UNIT 4 DNA and Its Role in Heredity PART ONE: DNA Structure/Function
DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of...
-
Upload
joleen-moody -
Category
Documents
-
view
219 -
download
3
Transcript of DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of...
![Page 1: DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.](https://reader035.fdocuments.us/reader035/viewer/2022062801/56649e265503460f94b1565e/html5/thumbnails/1.jpg)
DNA & Genetics
Biology
![Page 2: DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.](https://reader035.fdocuments.us/reader035/viewer/2022062801/56649e265503460f94b1565e/html5/thumbnails/2.jpg)
Remember chromosomes?
• What are genes?• Made up of DNA and are units of
heredity; unique to everyone• What are traits?• Are physical and unseen characteristics.• Examples: • physical: color of skin or eyes• unseen: blood type or intelligence level
![Page 3: DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.](https://reader035.fdocuments.us/reader035/viewer/2022062801/56649e265503460f94b1565e/html5/thumbnails/3.jpg)
Remember chromosomes?• What are chromosomes?• Carrier of genetic
materials, thread-like fibers found in the nucleus
• They are composed of genes
• What is an allele?• Gene form for each
variation of a trait of an organism. Example: gene for height can express tall or short
![Page 4: DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.](https://reader035.fdocuments.us/reader035/viewer/2022062801/56649e265503460f94b1565e/html5/thumbnails/4.jpg)
DNA structure
• DNA = deoxyribonucleic acid• A nucleic acid, genetic material• Carries the code for all proteins that
make up the human body• Composed of paired nucleotides• Nucleotides contain a phosphate
group, 5-carbon sugar (deoxyribose), and a nitrogen base
![Page 5: DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.](https://reader035.fdocuments.us/reader035/viewer/2022062801/56649e265503460f94b1565e/html5/thumbnails/5.jpg)
DNA structure
• The 4 nitrogen bases of DNA:– Thymine (T)– Cytosine (C)– Adenine (A)– Guanine (G)
![Page 6: DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.](https://reader035.fdocuments.us/reader035/viewer/2022062801/56649e265503460f94b1565e/html5/thumbnails/6.jpg)
DNA structureNucleotide
structures:1 phosphate
group1 5-carbon
sugar1 nitrogen
base
![Page 7: DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.](https://reader035.fdocuments.us/reader035/viewer/2022062801/56649e265503460f94b1565e/html5/thumbnails/7.jpg)
DNA structure
• Structurally pyrimidines pair with purines
• Thymine (T) and Cytosine (C) are pyrimidines
• Adenine (A) and Guanine (G) are purines
• Nitrogen bases are held together by hydrogen bonds
• Guanine (G) pairs with Cytosine (C)• Adenine (A) pairs with Thymine (T)
![Page 8: DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.](https://reader035.fdocuments.us/reader035/viewer/2022062801/56649e265503460f94b1565e/html5/thumbnails/8.jpg)
DNA structure
• Composed of 2 complementary strands
• Complete the following DNA strand:
•TACGTACCGCAGGTAATC•ATGCATGGCGTCCATTAG
![Page 9: DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.](https://reader035.fdocuments.us/reader035/viewer/2022062801/56649e265503460f94b1565e/html5/thumbnails/9.jpg)
DNA
![Page 10: DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.](https://reader035.fdocuments.us/reader035/viewer/2022062801/56649e265503460f94b1565e/html5/thumbnails/10.jpg)
What does DNA look like?
• Double helix• 1st published in
1951• Credited to
Watson and Crick• 1st seen by
Rosalind Franklin, whose pictures were stolen from her lab
![Page 11: DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.](https://reader035.fdocuments.us/reader035/viewer/2022062801/56649e265503460f94b1565e/html5/thumbnails/11.jpg)
DNA Replication
• Process where DNA copies itself• DNA replicates before mitosis• DNA replicates before meiosis I• The 2 strands of a DNA molecule
separate when the hydrogen bonds break. Two complimentary strands form, each using one of the single DNA as a template
![Page 12: DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.](https://reader035.fdocuments.us/reader035/viewer/2022062801/56649e265503460f94b1565e/html5/thumbnails/12.jpg)
DNA Replication
http://video.google.com/videoplay?docid=5595842121339099106&q=DNA+replication&hl=en
http://video.yahoo.com/video/play?p=DNA+replication&toggle=1&cop=mss&ei=UTF-8&b=2&oid=b4115effae59a11e&rurl=www.bioteach.ubc.ca&vdone=http%3A%2F%2Fvideo.yahoo.com%2Fsearch%2Fvideo%3Fp%3DDNA%2Breplication%26toggle%3D1%26cop%3Dmss%26ei%3DUTF-8
![Page 13: DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.](https://reader035.fdocuments.us/reader035/viewer/2022062801/56649e265503460f94b1565e/html5/thumbnails/13.jpg)
Steps of DNA Replication
• Enzyme breaks hydrogen bonds between paired nucleotides
• DNA strand unzips• Free nucleotides move in and bond with
complementary pairs on unzipped strands of DNA
• Enzyme bonds the newly paired nucleotides together
• 2 exact copies of the original DNA strand are produced
![Page 14: DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.](https://reader035.fdocuments.us/reader035/viewer/2022062801/56649e265503460f94b1565e/html5/thumbnails/14.jpg)
Steps of DNA Replication
• Replicate the following DNA strand:
•TACGTACCGCAGGTAATCATGCATGGCGTCCATTAG
![Page 15: DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.](https://reader035.fdocuments.us/reader035/viewer/2022062801/56649e265503460f94b1565e/html5/thumbnails/15.jpg)
DNA Replication
![Page 16: DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.](https://reader035.fdocuments.us/reader035/viewer/2022062801/56649e265503460f94b1565e/html5/thumbnails/16.jpg)
RNA structure
• RNA is produced from a DNA strand• What is RNA?• Ribonucleic acid• Consists of 1 strand of nucleotides• RNA nucleotides have 1 phosphate
group, 1 5-carbon sugar (ribose), and 1 nitrogen base
![Page 17: DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.](https://reader035.fdocuments.us/reader035/viewer/2022062801/56649e265503460f94b1565e/html5/thumbnails/17.jpg)
RNA structure• The 4 nitrogen bases of RNA:
– Uracil (U)– Cytosine (C)– Adenine (A)– Guanine (G)
![Page 18: DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.](https://reader035.fdocuments.us/reader035/viewer/2022062801/56649e265503460f94b1565e/html5/thumbnails/18.jpg)
RNA structure
• Nitrogen bases are held together by hydrogen bonds
• Guanine (G) pairs with Cytosine (C)• Adenine (A) pairs with Uracil (U)
![Page 19: DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.](https://reader035.fdocuments.us/reader035/viewer/2022062801/56649e265503460f94b1565e/html5/thumbnails/19.jpg)
Compare DNA and RNA
DNA:• 2 strands• Deoxyribose sugar• Phosphate group• 4 nitrogen bases:
adeninethymineguaninecytosine
RNA:• 1 strand• Ribose sugar• Phosphate group• 4 nitrogen bases
adenineuracilguaninecytosine
![Page 20: DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.](https://reader035.fdocuments.us/reader035/viewer/2022062801/56649e265503460f94b1565e/html5/thumbnails/20.jpg)
Types of RNA
• Messenger RNA – mRNA: carries sequence of nucleotides that code for protein from nucleus to ribosomes
• Transfer RNA – tRNA: picks up individual amino acids in the cytoplasm & carries them to the ribosomes
• Ribosomal RNA – rRNA: found in ribosomes, helps bind mRNA and tRNA together during translation (protein synthesis)
![Page 21: DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.](https://reader035.fdocuments.us/reader035/viewer/2022062801/56649e265503460f94b1565e/html5/thumbnails/21.jpg)
Transcription: DNA into RNA
• Enzymes break hydrogen bonds in DNA strands
• Unzipped strand of DNA gets paired with free RNA nucleotides
• RNA nucleotides bond together• Enzymes break hydrogen bonds
between DNA and RNA strands.• RNA strand becomes mRNA and
leaves the nucleus
![Page 22: DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.](https://reader035.fdocuments.us/reader035/viewer/2022062801/56649e265503460f94b1565e/html5/thumbnails/22.jpg)
Transcription: DNA into RNA
![Page 23: DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.](https://reader035.fdocuments.us/reader035/viewer/2022062801/56649e265503460f94b1565e/html5/thumbnails/23.jpg)
mRNA• Composed of a codons• A codon is a series of “3” letters or bases
that make up the code of mRNA• Codons are the “recipe” for making all
amino acids in the body• Every strand of mRNA starts with the
codon AUG or the start codon – starts protein synthesis. There is only 1 start codon
• Every strand of mRNA ends with a terminator or “stop” codon – stops protein synthesis. There are 3 stop codons.
![Page 24: DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.](https://reader035.fdocuments.us/reader035/viewer/2022062801/56649e265503460f94b1565e/html5/thumbnails/24.jpg)
Translation of mRNA
• Translate the following mRNA into amino acids using the Universal codon chart
• AUGAGGGCUCGAUGA• MET-ARG-GLY-ARG-STOP
![Page 25: DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.](https://reader035.fdocuments.us/reader035/viewer/2022062801/56649e265503460f94b1565e/html5/thumbnails/25.jpg)
Universal codon chart
![Page 26: DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.](https://reader035.fdocuments.us/reader035/viewer/2022062801/56649e265503460f94b1565e/html5/thumbnails/26.jpg)
What does mRNA do?
• Brings the code for protein production and assembly to the ribosome
• At the ribosome the code in the mRNA is translated into amino acids
• mRNA codons enter the ribosome• transfer RNA or tRNA brings the
complementary base pairs or the anti-codon - to the ribosome from the cytoplasm
• A protein is produced when the mRNA codon and the tRNA anti-codon bond
![Page 27: DNA & Genetics Biology. Remember chromosomes? What are genes? Made up of DNA and are units of heredity; unique to everyone What are traits? Are physical.](https://reader035.fdocuments.us/reader035/viewer/2022062801/56649e265503460f94b1565e/html5/thumbnails/27.jpg)
Translation