................23 Apoptosis assay....................................................................................................23
Proteins analysis.......................................................................................................23 Formaldehyde treatment and subcellular fractionation......................................23 Western blot and antibodies ................................................................................24 Viewing the cellular location of GFP fusion proteins .........................................24 Immunofluorescence ............................................................................................24 Immunohistochemistry .........................................................................................25
Chapter I - The functional connection between BID and the nucleus ..................26 Cellular BID partially localizes to the nucleus ........................................................26
DNA damage results in the nuclear export of BID..................................................27
Fusing BID to a strong nuclear localization signal inhibits its nuclear export ........30
3
Introduction of NLS–BID into BID-/- MEFs fails to restore susceptibility to Etop-induced cell death ....................................................................................................31
BID-/- MEFs expressing NLS–BID fail to arrest in the S phase of the cell cycle following Etop treatment .........................................................................................33
Caspases are not involved in the nucleocytoplasmic shuttling of BID...................35
BID phosphoryaltion occurs in the nucleus .............................................................37
Chapter II - BID phosphorylation at the mitochondria .........................................39 DNA damage induces phosphorylation of exogenous BID at the mitochondria.....39
The phospho-form of BID-TM is localized at the mitochondria.............................40
BID phosphorylation at the mitochondria is partially mediated by ATM ...............41
BID-TM expression does not result in the phosphorylation of other ATM substrates..................................................................................................................................42
Mutating the phosphorylation sites of BID-TM does not affect its ability to induce cell death ..................................................................................................................42
Mutating in the BH3 domain of BID-TM does not change its phosphorylation status..................................................................................................................................43
tBID is phosphorylated on S78 in the absence of DNA damage and this phosphorylation is mediated by ATM .....................................................................44
tBID is phosphorylated in-vitro by a mitochondria-associated kinase ....................45
Chapter III - The role of ATM-mediated BID phosphorylation in-vivo ..............46 Generation of BIDS61A/S78A knock-in mice, in which endogenous BID is no longer capable of being phosphorylated on serines 61 and 78............................................46
BIDAA primary activated B and T cells demonstrate increased chromosomal damage in response to DNA damaging reagents .....................................................47
BIDAA primary B and T cells fail to arrest in the S phase in response to DNA damage .....................................................................................................................48
BIDAA primary B and T cells are more susceptible to DNA damage-induced apoptosis ..................................................................................................................50
ATM-mediated phosphorylation of Chk2 and SMC1 is reduced in the BIDAA cells following DNA damage...........................................................................................52
BIDAA knock-in mice are hypersensitive to whole-body irradiation .......................54
Discussion....................................................................................................................57 The functional connection between BID and the nucleus .......................................57
BID phosphorylation at the mitochondria................................................................60
The role of ATM-mediated BID phosphorylation in vivo.......................................62
References...................................................................................................................66
Publications ................................................................................................................71
4
List of figures
Figure 1. Schematic of the extrinsic and the intrinsic apoptotic pathways..................10
Figure 2. Schema of the BCL-2 family........................................................................11
Figure 3. A model summarizing the role of BID in the DNA damage response. ........17
Figure 4. Mouse BID is partially localized to the nucleus...........................................27
Figure 5. DNA damage results in the nuclear export of BID. .....................................29
Figure 5. DNA damage results in the nuclear export of BID. .....................................30
Figure 6. Fusing BID to a strong NLS inhibits its nuclear export. ..............................31
Figure 7. Introduction of NLS–BID into BID-/- MEFs fails to restore susceptibility to
Etop-induced cell death................................................................................................32
Figure 8. BID-/- MEFs expressing NLS–BID fail to arrest in the S phase of the cell
cycle following etoposide treatment. ...........................................................................34
Figure 9. Caspases are not involve in the nucleocytoplasmic shuttling of BID. .........36
Figure 10. BID phosphoryaltion occurs in the nucleus................................................38
Figure 11. DNA damage induces phosphorylation of BID at the mitochondria. ........40
Figure 12. The phospho-form of BID-TM is localized at the mitochondria. ..............41
Figure 13. BID phosphorylation at the mitochondria is mediated by ATM................42
Figure 14. BID-TM expression does not result in the phosphorylation of other ATM
substrates......................................................................................................................42
Figure 15. Mutations in the phosphorylation site of BID do not affect on its ability to
kill. ...............................................................................................................................43
Figure 16. Mutation in the BH3 domain of BID-TM does not change its
phosphorylation status. ................................................................................................44
Figure 17. tBID is phosphorylated on S78 in the absence of DNA damage and this
phosphorylation is mediated by ATM. ........................................................................45
Figure 18. tBID is phosphorylated in-vitro by a mitochondria-associated kinase.......45
Figure 19. BID is expressed but is not phosphorylated following whole body
irradiation in homozygous BIDAA mice. ....................................................................46
Figure 20. BIDAA primary B and T cells demonstrate increased chromosomal damage
in response to DNA damaging reagents.......................................................................48
Figure 21. BIDAA primary B and T cells fail to arrest in the S phase in response to
DNA damage. ..............................................................................................................50
5
Figure 22. BIDAA primary B and T cells are more susceptible to DNA damage-
induced apoptosis.........................................................................................................51
Figure 23. ATM-mediated phosphorylation of Chk2 and SMC1 is reduced in the
BIDAA cells following DNA damage............................................................................53
Figure 24. BIDAA knock-in mice are hypersensitive to whole-body irradiation .........55
6
Abbreviations
Ab Antibody
A-T Ataxia-Telangiectasia
ATM Ataxia-Telangiectasia Mutated
BH Bcl-2 Homology
BrdU Bromodeoxyuridine (5-bromo-2-deoxyuridine)
Cyt c Cytochrome c
DDR DNA Damage Response
DRs Death Receptors
DSB Double-Strand Break
Etop Etoposide
FACS Fluorescence-activated cell sorter
GFP Green Fluorescence Protein
IB Immune Blot
IF Immunofluoresence
IHC Immunohistochemistry
IR Ionizing Radiation
LMB Leptomycin B
MEFs Mouse Embryonic Fibroblasts
MMC Mitomycin c
MPCs Myeloid Progenitor Cells
NES Nuclear Export Signal
NLS Nuclear localization Signal
PCD Programmed Cell Death
PI Propidium Iodide
RDS Radio-Resistant DNA Synthesis
SDS-PAGE Sodium dedocyl sulphate-Polyacrylamid gel electrophoresis
TM Trans-Membrane
4-HOT 4-hydroxy-tamoxifen
7
Abstract
The BH3-only BID protein acts as a sentinel to interconnect specific death signals to
the core apoptotic pathway. Our previous data demonstrated that BID is important for
both S-phase arrest and cell death following DNA damage, and that the cell cycle
arrest function is regulated by its phosphorylation by the ATM kinase.
In the first part of my thesis we showed that as expected from the previous data, a
portion of cellular BID localizes to the nucleus. Interestingly, we demonstrated that
etoposide and ionizing radiation induce the exit of BID from the nucleus and that
leptomycin B, a specific inhibitor of the nuclear export receptor CRM1, prevents the
nuclear exit of BID. BID carries a nuclear export signal (NES) consensus motif;
however, it does not seem to be functional. To examine the importance of BID
nuclear export, we targeted BID to the nucleus by fusing it to a strong nuclear
localization signal (NLS). NLS–BID is phosphorylated in a similar time course as
wild-type BID, but does not exit the nucleus following etoposide treatment.
Importantly, introducing NLS–BID into BID-/- cells failed to restore S-phase arrest
and cell death in response to etoposide. The results in this part implicate BID as a
nuclear protein and raise the possibility that nucleocytoplasmic shuttling of BID is
involved in regulating its activities in the DNA damage response.
In the second part of my thesis we were able to show that although BID is a
nuclear substrate of ATM it can also be phopshorylated outside the nucleus.
Surprisingly, we found that a BID-TM chimeric molecule [a BID molecule fused to
the trans-membrane (TM) domain of BCL-2, and therefore is constituently targeted to
the mitochondria] over-expressed in cells was phosphorylated in an ATM-dependent
manner, and this phosphorylation occurred in the mitochondria in the absence of
DNA damage. These results may indicate on additional regulatory role of BID in the
DNA damage response, which is different from its role in the DNA damage response
in the nucleus.
Finally, in the 3rd part of the work we defined the importance of ATM-mediated
BID phosphorylation in vivo. We generated a BID knock-in mouse, in which the
endogenous BID gene has been replaced with a gene that drives the expression of a
non-phosphorylatable BID protein (BIDAA). Using cells from these mice we found
that BIDAA knock-in primary T and B cells demonstrate a defect in the intra S phase
8
DNA damage response, increased chromosomal damage, and increased apoptosis in
response to DNA damage. Importantly, the BIDAA mice were hypersensitive to
whole-body irradiation and showed increased levels of apoptosis in the spleen. Taken
together, these results establish the role of BID as an ATM effector in the DNA
damage response in vivo.
9
Introduction
Apoptosis
Apoptosis, or programmed cell death (PCD), plays a central role in the development
and homeostasis of all multi-cellular organisms [1]. In humans, both excessive and
insufficient apoptosis can lead to severe pathological consequences. Suppression of
the apoptotic machinery causes autoimmune diseases and is a hallmark of cancer [2],
while abnormal upregulation of apoptosis contributes to neurological disorder [3].
Cells undergoing PCD assume morphological features, which include membrane
blabbing, chromatin condensation, and nuclear fragmentation [4]. The genetic
pathway that regulates apoptosis has been characterized, and it appears to be
conserved from the nematode C. elegans to mammals. BCL-2 proteins are the major
regulators of the apoptotic pathways [5], and caspase proteases are the major
executioners of this process [6].
Two major apoptotic pathways have been identified in mammals: the extrinsic and
the intrinsic pathways. The extrinsic pathway involves the initiation of apoptosis
through ligation of plasma membrane death receptors (DRs). These receptors belong
to the tumor necrosis factor receptor (TNFR) superfamily. They transmit their
apoptotic signals following binding of death ligands. These receptor-ligand complexes
initiate the apoptotic cascade within seconds of ligand binding and can result in
apoptotic cell death within hours. The best characterized family members include
FAS and TNFR1 [7-9]. Once engaged by ligand, these receptors initiate the formation
of the death inducing signaling complex (DISC), which leads to activation of caspase-
8 which then activates the downstream caspase-3 [10]. The intrinsic pathway is
activated by various developmental causes or cytotoxic insults, such as viral infection,
DNA damage and growth-factor deprivation. These stimuli trigger the release of
Cytochrome c (Cyt c) and other intermembrane space proteins from the mitochondria
to the cytosol. Cyt c is then free to bind Apaf-1 and caspase-9 to form the apoptosome
complex. The apoptosome complex is where caspase-9 is activated leading to
caspase-3 activation, which leads to apoptotic cell death [11]. Under certain
circumstances, the extrinsic pathway uses the mitochondrial pathway to amplify
caspase activation. This connection is done trough BID, which is cleaved by caspase-
8 (Fig 1).
10
Figure 1. Schematic of the extrinsic and the intrinsic apoptotic pathways. In the extrinsic pathway, activation of the TNF/Fas death receptor induces DISC formation that results in direct activation of caspases. In the intrinsic pathway, the BCL-2 family members are the major players. At the mitochondria, these proteins induce the release of Cyt c, resulting in the formation of the apoptosome and caspase activation. The extrinsic and intrinsic pathways are connected by BID.
BCL-2 family
Members of the BCL-2 family are essential mediators of cell survival and apoptosis.
The founder of this family is the BCL-2-proto-oncogene, that was discovered at the
choromosomal breakpoint of t(14;18) bearing human B cell lymphomas [12]. The
BCL-2 family of proteins has expanded significantly since the discovery of BCL-2. In
mammals, there are at least 12 core BCL-2 family proteins, including BCL-2 itself
and proteins that have either three-dimensional structural similarity or a predicated
secondary structure that is similar to BCL-2. These proteins display a range of
bioactivities, from inhibition to promotion of apoptosis [13].
The cell death regulatory mechanism of the BCL-2 family members is largely
unknown, although it is thought that their function depends mostly on their ability to
modulate the release of proteins from the inter-membrane space of mitochondria. The
BCL-2 family can be divided into two subclasses, defined in part by the homology
shared within four conserved regions termed BCL-2 homology (BH) 1-4 domains
(Fig. 2). The first subclass includes the anti-apoptotic members (e.g., BCL-2) that
display conservation in all four BH1-4 domains. The second subclass includes the
11
“multidomain” pro-apoptotic members (e.g., BAX, BAK) that possess the BH1-3
domains. A subset of the pro-apoptotic proteins are the BH3-only proteins that
possess only the BH3 domain (e.g.,BID)[14-16].
Figure 2. Schema of the BCL-2 family. Three subfamilies are indicated. BCL-2 homology region (BH1-4) are denoted as is the carboxy-terminal hydrophobic (TM) domain.
One of the major characteristics of the BCL-2 family members is their tendency to
form homo- as well as heterodimers. Mutagenesis studies have revealed that the BH
domains are important for these interactions. The BH1, BH2 and BH3 domains of the
anti-apoptotic members are required to heterodimerize with the pro-apoptotic
members to repress cell death [17]. On the other hand, only the BH3 domain of pro-
apoptotic members is required to heterodimerize with the anti-apoptotic molecules,
and to promote cell death. Early findings support the notion that the ratio of pro-
apoptotic to anti-apoptotic molecules dictates the susceptibility of cells to a death
signal [18]. It seems that the multidomain pro- apoptotic proteins possess two
potentially independent mechanisms for promoting cell death. One mechanism relies
upon their ability to suppress the function of anti-apoptotic proteins through
heterodimerization. The other is a heterodimerization-independent function. For
example, BAX can induce cell death independent of its interaction with BCL-2 [19].
Several BH3 mutants of BAX that fail to bind BCL-2 are nevertheless still capable of
inducing apoptosis [20]. Furthermore, activation of BAX appears to involve its
homodimerization [21]. A proposed theory suggests that the BCL-2 family members
form channels in the mitochondrial membrane. This model originated from the
structural similarity between the BCL-XL structure and structure of the pore forming
The BCL-2 family
BH4 BH3 BH1 BH2 TM
Anti-apoptoticBCL-2(BCL-XL, BCL-W, MCL-1,…)
BH3 BH1 BH2 TM
Pro-apoptotic
BAX(BAK, BOK,…)
BH3BID(BIK, BAD, BIM, PUMA, …)
BH3-only
The BCL-2 family
BH4 BH3 BH1 BH2 TM
Anti-apoptoticBCL-2(BCL-XL, BCL-W, MCL-1,…)
BH3 BH1 BH2 TM
Pro-apoptotic
BAX(BAK, BOK,…)
BH3BID(BIK, BAD, BIM, PUMA, …)
BH3-only
12
region of bacterial toxins [22]. Moreover, it was demonstrated that recombinant BAX
forms channels in artificial membranes allowing the passage of large macromolecules
[23-25]. The BH3-only proteins are known to be pro-apoptotic but there is a big
debate regarding their function. Recent evidence indicates that BH3-only proteins de-
repress BAX and BAK by direct binding and inhibition of BCL-2 and other anti-
apoptotic family members [26]. By contrast, an opposing model postulates direct
activation of BAX and BAK by some BH3-only proteins [27].
The BCL-2 family members are localized at multiple subcellular localizations, i.e.,
in the cytosol, nuclear outer membrane, endoplasmic reticulum membrane and
mitochondrial membranes. Most of the family members (excluding part of the BH3-
only proteins) contain a C-terminal hydrophobic domain that enables their targeting to
intracellular membranes [14]. In healthy cells, anti-apoptotic BCL-2 family members
are mostly found associated with internal membranes, whereas the pro-apoptotic ones
are predominantly found in the cytosol. In response to an apoptotic signal, the pro-
apoptotic proteins translocate to mitochondria, to trigger apoptosis [5]. Mitochondria
are not the only site for targeting of pro-apoptotic proteins, since it was only
previously demonstrated that pro-apoptotic proteins such as BAX and BOK
translocate to the nucleus [28,29]. Redistribution of BCL-2 family members to
internal membranes does not seem to be related only to apoptosis, since some studies
demonstrated accumulation of BCL-2 family members in the nucleus that might affect
cell cycle progression [28,30]. These studies, in addition to others suggest that
proteins of the BCL-2 family have different roles executed in different cellular
compartments.
BCL-2 family members have essential roles in the mouse from early
embryogenesis through to adult tissue homeostasis. The nervous system,
haematopoietic tissues and spermatogenesis are particularly dependent on BCL-2
family protein regulation [13]. Several members of the pro- and the anti-apoptotic
classes have been knocked out in mice to reveal their physiological roles, redundancy
and interactions in vivo. In many cases there are phenotypes of abnormal cell death,
like in the case of knockout of the anti-apoptotic proteins BCL-2, BCL-XL and
BCL-W, or hyperplasia and increase in cell resistance to apoptotic stimuli, like in the
case of BAX, BIM, BID and NOXA knockouts [13].
13
BID
BID was cloned in 1996 in a screen of cDNA library from a T cell hybridoma line
[31]. The library was screened using recombinant BCL-2 and recombinant BAX and
in both cases BID was identified. BID is phylogenetically conserved; human BID
shows 72.3% homology to murine BID at the amino acid level. BID is widely
expressed in various tissues, with the highest level being in the kidney [31] and in
organs of the hematopoetic system (Unpublished data, Gross lab).
The p22 BID protein connects between the extrinsic and the intrinsic pathways of
apoptosis; Ligation of DRs activates caspase-8, which processes the cytosolic form of
BID at Asp59 into truncated BID (p15 tBID) that translocates to the mitochondria [20
,32 ,33]. At the mitochondria, tBID induces the oligomerization of BAX and BAK,
resulting in the release of Cyt c and the activation of casapases [34,35]. Interestingly,
it was previously shown that caspase-8-mediated cleavage of BID is regulated by
phosphorylation, since this cleavage is attenuated by casein kinase I- or II-mediated
phosphorylation on serine 61 and serine 64 [36].
The apoptotic pathways in which BID plays a role are not fully characterized,
however studies with BID-/- mice have demonstrated a requirement for BID during
Fas-induced apoptosis [37]. In addition, it was demonstrated that BID-/- mouse
embryonic fibroblasts (MEFs) are less susceptible than are wild-type fibroblasts to the
DNA damage reagent adriamycin and the nucleotide analogue 5-fluorouracil [38].
Thus, BID seems to be important for both the death receptor and DNA damage
apoptotic pathways. Finally, it was recently demonstrated that BID-/- mice, as they
age, spontaneously develop a clonal malignancy closely resembling chronic
myelomonocytic leukemia (CMML), which demonstrates consistent chromosomal
abnormalities [39]. These results suggested that BID might play an unanticipated role
in regulating genomic stability.
A positive regulator of BID expression is p53; Functional p53-binding elements
have been found in both human and mouse BID genomic loci. Over-expression of p53
could induce the upregulation of BID mRNA level both in cell lines and in mice. This
upregulation of BID might be important to p53-mediated apoptosis following the
administration of DNA damaging agent such as adriamycin [38]. In general, BID is a
long-lived protein, but tBID has a half-life of less than 90 minutes. The degradation of
tBID is mediated by the ubiquitination proteasome system [40].
14
The responses of cells to double-strand break DNA damage
In eukaryotes, each cell’s genetic material is constantly subjected to DNA damage.
While a double-strand break (DSB) is not the major DNA lesion, it is certainly among
the most harmful. Following DSBs, the cell may activate a survival system that
enables repair and continuation of its normal life cycle, or it may activate its apoptotic
machinery in the face of extensive or irreparable damage [41]. One of the major
responses associated with the cell survival network is the temporary arrest of cell
cycle progression, which reflects the activation of cell cycle checkpoints [42]. The
best-documented, damage-induced cell cycle checkpoints operate in the G1/S
boundary, and at the S and G2 phases. The very early events that take place at the site
of a DNA double-strand break and precede activation of the response network involve
several proteins that are rapidly recruited to the damaged site; there, they act as DSB
sensors. They then convey a damage signal to transducers, which in turn deliver it to
numerous downstream effectors.
A prototype transducer of the DSB response is ataxia-telangiectasia mutated
(ATM), a nuclear serine-threonine protein kinase which is absent or inactivated in
patients with the genomic instability syndrome ataxia-telangiectasia (A-T) [43]. Cells
from A-T patients exhibit genomic instability, radiosensitivity, and defective
activation of the entire DSB response, most notably, the cell cycle checkpoints. ATM
is a member of a group of conserved large proteins, several of which are protein
kinases involved in mediating DNA damage responses. Activated ATM
phosphorylates a wide spectrum of substrates, many of them at the sites of damage,
and the functional consequences of some of ATM phosphorylation events have been
associated with the activation of the cell cycle checkpoints. However, not all of the
phenotypic abnormalities in A-T patients and their cells can be explained by a lack of
these phosphorylation events, implying that additional ATM targets exist, which have
not yet been identified.
BCL-2 family members and the response to double-strand break DNA damage
There are several reports that connect BCL-2 family members to the non-apoptotic
response of cells to DSBs. For example, homology-directed repair of DSBs is
enhanced by the anti-apoptotic BCL-XL protein [44], while overexpression of pro-
apoptotic BAX and BID, was found to inhibit homologous-recombination DNA repair
[45]. In addition, a protein essential for DSB repair, Ku70, was demonstrated to hold
15
BAX in an inactive state [46]. BAX and BCL-2 were previously reported to be
localized to the nucleus in certain cells [28,47]; however their roles in this organelle
remain unknown. Recently it was published that exposure of cells to IR increases the
expression of BCL-2 in the nucleus, which interacts and inhibits both Ku70 and Ku86
via its BH1 and BH4 domains [48]. Removal of the BH1 or BH4 domain abrogated its
inhibitory effect, which results in the failure to block DSB repair as well as V(D)J
recombination. Finally, it was found that BCL-XL colocalizes and binds to cdk1(cdc2)
during the G2/M cell cycle checkpoint, and its overexpression stabilizes a G2/M
arrest/senescence program in surviving cells after DNA damage [49].
BID and the DNA damage response
Although most studies in the field emphasize the importance of BID cleavage to
activate it, there are several studies that demonstrate an active role for full-length BID
[34,50-52]. One of these studies was conducted in our lab and demonstrated that a
caspase-8 non-cleavable BID mutant (BID-D59A) is a potent inducer of apoptosis in
MEFs [51]. In addition, this study showed that the non-cleavable BID mutant can
sensitize BID-/- MEFs to apoptosis induced by a variety of DNA damaging reagents,
suggesting that BID plays a role in the response of cells to DNA damage.
In search for BID’s role and mechanism of activation in the DNA damage
response (DDR), we found that DNA damage reagents that cause DSB [such as the
topoisomerase II poison etoposide (Etop) and ionizing radiation (IR)], led to its rapid
phosphorylation by the ATM kinase on serines 61 and 78 in a variety of cell types
[53]. We also found that Etop induced accumulation of BID+/+ MEFs in the S and G2
phases of the cell cycle, whereas such an accumulation was not observed in the BID-/-
MEFs. Reintroducing wild-type BID into BID-/- cells restored their ability to
accumulate in the S and G2 phases, whereas introducing a non-phosphorylatable BID
mutant (BID-S61A/S78A) restored accumulation in the G2 phase but not in the S
phase. Moreover, in response to Etop, the mutant BID cells entered apoptosis more
readily than the wild-type BID cells. We also demonstrated that BID is localized to
the nucleus ([53] and see Results section below). A collaborating group reported
similar results using a myloid progenitor cell line (MPCs) [54]. Taken together, these
results implicate BID as an ATM effector, and indicate that BID, a molecule that was
previously considered to be active only as a pro-apoptotic factor in the TNFα/Fas
16
death receptor pathway, also plays a pro-survival role important for the S phase
checkpoint in the DDR (Fig.3) [53-56]. Our results implicating BID as a nuclear
protein involved in cell cycle regulation in the DDR have been recently challenged,
and this criticism together with our response were published [57,58].
Previously it has been shown that BID-/- mice accumulate chromosomal
aberrations and develop a fatal myeloproliferative disorder resembling chronic
myelomonocytic leukemia (CMML; [39]). Spectral karyotype (SKY) analysis of the
BID-/- leukemias revealed chromosomal translocations and duplications. More
recently, it has been demonstrated that doses of Mitomycin c [a DNA interstrand
crosslinking agent (MMC)] that had little effect on BID+/+ MPCs and activated T cells
displayed a marked increase in chromosomal instability in BID-/- MPCs and activated
T cells [54]. Of note, metaphase spreads from MMC-treated BID-/- MPCs and
activated T cells displayed tri- and quadriradial chromosomal figures, quantifiable by
an increase in the number of breaks per cell. These abnormal chromosomal structures
represent “chromatid type” errors resulting from improperly repaired DNA damage
accrued during S phase of the cell cycle [59] and are characteristic of cells with a
defect in DNA repair, such as those in Fanconi anemia [60], Bloom’s syndrome [61],
and the hereditary breast and ovarian cancer syndromes involving BRCA1 [59]. Thus,
increased chromosomal instability seems to be a general feature of BID deficiency,
and phosphorylation of BID might be important for its ability to preserve genome
stability.
17
Figure 3. A model summarizing the role of BID in the DNA damage response. Following DNA damage, ATM and ATR are activated and, through p53, can cause either cell-cycle arrest at the G1 stage or apoptosis. ATM and ATR also activate several other protein targets, causing the cell cycle to stall in the S phase. Pro-apoptotic BID, known to play a role in the death receptor pathway, can be added to this list of ATM/ATR targets (model taken from [55]).
18
The objective of the research To define the role of ATM-mediated BID phosphorylation in the DNA damage
response.
The results of the research are presented in three chapters:
Chapter I - The functional connection between BID and the nucleus.
Chapter II - BID phosphorylation at the mitochondria.
Chapter III - The role of ATM-mediated BID phosphorylation in-vivo.
19
Material and Methods Constructs
For the construction of the NLS–BID expression vector, BID was PCR amplified,
using a 5' primer consisting of a BamHI restriction site followed by the SV40-LT-
NLS, and BID’s first 26 bases, and a 3' primer consisting of an EcoRI restriction site,
followed by BID’s C terminus antisense strand (list of primers will follow). To
introduce point mutations into the NES consensus motif of BID (BID-3L/A) or a
point mutations in BID-TM, we have used the QuickChanget site directed
mutagenesis kit (Stratagene). The fragments were digested and ligated into the
pcDNAIII vector (Invitrogen). To delete the NES consensus motif of BID, we have
used the QuickChanget site directed mutagenesis kit (Stratagene) followed by
phosphorylation and ligation into the pcDNAIII vector (Invitrogen). For the
construction of BID–GFP, BID-3L/A-GFP, BID-dNES-GFP BID-D59A-GFP and
BID-S61A/S78A-GFP, BID was PCR amplified using a 5' primer consisting of a
XhoI restriction site, followed by BID’s N terminus sense strand and a 3' primer
consisting of an EcoRI restriction site, followed by BID’s C terminus antisense strand.
For the construction of NLS–BID–GFP, BID was PCR amplified, using a 5' primer
consisting of an XhoI restriction site, followed by the SV40-LT-NLS and a 3' primer
consisting of an EcoRI restriction site, followed by BID’s C terminus antisense strand.
The fragments were digested and ligated into the pEGFP-N1 vector (Clontech).
For the construction of BID-ER we used the construct c-MycER [62] and replaced c-
Myc with BID in the BamH1 site.
List or primers:
NLS-BID: 5' primer: GCAGGATCCATGCCGAAGAAGAAGCGCAAGGTAGAC
TCTGAGGTCAGCAACGGTTCCGGC. 3' primer: GCGAATTCGTCAGTCCATCT
CGTTTCTAACCAAGTTCCT.
BID-3L/A: 5' primer:CTGTACTCGCCAAGAGGCGGAGGTGGCGGGTCGGGA
AGCGCCTGTGCAAGCTTAC. 3' primer: GTAAGCTTGCACAGGCGCTTCCCG
ACCCGCCACCTCCGCCTCTTGGCGAGTACAG.
BID-dNES: 5' primer: CAAGCTTACTGGGAGGCAGACCTCGAAGACGAG.
3' primer: CTCTTGGCGAGTACAGCCAGAGCTTTGGAGAAAGCCG
20
BID–GFP, BID-3L/A-GFP, BID-dNES-GFP BID-D59A-GFP and BID-
S61A/S78A-GFP: 5' primer: CCGCTCGAGATGGACTCTGAGGTCAGCAACG.
3' primer: GCGAATTCGGTCCATCTCGTTTC.
Tissue culture
hTERT transformation of primary MEFs
All the studies with BID+/+ and BID-/- MEFs described in this research were
performed with hTERT-immortalized MEFs. Immortalization of primary MEFs was
performed by transformation with hTERT (the catalytic subunit of human
telomerase). PA317 packaging cells stably producing pBABE-puro hTERT viral
particles (a generous gift from Tej Pandita, Washington University) were grown to
80% confluence, rinsed and the medium was then replaced with complete MEF
medium. The cells were incubated for 16 hrs and the medium was collected and
filtered through a 0.45 µm filter. The infecting media were stored at -80˚C until use.
Primary BID-/- and BID+/+ MEFs were grown for 3 passages and then infected at
~50% confluence with 3 ml infecting media mixed with 3 ml MEF media and 4 µg/ml
polybrene (Sigma). The cells were then incubated for 16 hrs, rinsed and incubated in
fresh medium for an additional 8 hrs. The cells were infected again as described
above, rinsed and incubated in fresh medium for an additional 48 hrs. The cells were
then split 1:3 and grown for 4 days in a selection medium containing 1 µg/ml
puromycin. After selection, the cells were washed once and incubated with MEF
medium (without puromycin). Stable clones were collected 14 to 18 days post-
infection, and their propagation took 3-to-4 months.
Generation of hTERT BID-/- stable clones expressing wtBID, NLS-BID or BID-ER
ψNX cells (a 293T cell line carrying an ecotropic packaging plasmid) were seeded in
a 100 mm plate at 60% confluence. The next day, the medium was replaced and cells
were incubated with a transfection cocktail containing 15 µg retroviral vector
(pBABE-wtBID, pBABE-NLS-BID or pBABE-BID-ER) prepared using a calcium
phosphate kit (Promega). Cells were incubated for 5 hrs with the cocktail and rinsed;
the medium was then replaced, and the cells reincubated in fresh medium. The
following day, the conditioned medium containing the retroviruses was collected and
filtered through a 0.45 µm filter. The viruses were divided into aliquots and frozen at -
21
80˚C. For infection of MEFs, cells were grown in a 60mm plate and incubated for 4
hrs at 37˚C in 2 ml of retroviral supernatant, supplemented with 16 µg/ml polybrene.
After that, 2 ml of DMEM containing 10% FCS was added and 24 hrs later, the
medium was replaced with fresh medium containing 10% FCS and 1 µg/ml
puromycin. Puromycin was replaced every day for three days. On the fourth day, cells
were seeded (100 cells per 10cm dish) and grown until single clones appeared.
Preparation of activated B and T cells
The spleens from either BID+/+, BID-/- or BIDA/A 8-10-wk old mice were pressed
through stainless steel mesh to make a cell suspension in PBS. The cells were
centrifuged at 1500 rpm for 5 min, resuspend in 1mL ACK lysis buffer for 1 min to
separate between erythrocytes and splenocytes and washed twice with PBS. B and T
cells were isolated from the total splenocytes by immune-magnetic depletion with
anti-B220 for B cells or anti-CD90.2 for T cells (BD Bioscience). B cells were
stimulated with 25µg/ml lipopolysaccharide (LPS; Sigma) and 10ng/ml interleukin 4
(IL-4; PeproTech Asia) for 2 days. T cells were stimulated with 2µg/ml Concanavalin
A (Con A; Sigma) and 10ng/ml interleukin 2 (IL-2; PeproTech Asia) for 2 days. The
cells were resuspended (1x106 cells/ml) in RPMI 1640 medium supplemented with
10% FCS, 50 U/ml penicillin, 50 mg/ml streptomycin, 1 mM Sodium pyruvate, 0.1
mM β-mercaptoethanol, 2 mM glutamine, 0.1 mM non-essential amino acids.
Human cell lines and transient transfection
293, a human embryonic kidney cell line, and HeLa, a human cervical
adenocarcinoma cell line were maintained in 10% fetal bovine serum. Transient
transfections were performed by using a calcium phosphate kit (Promega) or with
lipofectamine 2000 (Gibco BRL).
HeLa BID KD cells
Human cervical adenocarcinoma cell line (HeLa) was stably transfected with BID
SiRNA or scrambled SiRNA as a control. These cells were generated in the lab of Dr.
Jochen Prehn, Dublin.
22
Cellular assays
Radio-resistant DNA Synthesis assay (RDS)
For the intra-s-phase checkpoint analysis, T and B cells were activated for 48 hr and
than split into 6 wells dishes 150,000 cells per well. 2 hr later samples were either left
untreated or treated with 2 µM MMC or 10 Gy IR. 2 hr post MMC treatment and 1 hr
post IR treatment cells were labeled with 3H-thymidine for 30 min. Cells were fixed
in ice-cold TCA, the fixed cells were bound to glass fiber filters (Whatman GF/C) and 3H-thymidine incorporation was determined. The 3H-thymidine incorporation in
unirradiated cells was set at 100%, and percent incorporation was calculated.
Metaphase spreads assay
BID+/+, BID−/− or BIDAA T or B cells were treated with 100 nM MMC or with 2Gy
IR. After 24 hrs cells were mitotic arrested (2 h in 0.1mg/mL Colcemid, Invitrogen
Life Technologies). Then cells were incubated 8 min in 0.075M KCl (37°C), and 2
mL fixative (3:1 absolute methanol : acetic acid) was added dropwise. Cells were
mixed, centrifuged, and resuspended in fresh fixative; the fixative step was repeated
3–6 times, and air-dried slides stained with Gimesa were prepared. Metaphases from
BID+/+, BID−/− or BIDAA cells were scored for chromosomal damage per metaphase as
follows: each chromosome break was given a score of +1, and each triradial or
quadriradial form was given a score of +2.
BrdU labeling and analysis
The cells were labeled with 10 µM BrdU (Sigma; added to the medium) for 45 min,
washed with PBS and treated with MMC (1µM) for 2 hrs. Cells were then washed,
incubated in fresh medium for the indicated time points, and fixed with cold 70%
ethanol and incubated overnight at -20˚C. The next day, cells were collected and
resuspended in 2N HCl with 0.5% Triton X-100 for 30 min at room temperature
followed by neutralization with 0.1 M Na2B4O7. Cells were then collected and
incubated with anti-BrdU Abs (Becton-Dickinson) for 30 min in the dark at room
temperature. The cells were washed with PBS, and stained with FITC labeled goat
anti-mouse Abs (Jackson) for 30 min at room temperature in the dark. The cells were
then resuspended in PBS containing PI (5 µg/ml) and analyzed by FACScan.
23
Cell viability assay
Cell viability was determined by propidium iodide (PI) dye exclusion. PI (25 µg/ml)
was added to the cells immediately prior to analysis by FACScan (Beckton
Dickinson).
Cell cycle assay
Cells were treated with 10 µM Etop for 8 hrs, rinsed, and then collected for fixation in
methanol. Following fixation, cells were washed and resuspended in PBS with 25
µg/ml propidium-iodide (PI) and 50 µg/ml RNAse a half hour before FACScan
analysis. Analysis of the cell cycle results was performed using the ModFit LT
program [63].
Apoptosis assay
Cells were treated for the indicated times, harvested and stained as above. The percent
of cells displaying sub-G1 DNA content was determined by FACScan analysis.
Proteins analysis
Formaldehyde treatment and subcellular fractionation
Formaldehyde was added directly to the tissue culture media to a final concentration
of 1% and the cells were incubated for 10 min at room temperature. The cross-linking
reaction was stopped by adding glycine to a final concentration of 0.125 M and
incubation at room temperature for 5 min. Cells were then subfractionated as
previously described [64]. Cells were rinsed with wash buffer (125 mM KCl, 5 mM
magnesium acetate, 5 mM EGTA, 1 mM β−mercaptoethanol, 30 mM Tris-HCl, pH
7.5) at 4˚C, scraped from the plates, washed twice with the same buffer and allowed
to swell for 10 min in 0.5 ml swelling buffer [same as wash buffer except that the KCl
concentration was 10 mM and protease (set III; Calbiochem) and phosphatase (set I
and II; Sigma) inhibitor cocktails were added]. The cells were then lysed in a 2-ml
Wheaton Dounce glass homogenizer using 30 complete up and down cycles of a glass
“B”-type pestle. The homogenate obtained was overlaid on an equal volume of
swelling buffer containing 25% glycerol and centrifuged (600 x g at 4˚C for 5 min).
The upper layer of the supernatant was designated the cytosolic fraction. It should be
noted that all organelle membranes (besides the nuclear membrane) and the plasma
24
membrane are contained in this fraction. The nuclear pellet was washed once with
swelling buffer containing 25% glycerol and 0.1% Triton X-100. Nuclei were
resuspended in sonication buffer (100 mM NaCl, 2 mM MgCl2, 5 mM EGTA, 1 mM
β−mercaptoethanol, 10 mM Tris, pH 9.0). At this stage both the cytosolic and nuclear
samples were incubated at 65˚C for 4-5 hrs to reverse formaldehyde cross-links.
Nuclei were then disrupted by brief sonication. Aliquots of nuclear and cytosolic
fractions were separated by 12% or 15% SDS-PAGE and transferred to PVDF
membrane (Immun-blotTM, Bio-Rad).
Western blot and antibodies
Proteins were size-fractionated by SDS-PAGE and then transferred to PVDF
membranes (BioRad). Western blots were developed by use of the enhanced
chemiluminescence reagent (Amersham Bioscience, Inc). Protein A purified anti-
murineBID Ab, anti-MEK Ab (Sigma), anti-BAX and anti-lamin B Abs (Santa Cruz),
anti-p78-BID and anti-p61-BID abs (Bethyl laboratories), anti-human Chk-2, anti-
pP53, anti-cleaved caspase-3, anti-pSMC1 and anti-SMC1 abs (cell signaling), anti-
mouse Chk-2 ab (Upstate), anti-pATM ab (Rockland) and anti-ATM ab (a gift from
Yossi Shilo's lab) were used for Western blotting. Densitometry was done using
Quantity one program.
Viewing the cellular location of GFP fusion proteins
HeLa cells were grown on glass coverslips, transfected with either of the GFP
constructs, treated as indicated and fixed with 4% paraformaldehyde in PBS for 10
min. The coverslips were mounted and confocal microscopy was performed by using
an Axiovert 100 TV microscope (Zeiss, Oberkochen, Germany) attached to the Bio-
Rad Radiance 2000 laser scanning system (Bio-Rad) and operated by LaserSharp
software.
Immunofluorescence
For immunofluorescence experiments, cells were grown on glass coverslips and fixed
with 4% paraformaldehyde in PBS for 10 min and permeabilized with 0.2% Triton X-
100 in PBS for 5 min. For blocking, the cells were incubated in PBS containing 0.1%
Triton and 3% BSA for 1 h at room temperature. For immunostaining, cells were
25
incubated for 2 h at room temperature with anti-murine BID or anti-p78 Abs in
blocking solution. After three washes with PBS containing 0.1% Triton, the cells were
stained for 1 h at room temperature with Cyt2-conjugated AffiniPure donkey anti-
rabbit Abs (dilution 1: 300, Jackson ImmunoResearch). After three additional washes
with PBS containing 0.1% Triton, the coverslips were mounted and confocal
microscopy was performed as described above.
Immunohistochemistry
Mouse spleen tissues were fixed and sectioned at 4 µm and paraffin sections were
deparaffinized by using standard method. After deparaffinization, dehydration, and
blocking of endogenous peroxidases with 3% H2O2 in methanol, sections were
incubated with 10% goat serum for 1 h, followed by incubation with the anti-cleaved
caspase-3 antibody (Cell Signaling; dilution of 1:50) to detect the cleavage products
of caspase-3. The sections were then washed and incubated with the biotinylated
secondary antibody (Jackson ImmunoResearch 1:200), followed by incubation with
horseradish streptavidin-peroxidase conjugate. After washing, sections were incubated
with the chromogen substrate and counterstained with hematoxylin.
26
Chapter I - The functional connection between BID and the nucleus
Cellular BID partially localizes to the nucleus
This part of the results was published in [53].
The involvement of BID in the DNA damage pathway has prompted us to assess
whether BID localizes to the nucleus. Immunofluoresence (IF) studies with BID+/+
MEFs using anti-BID antibodies has revealed positive staining of BID in the nucleus
(Fig. 4A). To confirm these results, we performed subcellular fractionations followed
by Western blot analysis using anti-BID antibodies. In these experiments, cellular
BID was detected only in the soluble/cytoplasmic fraction (Fig. 4B, left top panel).
MEK and BAX (cytosolic proteins) and lamin B (a nuclear protein) were used as
markers to confirm the purity of the fractions. These results together with the IF
results, suggested that BID might be loosely associated with the nuclear fraction. To
examine this possibility, cells were treated with formaldehyde as a cross linker prior
to cellular disruption. These experiments demonstrated that a small fraction of cellular
BID was localized to the nuclear fraction (Fig. 4B, right top panel). These results
suggested that BID is loosely associated with the nuclear fraction by interaction with
another protein(s) or with DNA and that crosslinking is required to preserve this
interaction.
27
Figure 4. Mouse BID is partially localized to the nucleus. (A) Positive staining of BID in the nucleus of healthy MEFs. BID+/+ MEFs grown on glass coverslips and immunostained with anti-BID Abs (green). (B) A small fraction of cellular BID is detected in the nuclear fraction. BID+/+ MEFs were either left untreated (-) or treated with formaldehyde (+) and subfractionated. Aliquots of the cytosolic (C) and nuclear (N) fractions were subjected to SDS-PAGE followed by Western blot analysis using anti-BID (top), anti-MEK (middle top), anti-BAX (middle bottom) and anti-lamin B (botton) Abs.
DNA damage results in the nuclear export of BID
This part of the results up until figure 7 was published in [65].
The fact that BID partially localizes to the nucleus and that all currently identified
substrates of ATM are nuclear proteins, suggested that BID is phosphorylated in the
nucleus. Since BID is known to act at the mitochondria, we suspected that its
phosphorylation might trigger its release from the nucleus. To examine this point, we
performed IF studies with cells treated with Etop but could not detect any change in
the cellular location of BID. Since the IF studies using the anti-BID antibodies were
not conclusive, we took an alternative approach and generated a BID-GFP chimeric
construct, transfected HeLa cells with this construct, and determined the cellular
location of the chimeric protein in untreated cells and in cells treated with Etop. In
untreated cells, most of the BID–GFP fluorescence appeared in the nucleus (Fig. 5A,
top left panel). Forty-five minutes after Etop treatment, there was an increase in the
cytosolic fluorescence of BID–GFP, and at 90 min after treatment there was a further
increase in this fluorescence (Fig. 5A, top panels and bottom left panel). This pattern
of fluoresence remained untill 150 min after Etop treatment. Similar results were
obtained with cells treated with IR (Fig. 5A, bottom right panel), indicating that BID
nuclear exit is a general feature of the DDR.
The exit of proteins from the nucleus is mostly regulated via the nuclear export
receptor CRM1, and therefore, we tested whether leptomycin B (LMB), a specific
inhibitor of the CRM1, will prevent the nuclear exit of BID. Strikingly, treatment with
LMB prevented the nuclear exit of BID–GFP following Etop treatment (Fig. 5B).
These results suggest that DNA damage results in the nuclear export of BID, and that
this export is mediated via the export receptor CRM1. The nuclear export of proteins
by CRM1 is mediated via nuclear export signals (NESs) [66]. The fact that LMB
inhibited the nuclear exit of BID suggests that BID carries an NES. Examination of
the mouse BID sequence for an NES consensus motif revealed that it carries such a
28
motif (amino acid residues 35–44; Fig. 5C). The REV type NES consensus motif (the
one found in BID) is comprised of an 8–12 amino-acid stretch, and mutations of the
conserved leucines abolishes the nuclear export of proteins carrying this sequence
[66]. To assess whether the nuclear export of BID is regulated by this motif, we
mutated all three of the conserved leucines in this motif to alanines
{L35A/L38A/L42A-(3L/A)} or completely deleted this motif (delNES). wtBID, BID-
3L/A and BID-delNES were fused to GFP and expressed in HeLa cells and their
cellular locations were assessed in the absence or presence of Etop. These studies
showed that mutating/deleting this motif did not affect the nuclear exit of BID (Fig.
5D). Thus, the 35–44 amino acid stretch in BID does not seem to function as an NES,
and therefore, BID nuclear export is probably mediated by another NES-carrying
protein. Finally, it is tempting to speculate that ATM-mediated phosphorylation of
BID regulates its nuclear export. However, this does not seem to be the case, as DNA
damage resulted in the nuclear exit of the non-phosphorylatable BID mutant (BID-
S61A/S78A-GFP; data not shown).
29
30
Figure 5. DNA damage results in the nuclear export of BID. (A) DNA damage results in the nuclear exit of BID–GFP. HeLa cells were grown on coverslips and transfected with a BID–GFP construct. At 16 h post–transfection, the cells were either left untreated (N/T) or treated with Etop (100 µM) or IR (50 Gy). At the indicated times post Etop or -IR treatment, the cells were fixed and pictures were taken using a confocal microscope (top panels show only Etop-treated cells). Bottom: the histograms represent the percentage of cells out of transfected cells that show a prevalence of BID–GFP in the nucleus (N>C) or an equal distribution of BID–GFP between nucleus and cytoplasm (N=C). The data are expressed as the mean ±S.E.M. of three independent experiments in which 100 cells were analyzed each time. The left panel represents cells treated with Etop, and the right panel represents cells treated with IR. (B) LMB prevents the nuclear exit of BID–GFP. HeLa cells were treated as above. At 16 h post–transfection, the cells were pre-treated for 1 h with LMB (5 ng/ml), and then either left untreated (N/T) or treated with 100 µM Etop. At the indicated times after Etop treatment, the cells were fixed and pictures were taken using a confocal microscope (top panels). The histograms shown in the bottom panel were generated as described in (A). (C) Mouse BID carries an NES consensus motif. The NES consensus motif found in BID is shown in the top line, and in the bottom line appears the general NES consensus motif that contains four closely spaced leucines, which can be substituted by other large hydrophobic residues (Isoleucines/Valines). (D) The nuclear export of BID is not regulated by its NES motif or its phosphorylation. HeLa cells were grown on coverslips and transfected with BID-3L/A–GFP or BID-delNES-GFP constructs and treated as above. At the indicated times after Etop treatment, the cells were fixed and pictures were taken using a confocal microscope. The histograms shown were generated as described in (A).
Fusing BID to a strong nuclear localization signal inhibits its nuclear export
To examine the functional importance of BID nuclear export, we attempted to trap it
in the nucleus using a strong nuclear localization signal (NLS) ([67]; notably, mouse
BID does not carry a classical NLS). We found that fusing BID–GFP to the NLS of
the SV40 large-T antigen [68] further drove BID–GFP to the nucleus (Fig. 6A, left
panel). Importantly, Etop treatment did not result in the nuclear exit of NLS–BID–
GFP (Fig. 6A, middle panels), suggesting that this chimeric BID protein is trapped in
the nucleus. As mentioned above, we demonstrated by subcellular fractionation that
the endogenous BID in MEFs is loosely associated with the nuclear fraction, and that
crosslinking (using formaldehyde) is required to preserve this localization. To confirm
that NLS–BID–GFP is localized to the nucleus, we performed subcellular
fractionations in the presence of formaldehyde. Indeed, we found that BID–GFP was
mostly localized to the cytoplasmic fraction, whereas NLS–BID–GFP partitions
equally between the cytoplasmic and nuclear fractions (Fig. 6B). The fact that a
significant portion of NLS–BID–GFP appears in the cytoplasmic fraction (in contrast
to the results we obtained in the fluorescence studies) suggests that it leaks out of the
nucleus during preparation.
31
Figure 6. Fusing BID to a strong NLS inhibits its nuclear export. (A) NLS–BID–GFP does not exit the nucleus in response to Etop. HeLa cells were transfected with NLS–BID–GFP, and 16 h post–transfection, the cells were either left untreated (N/T) or treated with 100 µM Etop. At the indicated times after Etop treatment, the cells were fixed and pictures were taken using a confocal microscope (left and middle panels). Right panel: a schematic representation of the NLS–BID–GFP protein. (B) NLS–BID–GFP is localized to the nucleus. HeLa cells were transfected with either BID-GFP or NLS–BID–GFP, and 16 h post–transfection, the cells were treated with formaldehyde and subfractionated. Aliquots of the cytoplasmic (C) and nuclear (N) fractions were subjected to SDS–PAGE followed by Western blot analysis using anti-BID Abs (top). The blot was stripped and reprobed with anti-lamin B Abs to mark the nuclear fraction (bottom).
Introduction of NLS–BID into BID-/- MEFs fails to restore susceptibility to Etop-
induced cell death
Previously, we demonstrated that BID-/- MEFs are less susceptible than BID +/+ MEFs
to DNA damage-induced cell death, and that reintroduction of wtBID restored
susceptibility to DNA damage [51,53]. To explore the ability of NLS–BID to restore
susceptibility to DNA damage, we generated single stable clones of BID-/- MEFs that
express either wtBID or NLS–BID, or carry an empty vector. Initially, we confirmed
the cellular location of wtBID and NLS–BID in these clones, and showed by both
subcellular fractionation and by IF that wtBID was mostly cytosolic, whereas NLS–
BID partitions equally between the cytoplasmic and nuclear compartments (Fig. 7A).
Next, we assessed the levels of Etop-induced cell death in the wtBID, NLS–BID and
empty vector stable clones. We found that the wtBID clones showed a 2-to-3 fold
32
higher level of cell death compared to the empty vector clones, whereas there was no
significant difference in the levels of cell death between the NLS–BID clones and the
empty vector clones (Fig. 7B; only two clones from each are shown). Western blot
analysis using anti-BID antibodies indicated that the decreased levels of cell death
seen in the NLS–BID clones in response to Etop was not due to lower levels of
expression of NLS–BID (Fig. 7C). Thus, trapping BID in the nucleus impairs its cell
death activity in response to DNA damage.
Figure 7. Introduction of NLS–BID into BID-/- MEFs fails to restore susceptibility to Etop-induced cell death. (A) NLS–BID is localized to the nucleus in the MEFs stable clones. Left panel: BID-/- MEFs stably expressing either wtBID or NLS–BID (one clone from each) were treated with formaldehyde and subfractionated. Aliquots of the cytoplasmic (C) and nuclear (N) fractions were subjected to SDS–PAGE followed by Western blot analysis using anti-BID Abs (top). The blot was stripped and reprobed with anti-lamin B Abs to mark the nuclear fraction (bottom). Right panels: BID-/- MEFs stably expressing either wtBID or NLS–BID (one clone from each) were fixed and stained with anti-BID Abs, and pictures were taken using a confocal microscope. (B) BID/-/ MEFs stably expressing either wtBID or NLS–BID, or carrying an empty vector (two clones from each) were treated with 50 µM Etop for 24 h, and cell death was monitored by FACScan using PI dye exclusion. The data represent the means ±S.E.M. of pooled results from three independent experiments. (C) The decreased death
33
obtained with the NLS–BID clones is not due to lower levels of expression of NLS–BID. The two wtBID and two NLS–BID clones were lysed, and equal amounts of protein (20 µg per lane) were subjected to SDS–PAGE, followed by Western blot analysis using anti-BID Abs (top). The blot was stripped and reprobed with β-actin Abs to control for loading (bottom).
BID-/- MEFs expressing NLS–BID fail to arrest in the S phase of the cell cycle
following Etop treatment
Previously, we demonstrated that BID is important for S-phase arrest following DNA
damage, and that this novel activity of BID is regulated by its phosphorylation by
ATM [53]. To explore the effect of NLS–BID on S-phase arrest, we performed cell
cycle analysis on wtBID and on NLS–BID stable clones either untreated or treated
with Etop. Surprisingly, Etop treatment did not induce S-phase arrest in the NLS–BID
clones and cells from these clones rapidly accumulated in the G2 phase, whereas cells
from the wtBID clones accumulated in the S phase (Fig. 8A; only two clones from
each are shown). To exclude the possibility that the stable clones expressing NLS–
BID may have developed a compensating genetic or extragenetic change that is
responsible for the observed effects, we performed cell cycle experiments with BID-/-
MEFs 3 days post-infection with either wtBID or NLS–BID. We found that BID-/-
cells infected with wtBID showed an 10% increase in S phase following Etop
treatment, whereas BID-/- cells infected with NLS–BID did not (Fig. 8B). These
results confirm that NLS–BID is indeed impaired in its ability to induce S-phase
arrest, as it is unlikely that 3 days post-infection the NLS–BID cells developed a
compensating genetic change that is responsible for the observed effects. To assess
whether the impaired ability to arrest in S phase was due to an inability of NLS–BID
to be phosphorylated in response to Etop treatment, wtBID and NLS–BID cells were
treated with Etop and Western blot analyzed using the phospho-specific antibodies to
phosphoserine 78 [53]. Fig. 8C shows that NLS–BID is phosphorylated in a similar
time course as wtBID, suggesting that the inability of NLS–BID to induce S-phase
arrest is not due to impaired phosphorylation. Taken together, these results suggest
that nuclear export of BID is important for its S-phase arrest function in the DNA-
damage response.
34
B
35
Figure 8. BID-/- MEFs expressing NLS–BID fail to arrest in the S phase of the cell cycle following etoposide treatment. (A) BID-/- MEFs stably expressing either wtBID or NLS–BID (the same four clones shown in Figure 7B) were either left untreated (N/T) or treated with 10 µM Etop, and 8 h post–treatment, the DNA content was analyzed by flow cytometry. The actual raw data from a representative experiment together with multiline plots generated by the ModFit LT computer software program are show in the top panel. The dark histograms represent the percent of cells in the G1 and G2/M phases, and the hatched histograms represent the percent of cells in S phase. The exact percentage of cells in each phase of the cell cycle (in each of the four clones) is shown in the bottom three panels. The data represent the means ±S.E.M. of pooled results from three independent experiments. (B) BID-/- MEFs three days post infection with NLS-BID fail to arrest in the S phase of the cell cycle following Etop treatment. BID-/- MEFs were infected with retroviruses carrying either wtBID or NLS-BID. Three days post infection and selection with 1 µg/ml puromycin, the cells were either left untreated (N/T) or treated with 10 µM Etop, and 8 hrs post treatment the DNA content was analyzed by flow cytometry. The exact percentage of cells in each phase of the cell cycle is shown. The data represent the means ± SEM of pooled results from three independent experiments. (C) NLS–BID is phosphorylated on S78 in a similar time course as wtBID. BID-/- MEFs stably expressing either wtBID or NLS–BID (one clone from each) were either left untreated (N/T) or treated with 50 µM etoposide. At the indicated time points, the cells were lysed and equal amounts of protein (20 µg per lane) were subjected to SDS–PAGE, followed by Western blot analysis using either anti-pS78 Abs (top) or antibodies to regular BID (bottom).
Caspases are not involved in the nucleocytoplasmic shuttling of BID
To assess whether caspases are involved in the nucleocytoplasmic shuttling of BID,
we monitored the cellular location of BID–GFP in HeLa cells in the presence of the
broad caspase inhibitor zVAD-fmk, and found that inhibition of caspases had no
affect on the nuclear export of BID following DNA damage (data not shown).
Moreover, we performed similar studies with the caspase-8 non-cleavable mutant of
BID (BID D59A-GFP), and found that DNA damage resulted in the nuclear exit of
this mutant (Fig. 9A). We also used zVAD-fmk to test whether the S-phase arrest
might be an indirect consequence of cell death rather than a direct effect of BID
nuclear exit. We found that inhibition of caspases did not affect the ability of the
wtBID cells to arrest in the S phase and did not change the differences in the cell
cycle distribution between the wtBID and the NLS–BID cells (Fig. 9B). Thus,
caspases do not seem to be involved in the nuclear exit of BID or in the ability of BID
to induce S-phase arrest.
36
Figure 9. Caspases are not involved in the nucleocytoplasmic shuttling of BID. (A) The nuclear export of BID isn't regulated by caspase activity. HeLa cells were grown on coverslips and transfected with BID-D59A–GFP construct and treated with Etop (100 µM). At the indicated times after Etop treatment, the cells were fixed and pictures were taken using a confocal microscope. The histograms shown were generated as described in (5A). (B) The differences in the cell cycle distribution between the wtBID and the NLS–BID cells are not affected by caspases. BID-/- MEFs stably expressing either wtBID or NLS–BID (the same four clones shown in Figure 7B) were either left untreated (N/T) or treated with 10 µM Etop, in the presence or the absent of zVAD (50µM) and 8 h post–treatment, the DNA content was analyzed by flow cytometry. The data represent the means ±S.E.M. of pooled results from three independent experiments.
37
BID phosphoryaltion occurs in the nucleus
To assess whether BID phosphorylation occur in the nucleus and whether nuclear
localization of BID is essential to execute its function in the DDR, we created a BID-
estrogen receptor chimera (BID-ER) [62]. In this model, proteins that are artificially
fused to a portion of the estrogen receptor are held in the cytosol (excluded from the
nucleus) until the addition of 4-hydroxy-tamoxifen (4-HOT), which results in a
conformational change and translocation to the nucleus. We generated a BID-ER
chimeric protein by fusing a portion of the estrogen receptor to the C-terminus of
BID, and generated several BID-/- MEF stable clones that express this chimeric
protein (Fig. 10A). Of note, the stable clones expressed extremely low levels of BID-
ER, and treatment with 4-OHT significantly increased its expression level. We
initially assessed the cellular location of BID-ER by IF staining using αBID
antibodies and showed that while the BID-ER protein is localized in the cytosol,
addition of 4-OHT resulted in its translocation to the nucleus (Fig. 10B). Western blot
analysis using the pS78 antibody demonstrated that DNA damage-induced
phosphorylation of BID-ER occurs only in the presence of 4-OHT (Fig. 10C top
panel). Thus, ATM-mediated BID phosphorylation in the DDR occurs in the nucleus.
As noted above, treatment with 4-OHT increases the expression levels of BID-ER
(Fig. 10C, bottom panel) suggesting that BID translocation to the nucleus might
stabilize the protein. Functional assays using these lines demonstrated that the
addition of 4-OHT had no significant affect on DNA damage-induced S phase arrest
and apoptosis (data not shown). These results are probably due to the low levels of
BID-ER in the stable clones examined.
38
Figure 10. BID phosphoryaltion occurs in the nucleus. (A) Left panel: A schematic model of the BID-ER chimeric protein. Right panel: Expression of BID-ER in 3 stable clones. BID-/- MEFs stably expressing BID-ER were either left untreated (-) or treated (+) with 100nM 4-OHT for 24 hrs. Cells were then lyzed and equal amounts of protein were subjected to SDS-PAGE, followed by Western blot analysis using anti-BID Abs. (B) Addition of 4-OHT results in BID-ER translocation to the nucleus. BID-/- MEFs stably expressing BID-ER were either left untreated (N/T) or treated with 100nM 4-OHT for 24 hrs, fixed and stained with anti-BID Abs and DAPI. (C) BID phosphorylation on serine 78 occurs only in the presence of 4-OHT. BID-/- MEFs stably expressing BID-ER were either left untreated (-) or treated (+) with 100nM 4-OHT for either 3 or 24 hrs, and then were either left untreated (-) or treated (+) with 50µM Etop for an additional 1 hr. The cells were then lyzed and equal amounts of protein were subjected to SDS-PAGE, followed by Western blot analysis using either anti-pS78 (top) or anti- BID (bottom) Abs. * marks a crossreactive band.
Mr(kD)
55
55
43
72
43
72
Etop: +
IB:αpS78
P-BID-ER
IB:αBID
BID-ER
+- -4-OHT: - 3h
+-24h
*
Mr(kD)
55
55
43
72
43
72
Etop: +
IB:αpS78
P-BID-ER
IB:αBID
BID-ER
+- -4-OHT: - 3h
+-24h
*
39
Chapter II - BID phosphorylation at the mitochondria
The results that appear in this chapter have not been published yet
DNA damage induces phosphorylation of exogenous BID at the mitochondria
As shown above, generation of BID-ER that results in trapping of BID outside the
nucleus prevents its phosphorylation in response to DNA damage. DNA damage-
induced phosphorylation of BID-ER occurs only in the presence of 4-OHT, indicating
that ATM-mediated BID phosphorylation in the DDR occurs in the nucleus. Thus, in
accordance with our hypothesis, BID is most likely phosphorylated in the nucleus. If
this hypothesis is correct then targeting BID to the mitochondria should prevent its
phosphorylation. To examine this issue, we targeted BID to the mitochondria by
fusing the trans-membrane (TM) domain of BCL-2 to the C-terminus of wtBID. We
first confirmed by IF that BID-TM was localized to the mitochondria (Fig. 11A).
Next, we determined whether BID-TM is phosphorylated in response to Etop, and to
our surprise it was (Fig. 11B; in these experiments cells were treated with the broad
caspase inhibitor zVAD-fmk to block apoptosis since BID-TM is a potent inducer of
apoptosis). Even more surprising was the fact that BID-TM was phosphorylated in
cells that were not treated with Etop (Fig. 11B; of note, throughout this chapter only
results with the anti-pS78 antibodies are presented but similar results were obtained
with the anti-pS61 antibodies).
40
Figure 11. DNA damage induces phosphorylation of BID at the mitochondria. (A) BID-TM is localized to the mitochondria. HeLa cells were transfected with BID-TM construct (in the presence of zVAD-fmk to inhibit apoptosis). 16 hrs post transfection, cells were fixed and stained with anti-BID Abs. Pictures were taken using confocal microscope. (B) BID-TM is phosphorylated on S78 in non-treated cells and Etop increases its phosphorylation. HeLa cells were transfected with an empty vector, a wtBID or a BID-TM construct (in the presence of zVAD-fmk to inhibit apoptosis) and 16 hrs post transfection treated with 100µM Etop. At the indicated times following Etop treatment the cells were lysed and equal amounts of protein were subjected to SDS-PAGE, followed by Western blot analysis using either anti-pS78 Abs (top) or antibodies to regular BID (bottom). * mark crossreactive bands. The phospho-form of BID-TM is localized at the mitochondria
To confirm that the phosphorylated form of BID-TM (BID-TM-P) is localized to the
mitochondria, we co-transfected BID-TM with Tom5-GFP (a mitochondrial outer
membrane protein), and performed IF studies with our αpS78 antibody. These studies
indicated that BID-TM-P is indeed localized to the mitochondria (Fig. 12A). It is
important to note that our αpS78 antibody gives non-specific staining in cells treated
with DNA damage reagents (data not shown), but in the studies presented here cells
were left untreated.
We next asked whether BID-TM is initially phosphorylated in the nucleus and later
translocates to the mitochondria. Based on the fact that ATM is a nuclear kinase we
assumed that BID-TM is initially phosphorylated in the nucleus. To test this
possibility we performed similar studies in the presence of LMB, which should block
the translocation of BID-TM-P to the mitochondria. Surprisingly, the presence of
LMB did not eliminate the positive staining of BID-TM-P at the mitochondria (Fig.
12B). These results suggested that BID-TM is phosphorylated at the mitochondria.
41
Figure 12. The phospho-form of BID-TM is localized at the mitochondria. (A) The phospho-form of BID-TM is localized at the mitochondria. HeLa cells were co-transfected with BID-TM and TOM5-GFP (mitochondrial marker, in the presence of zVAD-fmk to inhibit apoptosis). 16 hrs post transfection, cells were fixed and stained with anti-pS78 Abs (left panel). The right panel is a merge of the left and middle panel. Pictures were taken using confocal microscope. (B) BID-TM is phosphorylated at the mitochondria. HeLa cells were co-transfected as above with addition of 5ng/ml LMB. 16 hrs post transfection, cells were fixed and stained with anti-pS78 Abs (left panel). The right panel is a merge of the left and middle panel. Pictures were taken using confocal microscope.
BID phosphorylation at the mitochondria is partially mediated by ATM
To test whether phosphorylation of BID-TM was ATM-dependent, we took advantage
of a stable HeLa cell line in which ATM was knocked down by siRNA (in these cells,
the level of ATM was reduced by ~95% [69]. Both these cells and the control cells,
which carry a siRNA against lacZ, were transfected with either wtBID or BID-TM
and either left untreated or treated with Etop. Interestingly, phosphorylation of BID-
TM was significantly reduced in the ATM knock down cells but was not blocked as in
the case of the wtBID cells (Fig. 13). Thus, DNA damage results in phosphorylation
of an exogenously expressed BID protein at the mitochondria, and this
phosphorylation is partially mediated by ATM.
42
Figure 13. BID phosphorylation at the mitochondria is mediated by ATM. A stable HeLa cell line in which ATM is knocked down by siRNA or a control line, which carries a siRNA against lacZ, were transfected with a wtBID or a BID-TM constructs (in the presence of zVAD-fmk to inhibit apoptosis) and 16 hrs post transfection treated with 100 µM Etop. At the indicated time points following Etop treatment, the cells were lyzed and equal amounts of protein were subjected to SDS-PAGE, followed by Western blot analysis using either anti-pS78 Abs (top) or antibodies to regular BID (bottom). * marks a crossreactive band.
BID-TM expression does not result in the phosphorylation of other ATM substrates
The results above show that phosphorylation of BID-TM occurs in the absence of
DNA damage and is partially dependent on ATM. Thus, over-expression of BID-TM
might activate ATM, which in turn phosphorylates BID-TM. If over-expression of
BID-TM results in the activation of ATM, then additional ATM substrates should be
phosphorylated. Interestingly, Chk2 and p53, nuclear substrates of ATM, were not
phosphorylated in the absence of DNA damage in cells expressing BID-TM as
compared to cells expressing wtBID (Fig. 14). These results suggest that over-
expression of BID-TM might activate ATM outside the nucleus.
Figure 14. BID-TM expression does not result in the phosphorylation of other ATM substrates. Chk2 and p53, nuclear substrates of ATM, are not phosphorylated in cells expressing BID-TM. HeLa cells were transfected with an empty vector, wtBID or BID-TM, (in the presence of zVAD-fmk to inhibit apoptosis) and 16 hrs post transfection treated with 50µM Etop. 2 hours post Etop treatment the cells were lysed and equal amounts of protein were subjected to SDS-PAGE followed by Western blot analysis using anti-pChk2 and anti-p-p53 Abs.
Mutating the phosphorylation sites of BID-TM does not affect its ability to induce
cell death
BID-TM, which is targeted to the mitochondria, is a potent inducer of apoptosis (Fig.
15). To test whether the phosphorylation of BID-TM on serines 61 and 78 regulates
43
its cell death activity, we assessed the ability of the mutated form (BID-S61A/S78A-
TM; BIDAA-TM) to induce cell death. Our results show that BIDAA-TM induces cell
death to the same levels as BID-TM and tBID, suggesting that in this setting BID-TM
phophorylation does not regulate its ability to induce cell death (Fig. 15).
Figure 15. Mutations in the phosphorylation site of BID do not affect on its ability to kill. HeLa cells were either left un-transfected or transfected with an empty vector, wtBID, BID-TM, BID-TM mutated in ser78 (S78A), BID-TM mutated in ser61 (S61A), BIDAA-TM and tBID constructs and 24 hrs post transfection cell death was measured by PI exclusion. The data represent the means ±S.E.M. of pooled results from three independent experiments.
Mutating in the BH3 domain of BID-TM does not change its phosphorylation
status
A G94E point mutation in the conserved BH3 domain of BID has previously been
shown to abolish its interaction with both BAX and BCL-2, and to significantly
decrease its Cyt c releasing activity [20,31]. Next, we tested the effect of this mutation
on BID-TM phosphorylation. We transfected HeLa cells with either wtBID, BID-TM
or BID(G94E)-TM constructs and cells were either left untreated or treated with Etop.
Our results show that BID(G94E)-TM is phosphorylated in a similar manner as BID-
TM, indicating that BID-TM’s interaction with BCL-2 family members and its pro-
apoptotic activity do not affect its phosphorylation (Fig. 16).
44
Figure 16. Mutation in the BH3 domain of BID-TM does not change its phosphorylation status. HeLa cells were transfected with a wtBID, BID-TM or BID(G94E)-TM constructs (in the presence of zVAD-fmk to inhibit apoptosis) and 16 hrs post transfection treated with 100µM Etop. 2 hrs following Etop treatment the cells were lysed and equal amounts of protein were subjected to SDS-PAGE, followed by Western blot analysis using either anti-pS78 Abs (top) or antibodies to regular BID (bottom).
tBID is phosphorylated on S78 in the absence of DNA damage and this
phosphorylation is mediated by ATM
BID-TM is an artificial molecule and therefore might not necessarily represent a
physiological situation. To test whether BID can indeed be phosphorylated at the
mitochondria, we determined whether over-expression of tBID also results in its
phosphorylation in an ATM-dependent manner in the absence of DNA damage.
Similar to the results we obtained with BID-TM, over-expression of tBID resulted in
its phosphorylation in the absence of DNA damage, and this phosphorylation was
ATM-dependent since it was significantly reduced in ATM knock down cells (Fig.
17, left panels), and in cells treated with the ATM inhibitor KU55933 (Fig. 17, right
panels).
45
Figure 17. tBID is phosphorylated on S78 in the absence of DNA damage and this phosphorylation is mediated by ATM. Left panel: A stable ATM knockdown HeLa cell line and a control line, were transfected with tBID and 16 hrs post transfection treated with 50µM Etop. 2 hours post Etop treatment the cells were lysed and equal amounts of protein were subjected to SDS-PAGE followed by Western blot analysis using anti-pS78 Abs. Right panel: HeLa cells were transfected with tBID and 16 hrs post transfection treated with KU55933 (10µM). 1 hr after KU addition the cells were treated with 50µM Etop. 2 hours post Etop treatment the cells were lysed and equal amounts of protein were subjected to SDS-PAGE followed by Western blot analysis using either anti-pS78 Abs (top) or anti-BID Abs (bottom). tBID is phosphorylated in-vitro by a mitochondria-associated kinase
To assess whether the mitochondria contains a kinase that phosphorylates BID, we
performed an in-vitro kinase assay using purified mitochondria and recombinant
tBID. Targeting recombinant tBID to mitochondria resulted in its phosphorylation on
S78 (Fig. 18, left panels). Interestingly, ATM seems to be required for this
phosphorylation in-vitro since when we targeted tBID to mitochondria that were
purified from ATM-/- MEFs there was a significant reduction in tBID phosphorylation
relative to the control (Fig. 18, right panels).
Figure 18. tBID is phosphorylated in-vitro by a mitochondria-associated kinase. Left panel: Recombinant tBID was either left untreated or incubated with purified mitochondria (prepare from HeLa cells) in the presence of a kinase buffer for 30 min at 37˚C. Phosphorylated tBID was evaluated using anti-pS78 Abs. Right panel: Mitochondria purified from ATM wild-type (+/+) or ATM knockout (-/-) MEFs were incubated with recombinant tBID in the presence of a kinase buffer for 30 min in 37˚C, and phosphorylated tBID was evaluated using anti-pS78 Abs.
46
Chapter III - The role of ATM-mediated BID phosphorylation in-vivo
The results presented in this chapter are being prepared for publication
Generation of BIDS61A/S78A knock-in mice, in which endogenous BID is no longer
capable of being phosphorylated on serines 61 and 78
To determine the role and importance of ATM-mediated BID phosphorylation in-vivo
BIDS61A/S78A (BIDAA) knock-in mice were generated in our lab. These mice are born
at a normal Mendelian frequency and with no gross abnormalities. To confirm that
endogenous BID in the BIDAA mice is no longer capable of being phosphorylated on
serines 61 and 78, BID+/+, heterozygous BID+/AA, and homozygous BIDAA animals
were exposed to a sub-lethal dose of γ-radiation and the phosphorylation status of
BID and its level of expression in thymus, spleen, and kidney were examined.
Western blot analysis using the anti-phospho BID antibodies detected phosphorylated
BID in wild-type and heterozygous tissues, but failed to detect phosphorylated BID in
tissues obtained from the homozygous BIDAA mice (Fig. 19, top and middle panels).
Western blot analysis using antibodies to unmodified BID revealed that the amounts
of BID protein expressed in the three tissues from all three types of animals were
similar (Fig. 19, bottom panel). These results indicate that BID levels and patterns of
expression in the BIDAA mice are normal, but in these mice BID is no longer capable
of being phosphorylated at the ATM regulatory sites.
Figure 19. BID is expressed but is not phosphorylated following whole body irradiation in homozygous BIDAA mice. Six-week old BID+/+, heterozygous BID+/AA, and homozygous BIDAA female mice were either left untreated (-) or subjected to whole body irradiation [+; 3Gy of IR]. The mice were sacrificed 1 hr later by cervical dislocation and the indicated organs were removed, immediately homogenized and equal amounts of protein were subjected to SDS-PAGE,
47
followed by Western blot analysis using either anti-pS78 (top), anti-pS61 (middle) or anti-BID (bottom) Abs.
BIDAA primary activated B and T cells demonstrate increased chromosomal
damage in response to DNA damaging reagents
A characteristic defect in the ATM pathway is chromosomal instability. Previously it
has been demonstrated that MMC induces the phosphorylation of BID on serines 61
and 78, and that BID-/- primary activated T cells show increased chromosomal
damage in response to MMC [54]. We repeated these studies and confirmed that BID-
/- primary activated T cells show a ~2-fold larger increase in chromosomal breaks as
compared to BID+/+ primary activated T cells when treated with MMC (Fig. 20A,B).
To assess whether ATM is involved in regulating BID's activity in preserving
genome stability, we determined the affect of MMC on BID+/+ and BIDAA primary
activated T cells. We found that BIDAA cells also showed a ~2-fold larger increase in
chromosomal damage as compared to BID+/+ cells when treated with MMC (Fig.
20C, D). Similar results were obtained when BID+/+ and BIDAA primary activated T
cells were treated with IR (Fig. 20E). We have also analyzed the chromosomal
damage in primary activated B cells in response to MMC, and scored the frequency
of each chromosome aberration. We found that the BIDAA cells demonstrate
significantly higher frequencies of chromosome and chromatid breaks in response to
MMC treatment as compared to BID+/+ cells (Fig. 20F). Frequencies of tri- and
quadriradial chromosomal figures and translocations were also significantly higher in
the BIDAA cells. Of note, the amount of chromosomal damage in the BIDAA cells was
higher than in the BID+/+ cells even in the absence of MMC treatment (Fig. 20F),
suggesting that the basal phosphorylation of BID also plays a role in preserving
genomic stability.
48
Figure 20. BIDAA primary B and T cells demonstrate increased chromosomal damage in response to DNA damaging reagents. (A) Metaphase spreads of BID+/+ and BID-/- primary activated T cells after 24 hrs of treatment with MMC (100 nM). Cells were arrested in metaphase with 0.1 mg/ml of colcemide, fixed, and visualized by Giemsa staing. The black arrows designate chromosomal breaks. (B) Quantification of the number of chromosomal breaks per cell evaluated in 100 metaphase spreads. (C) Metaphase spreads of BID+/+ and BIDAA primary activated T cells after 24 hrs of treatment with MMC (100 nM). Cells and chromosomes were prepared as in (A). The black arrow designates a quadriradial. (D) Quantification of the number of chromosomal breaks per cell evaluated in 100 metaphase spreads. (E) BIDAA primary activated T cells demonstrate increased metaphase aberrations in response to IR. Metaphase spreads were prepared as in (A). (F) BIDAA primary activated B cells demonstrate increased chromosomal damage in response to MMC treatment. Metaphase prepared has indicated in A, the table shows the chromosome aberration frequencies scored from 100 metaphases of each cell type/treatment in triplicates. The data presented is the mean of the three scorings from different metaphases, and * represent significant differences (P<0.05) based on Student's t test.
BIDAA primary B and T cells fail to arrest in the S phase in response to DNA
damage
Previously it was shown that BID-/- MEFs expressing BIDS61A/S78A fail to accumulate
in the S phase following DNA damage [53]. In addition the abnormal chromosomal
structures we observed in the BIDAA B and T cells represent “chromatid type” errors
resulting from improperly repaired DNA damage accrued during S phase of the cell
cycle [59] as previously demonstrated for BID-/- cells [54]. Based on these data it is
49
likely that the BIDAA cells have a defect in the S phase checkpoint. To test this
hypothesis we used two different methods; double-labeling experiments with BrdU
and PI and the radio-resistant DNA synthesis assay (RDS). Double-labeling
experiments with BrdU and PI enable us to follow the progress of cells through S
phase (see Fig. 21A for exact details of the experiment). We found that BIDAA T cells
are less delayed in the S phase following release from MMC as compared to BID+/+ T
cells (Fig. 21B; note the faster decrease in the % of BIDAA cells in S phase in the left
panel, and the faster decrease in the % of BIDAA cells in late S in the right panel). To
determine whether BIDAA cells are radio-resistant, BID+/+ and BIDAA cells were
treated with either MMC or IR, and labeled with 3H-thymidine to measure ongoing
DNA synthesis. MMC induced a significant reduction in DNA synthesis in the BID+/+
B and T cells (41% and 23%, respectively), whereas little reduction was observed in
the BIDAA B and T cells (14% and 0%, respectively; Fig. 21C, left panel). Similar
results were obtained with IR (Fig. 21C, right panel). Thus, BIDAA cells were found to
be impaired in their ability to temporarily arrest in S phase following DNA damage.
50
Figure 21. BIDAA primary B and T cells fail to arrest in the S phase in response to DNA damage. (A) Experimental design for the cell cycle experiments shown in B. Left panel: for the cell cycle experiments, BID+/+ and BIDAA activated T cells were labeled with BrdU (10µM) for 45 min, washed, and treated with MMC (1µM) for 2 hrs. Cells were then washed, and progression of BrdU-positive cells through the cell cycle was monitored at the indicated time points by flow cytometry. Right panel: The dot plot represent the distribution of cells through the cell cycle and the gates represent the % of cells in G1, early S, late S/G2 and G2/M phases. (B) Left panel: BIDAA T cells show a faster decrease in the % of cells in S phase after release from MMC. Right panel: BIDAA T cells show a faster decrease in the % of cells in late S phase (faster progression from the S to G2/M phase) after release from MMC. (C) BID+/+ and BIDAA primary activated B and T cells were either left untreated (N/T) or treated with MMC (2 µM; 2 hrs; left panel) or IR (10 Gy; right panel), followed by labeling with 3H-thymidine for 30 min. Columns represent the percent of 3H incorporation (mean ± SEM, n=3).
BIDAA primary B and T cells are more susceptible to DNA damage-induced
apoptosis
Based on the results presented above, the BIDAA cells should be more sensitive to
DNA damage-induced apoptosis. To test this we measured apoptosis of BIDAA
primary T cells in response to MMC, and confirmed that they are more susceptible to
MMC-induced apoptosis (Fig. 22A). Next we assessed the sensitivity of BIDAA
primary B cells to IR by monitoring the cleaved/activated form of caspase-3, and
found higher levels of this form in the BIDAA cells (Fig. 22B). Taken together, these
results indicate that the lack of BID phosphorylation weakens the intra-S phase
checkpoint leading to genomic instability and a decrease in cell survival
51
Figure 22. BIDAA primary B and T cells are more susceptible to DNA damage-induced apoptosis. (A) BIDAA primary T cells are more sensitive to MMC. BID+/+ and BIDAA primary activated T cells were treated with the indicated doses of MMC for 24 hrs and the percent of cells in sub-G1 (% Apoptosis) was monitored by flow cytometry. (B) BIDAA primary B cells are more sensitive to IR. Western blot analysis of cleaved caspase-3 in primary activated B cells at the indicated time points post 3 or 5 Gy IR. p17 marks the cleaved/active form of caspase-3. Bottom panel: Columns represent densitometry of the p17 bands in 3 different experiments.
52
ATM-mediated phosphorylation of Chk2 and SMC1 is reduced in the BIDAA cells
following DNA damage
The fact that BID is an ATM effector in the DDR and based on the results presented
above, we decided to search for alterations in cell cycle markers involved in the S
phase checkpoint, which are also localized in the ATM pathway that might give a clue
to BID's mechanism of action in the DDR.
Experimental evidence indicates that parallel branches of the ATM pathway
regulate the S phase checkpoint in mammalian cells. In response to DNA double-
strand breaks ATM activates both the Chk2 and NBS1/SMC1 pathways that
cooperate to inhibit replicative DNA synthesis [Fig. 23A; [70,71]]. Chk2 is activated
by ATM-mediated phosphorylation on T68, and upon activation it phosphorylates a
number of effectors which mediate S phase arrest and apoptosis [72]. In the parallel
cascade, the SMC1 protein is phosphorylated by ATM on S957 and S966 and this
phosphorylation is required for the checkpoint and for survival in response to IR
[71,73].
We initially assessed whether lack of BID phosphorylation affected the activation
of ATM by analyzing its phosphorylation on S1987 [74]. Primary activated B and T
cells were treated with 5 Gy IR and cells were harvested at several time points. Our
results showed that ATM was phosphorylated to the same extent in both the BID+/+
and BIDAA cells (Fig. 23B, and data not shown), suggesting that BID is acting
downstream of ATM. To analyze Chk2 phosphorylation, we treated BID+/+ and
BIDAA primary activated B and T cells with 5 Gy IR and harvested the cells at several
time points. Chk2 was phosphorylated (mobility shift) in both BID+/+ and BIDAA
cells; however there was significantly less accumulation of the
phosphorylated/mobility shifted form in the BIDAA cells (Fig. 23C, and data not
shown).
We have also assessed the activation of SMC1 by analyzing its phosphorylation on
S957. Figure 23D shows that SMC1 was significantly less phosphorylated in the
BIDAA cells. It is known that NBS1 phosphorylation by ATM is required for the
phosphorylation of SMC1, establishing a role for NBS1 as an adaptor in the
ATM/NBS1/SMC1 pathway [71]. Therefore we also examined the phosphorylation
status of NBS1 on Ser343 but due to a technical problem with the antibody we did not
obtain satisfying results (data not shown). Thus, BID acts downstream of ATM and
upstream of Chk2 and SMC1 to regulate the intra-S phase checkpoint.
53
Figure 23. ATM-mediated phosphorylation of Chk2 and SMC1 is reduced in the BIDAA cells following DNA damage. (A) Schematic model of the two parallel branches of the ATM-regulated S phase checkpoint in mammalian cells. (B) ATM activation/autophosphorylation on S1987 is similar in the BID+/+ and BIDAA cells. Western blot analysis of ATM phosphorylation in primary activated B cells at the indicated time points post 5 Gy IR. ATM-P marks the phosphorylated form of ATM. Bottom panel: Columns represent densitometry of the phosphorylated form indicated by ATM-P. (C) ATM-induced phosphorylation of Chk2 on T68 is reduced in the BIDAA cells. Western blot analysis of Chk2 mobility shift (hyperphosphorylation) in primary activated T cells at the indicated time points post 5 Gy IR. Chk2-P marks the phosphorylated/mobility shifted form of Chk2. Bottom panel: Columns represent densitometry of the phosphorylated/mobility shifted band indicated by Chk2-P. (D) ATM-induced phosphorylation of SMC1 on S957 is reduced in the BIDAA cells. Western blot analysis of SMC1 phosphorylation in primary activated B cells at the indicated time points post 5 Gy IR. SMC1-P marks the phosphorylated form of SMC1. Bottom panel: Columns represent densitometry of the phosphorylated form indicated by SMC1-P.
54
BIDAA knock-in mice are hypersensitive to whole-body irradiation
Next we determined the relevance of our findings to the whole animal setting. A
hallmark defect in the ATM pathway is increased radiation sensitivity. ATM-/-,
H2AX-/- and 53BP1-/- mice show a marked hypersensitivity to whole-body irradiation
[75-77]. To assess the radiation sensitivity of the BIDAA mice, BID+/+ and BIDAA mice
were exposed to a lethal dose of γ-irradiation (8 Gy) and their survival was monitored.
While all the BIDAA mice died within 11 days, only 14% of the BID+/+ mice died at
this time point, and the rest died between 11 and 15 days (Fig. 24A). Larger
differences between the BID+/+ and the BIDAA mice were observed when mice were
exposed to 7 Gy of γ-irradiation (Fig. 24B).
To assess whether the hypersensitivity observed in the BIDAA mice is accompanied
by increased apoptosis, we preformed immunohistochemistry staining of spleen
sections with the anti-cleaved caspase-3 antibody. We focused on the spleen because
in this tissue BID is highly expressed and phosphorylated and because most of our
results obtained with cells from the spleen. Mice were irradiated with 10Gy and 3 hrs
post irradiation the mice were sacrificed and the spleens were harvested. Next, we
counted the number of the caspase-3 positive cells in the white pulp (the area in the
spleen in which B and T cells are located) using the ImagePro software. As we
expected, the BIDAA spleens showed a 2-to-4 fold higher average number of apoptotic
cells in the white pulp (Fig. 24C). These results indicate that ATM-mediated BID
phosphorylation plays an important pro-survival role in the spleen in vivo.
55
56
Figure 24. BIDAA knock-in mice are hypersensitive to whole-body irradiation (A) Survival curves of BID+/+ mice (n=7) and BIDAA mice (n=6) after whole body irradiation with 8 Gy. The results are statistically significant, p=0.003 (B) Survival curves of BID+/+ mice (n=19) and BIDAA mice (n=15) after whole body irradiation with 7 Gy. The results are statistically significant, p=8.82*10-8. (C) White pulp in the spleen of BIDAA mice shows higher average number of apoptotic cells than BID+/+ mice. Top panel: representative pictures of IHC staining with caspase-3 antibody. The mice were irradiated with 10Gy and 3 hrs post irradiation the spleen was harvested, fixed with paraformaldehyde and stained with anti-cleaved caspase-3 antibody followed by light staining with hematoxylin. Bottom panel: Columns represent the average number of apoptotic cells in a white pulp. 1 animal from each genotype was left un-irradiated and 3 were irradiated and the number of the apoptotic cells was counted using the ImagePro software.
57
Discussion BID belongs to a subset of the pro-apoptotic proteins, the BH3-only proteins, which
are sentinels of intracellular damage. These proteins are held in check by diverse
mechanisms and seemingly at cellular locations in which they can sense or
communicate specific damage. In this work we studied the role of BID as a sentinel of
DNA damage and examined some of the mechanisms that regulate its activity in the
DDR; we demonstrated that BID is a nuclear protein that is exported from the nucleus
in response to DNA damage and that this export is important for its ability to induce
cell-cycle arrest. We also presented evidence that BID can be phosphorylated at the
mitochondria in the presence or the absence of DNA damage. Finally, in the 3rd part
of the work we explored the role of BID phosphorylation in vivo. Using cells from
the BIDAA mice we found that primary T and B cells demonstrate a defect in the intra
S-phase DNA damage checkpoint, increased chromosomal damage, and increased
apoptosis in response to DNA damage. According to that BIDAA mice were also
hypersensitive to whole-body irradiation and demonstrated rapid death.
The functional connection between BID and the nucleus
Up until now, BID has been considered a cytosolic protein. Since signaling proteins
involved in cell cycle checkpoints often function in the nucleus as well as proteins
that are phosphorylated by ATM, we examined the subcellular location of BID, and
found that it is partially localized to the nucleus. IF studies using anti-BID antibodies
and subcellular fractionations of MEFs after treatment with cross-linker showed that a
fraction of BID is localized to the nucleus (Fig 4). Since cellular disruption avoided
the detection of BID in the nucleus, we suggested that BID is loosely associated with
the nuclear fraction by interaction with another protein(s) or with DNA, and that
cross-linking is required to preserve this interaction.
Where in the cell is BID executing its function? Many of the ATM substrates are
phosphorylated at the damaged sites, and some of them are rapidly distributed to the
undamaged parts of the nucleus (and perhaps to other cellular locations) to reach their
physiological targets [78]. Here, we demonstrate that DNA damage results in the
nuclear export of BID (Fig. 5), and that trapping BID in the nucleus inhibits its
functions in the DNA-damage response (Figs. 7 and 8). Taken together, these results
58
suggest that BID is required to exit the nucleus to execute its functions in this
pathway. Thus, we suspect that BID is phosphorylated at the damaged sites and
rapidly distributed to another cellular location (outside of the nucleus) to execute its
functions. One attractive location is the mitochondria, as several BH3-only proteins
are known to communicate specific damage by translocating from the site of damage
to the mitochondria. Notably, a collaborating group has previously published that
DNA damage induces the translocation of cytoplasmic BID to the nucleus [54]. A
possible explanation for this discrepancy is that BID is moving both into and out of
the nucleus, and that in our setting, we are detecting its net exit. If DNA damage
indeed results in the translocation of cytoplasmic BID to the nucleus (translocation of
the nonphosphorylated form), it remains to be determined the functional importance
of this translocation.
Do our findings using BID–GFP apply to endogenous BID? In Fig.4 we demonstrated
that a portion of endogenous BID is localized to the nucleus. However, we did not
detect a change in the cellular location of endogenous BID following Etop treatment,
as we did using BID–GFP in this study. A possible explanation for these differences
is that it is more difficult to detect changes in the cellular location of proteins using
IF, as compared to using GFP fusion proteins. In the case of BID, it is even more
difficult as we detected only an ~20% increase in cytosolic BID–GFP following DNA
damage (Fig. 5). We also demonstrated that LMB prevents the nuclear exit of BID,
suggesting that this exit occurs via the nuclear export receptor CRM1. On the other
hand, mutating or deleting of the NES consensus motif found in BID had no effect on
its nuclear export, suggesting that this motif does not function as a NES. As the export
of nuclear proteins by CRM1 is mediated via NESs [66], it is likely that the nuclear
export of BID is mediated by another NES-carrying protein. Recently, such a
mechanism has been demonstrated by showing that nucleophosmin (NPM), which
utilizes a conserved CRM1-dependent NES to enable its nucleocytoplasmic shuttling,
provides a necessary chaperoning activity for the nuclear export of ribosomal protein
L5 (rpL5) [79]. Finally, it is tempting to speculate that ATM-mediated
phosphorylation of BID regulates its nuclear export. However, this does not seem to
be the case, as DNA damage resulted in the nuclear exit of the nonphosphorylatable
BID mutant (BIDAA-GFP; data not shown).
59
How does BID induce S-phase arrest? One possible mechanism for inducing cell
cycle arrest would be that phosphorylated BID directly interacts with a cell cycle
regulatory protein located in the nucleus to directly halt cell cycle progression at the
S-phase checkpoint. However, based on our current results, it is equally possible that
BID affects cell cycle progression indirectly by interacting with a ‘non-cell cycle’
protein that could be located outside of the nucleus. BID is also involved in promoting
cell death following DNA damage [53,54] and it is well established that BID initiates
death at the mitochondria. Thus, it is not surprising that trapping BID in the nucleus
inhibits its ability to sensitize cells to DNA damage-induced death (Fig. 7).
Finally, are caspases involved in the nucleocytoplasmic shuttling of BID? We
monitored the cellular location of BID–GFP in HeLa cells in the presence of the broad
caspase inhibitor zVAD-fmk, and found that inhibition of caspases had no affect on
the nuclear export of BID following DNA damage (data not shown). Moreover, we
performed similar studies with the caspase-8 noncleavable mutant of BID (BID-
D59A-GFP), and found that DNA damage resulted in the nuclear exit of this mutant
(Fig. 9). We also used zVAD-fmk to test whether the S-phase arrest might be an
indirect consequence of cell death rather than a direct effect of BID nuclear exit. We
found that inhibition of caspases did not affect the ability of the wtBID cells to arrest
in the S phase and did not change the differences in the cell cycle distribution between
the wtBID and the NLS–BID cells (Fig. 9). Thus, caspases do not seem to be involved
in the nuclear exit of BID or in the ability of BID to induce S-phase arrest.
In the results presented above we examined the role of BID in the DDR by trapping it
in the nucleus using NLS. We also performed an opposite experiment in which BID
was excluded from the nucleus by creating a BID-estrogen receptor chimera (BID-
ER) . In this model, proteins that are artificially fused to a portion of the estrogen
receptor are held in the cytosol until the addition of 4-hydroxy-tamoxifen (4-HOT),
which results in a conformational change and translocation to the nucleus. Using this
model we demonstrated that BID-ER is phosphorylated in response to Etop only in
the presence of 4-OHT, indicating that BID phopshorylaion occur in the nucleus (Fig.
10). Unfortunately we could not use this system to perform functional assays probably
due to the low expression of the chimeric protein.
60
In summary, this study raises the novel possibility that BID, a molecule that was
previously considered to be active only at the mitochondria, may also be active in the
nucleus and that its activity in the DNA-damage pathway requires nuclear export. If
BID is indeed acting in such a manner, then it is an excellent candidate to
communicate DNA damage/repair processes to other cellular compartments.
BID phosphorylation at the mitochondria
Based on the results presented above we concluded that BID phosphorylation in
response to DNA damage occurs in the nucleus. Therefore we were surprised that a
construct of BID which is targeted to the mitochondria, BID-TM, was also
phosphorylated in response to DNA damage (Fig. 11). Similar results were obtained
with a series of truncated BID proteins (deletion of 25 or 45 amino acids from the N-
terminus of BID) that are targeted to mitochondria upon expression in cells (data not
shown). It is important to note that this phosphorylation event occur even in the
absence of DNA damage. Using our phospho-specific antibody we were able to prove
that the phosphorylated BID-TM is localized at the mitochondria (Fig. 12). This may
indicate that BID phosphorylation in response to DNA damage occurs in the nucleus,
but additional phosphorylation events that do not involve DNA damage occur in the
mitochondria.
We detected the phosphorylation of BID-TM and of the truncated BID proteins using
our phospho-specific antibodies that recognize phopshorylation in the ATM
consensus sites; this may indicate that the phosphorylation is ATM-dependent. As
demonstrated in Fig. 13 the phosphorylation we detected was indeed mediated by
ATM. Since we observed that BID-TM phosphorylation is partially mediated by
ATM but occurs also in the absence of DNA damage, we suspected that BID-TM
expression results in ATM activation. If this was the case then other ATM substrates
should have been phosphorylated as well. To our surprise, when we tested the
phosphorylation of Chk2 and p53, nuclear substrates of ATM, they did not show
higher levels of phosphorylation in cells expressing BID-TM as compared to cells
expressing wtBID (Fig. 14). These results suggest that over-expression of BID-TM
might activate ATM outside the nucleus. It would be interesting to check whether
targeting of Chk2 or p53 to mitochondria (in the presence or absence of BID-TM)
would also result in their phosphorylation in the absence of DNA damage.
61
BID-TM which is targeted to the mitochondria by the fusion of the TM domain of
BCL-2 is a potent inducer of apoptosis. We found that mutating its phosphorylation
sites had no effect on its apoptotic activity (Fig. 15). We also found that mutating its
BH3 domain had no effect on its phosphorylation (Fig. 16). Thus, phosphorylation of
BID-TM does not seem to regulate its apoptotic activity, and its apoptotic activity
does not seem to regulate its phosphorylation.
BID-TM is an artificial molecule and therefore might not necessarily represent a
physiological situation. To test whether BID can indeed be phosphorylated at the
mitochondria, we determined whether over-expression of tBID also results in its
phosphorylation in an ATM-dependent manner in the absence of DNA damage.
Similar to the results we obtained with BID-TM, over-expression of tBID resulted in
its phosphorylation in the absence of DNA damage, and this phosphorylation was
ATM-dependent (Fig. 17). Our results may indicate that the mitochondria fraction
contains a kinase that phosphorylates BID. To test this, we performed in-vitro kinase
assays using purified mitochondria and recombinant tBID. Targeting recombinant
tBID to mitochondria resulted in its phosphorylation on S78, and interestingly, ATM
seems to be required for this phosphorylation in-vitro since when we targeted tBID to
mitochondria that were purified from ATM-/- MEFs there was a significance reduction
in tBID phosphorylation relative to the control (Fig. 18). Our results suggest that
ATM might also localize to mitochondria and directly phosphorylate BID. In the past,
several articles claimed that a portion of ATM is localized outside the nucleus,
especially in neuronal cells [80-82], but these claims are not well-established. We also
looked for ATM outside the nucleus using IF and subcellular fractionations but did
not obtain satisfying results (data not shown).
In this part we raised the possibility that ATM phosphorylates BID at the
mitochondria. We have used several approaches to assess whether ATM is localized
to the mitochondria but with no success. The other possibility is that a kinase, acting
downstream of ATM is involved in phosphorylating BID at the mitochondria. One of
our collaborators in Germany has recently found that TRAIL induces the
phosphorylation of tBID on S78, which seems to be ATM-independent. Future studies
(that will probably not involve me) will determine whether tBID-S78-P generated in
62
response to TRAIL, is localized to the mitochondria and whether phosphorylation
affects the pro-apoptotic function of tBID in this pathway. These studies will also
include an attempt to identify the kinase involved in this phosphorylation.
The role of ATM-mediated BID phosphorylation in vivo
Most of the BID phosphorylation studies in our lab in the past involved the use of
immortalized cells, and thus it remained to be established the relevance of these
findings to the in vivo setting. In addition, Our results implicating BID as a nuclear
protein involved in cell cycle regulation in the DDR have been previously challenged
[57] and thus it is important to settle this dispute.
To begin to assess the involvement of BID in the DDR in vivo, whole body
irradiation studies in mice were performed. In these studies it was found that BID is
phosphorylated in vivo in response to γ-irradiation, and that this phosphorylation
occurred mainly in lymphoid populations (populations in which BID is mainly
expressed). It was also found that BID phosphorylation in vivo occurs relatively early,
it is transient, and it increases in an IR dose-dependent manner. These features
suggested that BID plays a role in the early stages of the DDR in vivo. To explore the
role of phosphorylated BID in the DDR in vivo, BIDAA mice were generated in our
lab, in which the wild type BID gene was replaced with the non-phosphorylatable
BIDS61A/S78A mutant. We initially confirmed that endogenous BID in the BIDAA mice
is no longer capable of being phosphorylated on serines 61 and 78 (Fig. 19).
Next, we assessed the cytological consequences of DNA damage in the absence of
BID phosphorylation. Our analysis focused on hematopoietic cells since we found
that BID mainly expressed and phosphorylated in these cells. We initially analyzed
chromosome stability by examining metaphase spreads prepared from primary
activated T and B cells treated with DNA damaging reagents, and found that the
BIDAA cells demonstrated increased genome instability (Fig. 20). Similar results were
obtained with BID-/- primary activated T cells, as previously reported [54]. The
abnormal chromosome structures detected in BID-/- cells [54], and that we detected in
the BIDAA cells represent “chromatid type” errors resulting from improperly repaired
DNA damage accrued during S phase of the cell cycle. Based on these findings and
63
on our previous studies showing that BID is important for S phase arrest [53,54], it
was likely that BIDAA primary B and T cells have a defect in the intra-S phase
checkpoint. Indeed, double-labeling experiments with BrdU and PI together with the
RDS assay, the accepted assay for interrogating the intra-S phase checkpoint in
studies of DNA damage, showed a defect in the BIDAA primary B and T cells treated
with either MMC or IR (Fig. 21). Thus, phospohorylated BID plays an important role
in the DDR in lymphoid populations to induce S phase arrest and preserve genomic
stability. In agreement with these results we also observed increased sensitivity of the
BIDAA cells to DNA damage (Fig. 22). Taken together, our results demonstrate that
the lack of cell cycle arrest and accumulation of unrepaired DNA damage eventually
leads to death.
Where is BID positioned in the ATM pathway? Experimental evidence indicates that
parallel branches of the ATM pathway regulate the S phase checkpoint, the Chk2 and
NBS1/SMC1 pathways [70,71]. We examined the two parallel branches and found
that there is a defect in the activation of both cascades as demonstrated by reduced
phosphorylation of Chk2 and SMC1 in response to DNA damage (Fig. 23). On the
other hand, the lack of BID phosphorylation did not affect the phosphorylation of
ATM, arguing that BID acts downstream of ATM and upstream of Chk2 and SMC1.
These results may provide a molecular explanation for the defects we observed in the
BIDAA mice and cells. Chk2 is directly phosphorylated/activated by ATM, and upon
its activation it relays the checkpoint activation signal to a number of effector which
mediates many of the phenotypic characteristics provoked by DNA damage including
cell cycle arrest and apoptosis [72]. Similar to Chk2, SMC1 is also a target of ATM,
and in response to DNA damage it is phosphorylated on S957 and S966. Cells
carrying a non-phosphorylatable SMC1 exhibit a defective S-phase checkpoint,
decreased survival, and increased chromosomal aberrations post DNA damage [73].
The decreased phosphorylation of Chk2 and SMC1 in the BIDAA cells in response to
DNA damage indicates that these proteins are less active, and thus may explain the
defects in the intra-S phase checkpoint as well as the increased apoptosis and the
increased chromosomal aberrations observed in the BIDAA cells.
Finally we assessed the radiation sensitivity of the BIDAA mice since a hallmark
defect in the ATM pathway is increased radiation sensitivity [75-77]. Indeed we
64
found that the BIDAA mice were hypersensitive to whole-body irradiation and died 3-
to-4 days earlier than the BID+/+ mice in response to a lethal and a sub-lethal dose of
γ-irradiation (Fig. 24). ATM-/- mice display a rapid death in response to irradiation
due to acute radiation toxicity to the gastrointestinal tract. These mice display
characteristic toxicity indicated by severe epithelial crypt degeneration and loss of
villi [75]. Based on that we histologically examined intestinal tissues of BIDAA mice
but did not observe similar defect (data not shown). However, the hypersensitivity
observed in the BIDAA mice was accompanied by increased apoptosis, as
demonstrated by the immunohistochemistry staining of spleen sections with the anti-
cleaved caspase-3 antibody (fig. 24). Interestingly, Maria Maryanovich, a Ph.D
student in our lab, found that hematopoietic progenitors prepared from the bone
marrow of BIDAA mice formed less colonies under stressed conditions such as
limiting cytokines or recovery from whole-body irradiation. Moreover, competitive
bone marrow repopulation assays demonstrated that the BIDAA bone marrow
progenitors were significantly less competitive than the BID+/+ progenitors and
exhibited poor repopulation of both myeloid and lymphoid lineages in vivo,
suggesting a defect in hematopoiesis.
Recently, it was reported that Apaf-1 and Aven, two apoptosis regulators acting at the
mitochondria, also possess non-apoptotic functions in the DDR related to cell cycle
regulation. Apaf-1 was demonstrated to regulate S phase arrest in response to DNA
damage by acting downstream of ATM/ATR and upstream of Chk1 [83]. It was
reported that this new role can be separated from its apoptotic activity since Apaf-1
lacking the proapoptotic CARD domain (unable to activate caspase-9) induces S
phase arrest and Chk1 phosphorylation. BID's cell cycle role in the DDR can also be
separated from its pro-apoptotic activity since BID lacking its BH3 death domain is
capable of inducing S phase arrest [54]. Aven, on the other hand, which was
previously demonstrated to act as an anti-apoptotic protein at the mitochondria, was
now found to function as an ATM activator to inhibit G2/M progression [84]. Aven
was found to bind ATM and overexpression of Aven in cycling Xenopus egg extracts
prevented mitotic entry and induced phosphorylation of ATM and its substrates.
There are also similarities regarding protein localization: Aven and BID were found
to localize to the nucleus in healthy cells, whereas Apaf-1 was found to translocate to
65
the nucleus upon DNA damage. Thus BID, along with Apaf-1 and Aven demonstrate
the ability of proteins to act as double agents – in regulating apoptosis on one hand,
and cell cycle progression on the other hand. It is yet to be determined how these
proteins function in this “life versus death” decision.
66
References 1. Jacobson MD, Weil M, Raff MC. Programmed cell death in animal
development. Cell 1997;88(3):347-354. 2. Hanahan D, and Weinberg, R.A. The hallmarks of cancer. cell 2000;
100:57-70 3. Yuan J, and Yankner, B.A. Apoptosis in the nervous system. Nature
2000;407:802-809. 4. Lockshin RAaZ, Z. Programmed cell death: early changes in metamorphosing
cells. Biochem Cell Biol 1994;72:589-596. 5. Gross A, McDonnell JM, Korsmeyer SJ. BCL-2 family members and the
mitochondria in apoptosis. Genes Dev 1999;13(15):1899-1911. 6. Thornberry NA, Lazebnik Y. Caspases: enemies within. Science
1998;281(5381):1312-1316. 7. Ashkenazi A, Dixit VM. Death receptors: signaling and modulation. Science
1998;281(5381):1305-1308. 8. Chen G, Goeddel, D. V. TNF-R1 signaling: a beautiful pathway. Science
2002;296:1634-1635. 9. Wajant H. The Fas signaling pathway: more than a paradigm. Science
2002;296:1635-1636. 10. Medema JP, Scaffidi C, Kischkel FC et al. FLICE is activated by association
with the CD95 death-inducing signaling complex (DISC). Embo J 1997;16(10):2794-2804.
11. Wang X. The expanding role of mitochondria in apoptosis. Genes Dev 2001;15(22):2922-2933.
12. Bakhshi A, Jensen, J.P., Goldman, P., Wright, J.J., McBride, O.W., Epstein, A.L.,, and Korsmeyer SJ. Cloning the chromosomal breakpoint of t(14;18) human lymphomas: clustering around JH on chromosome 14 and near a transcriptional unit on 18. cell 1985;41:899-906.
13. Youle RJ, Strasser A. The BCL-2 protein family: opposing activities that mediate cell death. Nat Rev Mol Cell Biol 2008;9(1):47-59.
14. Adams JM, Cory S. The Bcl-2 protein family: arbiters of cell survival. Science 1998;281(5381):1322-1326.
15. Kelekar A, Thompson CB. Bcl-2-family proteins: the role of the BH3 domain in apoptosis. Trends Cell Biol 1998;8(8):324-330.
16. Reed JC. Bcl-2 family proteins. Oncogene 1998;17(25):3225-3236. 17. Yin XM, Oltvi, Z.N, and Korsmeyer, S.J. BH1 and BH2 domains of Bcl-2 are
required for inhibition of apoptosis and heterodimerization with BAX. Nature 1994;369:321-323.
18. Oltvai ZN, Milliman CL, Korsmeyer SJ. Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell 1993;74(4):609-619.
19. Knudson CM, Korsmeyer SJ. Bcl-2 and Bax function independently to regulate cell death. Nat Genet 1997;16(4):358-363.
20. Luo X, Budihardjo I, Zou H, Slaughter C, Wang X. Bid, a Bcl2 interacting protein, mediates cytochrome c release from mitochondria in response to activation of cell surface death receptors. Cell 1998;94(4):481-490.
21. Gross A, Jockel J, Wei MC, Korsmeyer SJ. Enforced dimerization of BAX results in its translocation, mitochondrial dysfunction and apoptosis. Embo J 1998;17(14):3878-3885.
67
22. Muchmore SW, Sattler M, Liang H et al. X-ray and NMR structure of human Bcl-xL, an inhibitor of programmed cell death. Nature 1996;381(6580):335-341.
23. Schendel SL, Montal M, Reed JC. Bcl-2 family proteins as ion-channels. Cell Death Differ 1998;5(5):372-380.
24. Saito M, Korsmeyer SJ, Schlesinger PH. BAX-dependent transport of cytochrome c reconstituted in pure liposomes. Nat Cell Biol 2000;2(8):553-555.
25. Kuwana T, Mackey MR, Perkins G et al. Bid, bax, and lipids cooperate to form supramolecular openings in the outer mitochondrial membrane. Cell 2002;111(3):331-342.
26. Willis SN FJ, Kaufmann T, van Delft MF, Chen L, Czabotar PE, Ierino H, Lee EF, Fairlie WD, Bouillet P, Strasser A, Kluck RM, Adams JM, Huang DC. Apoptosis initiated when BH3 ligands engage multiple Bcl-2 homologs, not Bax or Bak. Science 2007;315:856-859.
27. RJ. Y. Cell biology. Cellular demolition and the rules of engagement. Science 2007;315:776-777.
28. Hoetelmans R, van Slooten HJ, Keijzer R, Erkeland S, van de Velde CJ, Dierendonck JH. Bcl-2 and Bax proteins are present in interphase nuclei of mammalian cells. Cell Death Differ 2000;7(4):384-392.
29. Bartholomeusz G, Wu Y, Ali Seyed M et al. Nuclear translocation of the pro-apoptotic Bcl-2 family member Bok induces apoptosis. Mol Carcinog 2006;45(2):73-83.
30. Jamil S, Sobouti R, Hojabrpour P, Raj M, Kast J, Duronio V. A proteolytic fragment of Mcl-1 exhibits nuclear localization and regulates cell growth by interaction with Cdk1. Biochem J 2005;387(Pt 3):659-667.
31. Wang K, Yin XM, Chao DT, Milliman CL, Korsmeyer SJ. BID: a novel BH3 domain-only death agonist. Genes Dev 1996;10(22):2859-2869.
32. Li H, Zhu H, Xu CJ, Yuan J. Cleavage of BID by caspase 8 mediates the mitochondrial damage in the Fas pathway of apoptosis. Cell 1998;94(4):491-501.
33. Gross A, Yin XM, Wang K et al. Caspase cleaved BID targets mitochondria and is required for cytochrome c release, while BCL-XL prevents this release but not tumor necrosis factor-R1/Fas death. J Biol Chem 1999;274(2):1156-1163.
34. Desagher S, Osen-Sand A, Nichols A et al. Bid-induced conformational change of Bax is responsible for mitochondrial cytochrome c release during apoptosis. J Cell Biol 1999;144(5):891-901.
35. Wei MC, Lindsten T, Mootha VK et al. tBID, a membrane-targeted death ligand, oligomerizes BAK to release cytochrome c. Genes Dev 2000;14(16):2060-2071.
36. Desagher S, Osen-Sand A, Montessuit S et al. Phosphorylation of bid by casein kinases I and II regulates its cleavage by caspase 8. Mol Cell 2001;8(3):601-611.
37. Yin XM, Wang K, Gross A et al. Bid-deficient mice are resistant to Fas-induced hepatocellular apoptosis. Nature 1999;400(6747):886-891.
38. Sax JK, Fei P, Murphy ME, Bernhard E, Korsmeyer SJ, El-Deiry WS. BID regulation by p53 contributes to chemosensitivity. Nat Cell Biol 2002;4(11):842-849.
68
39. Zinkel SS, Ong CC, Ferguson DO et al. Proapoptotic BID is required for myeloid homeostasis and tumor suppression. Genes Dev 2003;17(2):229-239.
40. Breitschopf K, Zeiher AM, Dimmeler S. Ubiquitin-mediated degradation of the proapoptotic active form of bid. A functional consequence on apoptosis induction. J Biol Chem 2000;275(28):21648-21652.
41. Kaina B. DNA damage-triggered apoptosis: critical role of DNA repair, double-strand breaks, cell proliferation and signaling. Biochem Pharmacol 2003;66(8):1547-1554.
42. Iliakis G, Wang Y, Guan J, Wang H. DNA damage checkpoint control in cells exposed to ionizing radiation. Oncogene 2003;22(37):5834-5847.
43. Shiloh Y. ATM and related protein kinases: safeguarding genome integrity. Nat Rev Cancer 2003;3(3):155-168.
44. Wiese C, Pierce AJ, Gauny SS, Jasin M, Kronenberg A. Gene conversion is strongly induced in human cells by double-strand breaks and is modulated by the expression of BCL-x(L). Cancer Res 2002;62(5):1279-1283.
45. Dumay A, Laulier, C., Bertrand, P., Saintigny, Y., Lebrun, F., Vayssiere, J.L., and Lopez, B.S. Bax and Bid, two proapototic Bcl-2 family members, inhibit homologous recombination, independently of apoptosis regulatio. Oncogene 2006;25:3196-3205.
46. Sawada M, Sun W, Hayes P, Leskov K, Boothman DA, Matsuyama S. Ku70 suppresses the apoptotic translocation of Bax to mitochondria. Nat Cell Biol 2003;5(4):320-329.
47. Krajewski S, Tanaka S, Takayama S, Schibler MJ, Fenton W, Reed JC. Investigation of the subcellular distribution of the bcl-2 oncoprotein: residence in the nuclear envelope, endoplasmic reticulum, and outer mitochondrial membranes. Cancer Res 1993;53(19):4701-4714.
48. Wang O, Gao, F., May, W.S., Zhang, Y., Flagg, T., and Deng, X. Bcl2 negatively regulates DNA double-strand-break repair through a nonhomologous end-joining pathway. Mol Cell 2008;29:488-498.
49. Schmitt E, Beauchemin M, Bertrand R. Nuclear colocalization and interaction between bcl-xL and cdk1(cdc2) during G2/M cell-cycle checkpoint. Oncogene 2007;26(40):5851-5865.
50. Tafani M, Karpinich NO, Hurster KA et al. Cytochrome c Release upon Fas Receptor Activation Depends on Translocation of Full-length Bid and the Induction of the Mitochondrial Permeability Transition. J Biol Chem 2002;277(12):10073-10082.
51. Sarig R, Zaltsman Y, Marcellus RC, Flavell R, Mak TW, Gross A. BID-D59A is a potent inducer of apoptosis in primary embryonic fibroblasts. J Biol Chem 2003;278(12):10707-10715.
52. Valentijn AJ, Gilmore AP. Translocation of full-length Bid to mitochondria during anoikis. J Biol Chem 2004;279(31):32848-32857.
53. Kamer I, Sarig R, Zaltsman Y et al. Proapoptotic BID is an ATM effector in the DNA-damage response. Cell 2005;122(4):593-603.
54. Zinkel SS, Hurov KE, Ong C, Abtahi FM, Gross A, Korsmeyer SJ. A Role for Proapoptotic BID in the DNA-Damage Response. Cell 2005;122(4):579-591.
55. Kastan MB. Cell biology: A BID for the pathway. Nature 2005;437(7062):1103.
56. Gross A. BID as a double agent in cell life and death. Cell Cycle 2006;5(6):582-584.
69
57. Kaufmann T, Tai L, Ekert PG et al. The BH3-only protein bid is dispensable for DNA damage- and replicative stress-induced apoptosis or cell-cycle arrest. Cell 2007;129(2):423-433.
58. Zinkel SS, Hurov KE, Gross A. Bid plays a role in the DNA damage response. Cell 2007;130(1):9-10; author reply 10-11.
59. Scully R, Puget N, Vlasakova K. DNA polymerase stalling, sister chromatid recombination and the BRCA genes. Oncogene 2000;19(53):6176-6183.
60. D'Andrea AD. The Fanconi road to cancer. Genes Dev 2003;17(16):1933-1936.
61. Langland G, Elliott J, Li Y, Creaney J, Dixon K, Groden J. The BLM helicase is necessary for normal DNA double-strand break repair. Cancer Res 2002;62(10):2766-2770.
62. Littlewood TD, Hancock DC, Danielian PS, Parker MG, Evan GI. A modified oestrogen receptor ligand-binding domain as an improved switch for the regulation of heterologous proteins. Nucleic Acids Res 1995;23(10):1686-1690.
63. Tripathi AK, Chaturvedi R, Ahmad R et al. Flow cytometric analysis of aneuploidy and S-phase fraction in chronic myeloid leukemia patients: role in early detection of accelerated phase. Leuk Res 2003;27(10):899-902.
64. Eldar H, Ben-Chaim J, Livneh E. Deletions in the regulatory or kinase domains of protein kinase C-alpha cause association with the cell nucleus. Exp Cell Res 1992;202(2):259-266.
65. Oberkovitz G, Regev, L., and Gross, A. Nucleocytoplasmic shuttling of BID is involved in regulating its activities in the DNA-damage response. cell Death Differ 2007;14:1628-1634.
66. Henderson BR, Eleftheriou A. A comparison of the activity, sequence specificity, and CRM1-dependence of different nuclear export signals. Exp Cell Res 2000;256(1):213-224.
67. Nigg EA. Nucleocytoplasmic transport: signals, mechanisms and regulation. Nature 1997;386(6627):779-787.
68. Kalderon D, Richardson WD, Markham AF, Smith AE. Sequence requirements for nuclear location of simian virus 40 large-T antigen. Nature 1984;311(5981):33-38.
69. Elkon R, Rashi-Elkeles S, Lerenthal Y et al. Dissection of a DNA-damage-induced transcriptional network using a combination of microarrays, RNA interference and computational promoter analysis. Genome Biol 2005;6(5):R43.
70. Falck J, Petrini JH, Williams BR, Lukas J, Bartek J. The DNA damage-dependent intra-S phase checkpoint is regulated by parallel pathways. Nat Genet 2002;30(3):290-294.
71. Yazdi PT, Wang Y, Zhao S, Patel N, Lee EY, Qin J. SMC1 is a downstream effector in the ATM/NBS1 branch of the human S-phase checkpoint. Genes Dev 2002;16(5):571-582.
72. Ahn J, Urist M, Prives C. The Chk2 protein kinase. DNA Repair (Amst) 2004;3(8-9):1039-1047.
73. Kitagawa R, Bakkenist CJ, McKinnon PJ, Kastan MB. Phosphorylation of SMC1 is a critical downstream event in the ATM-NBS1-BRCA1 pathway. Genes Dev 2004;18(12):1423-1438.
70
74. Bakkenist CJ, Kastan MB. DNA damage activates ATM through intermolecular autophosphorylation and dimer dissociation. Nature 2003;421(6922):499-506.
75. Barlow C, Hirotsune S, Paylor R et al. Atm-deficient mice: a paradigm of ataxia telangiectasia. Cell 1996;86(1):159-171.
76. Celeste A, Petersen S, Romanienko PJ et al. Genomic instability in mice lacking histone H2AX. Science 2002;296(5569):922-927.
77. Ward IM, Minn K, van Deursen J, Chen J. p53 Binding protein 53BP1 is required for DNA damage responses and tumor suppression in mice. Mol Cell Biol 2003;23(7):2556-2563.
78. Lukas C, Falck J, Bartkova J, Bartek J, Lukas J. Distinct spatiotemporal dynamics of mammalian checkpoint regulators induced by DNA damage. Nat Cell Biol 2003;5(3):255-260.
79. Yu Y, Maggi LB, Jr., Brady SN et al. Nucleophosmin is essential for ribosomal protein L5 nuclear export. Mol Cell Biol 2006;26(10):3798-3809.
80. Wu Z-H, Shi, Y., Tibbetts, R. S., Miyamoto, S. . Molecular linkage between the kinase ATM and NF-kB signaling in response to genotoxic stimuli. Science 2006;311:1141-1146.
81. Li. J. HYR, Plummer. M. R., and Herrup K. Cytoplasmic ATM in Neurons Modulates Synaptic Function. Curr Biol 2009;19:2091-2096.
82. Watters D KP, Spring K, Bjorkman J, Chen P, Gatei M, Birrell G, Garrone B, Srinivasa P, Crane DI, Lavin MF. Localization of a portion of extranuclear ATM to peroxisomes. J Biol Chem 1999;274:34277-34282.
83. Zermati Y, Mouhamad S, Stergiou L et al. Nonapoptotic role for Apaf-1 in the DNA damage checkpoint. Mol Cell 2007;28(4):624-637.
84. Guo JY, Yamada A, Kajino T et al. Aven-dependent activation of ATM following DNA damage. Curr Biol 2008;18(13):933-942.
71
Publications Oberkovitz G, Regev L, Gross A. (2007) Nucleocytoplasmic shuttling of BID is
involved in regulating its activities in the DNA-damage response. Cell Death
Differ. 14: 1628-34.
Kamer I, Sarig R, Zaltsman Y, Niv H, Oberkovitz G, Regev L, Haimovich G,
Lerenthal Y, Marcellus RC, Gross A. (2005) Proapoptotic BID is an ATM effector
in the DNA-damage response. Cell. 122: 593-603.
72
תקציר פועל כזקיף שתפקידו לקשר בין אותות בתא הנוצרים בתגובה לנזק לבין מנגנון המוות BIDהחלבון
י " עובר זירחון עBIDא "עבודות קודמות בקבוצתנו הראו שבתגובה לנזק בדנ. המתוכנן של התאים
. התאים לגרום לעצירה במחזור התא ולמוות של BIDוזרחון זה מבקר את יכולתו של , ATMהקינאז
א יכול לגרום "נזק לדנ. הוא בחלקו חלבון גרעיניBIDבחלק הראשון של מחקר זה אנו מראים שהחלבון
. מונע יציאה זוCRM1 מהגרעין אל הציטוזול ושימוש במעכב ספציפי של הרצפטור BIDליציאה של
. צף זה אינו פעילאך נראה כי ר, )NES( נושא רצף המכוון ליציאה של חלבונים מהגרעין BIDהחלבון
צימדנו לו רצף המכוון חלבונים אל הגרעין , מהגרעיןBIDכדי לבחון את החשיבות של היציאה של
)NLS( ,חלבון זה עובר זירחון בדומה לחלבון המקורי אך אינו יכול . ובכך יצרנו חלבון התקוע בגרעין
מצביעות על האפשרות שמעבר תוצאות אלו . א"לגרום לעצירה במחזור התא ולמוות בתגובה לנזק בדנ
. א הכרחי לבקרת פעילותו בתגובה לנזק זה" בין הגרעין לציטוזול בתגובה לנזק בדנBIDשל החלבון
ATM הוא סובסטרט גרעיני של הקינאז BIDבחלק השני של המחקר אנו מראים שלמרות שהחלבון
אנו יצרנו חלבון שבאופן מלאכותי ממוקם . רות שהוא יעבור זירחון גם מחוץ לגרעיןישנה אפש
חלבון זה , באופן מפתיע. BID-TM, י כך שהצמדנו לו רצף שמכוון למיטוכונדריה"במיטוכונדריה ע
תוצאות אלו מצביעות . א" וזירחון זה מתרחש גם לא בתגובה לנזק בדנATMי "עובר זירחון המתווך ע
מנגנון השונה ממנגנון , מעורב בוBIDא שייתכן והחלבון "ון בקרה נוסף בתגובה לנזק בדנעל מנגנ
. מעורב בגרעיןBIDהתגובה בו
במערכת ATMי " עBIDבחלק השלישי והאחרון של המחקר חקרנו את חשיבות הזירחון של , לבסוף
בעזרת . כול לעבור זירחון שאינו יBIDלשם כך יצרנו עכברים שנושאים חלבון מוטנטי של . של חיה
ATMי " עBIDלזירחון של , תאים שנלקחו מעכברים אלה אנו מראים כי גם בהקשר של החיה השלמה
החיות , בנוסף. א"עצירת מחזור התא ומוות בתגובה לנזק בדנ, א"יש תפקיד בבקרה על מניעת שברים בדנ
א ולכן מתות מוקדם "רמת לנזק בדנ המוטנטי מראות רגישות יתר לקרינה הגוBIDשנושאות את החלבון
ומראות כי גם במערכת של חיה לחלבון BID לחלבון ATM תוצאות אלה מחזקות את הקשר בין. יותר
BIDא" יש תפקיד חשוב בתגובה לנזק בדנ .