Phase Transformations - Vocabulary Phase Allotropes Phase Transitions Phase Diagram
Divine Mercy Parish - jppc.net · required to a ©end Mass when public celebra ons resume. 2. A...
Transcript of Divine Mercy Parish - jppc.net · required to a ©end Mass when public celebra ons resume. 2. A...
Divine Mercy Parish Parroquia Divina Misericordia
Formerly St. Mary’s and St. Mark’s Roman Catholic Churches Serving Jesus Christ since 1854 and 1871 232 Central Avenue, Rahway NJ 07065
h ps://www.divinemercyrahway.church
New Mass Schedule Effec ve June 21, 2020
Weekday 12:00 pm Monday to Friday Martes 7:00 pm Misa en Español Saturday 9:00 am, 4:00 pm (Vigil Mass) Sunday 8:00 am, 9:30 am, 11:00 am, 12:30 pm Misa en Español Holydays 6:00 pm (Vigil Mass) 12:00 pm, 6:00 pm, 7:00 pm Misa en Español
Rev. Alexander T. Cruz
Pastor, extn 103 Email:[email protected]
Rev. Jozef Krajnak, Ph.D. Resident Priest, extn 104
Email:[email protected] Joseph Keefe Arlene Mione
Trustees
Twenty-second Sunday in Ordinary Time
August 30, 2020
Parish Membership
Our parish embraces diversity. We may come from different origins but we are
one in faith, love & devo on to the merciful Heart of Jesus. Everyone is
welcome to join our growing communi-ty. Please email or visit our office to
register. Parish Office/Rectory
Hours: Monday to Friday 9 am - 3 pm
Email: [email protected] Tel (732)388-0082, (732)388-0083
CCD (732)382-0004
The Perfect Prayer in time of Covid19
Eternal God, in whom mercy is endless and the treasury of com-
passion inexhaustible, look kindly upon us, and increase Your mercy in us, that in difficult moments, we might not despair nor become despondent, but with great confi-dence, submit ourselves to Your
holy will, which is Love and Mercy itself.
Amen.
Jesus, I Trust in You
TWENTY-SECOND SUNDAY IN ORDINARY TIME AUGUST 30, 2020
GIFTS AND OFFERINGS
The TTabernacle Lamp is being offered for Ϯ Albert F. Reitenmeyer. The AAltar Bread is being offered for Ϯ John R. Reitenmeyer. The AAltar Wine is being offered for Ϯ Margaret Reitenmeyer The AAltar Candles are being offered for Ϯ Albert F. Reitenmeyer .
Sacramental Schedule Confession Saturdays 3:00 pm to 4:00 pm or call
the priest for an appointment
Bap sm Call the parish office to make an ap-pointment with a priest
Marriage Couples planning marriage must no fy the Parish rectory a year in advance for date and requirement. Call the parish office to make an appointment with a priest.
Anoin ng of the Sick Contact a priest at any me. Hospital visits are s ll suspended due to Covid19.
Holy Communion For anyone who are homebound and would like to receive Holy Communion please contact the parish office or rectory.
Divine Mercy Parish Community Worship Apostolate meets in Room 104 Rosary Society meets four mes a year
Filipino Community Mass every 3rd Sunday of the month with the Filipino Choir, 5:00 pm to 6:30 pm at the Church
Divine Mercy Ministry of Jesus Meets at the Vigil Mass on every 4TH Saturday of the month
Spanish Community Reuniones Hispanas Eucaris a Dominical 12:30 pm Bau sos Por favor llamar la oficina de Lunes a Viernes. Matrimonio Feligreses registrados enen que presentarse un
año antes de la boda. Reconciliación Cada Martes Despues de la Misa 12:00 pm Y de
la 7:00 pm, Cada Miercoles Despues de la Misa de la 12:00pm
Unción de los Enfermos Por favor llamar a la oficina para visitas a las casa o hospital.
Mensajeras del Amor de Cristo Visitan los enfermos Diana (732)535-0278 Educación Religiosa llamada (732)382-0004 Movimiento Juan XXIII Jueves 8:00 pm Parish School #104 Grupo Guadalupano Martes 7:00 pm Iglesia Grupo Juvenil "Angeles de Jesús" Sábado 4:00pm - 6:00pm Aula 202 Grupo de Oración Sábado 7:00 pm Connell Hall
“Grupos Voluntarios Limpian La Iglesia” Mil Ave Marias - Cada Primera Semana del mes, Miercoles
manana Juan XXIII - Cada Segunda Semana del mes, Sábado Guadalupanos - Cada Tercera semana del mes, Sábado Grupo de Oracion– Cada Cuarta semana del mes, Sábado
DUE TO COVID 19 ALL MEETINGS ARE TEMPORARILY SUSPEND-
ED. MEETINGS WILL START TO RESUME SEPTEMBER 2020.
CDC and Archdiocesan Guidelines in Celebra ng Mass during Pandemic
1. Everyone MUST WEAR MASK all the me while inside the church.
2. Front of every available seats are marked with a WHITE TAPE. Seats without the white tape should be le vacant.
3. To follow and maintain social distancing 70 to 80 peo-ple only will be allowed inside the church.
4. Keep social distancing at all mes (6 feet apart from each other) Couples and families living in one roof may seat next to each other
5. NO SHAKING OF HANDS and NO KISSING during the giving of the sign of peace. NOD and WAVING of HANDS are the methods acceptable in giving the sign of peace.
6. Use the middle aisle to receive Holy Communion. Stay on the floor markings to keep social distancing. Use the le or right aisle to return to the pew.
7. Communion by hands are highly recommended and encouraged at this me.
8. Anyone who feels the need to step out of the church during mass for a moment to breath may do so and may return to the seat a er.
9. The Chapel at the le side of the church will be used as extension of the church during mass and will open for people with special condi on and to those in need of space and flexibility. The chapel has a maximum capacity of 6 people at this me. Communion will be served to all occupants by a Eucharis c minister.
10. Please maintain social distancing when leaving the church.
11. Congrega ng a er the mass inside the church is not allowed.
12. Please follow all the guidelines religiously. Thank you very much for your coopera on
and understanding.
TWENTY-SECOND SUNDAY IN ORDINARY TIME AUGUST 30, 2020
SATURDAY, AUGUST 29 ( Vigil Mass ) 4:00 pm (V) Ϯ Jean Joseph Pressage Pierre
SUNDAY, AUGUST 30 Twenty-second Sunday in Ordinary Time
8:00 am Ϯ Elizabeth Pierre 9:30 am Ϯ Be e Thornton 11:00 am (FBL) Ϯ Timothy Albert Veloso 12:30 pm (SP, FBL) Ϯ Paulina Vargas
MONDAY, AUGUST 31 12:00 pm Ϯ Peter A. Paguiligan (Death Anniversary
TUESDAY, SEPTEMBER 1 12:00 pm People of the Parish 7:00 pm (SP) Ϯ Joel Cruz
WEDNESDAY, SEPTEMBER 2 12:00 pm Ϯ Florence Kelly
THURSDAY, SEPTEMBER 3
Feast of Saint Gregory the Great 12:00 pm † George Lussa
FRIDAY, SEPTEMBER 4
12:00 pm Ϯ Ellen Carandang
SATURDAY, SEPTEMBER 5 9:00 am Ϯ Fr. Vincent Capodanno 4:00 pm (V) Ϯ Mary Pileggi
SUNDAY, SEPTEMBER 6 8:00 am Ϯ Sophie & Anthony Hudzik
9:30 am Ϯ Be e Thornton 11:00 am (FBL) Ϯ Elvin Francisco Fernandez 12:30 pm (SP, FBL) Ϯ Sergio Rodriguez
Legend: (V) Vigil Mass , (SP) Spanish Mass, (F) Filipino Mass
(FBL) Facebook Livestreamed Mass @ the parish Facebook account Divine Mercy Parish, Rahway NJ
MASS INTENTIONS ONLINE
The offering of mass inten ons for 2021 is now open. Mass inten on requests are now accessible through our
webpage. Mass offerings and available dates for mass inten ons are now visible at h ps://
divinemercyrahway.church/mass-inten ons . Credit cards and bank transfers are now accepted as mode of payments for all offering of mass inten ons made using our website. Anyone who has problems using the internet and not com-fortable with online payments can s ll visit the parish office
for mass inten ons from 9am to 3pm, Monday to Friday.
FOLLOWING THE DIRECTIVES OF THE ARCHDIOCESE OF NEWARK (PHASE 3)
Started June 21, 2020 The Church will be reopened for SUNDAY Masses. Includes everything that reopened and all direc ves on Phase 2 and Phase 1 Only 50% capacity of the Church or 70 people only are allowed inside the Church excess will be turned away.
STRICT OBSERVANCE OF THE CARDINAL’S DIRECTIVE
BELOW FOR REOPENING IS WITHOUT EXCEPTION 1. Dispensa on from the obliga on to a end Mass on Sun-
days and Holy Days will remain in effect. No one will be required to a end Mass when public celebra ons resume.
2. A endance will be limited to 20% for Phase 2 & 50% for Phase 3.
3. Social distancing should be strictly observed while inside the church (6 apart from each other).
4. NO MASK NO ENTRY. Mask should be worn inside the church at all mes
5. Parishioners should take their temperature before coming to Mass. Anyone with any symptoms of sickness must stay home.
6. Liturgical changes will be in placed.
PARISH RELIGIOUS EDUCATION PROGRAM SY 2020 - 2021
CCD To register for CCD, please visit h ps://www.divinemercyrahway.church/ccd & select “Program Infor-ma on.” To register in person, please visit the CCD office on Sundays from 12-12:30 PM, or the Rectory Monday to Friday from (9am to 3pm). For any inquiries please email [email protected]. Please be advised that star ng August 1, 2020 a $10 late fee will be added to the registra on fee. Classes will start on Sept. 13, 2020. RCIA Inquiry sessions are ongoing for RCIA (English and Spanish). Rite of Chris an Ini a on for Adults (age 18 & old-er) is the process by which adults are fully ini ated into the Catholic faith community. For Adults who would like to grow in their faith and would like to receive the sacraments in 2021, please visit h ps://www.divinemercyrahway.church/rcia and select RCIA informa on and registra on. August 31, 2020 is the last day of registra on. Non-Catholics interested in joining the Catholic faith are very much welcome and are advised to enroll in the RCIA program. Please email Suzie A enza our Director of Religious Educa on at [email protected] for any ques on and for referrals to the program. Missale es are now for sale for personal use at $5. Please
inquire at the parish office if interested.
TWENTY-SECOND SUNDAY IN ORDINARY TIME AUGUST 30, 2020
FROM THE PASTOR’S DESK
Dearest Parishioners,
I am very happy to inform all of you that we will start the addi on of new restrooms for our church. The es mated cost of the project is around $25,000. As of August 25, 2020 the total dona on is $11,280. Please help us pray and raise funds for the success of this project.
DONORS Ilda Monterroso - $500 Grupo de Oracion - $1,000 Spanish Group - $1,000 Dinner Dance - $3,595 Susan Barrone - $20 Genevieve Norante - $500 Juana Sandoval - $20 Mil Ave Marias - $1,000 Barbara Rusk - $75 Maria Fine - $100 Ϯ Irene McElroy - 150 Eleanor Orpilla - $50 Edward Montoya - $20 Irma Lopez - 200 Dorothy Yuhas - $100 Mercedes Gamboa - $300 Maria Wilms - $200 Julio Biel - $1000 Anonymous 1 - $450 Anonymo dela Comunidad Espana - $1,000
Thank you very much for your generosity and con n-ued support. May God bless you all. Yours in Christ, Rev. Alexander T. Cruz
Bap sm Let’s welcome and pray for the newly Bap zed of
our parish community Ma as Francis Acosta Valadez.
Please remember to include our parish in your prayers. Every-one can s ll send weekly offerings for our Parish by signing up @ Parish Giving online. It is fast, secure and easy. Thank you
and be safe everyone. God bless.
For the Recently Deceased of the Parish Dear brothers and sisters in Christ, let’s pray for the soul of Conrad Cykowski. Eternal rest grant unto him, O Lord and let perpetual light shine upon him. May
he rest in peace Amen.
THIS WEEK AT DIVINE MERCY
SATURDAY, AUGUST 29 1:00 PM Bap sm Ma as Francis Acosta Valadez
SUNDAY, AUGUST 30 12:00 PM Food Pantry (Annex)
TUESDAY, SEPTEMBER 1 7:00 PM Guadalupano (Church)
FRIDAY, SEPTEMBER 4 First Friday
11:00 AM HOLY HOUR ( Exposi on of the Blessed Sacrament) 6:30 PM ROSARY with the Knights of Columbus
All parish schedules are now posted at the Parish web Site h ps://divinemercyrahway.church Events & News.
“Pray this during communion of our LIVE streamed mass @ our Facebook account Divine Mercy Parish, Rahway NJ
Every Sunday at 11:00 am & 12:30 pm.”
Saint of the Week Saint Gregory the Great (Feast day- September 3)
TWENTY-SECOND SUNDAY IN ORDINARY TIME AUGUST 30, 2020
Jeremiah 20 : 7 - 9 Psalms 63 : 2, 3 - 4, 5 - 6, 8 - 9
Romans 12 : 1 - 2 Gospel from Ma hew 16 : 21 - 27
SUNDAY REFLECTION
Walking with Jesus Today’s Gospel goes further than just asking us to understand why the glory of Jesus our King and Lord was to be found through suffering and the shameful death of the Cross. There is a further call for us to walk the same road with Je-sus. “If anyone (not just the heroic martyr or the saint) wants to be a follower of mine, let him renounce himself and take up his cross and follow me.” Jesus is asking each one of us to dedicate our lives in totally loving and serving others even if, at times, this involves misunderstanding, ridicule, pain and even death itself. It would be altogether wrong to think that Jesus is asking us to lead miserable lives in order to be good Christians, alt-hough one gets the impression that some people interpret the passage in that way. To follow Jesus fully, we must be able to see life as he sees it, we must have that “mind of Christ”. When we have the mind of Christ then we can only see our lives in terms of loving and serving others and not in the pur-suit of purely self-centered or even family-centered ambition. When we have the mind of Christ, the whole direction of our life changes. Our whole concept of happiness changes. Jesus is calling us not to a life of sacri ice and suffering but rather to a life of total love and freedom. The person who can go to jail for his beliefs is more free and usually a lot happier than the one who is tied to the pursuit of material things, social posi-tion, pleasure and the fear of pain. “Renouncing oneself” is not a suppression of one’s personali-ty. It is rather to let go of oneself so that one can really ind oneself. This is what today’s readings are saying, namely, that Jesus is calling us to where true success and happiness are. Maybe when we walk the way of Jesus there will be people who criti-cize us, think we are stupid and even attack us. Yet those who have chosen the way of Jesus again and again con irm that their lives are full of freedom, happiness and peace. Isn’t that what we all would like to experience? The other readings for this Sunday give examples of people who had similar experiences to Jesus.
In the First Reading Jeremiah seems to regret that he was called by God to be his prophet. “You have seduced me, Lord, and I have let myself be seduced.” As a result he became an object of people’s ridicule, “everybody’s butt”. Every time he opened his mouth, he had to warn of violence and disaster coming on God’s people. In return he got nothing but insults and derision. He decided he would not speak about God. “I will not think about him, I will not speak in his name any more.” But that did not work. “There seemed to be a ire burning in my heart… The effort to restrain it wearied me, I could not stand it.” He just had to go on speaking God’s message, which was like a ire in his heart, to his people whatever the cost to himself. It is a situation like this which explains why a per-son would risk insults, suffering and even death in order to witness to Truth and Love. Many people languishing in jails today for expressing their religious and political beliefs know this feeling. We have seen how political or religious dissidents released from jail show no signs of “conversion” and continue the struggle for human dignity. It is something which those who see life in terms of material comfort and power simply cannot understand. Paul, in the Second Reading, also knew all about this. He urg-es his fellow-Christians to offer their “living bodies as a holy sacri ice, truly pleasing to God” and not to “model [themselves] on the behavior of the world around [them]”. They need a “new mind”, the way of thinking which Jesus had and which Peter certainly did not yet have in today’s Gospel.
Gospel re lection excerpt from
h ps://livingspace.sacredspace.ie/oa221g/
671 Divine Mercy Parish, Rahway, NJ John Patrick Publishing Company • www.jppc.net • 1-800-333-3166
Spin Central Laundromat519 Avenel Street, Avenel, NJ 07001 (Next to Krauszers) 732-326-9696
Earn Free Washes!!Earn Free Washes!!
Plumbing & HeatingSewer & Drain Cleaning
Fax: (732) 738-1156 Member of the Parish24 Hour EMERGENCY Service
Call Toll Free 1-866-81CRAIG 2 7 2 4 4
Craig Lehman Plumbing License Number 11122
FULLY INSURED& BONDED
N.J. LIC. NO. 4183 “A Family Tradition of Dignifi ed Service Since 1832” N.J. LIC. NO. 3786
PRE-ARRANGEMENT CENTER • CREMATION SERVICESWilliam G. Davis Jr., Manager • John W. Tluchowski, Director371 West Milton Ave. • Rahway, NJ 07065 • P: 732.388.0038
F: 732.388.7998 • www.pettitdavisfuneralhome.com
Pettit-DavisPettit-DavisFuneral HomeFuneral Home
Est. 1832Est. 1832
Heating & Air Conditioning • Over 35 Years Experience
685 Saint George Ave., Woodbridge, NJ 07095 • www.AirtecServiceInc.com
We Service All Makes & ModelsFurnaces • Air Conditioning • Indoor Air Quality • Boilers
Duct Fabricating • Maintenance ContractsCommercial Leasing • Residential Financing Available
732-634-4188Daniel McKenzie
Italian Restaurant
Christenings • Bridal ShowersEngagement Parties • ShowersFuneral Repast • Anniversaries
Birthdays and Much More.732-726-3355
Fax: 732-726-9335453 Avenel St., Avenel, NJ 07001 • www.dominics-italian.com
What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering their vehicle to make sure it is the car they
are supposed to enter.
In Rememberance of Samantha Josephson
#WHATSMYNAME
Mallory’s Army FoundationUnited Together In The Fight Against Bullying...
Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com
(973) 440-8657 • [email protected] It’s easy to join our mailing list! Just send
your email address by text message: Text MALLORYSARMY to 22828 to get started.
Message and data rates may apply.
Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Work-ers - Critical Manufacturing - Chemi-cal & Hazardous Materials Financial Service - Private & Public Healthcare - Law Enforcement, Public Safety - Of-fi cers & First Responders - Food & Agriculture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & G W k C i i l M
To all those essential workers keeping us safe,
yourservice is
invaluable & appreciated.
& Public Healthcarent Public Safety O
oy &
MaM nrdrdrdrdrdrddddouddrd
eeefefefensl FacilShelte
ene Prod& Publi
ment, PubliResponder
Energy Secwaste - Trans- Public Work
Communicationhnology Worker
overnment Workufacturing - ChemM t i l Fi i
yournicationnicationWorkerWorke
service isovernment Workovernment Workacturing Chemacturing Chem
nvaluable &Materials FinanciaMaterials Financia& Public Healthcar& Public Healthcar
ent, Public Safety - OSafety - OervLaw EnEEE fo
dustrial Baes Workerservices & cts & Seealthcarafety -Food r - W
orta- II
CC
acturing - C
First Responders -y Se
Waterwaste - Transpcs - Public Works
Communicationechnology Work
Wo
To all thosenforcement, Public Sanforcement, Public Sa
essentiallture - Energylture - EnergyWater aste TraWater aste Tra
workerscs - Public Wors - Public WorCommunicatioCommunicatio
keepingechnology Wochnology Woovernment Wovernment W
us safe,acturing Caterials Finaaterials Fina
ficererereafety --- OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOf cercercercercecece- Food & d & d & d &d &d &d &d &d &d d d d d d AgAgAAAAgAgAgAgrAgrAgrAgAgAgrAg
ector - WaWaWaWaWaWaWaWaWaWaWaWaWaWaWastestestestestesteteestestestestestestest &sportatatatttttttttion ionion ionioionion ioniononion onion & L& L& L& L& L& L& L& Lo& L& L& L& L& & giss & - Infrnfrnfrnfrnfrnfrnfnfnfnfnfrnfrnfrnfrnfrastructuucucucucucucuc r
ons & IIIIIIIIIIIIIIInfornfornfornfornfornfornfornfornfornfornfornfornfornfornformatimammmmmmammmmmm orkers - ComComComComComComComComComComComComComComCommunimumumummmmmmm ty
Workers -s -s -s -s -s -s -s -s -s -s --- CriCriCriririririiiiriiticacaticacacaticaticaticaticaticaticaticaticaticatical Ml Ml Ml Ml Ml Ml Ml Ml Ml Ml Ml l Ml MChemical &&&&&&&&&&&l &l & l & l & HazaHazaHazaHazaHazaHazaHazaHazaHazaHazaHHHH rrrrrrrrrncial Services - DDDDDDDDDeeeeeeeee
ase - Commercialrssrssssss - RResidesidesidesidesidesidesidesididesidesidesidesideentientientientientientientientientiential &aaaaaaaa
& FFFFFFFFFFFFFFFaciaciacilacilacilacilacilacilacilcilaciacilacilacilacilitieitieitieitieitieitietieitietieitieies -s -s - - - - - HyHyHygiHyHyHyHyHyHyHyHyHH enervices es esesesesesesesesessss - Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Priiiiivivivivivivivaivaivativ e
are - Lawawawawawawawawawaw EnfEnfEnfnfnfnffnfnffffffforcorcorcorcorcorcorcorcorcorcorcorceorc m- Officercercercercerererercercers &&&s &s &s &s &s &s &s &s &s &s &s &s & FiFiFiFFirsFFFFFFFFF t R
d & Agrgrgrgrrrrriculiculiculiculiculiculiculiculiculiculicuiculiculicic turturturturturturureturturturturturtutut - Waste e eee ee & Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& ttttterwtttettt
ation &&&&& & && & &&&&&& LogiLogiLogiLogiLogiogiogiogiLogiLogLogLogiLogLogLog stististststststisticststststsss s - Infrastrtrrrrrrrrrrrrrrucucucucucuctctctuucucucucuctucuc re -e e e ee e Co
Informatioatioatioiooooooioooooonnn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn TechCoCoCoCoCoCoCoCoCoCoCoCoCoCoCommunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunity ity ity ity ity ity ity ity ity ity ity ity ityityity & Go&&&&&&&&&&&s - CrCrCrCrCrCrCrCrCrCrCrCrCrCrCriticiticiticticiticiticticiticiticticiiticiticiticitical al Mal Mal Mal Mal Mal Mal Mal a anufl l ll & Ha& Ha& H& H& H& H& H& H& H& H&&&&& zardzardzardzardzardzardardardardardardardzardardardooooooous ooooooo
ervrvrvvvvice ice ice ice ice iceicicice icicicicicic - P- Pr- Pr- P- P- P- P- - - P- - - - ivativaivivvvvvvv e Enforcforcforcffforcforcforcforcforcforcforceeme
e SaSa
gWe,
Canan
inus us e &e
methan
k yo
u
g gyWatateatttatatatattaaaaaa rwaswaswawaswaswawwwaswaswwwwwasswasawaw ste -tettttttttttteee Transportation & Log
cccscccccc - PPPPPPPPPPPPPPubliubliubliubliublililublibbliububuubuuubu c c WoWoc WoWWWoWoWoWWoWWWoWc oc WoWWc Woc WWc WWWWccc rks rksrrksrkskrkrkkkkkrr & - & -& -&& -&& -&&&& -&& -&&&&& -&&&& -&& InfrInfInfrnfrInfInfrnfrIInffI ffInI fnfI fInfnfInnnfn astructuCCoCoCoCoCoCoCCoCCoCCCoooCCCCCCCC mmunmmunmmmmmmunmmm nmmmm nmmmmm nmmmm nnm nm nmmmm nicatcaticaticatcatcatcatcattcatcatcatcattcatcatcatcatccacatcccacc ionsionsionsonsionononsonsiooionssonsonsonsiononoooon & I&&& I&& I&&& I& II& I& I& I&& nfornfornfornfornfornforforfornfornforforfnfnfornfornfornfornforfofornfornforrrfornnfforrmatimatimatmatmatiamatimatmattimatiatitimatiattatmatmatimattattmattmmmatim
echhhhhhhhhnolonononoonnoloonolonnoln lonolonoooloonnnn onolonoln oonoo ggy Wgggg orkers - Community
Wedding InvitationsWedding Invitations Holiday CardsHoliday Cards
Log ontoLog onto www.JPPC.netwww.JPPC.net conveniently from your home or office.conveniently from your home or office.
ONLINE CATALOG - ONLINE ORDERING - ONLINE PROOFINGONLINE CATALOG - ONLINE ORDERING - ONLINE PROOFING
All Major Credit Cards Accepted All Major Credit Cards Accepted FREE UPS GROUND SHIPPINGFREE UPS GROUND SHIPPING!
Local, trusted, proven, effective, supportive, referrals, relationships, affordable, repetitious, versatile, lasting.
This describes the power of...
Placing an ad in the parish bulletin supports the parish while building your business - THAT’S A WIN WIN!
Call 1.800.333.3166 TODAY!