DNA structure, function, replication lesson

of 17 /17
A dvanced Biology Plansforthe w eek ofJanuary 9 th through January 13 th , 2017 o M onday 1-9-17:D N A replication and function lesson + m odel o Tuesday 1-10-17:G ene Expression Lesson o W ednesday 1-11-17:D N A Extraction Pre-Lab o Thursday 1-12-17:D N A Extraction Lab o Friday 1-13-17:Science SkillsLesson -W orking w ith data in a table;D N A structure and function quiz

Embed Size (px)

Transcript of DNA structure, function, replication lesson

Page 1: DNA structure, function, replication lesson

Advanced Biology Plans for the week of January 9th through January 13th, 2017 o Monday 1-9-17: DNA replication and function lesson + model o Tuesday 1-10-17: Gene Expression Lesson o Wednesday 1-11-17: DNA Extraction Pre-Lab o Thursday 1-12-17: DNA Extraction Lab o Friday 1-13-17: Science Skills Lesson - Working with data in a table; DNA structure and function quiz

Page 2: DNA structure, function, replication lesson

DNA structure, replication & function

Page 3: DNA structure, function, replication lesson

What do you already know about the structure of DNA?

Page 4: DNA structure, function, replication lesson

DNA REPLICATION

Page 5: DNA structure, function, replication lesson

“It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetics material.

Page 6: DNA structure, function, replication lesson

Replication = copying

Page 7: DNA structure, function, replication lesson

When DNA is copied, the 2 strands break apart at the hydrogen bonds between the nitrogen bases

The exposed bases are a template for the new strand.

What are the base pairing rules?

Page 8: DNA structure, function, replication lesson

At the end of replication there are 2 new DNA molecules that are exactly the same

Page 9: DNA structure, function, replication lesson

Draw a diagram in your notebook

Page 10: DNA structure, function, replication lesson

DNA replication is called semi-conservative replication

Each new molecule is 1/2 original DNA and 1/2 new DNA

Page 11: DNA structure, function, replication lesson

Practice

DNA strand:ATGGCTTCTAAGGCTATCTACCGAAGATTCCGATAG

Write the complimentary strand

TACCGAAGATTCCGATAG

Page 12: DNA structure, function, replication lesson

DNA FUNCTION

Page 13: DNA structure, function, replication lesson

DNA/chromosomes contain regions called genes

Genes code for proteins Proteins carry out life processes and give an

organism it’s physical appearance

Page 14: DNA structure, function, replication lesson

Different versions of genes are called alleles

Page 15: DNA structure, function, replication lesson

Only about 1% of the DNA in a human are genes that code for proteins

What is the other 99% for?

Page 16: DNA structure, function, replication lesson

Some DNA regulates genes Turns them on or off as needed

Lots of DNA appears to have no purpose

Page 17: DNA structure, function, replication lesson

DNA replication model Work with a partner to:

Create a model of DNA during replication Clearly label the deoxyribose, phosphate, A, T, C

and G on your model Clearly show how some of the DNA is a coding

region called a gene and some of the DNA is non-coding