DNA-Based Microbial Analysis Microbe Detectives Trevor Ghylin, P. E .
24
DNA-Based Microbial Analysis Microbe Detectives Trevor Ghylin, P. E. trevor.ghylin @microbedetectives.com 414-217-7784 www.microbedetectives.com What’s living in your water?™ Global Water Center, Milwaukee, WI
description
What’s living in your water?™. DNA-Based Microbial Analysis Microbe Detectives Trevor Ghylin, P. E . Global Water Center, Milwaukee, WI. trevor.ghylin @microbedetectives.com 414-217- 7784 www.microbedetectives.com. Company Introduction. My Background Professional Engineer – CH2M Hill - PowerPoint PPT Presentation
Transcript of DNA-Based Microbial Analysis Microbe Detectives Trevor Ghylin, P. E .
DNA-Based Microbial Analysis
Microbe DetectivesTrevor Ghylin, P. E.
www.microbedetectives.com
What’s living in your water?™
Global Water Center, Milwaukee, WI
Company Introduction• My Background
o Professional Engineer – CH2M Hillo WEF Canham Graduate Studies Fellowshipo NIH Biotechnology Training Program Fellowo PhD Candidate – Biotechnology
• Founded in 2012 to improve access to DNA sequencing serviceso Global Freshwater Seed Accelerator Winnero Rising Star Award - Early Stage Symposium
• Advisory Board - Current and former IWA presidents• Key Developers - Biomolecular Engineer,
Bioinformaticist• Clients – CH2M Hill, Milwaukee Water, Consulting Firms
Current paradigmProblem: >99% of microbes can’t be cultured or identified under a microscope
Solution
DNA-Based Microbial Analysis
Collect Environmental Sample (50mL sterile bottle)
Sterilize, Preserve, Ship
Add ethanol to 70% concentration to sterilize.
Dilute with water to 25% for preservation and shipping (Shipping via Fedex: 5
days/$85USD/51GBPConcentrateCentrifuge or Filtration
Extract DNA/Purify
DNA SequencingPCR Amplification/DNA Sequencing
Assign Taxonomy (Proprietary)
Bioinformatics/DNA Processing/Taxonomic Assignment
Interpretation of Results (Proprietary)
ATGCATT…...
Nitrosomonas
Healthy AOB population
Example DNA Data>594682TACGGAGGATCCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTACGTAGGCGGACCCGTCAGTCAGTGGTGAAAGTTTGCAGCTTAACTGTAAAATTGCCATTGAAACTACGGGTCTTGAGTGTAAATGAGGTAGGCGGAATGTGTTGTGTAGCGGTGAAATGCTTAGATATAACACAGAACACCAATTGCGAAGGCAGCTTACTGGGATACAACTGACGCTGAGGCACGAAAGCGTGGGGATCAAACAGG>594511TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAACGCAGGCTGGAGATTAAGCGTGCTGTGAAATGTACCGGCTCAACCGGTGACGTGCAGCGCGAACTGGTTTCCTTGAGTGAGTACGACGTCAGCGGAATTCGTGGTGTAGCGGTGAAATGCTTAGATATCACGAA
Database of Wastewater Microbes (Proprietary)
Solution Cont’d
Solution Cont’d• Benefits
o Wastewater Treatment • Solve treatment problems • Reduce energy and chemical consumption• Maximise digester energy production• Maximise effluent quality
o Membrane Treatment• Solve Biofouling issues• Reduce chemical consumption• Reduce operational and maintenance labor• Increase membrane life
o Drinking Water• Solve taste/odor issues• Solve coliform issues• Ensure quality and safety• Identify and fix distribution system issues
Case Studies
Membrane Biofouling
Membrane Biofouling Cont’d
Wastewater Treatment• Municipal SBR – Filamentous Bulking in
Spring• SVI~300• Poor settling, poor effluent quality• Potential to exceed permit TSS limit
Microscopy Results
Drinking Water Distribution System Case Study
Costs• Project specific• Membrane Biofouling
o $2,000USD (1,200 GBP) analysis (save >$10,000 USD/6,000GBP in chemical/operational)
• Wastewater Treatmento $600USD (350 GBP) for 1 sample ($1000USD/600GBP)
with microscopy)• Drinking Water
o Provide distribution system insurance for pennies per resident
• Business Model o Mail-in service business with additional consulting fee
($140/hr USD/85 GBP)o Return on investment can be extremely high
Status and Path Forward
• Currently serving clients in drinking water and wastewater
• Pilot studies o Wastewater Treatment
• Year-long pilot; weekly or monthly samples
o Drinking Water Distribution System• Single sampling event; collect samples from
various locations in the distribution system• Multiple cities to generate more data
o Membrane Biofouling
Status and Path Forward Cont’d
• Planso Pilot studieso Continue to serve clients and build our knowledge,
refine our databaseso Milwaukee distribution system project
• Support Neededo Wastewater Treatment Demonstration o Membrane Biofouling Demonstrationo Drinking Water Distribution System Demonstration
Summary and next steps
• DNA analysis is economical o Superior to existing petri dish and microscopy methods
• Need partners to do more extensive pilot testing work and demonstrate resultso Reduced energy and chemical consumptiono Improved drinking water qualityo Improved membrane performance
Thank You
What’s living in your water?
www.microbedetectives.comLinkedIn: Trevor Ghylin
Global Water Center, Milwaukee, WI
