DNA Technology: Revolution in Evolution

Why study (organic) evolution? Evolution: descent with modification

• To understand natural history of life on earth

• To understand disease processes and public health risks– Immunity– Host-specificity– Risk assessment

Observation Propose Hypothesis

Refine HypothesisRepeat Experiment

Determine if Data are Bias

Collect and Analyze Data

Design Experiment

Redesign Experiment

Repeatable

Not repeatable

Data are Bias

Propose Alternate Hypothesis

Accept as Theory

Original population

Population after selection

Spectrum of characteristics in population

Different selection processes

Effects of Natural Selection on Populations

Divergence in a Population

Darwin’s Disadvantages

• Didn’t have knowledge of principles of inheritance (but made very good predictions)

• Made analogy between natural selection and artificial selection (a good hypothesis) but didn’t have the skills to test it thoroughly

Advances in Evolutionary Science:Contributions to the Neo-Darwinian Synthesis

• Principles of inheritance

• Linkage and mutation

• ‘Genes’ are the basis for inheritance and are found within chromosomes

• Discovery that DNA is the molecular material of genes, cracking genetic code

• Molecular mechanisms worked out for DNA replication and protein synthesis

• Multiple methods invented to study genetic variation and evolution

Cross-sectional data

• Cross-sectional data (snap-shot in time) can be used scientifically to make deductions about a process

Evolutionary science is like criminal forensics

• The crime may not have any witnesses

• The evidence is often patchy and comes in many forms

• In the absence of eyewitness accounts, DNA is often the most convincing evidence

• The best evidence is based on DNA sequence variation

DNA

Genetic Variation Results from MutationMost mutations are either harmful, or neutral, but sometimes they are beneficial.

If the mutations are not too harmful, they will be passed on to their progeny (offspring). This is the hereditary basis of evolution.

These heritable changes in a lineage or populations of organisms over generations contribute to micro-evolution

the red fox ran out

the red fax ran out

thr edf oxr ano ut

Point mutation

Frame shift

Mutations Analogy

Variation by Mutation is Compounded by Genetic Recombination

• Sexual reproduction

• Bacterial transformation

• Bacterial conjugation

• Virus-mediated gene transfer

• Other transfer between symbionts

DNA technology

• Facilitates the study of heritable characteristics between individuals, within populations and higher taxa

• Population genetics studies- field studies of evolutionary processes

• Phylogenetics- infer evolutionary relationships (family trees) from genetic similarity

Longitudinal vs cross-sectional

Phylogenetic analysis examines relationship from cross-section

Population genetic studies can follow gene flow over time

• DNA microarrays

• PCR based methods

Molecular (DNA) Methods• Restriction Enzyme Digestion

– RFLP– PFGE– Ribotyping

Combination of methods

• DNA sequencing

RFLP

RFLP-restriction fragment length polymorphisms

DNAOrganism A Organism B

Restriction Endonuclease- enzyme that cleaves DNA at palandromic sequences. Example: EcoRI cuts at GAATTC

RE

Gel Electrophoresis

Gel Made of Translucent, Porous Matrix

DNA samples added to wells in matrix

DNA migrates at a rate inversely related to log10 of amplicon size

+

-EtBr binds to DNA as it travels through the gel

Visualizing DNA with UV light

Large pieces of DNA

Small pieces of DNA

L 1 2 3 4 5 6 7 8 9 10 11 12 13 14 L

_

+

Ribotyping

DNA EcoRIcells

Transfer to nylon membrane (Southern Blot)

1% Agarose Gel

Bind labeled 16S rDNA Probe

-

+Gel electrophoresis

Anti-probe Ab and enzyme-linked color reaction

PFGE

(Pulse Field Gel Electrophoresis)+ +

- -

Agarose gel

PCRpolymerase chain reaction

• Invented by Kary Mullis in 1983

• As soon as 1984 it was used for identification of unknown DNA

• Now widely used for many types of scientific research

Concept

• Amplify small quantities of DNA by in vitro DNA replication

Target DNA

PCR

Copies of Target DNA

Generalized PCR cyclerepeated ca. 40 times

94 degrees Celsius-denaturation

Ca.45-60 degrees-primer annealing

72 degrees Celsius-extension

Target sequence

Taq

1st Cycle

2nd Cycle

Single copy of dsDNA target

3rd Cycle

Amplicons increase exponentially with each cycle

Variations of PCR technique

• Repetitive element PCR• RAPD PCR

Primers bind where ever there is a complemetary DNA sequence

Can be used to generate qualitative or quantitative data

L 1 2 3 - Positive Charge

Negative Charge

L 1 2 3 -

DGGEdenaturing gradient gel electrophoresis

Gel made of substance that denatures DNA molecules

Denaturing agent exists in a gradient from top to bottom

PCR amplicons with different sequences will denature at different distance from the top

DNA sequencing

• DNA usually in the form of PCR amplicon

• One strand at a time

• Most thorough method of studying variation

• Relatively expensive and time consuming

Extension (polymerization)

3’TAGCTTGCCTCTGAATGAGAATATGGCACCATCGAAA…

5’ATCGAACGGAGACTTACTCTTA

Taq

C A

A

T

G

C

A

T

A

G

T

T

A

3’TAGCTTGCCTCTGAATGAGAATATGGCACCATCGAAA…

Taq

5’ATCGAACGGAGACTTA

dNTPs are randomly- incorporated into new strand until a ‘stop’ is added

Possible fragments

A

G

CT

T

A

G

TIf there is contradictory info, it will be read as ‘N’

Sequence Trace