PRIMARY RESEARCH PAPER | Philippine Journal of Systematic Biology

DOI 10.26757/pjsb2020c14002

Volume 14 Issue 3 - 2020 | 1 © Association of Systematic Biologists of the Philippines

DNA barcode of the Lanzones scale insect, Unaspis mabilis Lit

& Barbecho (Hemiptera: Diaspididae)

Abstract

The mitochondrial cytochrome c oxidase subunit 1 (COI) nucleotide sequences of Unaspis mabilis Lit & Barbecho

(Hemiptera: Diaspididae), are provided for the first time. The total genomic DNA of each scale insect was extracted from

individuals infesting lanzones leaves from three selected sites in Los Baños, Laguna. A partial COI gene amplicon with

approximately 750 bp was obtained using the primer pair PcoF1 and LepR1. Nucleotide sequence alignment showed no

variation among the COI sequences from all the samples. BLASTn search yielded no significant match with any of the

available sequences for Unaspis species. The closest hit was Aulacaspis tubercularis Newstead (GenBank Accession No.

HM474091) with 87.4% nucleotide similarity. Nonetheless, phylogenetic analyses revealed that generated COI sequences

from U. mabilis form a monophyletic clade with U. yanonensis and U. euonymi, with closer proximity to the former.

These findings also strengthen the species status of U. mabilis under the genus Unaspis. The DNA barcodes generated

from this study (GenBank Acc. Nos. MN114099, MN14101, and MN114102), could, therefore, be used to verify the

species identity of other lanzones scale accessions, as well as monitor the distribution and spread of U. mabilis, which

would greatly influence possible pest management options.

Keywords: cytochrome C oxidase I, COI, Lansium domesticum Correa, lanzones

1Institute of Weed Science, Entomology and Plant Pathology, College

of Agriculture and Food Science, University of the Philippines Los

Baños, College, Laguna 4031 Philippines; 2Environmental Biology

Division, Institute of Biological Sciences, College of Arts and

Sciences, University of the Philippines Los Baños, College, Laguna

4031 Philippines 3Entomology Section, Museum of Natural History, University of the

Philippines Los Baños, College, Laguna 4031 Philippines

*Corresponding email: blcaoili@up.edu.ph

§ Co-corresponding email: illit@up.edu.ph

Date Submitted: 13 August 2019

Date Accepted: 27 June 2020

Introduction

Lanzones, Lansium parasiticum (Osbeck) Sahni & Bennet

(=Lansium domesticum Corrêa), is a well-known fruit sold in

the Philippine market. In 2013, the volume of production for

lanzones reached approximately 35,000 MT (Philippine

Statistics Authority 2018). Aside from being a table fruit, it is

also known to have medicinal value, which makes it a good

choice of crop for massive production (Tilaar et al. 2008).

Lanzones is known as an alternative medicine to treat illnesses

such as diarrhea, fever, dysentery, and even malaria (Yapp and

Yap 2003). However, recent threats posed by insect pests

gravely affected its local production.

The recently described Unaspis mabilis Lit & Barbecho

(Hemiptera: Diaspididae) is a species of armored scale insect

that infests on lanzones. Serious infestation was first observed in

2004 in North Cotabato (Provido 2007). The same scale insect

was also found to attack lanzones in Davao (Provido 2007; DA-

SMIARC 2014), South Cotabato and Saranggani provinces

(Tacio 2008). In addition, an outbreak in Makilala, North

Cotabato was reported in 2009 (Lit & Barbecho 2014). The

infestation was reported to have spread to Negros Occidental

(pers. comm.), Batangas (Watson 2015), Laguna (Lit &

Barbecho 2014; Watson 2015), and recently in Aklan (Lit 2015,

unpublished identification report).

Owing to the minute nature of these scale insects, there

were several misidentifications, as summarized by Lit &

Barbecho (2014) and Watson (2015). They were initially

misidentified in popular pest reports as Lepidosaphes ulmi

(Linnaeus), and later as Lepidosaphes beckii (Newman), as their

scale cover superficially resembles those of mussel scales (e.g.

Mindanews 2007; Provido 2007; Cahatian & Pagal 2011). Later

on, it was thought to represent Unaspis citri (Comstock) (e.g.

Vanessa Kate I. Alvarez1, Ireneo L. Lit, Jr.2,3,§, Cristian C. Lucañas2,3, Kristine O. Abenis2, Romnick A.

Latina1, and Barbara L. Caoili1,*

Volume 14 Issue 3 - 2020 | 2 Philippine Journal of Systematic Biology Online ISSN: 2508-0342

Alvarez et al.: DNA barcode of the Lanzones scale insect

BPI-NPQD 2014). There were also a few misconceptions in

national news that “coconut scale insects Aspidiotus spp.

spreads to lanzones” (Valencia 2014). However, a careful and

thorough morphological examination by Lit & Barbecho (2014)

established that the mussel scale insect is a new species,

Unaspis mabilis Lit & Barbecho.

Despite only being reported from the country, Lit &

Barbecho (2014) hypothesized that it may be an invasive

species, based on its aggressive behavior and spread. With that,

a more robust monitoring system should be implemented. The

use of a DNA barcode for U. mabilis, would serve as a useful

tool to survey and monitor its spread as well as understand its

biogeographical origins, which is essential in designing efficient

management programs.

The mitochondrial gene, cytochrome c oxidase I (COI),

serves as a standard DNA barcode for animals. This COI gene

has a simple genomic structure, is distinct, easy to isolate and

has a rapid pace of evolutionary change (Avise et al. 1987), and

is one of the most frequently sequenced mitochondrial DNA

genes (Caterino et al. 2000). Here, the partial sequences of the

mitochondrial COI gene that could be used as a DNA barcode

of the lanzones scale insect, U. mabilis, is provided.

Materials and Methods

Insect samples

Unaspis mabilis samples were collected from lanzones

trees in three sites in Los Baños, Laguna: Mt. Makiling Station

9, Bagong Silang, and Mudspring. High rates of lanzones scale

insect infestation were recorded in these areas. The specimens

were verified as U. mabilis by Dr. Ireneo L. Lit, Jr., the main

author of the species.

Total genomic DNA extraction

The total genomic DNA of each lanzones scale insect was

extracted following the protocol of the Animal and Fungi

Genomic DNA Extraction Kit™ (Jena Bioscience, Germany)

with slight modifications. Briefly, fresh specimens were placed

individually on the cap of a 1.5 mL microcentrifuge tube and

homogenized in 40 µL of cell lysis buffer with 0.3 µL

proteinase K solution. The homogenates were incubated at 55°C

for 2 h. After which, 30 µL of protein precipitation solution was

then added into each tube, mixed on a vortex mixer for 30 s and

centrifuged at 15,000 x g for 10 min. The supernatant was then

transferred into a new microcentrifuge tube with 80 µL of

isopropanol, which was then mixed by inverting the tubes 50

times. The genomic DNA was collected by centrifugation at

15,000 x g for 15 min to form the DNA pellet. After discarding

the supernatant, 100 µl washing buffer was added followed by

centrifugation at 15,000 x g for 20 min. The DNA pellet was

allowed to air-dry and was resuspended in 20 µL DNA

hydration solution with 0.3 µL of RNAse. The tubes were

incubated at 37°C for 1 h and then incubated at 65°C for another

hour. The samples were stored at -20°C until use.

Amplification of COI gene

The COI gene was amplified using PcoF1 (5’-

CCTTCAACTAATCATAAAAATATYAG-3’), and LepR1 (5’-

TAAACTTCTGGATGTCCAAAAAATCA -3’) primers

following the thermocycle conditions; 2 min at 95°C; 5 cycles of

40 s at 94°C, 40 s at 45°C, 70 s at 72°C; 40 cycles of 40 s at 94°

C, 40 s at 51°C, 70 s at 72°C; 5 min at 72°C; held at 4°C (Park

et al. 2010) in 25 µL PCR reaction mixture containing 12.5 µL

of 2X Taq Master mix (Vivantis, Malaysia), 10 pmol PcoF1, 10

pmol LepR1, 4 mM MgCl2, and 50 ng genomic DNA. The

amplicons were resolved in 1% agarose gel in 0.5x TBE buffer

stained with GelRed® (Biotium, Inc., Fremont, CA, USA).

Molecular size of the PCR products were estimated using

VC100 bp Plus DNA Ladder (Vivantis, Malaysia). The gels

were viewed and photographed using Alpha Imager Mini

(Protein Simple, San Jose, CA, USA) at 302 nm.

COI nucleotide sequence analysis

Samples with corresponding expected molecular weight of

amplicons were sent to Apical Scientific Sdn. Bhd. (Taman

Serdang Perdana, 43300 Seri Kembangan, Selangor, Malaysia)

via Asia Gel Corp. (Villa Lourdes Townhomes, Congressional

Avenue, Barangay Bahay Toro, Quezon City 1100) for Sanger

sequencing. The generated nucleotide sequences were edited in

BioEdit software (Hall 1999). Those with high quality

nucleotide sequences were then subjected to BLASTn (https://

blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=Blast Search)

for NCBI database mining. Phylogenetic analysis of the

generated COI sequences was also performed using Mega X

(Kumar et al. 2018)

Results and Discussion

The primer pair PcoF1 and LepR1, designed to address the

low recovery of COI barcodes for scale insects (Park et al.

2010), successfully generated an approximately 750 bp COI

gene amplicon from Unaspis mabilis samples from the three

collection sites (Figure 1). The amplicons generated were of the

same expected molecular size as those reported by Park et al.

(2010).

High-quality COI nucleotide sequences of 649 bp in length

were obtained from the insect samples from Barangay Bagong

Silang (n=10), Mudspring Area (n=12), and Mt. Makiling

https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearchhttps://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch

Volume 14 Issue 3 - 2020 | 3 © Association of Systematic Biologists of the Philippines

Alvarez et al.: DNA barcode of the Lanzones scale insect

Station 9 (n=10). Alignment of the nucleotide sequences

showed a 100% identity among all the samples without any stop

codon within the deduced amino acid sequence (Figure 2) and

thus, represents an uninterrupted open reading frame. This

result confirmed the integrity of the COI nucleotide sequences

generated, and hence, could serve as an ideal DNA barcode for

U. mabilis.

Comparison of the U. mabilis COI nucleotide sequence

with other COI sequences in GenBank revealed an 87.40%

identity match with another armored scale, Aulacaspis

tubercularis Newstead (GenBank Acc. No. HM474091.1). The

relatively low nucleotide identity match with A. tubercularis is

due to 86 substitution sites observed within the COI gene region.

Surprisingly, an even lower percentage nucleotide identity

match (86.35%) was observed between the U. mabilis COI

nucleotide sequences and its congener, U. euonymi (Comstock)

(GenBank Acc. No. HM474405.1), with 91 substitution sites

observed (Figure 3). These results further proved the utility of

the generated COI sequences as DNA barcode for U. mabilis.

Despite a deep sequence genetic divergence (>2%) and

apparent BLAST mismatch, phylogenetic analysis of

Diaspididae COI nucleotide sequences revealed that the

generated U. mabilis DNA barcodes form a monophyletic clade

with U. yanonensis (Kuwana) and U. euonymi indicative of its

valid species status under Unaspis genus (Figure 4).

Interestingly, U. mabilis had a closer proximity to U. yanonensis

than U. euonymi. Nevertheless, the degree of divergence and

uniqueness of U. mabilis COI barcode from the rest of the

sequences examined proved its utility as a marker for this

species. In a DNA barcoding study using the same COI locus

done by Park et al. (2011b), high genetic differences were also

observed among scale insects belonging to Pseudococcidae and

Diaspididae. It was reported that genetic divergences within

species (n=57 taxa) and in congeneric species (n=30 taxa)

ranged from 0-5.98% with a mean of 0.97%, and 1.93-23.29%

with a mean of 10.09%, respectively. Almost similar degree of

divergence ranges within and in congeneric species was also

observed in 1,090 Heteroptera COI barcodes (Park et al. 2011a).

The nucleotide sequence identity matrix of U. mabilis, U.

euonymi, and A. tubercularis showing the divergence among the

Figure 1. Molecular size estimation of the amplicons of cytochrome c

oxidase I (COI) gene region of Unaspis mabilis Lit & Barbecho from

three sites in Los Baños, Laguna (Lanes 1-12 in each panel). The PCR

products are resolved in 1% agarose gel ran in 0.5x TBE buffer and

stained with GelRed® (Biotium, Inc., USA). VC 100 bp Plus DNA

Ladder (Vivantis, Malaysia) was used as a molecular size standard

(MW).

Figure 2. Nucleotide sequence alignment and the deduced amino acid sequence of cytochrome c oxidase I

gene of Unaspis mabilis Lit & Barbecho infesting lanzones Lansium parasiticum collected in Bagong Silang

(MN114099), Mud Spring (MN114101) and Mt. Makiling Station 9 (MN114102), Los Baños, Laguna.

Volume 14 Issue 3 - 2020 | 4 Philippine Journal of Systematic Biology Online ISSN: 2508-0342

Alvarez et al.: DNA barcode of the Lanzones scale insect

species is summarized in Table 1. U. mabilis samples are

significantly different from U. euonymi and A. tubercularis with

genetic distances of 14.4% and 13.3%, respectively. These

sequence variation values are highly significant since a

minimum of 2.0% divergence in the COI nucleotide sequence is

enough for species delineation (Hebert et al. 2003).

By itself, the closeness of U. mabilis with U. euonymi is

attributable to their being congeners but the significant

difference confirms the distinctness of U. mabilis as a species,

as first established by Lit & Barbecho (2014) based on

morphological characters. In fact, it is the first Unaspis species

to be reported on a host plant in the Meliaceae. The closest

match, albeit 87% only, with A. tubercularis, can be attributed

to the closeness of the subtribe Chionaspidina (where

Aulacaspis belongs) and the Unaspis group, within the tribe

Diaspidini (Normark et al. 2019).

With the very minute size of U. mabilis, the availability of

a DNA barcode will speed up studies on its distribution across

geographical locations. This DNA barcode, which is the first

report for U. mabilis, could also be used as a tool to monitor and

trace the spread of this insect as well as identify other potential

host plants. The identical COI sequences obtained from the three

populations suggest the presence of only one haplotype, an

indication that the establishment is recent. Comparison of the

DNA barcode from U. mabilis from other locations could,

therefore, provide potential data for understanding its origins.

Such information is essential in designing pest management

strategies against this pest.

Figure 3. Multiple nucleotide sequence alignment of cytochrome c oxidase I gene consensus

sequence of Unaspis mabilis Lit & Barbecho infesting lanzones, Lansium parasiticum, Aulascaspis

tubercularis (HM474091.1) and U. euonymi (HM474405.1).

COI Sequences U. mabilis

MN114099

U. mabilis

MN114101

U. mabilis

MN114102

A. tubercularis

HM74091.1

U. euonymi

HM74405.1

U. mabilis MN114099 1 1 0.867 0.856

U. mabilis MN114101 1 1 0.867 0.856

U. mabilis MN114102 1 1 0.867 0.856

A. tubercularis HM74091.1 0.867 0.867 0.867 0.855

U. euonymi HM74405.1 0.856 0.856 0.856 0.855

Table 1. Nucleotide sequence identity matrix of Unaspis mabilis Lit & Barbecho infesting lanzones, Lansium parasiticum collected in

Bagong Silang (MN114099), Mud Spring (MN114101) and Mt. Makiling Station 9 (MN114102), Los Baños, Laguna.

Volume 14 Issue 3 - 2020 | 5 © Association of Systematic Biologists of the Philippines

Alvarez et al.: DNA barcode of the Lanzones scale insect

Conclusion and Recommendation

A 649 bp long COI gene sequence was generated as a

DNA barcode for U. mabilis. This important molecular

information can facilitate studies on the distribution of this

species across geographical locations, particularly where

lanzones are grown. It could also provide potential data for

understanding its biogeographical origins, especially since there

is doubt as to the species current endemic status in the

Philippines and the hypothesis that it might be an invasive alien

species. In turn, such understanding can have potentially great

impacts on possible pest management options. Future detection

on other potential host plants can also be hastened using this

molecular barcode.

Acknowledgement

We thank the Department of Science and Technology –

Philippine Council for Agriculture, Aquatic and Natural

Resources Research and Development for funding the projects

(1) Development of Molecular Diagnostic Tools for Armored

Scale Insects (Hemiptera: Diaspididae) and their Natural

Enemies on Coconut and Associated Crops (Phases 1 and 2)

and (2) Morphology-Based Diagnostics of Armored Scale

Insects (Hemiptera: Diapididae) and Their Natural Enemies on

Coconuts and Associated Crops (Phases 1 and 2), under which

the scale insects on lanzones trees within coconut plantations

were initially collected and studied. The fresh materials used for

generating the DNA barcode were collected under a permit

granted by the Makiling Center for Mountain Ecosystems,

Figure 4. Phylogenetic relationship of Unaspis mabilis (n=3) and selected Diaspididae species (n=27) based on partial

nucleotide sequences of cytochrome C oxidase I sequences analyzed by neighbor-joining using K2P distance model and 1000

bootstraps, with Pseudococcidae species namely, Pseudococcus jackbeardsleyi (KY373149.1) and Planococcus citri

(EU250560.1) as outgroups.

Volume 14 Issue 3 - 2020 | 6 Philippine Journal of Systematic Biology Online ISSN: 2508-0342

Alvarez et al.: DNA barcode of the Lanzones scale insect

College of Forestry and Natural Resources, University of the

Philippines Los Baños.

Literature Cited

Avise, J.C., J. Arnold, R.M. Ball, E. Bermingham, T. Lamb,

J.E. Neigel, C.A. Reeb, & N.C. Saunders, 1987.

Intraspecific phylogeography: the mitochondrial DNA

bridge between population genetics and systematics.

Annual Review of Ecology, Evolution and Systematics, 18:

489-522. doi.org/10.1146/annurev.es.18.110187.002421.

Bureau of Plant Industry – National Plant Quarantine Division

(BPI-NPQD). 2014. Declaring severe infestation of

Aspidiotus spp. and Unaspis sp. in mangosteen (Garcinia

mangostana) and lanzones (Lansium domesticum),

respectively, including other scale insects affecting other

plants. BPI Special Quarantine Order no. 1, series of 2014.

https://pqs.bpinsicpvpo.com.ph/domestic.php.

Cahatian, P.O. & Y.G. Pagal, 2011. Biological studies of two

species of predatory ladybird beetles of the lanzones mussel

scale insect (Lepidosaphes ulmi Linnaeus). [Abstract] USM

(University of Southern Mindanao) R&D Journal https://

scinapse.io/papers/1640020967

Caterino, M.S., S. Cho & F.A. Sperling, 2000. The current state

of insect molecular systematics: a thriving Tower of Babel.

Annual Review of Entomology, 45: 1-54. doi.org/10.1146/

annurev.ento.45.1.1.

Department of Agriculture Region XI – Southern Mindanao

Integrated Agricultural Research Center [DA-SMIARC].

Bio control of scale insects in lanzones. SMIARC

Technoguide. [Brochure]. DA SMIARC Knowledge

Management-Farmer Info & Technology Services Center,

Davao City.

Hall, T.A., 1999. BioEdit: a user-friendly biological sequence

alignment editor and analysis program for Windows 95/98/

NT. Nucleic Acids Symposium Series, 41: 95-98.

Hebert, P.D., A. Cywinska, S.L. Ball & J.R. Dewaard, 2013.

Biological identifications through DNA

barcodes. Proceedings of the Royal Society of

London, B Biological Science, 270 (1512): 313-321.

Kumar, S., G. Stecher, M. Li, C. Knyaz & K. Tamura, 2018.

MEGA X: Molecular Evolutionary Genetics Analysis

across computing platforms. Molecular Biology and

Evolution, 35: 1547-1549.

Lit, I.L. Jr. & N.M. Barbecho, 2014. A new species of armored

scale insect (Hemiptera: Diaspididae) on Lansium

domesticum trees in the Philippines. Arthropoda Generalis,

4: 1-7.

MindaNews, 2007. Insects destroy lanzones trees but growers

urged against using pesticides. MindaNews August 24, 2007

https://www.mindanews.com/business/agriculture/2007/08/

insects-destroy-lanzones-trees-but-growers-urged-against-

using-pesticides/

Normark, B.B., A. Okusu, G.E. Morse, D.A. Peterson, T. Itioka

& S.A. Schneider, 2019. Phylogeny and classification of

armored scale insects (Hemiptera: Coccomorpha:

Diaspididae). Zootaxa, 4616 (1): 1-98. https://

doi.org/10.11646/zootaxa.4616.1.1

Park, D.S., R. Foottit, E. Maw & P.D. Hebert, 2011a. Barcoding

bugs: DNA-based identification of the true bugs (Insecta:

Hemiptera: Heteroptera). PLoS ONE, 6(4). doi: 10.1371/

journal.pone.0018749.

Park, D.S., S.J. Suh, P.D. Hebert, H.W. Oh & J.J. Hong, 2011b.

DNA barcodes for two scale insect families, mealybugs

(Hemiptera: Pseudococcidae) and armored scales

(Hemiptera: Diaspididae). Bulletin of Entomological

Research, 101(4): 429-434. doi:10.1017/

S0007485310000714.

Park, D.S., S.J. Suh, H.W. Oh & P. Hebert, 2010. Recovery of

the mitochondrial COI barcode region in diverse Hexapoda

through tRNA-based primers. BMC Genomics, 11(1): 423.

doi:10.1186/1471-2164-11-423.

Philippine Statistics Authority, 2018. Crops Statistics of the

Philippines 2013–2017. Quezon City. Retrieved from

https://psa.gov.ph/sites/default/files/Crops%20Statistics%

20of%20the%20Philippines%202013-2017.pdf

Provido, N.T., 2007. How to control lanzones pest. Philippine

Headline News Online, 26 September, 2007. Retrieved 01

April 2019 from http://www.newsflash.org/2004/02/si/

si002421.htm.

Qin, Y.-G., Q-S Zhou, F. Yu, X.-B. Wang, J.-F. Wei, C.-D.

Zhu, Y.-Z. Zhang & A.P. Vogler, 2018 Host specificity of

parasitoids (Encyrtidae) toward armored scale insects

(Diaspididae): Untangling the effect of cryptic species on

quantitative food webs. Ecology and Evolution, 2018: 8:

7879-7893. DOI: 10.1002/ece3.4344

Tacio, H.D., 2008. Meet the luscious lanzones. Random

thoughts. Retrieved 01 April 2019 from http://

henrytacio.blogspot.com/2008/09/meet-luscious-

lanzones.html.

Tilaar, M, W.L. Wih, A.S. Ranti, S.M. Wasitaatmadja,

Suryaningsih, F.D. Junardy & Maily, 2008. Review of

Lansium domesticum Corrêa and its use in cosmetics.

Boletin Latinoamericano y del Caribe de Plantas

Medicinales y Aromáticas, 7(4): 183-189. Retrieved 22

May 2019 from https://www.redalyc.org/

html/856/85670401/.

https://scinapse.io/papers/1640020967https://scinapse.io/papers/1640020967

Volume 14 Issue 3 - 2020 | 7 © Association of Systematic Biologists of the Philippines

Alvarez et al.: DNA barcode of the Lanzones scale insect

Valencia, C. 2014. Cocolisap spreads to lanzones, mangosteen.

ABS-CBN News, 09 July, 2014. Retrieved 13 April 2019

from https://news.abs-cbn.com/nation/regions/07/08/14/

cocolisap-spreads-lanzones-mangosteen.

Watson, G.W., 2015. Unaspis lansivora sp.n. (Hemiptera:

Diaspididae), a new pest of Lansium domesticum

(Meliaceae), and a key to Unaspis species. Zootaxa, 3905

(3): 432-440. doi.org/10.11646/zootaxa.3905.3.9.

Yapp, D.T. & S.Y. Yap, 2003. Lansium domesticum: skin and

leaf extracts of this fruit tree interrupt the lifecycle of

Plasmodium falciparum and are active towards a

chloroquine-resistant strain of the parasite (T9) in vitro.

Journal of Ethnopharmacology, 85(1): 145-150.

doi.org/10.1016/S0378-8741(02)00375-6.