1

DNA Fingerprinting

Can DNA evidence solve crimes?

Introduction

DNA fingerprinting is now used routinely to solve crimes. In recent years, news stories

have reported how miniscule amounts of DNA have been used to identify individuals

involved in incidents even many years in the past. It has also been used to exonerate

innocent people from incrimination. The power of DNA as a tool for individual

identification is known as DNA fingerprinting.

Like the fingerprints that came into use by detectives and police labs during the 1930s,

each person has a unique DNA fingerprint. Unlike a conventional fingerprint that occurs

only on the fingertips and can be altered by surgery, a DNA fingerprint is the same for

every cell, tissue, and organ of a person. It cannot be altered by any known treatment.

Consequently, DNA fingerprinting is rapidly becoming the primary method for

identifying and distinguishing among individual human beings.

An additional application of DNA fingerprint technology is the diagnosis of inherited

disorders in adults, children, and unborn babies. The technology is so powerful that, for

example, even the blood-stained clothing of Abraham Lincoln could be analyzed for

evidence of a genetic disorder called Marfan's Syndrome.

DNA typing is used in forensics, anthropology and conservation biology not only to

determine the identity of individuals but also to determine relatedness. This process has

been used to free innocent suspects, reunite children with their relatives, identify stolen

animals and even used in times of war to identify the remains of soldiers killed in

combat.

The Structure of DNA

The characteristics of all living organisms, including humans, are essentially determined

by information contained within DNA that they inherit from their parents. The molecular

structure of DNA can be imagined as a zipper with each tooth represented by one of four

letters (A, C, G, or T), and with opposite teeth forming one of two pairs, either A-T or G-

C. The letters A, C, G, and T stand for adenine, cytosine, guanine, and thymine, the basic

building blocks of DNA.

The information contained in DNA is determined primarily by the sequence of letters

along the zipper. For example, the sequence ACGCT represents different information

than the sequence AGTCC. The traits of a human being are the result of information

contained in the DNA code.

2

Living organisms that look different or have different characteristics also have different

DNA sequences. The more varied the organisms, the more varied the DNA sequences.

DNA fingerprinting is a very quick way to compare the DNA sequences of any two

living organisms.

Even more than a finger's print, each person's "DNA fingerprint" is unique. While old-

fashioned fingerprints record the wavy, whorled ridges on fingertips, DNA fingerprints

record the chemistry of small sections of DNA in chromosomes. A genome is a complete

set of human chromosomes. It is a string of DNA with about 3 billion bases, divided

into roughly 35,000 genes. Still, the DNA in every one of your cells codes for all of the

thousands of proteins you need from conception to adulthood (DNA's entire job is to

serve as a pattern for proteins.)

For instance, an intron might have the sequence "CGGT" and it might form the repeat

"CGGT CGGT CGGT CGGT CGGT CGGT." This number varies in different

individuals and this variability accounts for the unique fingerprint in each and every

organism. There are many introns present in DNA and these regions can be analyzed to

determine a fingerprint for every individual.

Objectives:

You should be able to:

1. Run a gel electrophoresis and to separate DNA fragments

2. State or explain the basic principles involved in DNA fingerprinting

3. Analyze the data generated in this investigation

4. Describe the methodology of the investigation

5. Use evidence to solve a crime

Making DNA Fingerprints

DNA fingerprinting is a laboratory procedure that requires several steps:

1: Isolation of DNA. DNA must be recovered from the cells or tissues of the body. Only a small

amount of tissue - like blood, hair, or skin - is needed. For example, the amount of

DNA found at the root cells of one hair is usually sufficient. The procedure is

similar to the one you used when extracting DNA from the onion.

DNA Profiling can be performed on:

Chewing gum

Licked stamps

Hair samples (with roots intact)

Razor shavings

Toothbrush

Cigarette butts

Body fluids like blood and semen

3

2: Cutting this DNA. Special enzymes called restriction enzymes are used to cut the DNA at specific

places. For example, an enzyme called EcoR1, found in bacteria, will cut DNA

only when the sequence GAATTC occurs. If the restriction site occurs in more

than one location on a DNA molecule, a restriction enzyme will make a cut at

each of those sites, resulting in multiple fragments.

If a given linear piece of DNA is cut with a restriction enzyme whose specific

recognition code is found at two different locations, how many fragments will be

produced? ___________________

Restriction Enzymes: Molecular Scissors

A restriction enzyme is used then to cut out the targeted gene from that chromosome.

Restriction enzymes are proteins that cut DNA at specific sites. There are thousands of

restriction enzymes and each is named after the bacteria from which it was isolated.

Three common restriction enzymes are EcoR1, Hind III, and PstI. EcoRI was isolated

from Escherichia coli bacteria, Hind III was isolated from Haemophilus influenzae

bacteria, and PstI was isolated from Providencia stuartii bacteria. Each restriction

enzyme recognizes a specific nucleotide base sequence in the DNA, called a restriction

site, and cuts the DNA molecule at only that specific sequence.

4

In general, restriction sites are palindromic, meaning they read the same sequence of

bases forwards and backwards on the opposite DNA strand.

For example, in the figure below, GAATTC read to the right has a counterpart in the

lower strand, CTTAAG read to the left. These are called palindromic sequences.

An important feature of restriction enzymes is that each enzyme only recognizes a

specific palindrome and cuts the DNA only at that specific sequence of bases. A

palindrome can be repeated a number of times on a strand of DNA, and the specific

restriction enzymes will cut all those palindromes at their restriction sites , no matter

what species the DNA comes from.

The restriction enzyme EcoRI cuts DNA between the G and the A in a GAATTC

palindrome.

How many base pairs are there to the left of the cut?

How many base pairs are there to the right of the cut?

Counting the number of base pairs, is the right fragment the same size as the left

fragment?

You can describe the fragment size by referring to the number of base pairs in the

fragment. This method is typically used to determine the size of fragments and it is

represented in base pairs.

5

If the GAATTC palindrome is repeated four times on the same piece of linear DNA how

many DNA fragments would be produced upon cutting the DNA with EcoRI? _________

What have we learned so far?

1. The base sequence in one strand of DNA can have a palindrome in the other

strand.

2. Palindromes can be detected by restriction enzymes

3. Restriction enzymes cut the palindromes at restriction sites.

4. A restriction enzyme only recognizes one specific kind of palindrome

5. Cutting DNA at restriction sites will produce DNA fragments

6. Fragment size can be described by the number of base pairs they contain

3: Separating the cut DNA by gel electrophoresis

Electrophoresis separates DNA fragments according to their size. DNA

fragments are loaded into the wells of an agarose gel. Buffer is added to the

electrophoresis chamber and an electric current is applied. The matrix of the

agarose gel acts as a sieve through which smaller DNA fragments move faster

than the larger ones.

Each person has differences in DNA sequences that are unique. The DNA

isolated from individuals is cut with restriction enzymes and then run on an

agarose gel. The gel is then stained and compared to DNA obtained from other

individuals. Based upon these results, one can determine which DNA fingerprint

is similar to the one obtained at the crime scene for instance.

Agarose Gel Electrophoresis: A Molecular Strainer

How can DNA fragments be separated from one another?

Agarose gel electrophoresis is a procedure used to separate DNA fragments based on

their sizes. Electrophoresis means to carry with electricity. DNA is a negatively charged

molecule. Scientists have used this fact to design a method that can be used to separate

pieces of DNA. A solution containing a mixture of DNA fragments is placed into a small

well formed in a gel that has a texture similar to gelatin. The gel is then placed in an

electrophoresis chamber that is filled with a conductive buffer solution. An electric

current is applied to the gel. This current causes the negatively-charged DNA molecules

to move towards the positive electrode.

6

You can think of an agarose gel as a strainer with tiny pores that allow small particles to

move through it very quickly. The larger the size of the particles, the slower they are

strained through the gel. After a period of exposure to the electrical current, the DNA

fragments will sort themselves out by size. Fragments that are the same size will tend to

move together through the gel and form bands. Therefore, the rate at which a DNA

fragment migrates through the gel is inversely proportional to its size in base pairs.

Over time, the smaller DNA fragments will travel farther than the larger ones. The bands

of DNA will be seen in the gel after the DNA is stained.

DNA is colorless so DNA fragments in the gel cannot be seen during electrophoresis. A

blue loading buffer, containing a blue dye, is added to the DNA solution. The loading

dyes do not stain the DNA but make it easier to load DNA into the wells of the gel. the

blue dye also allows one to see how far the DNA is moving along the gel.

Today’s Lab Exercise:

In this laboratory exercise, you will analyze three different samples of DNA. One

sample has been collected from a crime scene and the other two samples are

obtained from suspects 1 and two. The DNA from all three samples has been cut

with EcoR1 and Pst1 (see below) which are the most common enzymes used in

forensic science. The resulting DNA fragments will be separated and visualized

on agarose gels. Based on the restriction fragment patterns, you will compare the

evidence and match one of the suspect’s DNA to the sample collected at the crime

scene.

7

Procedure for sample preparation and gel electrophoresis

Follow figure on following page.

1. Obtain an agarose gel and place it in the electrophoresis apparatus. Be sure to

make sure you are wearing gloves and goggles while handling the gels and

running this procedure. Do not handle gels without gloves and goggles.

2. Fill the electrophoresis chamber with 1X TBE buffer to cover the gel,

approximately 250 ml.

3. Make sure the wells are near the black electrode (-)

4. Using a separate tip for each sample, load 10 l of DNA marker in well 2 and

then load 10 l of DNA samples into the next few wells.

Lane 2: DNA marker standard

Lane 3: crime scene DNA sample

Lane 4: suspect 1 DNA sample

Lane 5: suspect 2 DNA sample

8

5. Place the lid on the electrophoresis chamber. The red and black jacks on the

lid should match up.

6. Place leads into the power supply and match the red with red and black with

black.

7. Turn on the main power switch. Set the voltage to 110 volts and press the

“marathon person” button to begin the electrophoresis. Allow gel to run for 50

min.

8. Turn off the power supply and remove the top of the gel box.

9. Carefully remove the gel and tray from the gel box.

10. Analyze the results by placing your group’s gel in the light box and camera set

up as per the instructions listed below.

Gel Electrophoresis Analysis Procedure for Instructors:

1. NOTE TO INSTRUCTOR: Before beginning, prepare a PowerPoint presentation

with a slide for each of your student groups. Put the instructor name, section number and date on the first slide in the “click to add title” box. Put the names of each student in the group in the “Click to add title” section of each slide. You will be pasting the picture of the group’s gels in the “Click to add text” section of each slide.

9

2. Turn on the Light Box. Lift the orange lid and place a gel on blue surface of the Light Box. Note: It is easier to position the gel in front of the camera when the light box is on.

3. Open LoggerPro software.

4. Click on the Insert option on the menu to open a drop down menu.

5. Select Gel Analysis.

6. Click on Take Photo.

7. A new window will open that will show you the live picture.

8. Position the gel under the camera so that it is centered.

9. Click the Take Photo button.

10. The window will close and the photo should appear in a new window.

11. Right click on the picture of the gel to open a menu.

12. Select Copy from the menu.

13. Open the PowerPoint presentation. Left click on the “Click to add text” portion of the slide. Click “Paste” from the left-hand side of the Home tab to past the slide into the file.

14. Repeat this process until you have pasted all of the student groups gels into the PowerPoint presentation.

15. Save the PowerPoint presentation.

16. Have copies made of the PowerPoint presentation and bring them to the next lab. You will need four copies (one for each student in each group).

17. You can also distribute the files to your students through WebStudy or via email.

18. During next week’s lab, students will use the photographed copy of their gel to complete their analysis as part of a formal laboratory report.

10

Results

Here is the replica of the gel you are running:

Marker CS S1 S2

Draw a replica of the prepared gel at your bench of the DNA samples above:

11

How many different sizes of the DNA fragments are in each sample?

Crime Scene _______

Suspect 1 __________

Suspect 2 __________

12

Is there a suspect that matches the crime scene? ____________________

How sure are you that this is a match? ____________________________

Questions:

Number 1

The schematic represents a small section of DNA from three different individuals.

1. Compare the sugar phosphate backbone in the side chains of all three individuals. Are

there any differences?

2. Do all three samples contain the same bases? Explain.

13

3. Are the bases paired in an identical manner in all three samples? What is the base

pair bonding rules?

4. What differences do you observe in the three individuals?

5. What will you need to compare between these DNA samples to determine if they

are identical or not?

Question 2:

Observe the two samples of DNA shown below:

Sample 1: CAGTGATCTCGAATTCGCTAGTAACGTT

14

Sample 2: TCATGAATTCCTGGAATCAGCAAATGCA

If both samples are treated with a restriction enzyme that recognizes the sequence

GAATTC then indicate the number of fragments and the size of each fragment from each

sample of DNA.

Sample 1: Number of fragments _________________

Sample 2: Number of fragments _________________

Question 3

A piece of DNA is cut into four fragments as shown in the diagram. The solution

containing the four fragments is placed in a well in an agarose gel. Using the information

given, draw how you think the fragments might be separated. Label each fragment with

its corresponding letter.

A B C D

Complete this rule for the movement of DNA fragments through an agarose gel

THE LARGER THE DNA FRAGMENT, THE_______________________________

Question 4

Observe the diagram of the agarose gel below. It shows two lanes. Remember a lane is

the column of bands below a well. The right lane contains a banding pattern from four

fragments of known length

6000 base pairs

15

5000 base pairs

3000 base pairs

1000 base pairs

1. Which lane is the reference ladder or marker? ______________________

2. How did you come up with this conclusion?

3. Label each band in the right lane with its base-pair size.

4. Compare the two columns of bands. Estimate the size of the fragments in the left

lane.

a. upper band ____________________

b. lower band ___________________

5. How did you determine the sizes of the two bands in the left lane?

Question 5:

Analyze the bands on the following gel. Answer the following questions.

16

1. What is contained within each band seen?

2. If this were a fingerprinting gel, how many samples of DNA can you assume were

placed in each separate well?

3. What caused the DNA to become fragmented?

4. Which of the DNA samples have the same number of restriction sites for this

restriction enzyme? Write lane numbers.

5. Which sample has the smallest DNA fragment?

6. How many restriction sites were there in lane three?

17

7. Which DNA samples appear to have been cut into the same number and size of

fragments?

8. Based on your analysis of the gel, what is your conclusion about the DNA

samples in the gel. Do any of the samples seem to be from the same source? If

so, which ones? Describe the evidence that supports your conclusion.

Question 6:

By observing this gel, who committed the crime?

Question 7:

18

Based on the evidence below, what do you conclude about who committed the crime.

Explain how you came up with this conclusion