at SciVerse ScienceDirect

Food Microbiology 36 (2013) 103e111

Contents lists available

Food Microbiology

journal homepage: www.elsevier .com/locate/ fm

Diversity of thermophilic bacteria in raw, pasteurized andselectively-cultured milk, as assessed by culturing, PCR-DGGEand pyrosequencing

Susana Delgado a, Caio T.C.C. Rachid b, Elena Fernández a, Tomasz Rychlik a, Ángel Alegría a,Raquel S. Peixoto b, Baltasar Mayo a,*

aDepartamento de Microbiología y Bioquímica, Instituto de Productos Lácteos de Asturias (IPLA-CSIC), Paseo Río Linares s/n, 33300 Villaviciosa,Asturias, Spainb Instituto de Microbiologia, Departamento de Microbiologia Geral, Universidade Federal do Rio de Janeiro, Avenida Carlos Chagas Filho, 373, 21941904Cidade Universitária, Rio de Janeiro, RJ, Brazil

a r t i c l e i n f o

Article history:Received 5 December 2012Received in revised form18 April 2013Accepted 23 April 2013Available online 6 May 2013

Keywords:Thermophilic lactic acid bacteriaStreptococcus thermophilusLactobacillus delbrueckiiLactobacillus helveticusPCR-DGGEPyrosequencing

* Corresponding author. Tel.: þ34 985892131; fax:E-mail address: baltasar.mayo@ipla.csic.es (B. May

0740-0020/$ e see front matter � 2013 Elsevier Ltd.http://dx.doi.org/10.1016/j.fm.2013.04.015

a b s t r a c t

Thermophilic lactic acid bacteria (LAB) species, such as Streptococcus thermophilus, Lactobacillus del-brueckii and Lactobacillus helveticus, enjoy worldwide economic importance as dairy starters. To assessthe diversity of thermophilic bacteria in milk, milk samples were enriched in thermophilic organismsthrough a stepwise procedure which included pasteurization of milk at 63 �C for 30 min (PM samples)and pasteurization followed by incubation at 42 �C for 24 h (IPM samples). The microbial composition ofthese samples was analyzed by culture-dependent (at 42 �C) and culture-independent (PCR-DGGE andpyrosequencing of 16S rRNA gene amplicons) microbial techniques. The results were then compared tothose obtained for their corresponding starting raw milk counterparts (RM samples). Twenty differentspecies were scored by culturing among 352 isolates purified from the counting plates and identified bymolecular methods. Mesophilic LAB species (Lactococcus lactis, Lactococcus garvieae) were dominant (87%of the isolates) among the RM samples. However, S. thermophilus and Lb. delbrueckii were found to be thedominant recoverable organisms in both PM and IPM samples. The DGGE profiles of RM and PM sampleswere found to be very similar; the most prominent bands belonging to Lactococcus, Leuconostoc andStreptococcus species. In contrast, just three DGGE bands were obtained for IPM samples, two of whichwere assigned to S. thermophilus. The pyrosequencing results scored 95 operational taxonomic units(OTUs) at 3% sequence divergence in an RM sample, while only 13 were encountered in two IPM samples.This technique identified Leuconostoc citreum as the dominant microorganism in the RM sample, whileS. thermophilus constituted more than 98% of the reads in the IPM samples. The procedure followed inthis study allowed to estimate the bacterial diversity in milk and afford a suitable strategy for theisolation of new thermophilic LAB strains, among which adequate starters might be selected.

� 2013 Elsevier Ltd. All rights reserved.

1. Introduction

Strains of the moderately thermophilic species Streptococcusthermophilus, Lactobacillus delbrueckii and Lactobacillus helveticusare among the most important lactic acid bacteria (LAB) for thedairy industry (Parente and Cogan, 2004; Mills et al., 2010). Care-fully selected strains are used worldwide as starters and adjunctcultures to either control the fermentation or to provide aroma andtaste compounds to the dairy products (Helinck et al., 2004; Smitet al., 2005). These species belong to the group of thermoduric(pasteurization-surviving) and aciduric (able to live and multiply in

þ34 985892233.o).

All rights reserved.

acidic environments) bacteria, which are dominant in natural fer-mentations subjected to a heating (cooking) step (from 55 to 85 �C)either before (such as in yoghurt) or during manufacture (such as insome ItalianandSwiss cheeses) (Hébert et al., 2000;Mora et al., 2002;Mauriello et al., 2003; Callanan et al., 2005; Ercolini et al., 2012). Innatural, starter-free dairy fermentations, thermophilic LABmaycomefrom the raw materials (including milk) or the manufacturing envi-ronment,which become enriched through the process. Themicrobialtypingof suchproductshas allowed the identificationandselectionofstrains with new properties that can complement or replacecurrently-in-use thermophilic starters (Hébert et al., 2000; Moraet al., 2002; Rossetti et al., 2008). The search for new starters isparticularly important with respect to S. thermophilus, because thestrains of this species form a relatively coherent and homogenous

S. Delgado et al. / Food Microbiology 36 (2013) 103e111104

group showing low level genetic and phenotypic polymorphisms(Rasmussen et al., 2008; Delorme et al., 2010).

Thermophilic bacteria from raw milk are assumed to be presentin traditional cheeses not subjected to heating, although they mayonly appear as minority populations. Such products are not usuallyscreened for thermophilic organisms (Cogan et al., 1997); even so,culture-independent techniques have repeatedly detected DNA ofthermophilic species (Ogier et al., 2004; Flórez and Mayo, 2006;Alegría et al., 2009, 2011; Edalatian et al., 2012). The environment oftraditional cheeses might in fact be a natural source of novelthermophilic LAB strains or strains with improved properties(Wouters et al., 2002; Jensen et al., 2009).

Culturing methods have proven unreliable for the completecharacterization of microbial ecosystems, including those of fer-mented foods (Giraffa and Neviani, 2001; Jany and Barbier, 2008).Culture-independent PCR-based techniques, such as denaturinggradient gel electrophoresis (DGGE) (Cocolin et al., 2004; Ercoliniet al., 2004; Ogier et al., 2004; Giannino et al., 2009), temporaltemperature gradient gel electrophoresis (TTGE) (Ogier et al., 2002),single stranded conformation polymorphism (SSCP) analysis, andthe construction and analysis of libraries of conserved genes such asthe 16S rRNA gene (Duthoit et al., 2003; Delbès et al., 2007; Rasolofoet al., 2010), have therefore been used. Indeed, they have been usedto study the microbial diversity and population dynamics of milkand other dairy ecosystems (for a recent comprehensive review seeQuigley et al., (2011)). Pyrosequencing, an automated high-throughput parallel sequencing technique, is also becoming popu-lar for the study of dairy products (Dobson et al., 2011; Alegría et al.,2012; Leite et al., 2012; Masoud et al., 2012; Ercolini et al., 2012;Quigley et al., 2012). It allows for the rapid and accurate analysis ofthousands of nucleotide sequences, which can then be used toanalyze the population structure, gene content and metabolic po-tential of the microbial communities in dairy ecosystems. Pyrose-quencing has shown to provide a more complete inventory of theconstituents of the microbial populations, detecting not only allknown cultivable species but also a great number of previouslyunnoticed microorganisms (Dobson et al., 2011; Alegría et al., 2012;Leite et al., 2012; Masoud et al., 2012; Quigley et al., 2012).

In this work a stepwise procedure was devised in order to es-timate the thermophilic bacterial diversity present in cheese milksamples. Raw milk, and their derived pasteurized milk (63 �C,30 min) and pasteurized and incubated at 42 �C for 24 h milksamples were consecutively analyzed by culturing and culture-independent techniques. Culturing permitted the recovering ofthermophilic LAB strains that, after a proper characterization, couldbe used as components of (new) thermophilic starters. DGGE andpyrosequencing approaches allowed us to get deeper insights intothe thermoduric and aciduric bacterial diversity spread in milk.

2. Material and methods

2.1. Sampling and treatment of milk

Twenty two milk samples were collected from bulk tanks indairy farms in Northern Spain from February to July 2010, andtransported to the laboratory under refrigerated conditions. Thesesamples were left as either RM or subjected to pasteurization at63 �C for 30 min (PM samples); PM samples were then subjected toincubation at 42 �C for 24 h (IPM samples). Culturing analysis of RMand PM samples were done within 3e4 h after sampling.

2.2. Analysis of milk by culturing

Aliquots of RM, PM and IPM samples were serially diluted inMaximum Recovering Diluent (Scharlab, Barcelona, Spain) and

plated on Plate Count Agar with 1% skimmed milk (PCAM; Merck,Darmstadt, Germany) and Brain Heart Infusion agar (BHI; Oxoid,Basingstoke Hampshire, UK). Both agar media were supplementedwith 0.5% lactose and glucose each. To determine total mesophiliccounts, plates containing dilutions of RM samples were incubatedat 30 �C for 48 h. To select for thermophilic bacteria, dilutions of PMand IPM samples were plated and incubated at 42 �C for 24 h.

2.3. Identification of bacteria

Three hundred and fifty two colonies, representative of allmorphologies and sizes from the counting plates, were picked atrandom and purified twice in the same isolation medium. A singlecolony was then inoculated in the corresponding liquid mediumand incubated for 24 h at either 30 or 42 �C. These cultures werecentrifuged and the pellet suspended in fresh medium containing15% glycerol. These isolates were then frozen at �80 �C until use.

Isolates were identified by partial amplification of their 16SrRNA genes, sequencing and comparing the sequences with thosein databases. Cell extracts were obtained following a mechanicalprocedure in a Mini-Beadbeater apparatus (BioSpec Products, Inc.,Bartlesville, OK, USA). For this, a single colony was suspended in100 ml sterile water and mixed with 50 mg of sterile glass beads(SigmaeAldrich, Saint Louis, MO, USA). Cell extracts (between 2and 4 ml) were then used as a source of template DNA for PCRamplification. Amplifications were performed using the universalprimers 27F (50-AGAGTTTGATCMTGGCTCAG-30) and 1492R (50-GGTTACCTTGTTACGACTT-30) (Lane, 1991). PCR was performed in50 ml reaction volumes using a Taq-DNA polymerase master mix(Ampliqon, Skovlunde, Denmark) and 0.2 mM of each primer. ThePCR conditions were as follows: 95 �C for 5 min, 35 cycles of 94 �Cfor 30 s, 50 �C for 45 s, 72 �C for 2 min, and a final extension step at72 �C for 5 min. The amplicons were then purified through GenE-lute PCR Clean-Up column (SigmaeAldrich) and sequenced. Se-quences were then compared to those in the GenBank (http://www.ncbi.nlm.nih.gov/BLAST/) and Ribosomal Database Project(RDP) (http://rdp.cme.msu.edu/index.jsp) databases using onlinetools. Isolates were allocated to different genera and species basedon percentages of sequence identity higher than 95 and 97%,respectively (Stackebrandt et al., 2002). For close relative species,manual inspection of sequences at key variable positions was alsorequired.

2.4. Isolation of total microbial DNA from milk

Total microbial DNA from the RM, PM and IPMmilk samples wasisolated using the QIAamp DNA stool kit (Qiagen, GmbH, Hilden,Germany) following the optimized protocol reported by Martínet al. (2007) with an additional bacterial enzymatic lysis step.This modification consisted of prior treatment of the cells with30 mg/ml of lysozyme and 20 units of mutanolysin (both fromSigmaeAldrich) at 37 �C for 60 min.

2.5. PCR-DGGE analysis of milk samples

PCR-DGGE analysis was used to assess the composition anddynamics of the dominant bacterial populations in the RM, PM andIPM milk samples.

2.5.1. PCR amplification of 16S sequencesTotal DNA from 10 samples each of RM, PM and IPM was sub-

jected to PCR-DGGE analysis. The V3 region of the bacterial 16SrRNA gene was amplified with the F357-GC (50eCGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGG-GGGTACGGGAGGCAGCAGe30 and R518 (50eATTACCGCGGCTGCTGGe30) primers, as

S. Delgado et al. / Food Microbiology 36 (2013) 103e111 105

reported by Muyzer et al. (1993). PCR was performed in 50 ml re-action volumes using Taq-DNA polymerase with w100 ng of eachmilk DNA sample as a template and 0.2 mM of each primer. PCRconditions were as follows: 95 �C for 2 min, 35 cycles of 95 �C for30 s, 56 �C for 40 s, 72 �C for 1 min, and a final extension step at72 �C for 5 min.

2.5.2. Electrophoresis and identification of bandsDGGE was performed using a DCode apparatus (Bio-Rad, Rich-

mond, CA, USA) at 60 �C, employing 8% polyacrylamide gels with adenaturing range of 40e60%. Electrophoresis was performed at75 V for 16 h. Bands were visualized under UV light after stainingwith ethidium bromide (0.5 mg ml�1), and photographed.

Representative bands were also excised from the acrylamidegels and their DNA eluted overnight in 50 ml of sterile water at 4 �C.The DNA was then re-amplified using the same primer pair butwithout the GC-clamp. Purified amplicons were sequenced by cycleextension in an ABI 373 DNA sequencer (Applied Biosystems, FosterCity, CA, USA). Bands were assigned to species based on sequencesimilarity as above.

2.6. Pyrosequencing analysis of milk samples

The amplicons obtained from 16S rRNA genes of three milksamples (one RM and two IPM samples) were subjected to pyro-sequencing. The RM sample was analyzed to assess the overallbacterial diversity of the milk and the relative abundance of ther-mophilic species, while the IPM samples were analyzed for deter-mining the diversity of thermoduric and aciduric bacteria afterpasteurization and fermentation.

2.6.1. Primers and 16S rRNA gene amplification conditionsThe universal primers Y1 (50eTGGCTCAGGACGAACGCTGGCG

GCe30) (position 20e43 on the 16S rRNA gene of Escherichia coli)and Y2 (50eCCTACTGCTGCCTCCCGTAGGAGTe30) (positions 361e338) (Young et al., 1991), were used to amplify a 348 bp stretch ofDNA embracing the V1 and V2 hyper-variable regions of the pro-karyotic 16S rRNA gene. Both primers were enlarged at the 50 endwith a 10 bp sample-specific barcode, as well as forward (50eCGTATCGCCTCCCTCGCGCCATCAGe30) and reverse (50eCTATGCGCCTTGCCAGCCCGCTCAGe30) 454-adaptors. Amplifications wereperformed under the following PCR conditions: 95 �C for 5 min, 25cycles of 94 �C for 30 s, 52 �C for 40 s, 72 �C for 30 s, and a finalextension step at 72 �C for 10 min. The amplicons were then pu-rified through a column, and the DNA concentration and qualitymeasured in an Epoch microvolume spectrophotometer (BioTekInstruments, Winooski, VT, USA). Equal amounts of DNA from thethree samples were pooled to a total amount of 100 ng. This pooledDNAwas subsequently amplified in PCR-mixture-oil emulsions andsequenced in different lanes of a PicoTiter plate in a 454 GenomeSequencer 20 system (Roche, Basel, Switzerland).

2.6.2. Sequence identification and bioinformatic analysisThe raw sequences were processed using mothur v.1.26.0 soft-

ware (Schloss et al., 2009). The flowgrams were subjected toPyronoise software analysis (Quince et al., 2011) to reduce the errorin the retained data set. All sequences missing the forward primerand/or having a length smaller than 300 bases were removed toimprove the robustness of comparisons. The remaining high qualitysequences were then aligned using the Silva reference database,and the chimeras detected with the utilization of mothur’s algo-rithm chimera.uchime were eliminated. The resultant alignmentsfile, which contained only high quality sequences, provided inputfor the construction of the distance matrix and for clustering thesequences into operational taxonomic units (OTUs). For taxonomic

assignment, high quality partial 16S rRNA gene sequences wereclassified using RDP-II software employing an 80% confidencethreshold (Wang et al., 2007). Clusters were constructed with a 3%dissimilarity cut-off, and normalized number of sequences(selected randomly by mothur). These clusters served as OTUs forgenerating predictive rarefaction models and for determining non-parametric species richness estimators, such as abundance-basedcoverage estimators (ACE), Chao1 and Jacknife (Chao and Bunge,2002), and Shannon diversity index (Shannon and Weaver, 1949).The mothur software was used to select representative sequencesof each OTU. In an attempt to assign the OTUs at the species level,representative reads of the more abundant OTUs were comparedagainst those in the RDP database using the Seqmatch option.Representative sequences and their nearest neighbors in the RDPdatabase were also aligned using MEGA 5.0 software (Tamura et al.,2011). Aligned sequences were used for the construction of aphylogenetic tree by the Kimura 2-parameter model using theneighbor-joining method. The equivalent sequence of the ArchaeaPyrolobus fumarii (X99555) was used as an outgroup. Finally,manual sequence comparisons against both the RDP and GenBankdatabases were also performed.

2.6.3. Nucleotide sequence accession numbersThe pyrosequencing data generated were deposited in the NCBI

Sequence Read Archive (SRA) and are available under accessionnumbers SRS349940, SRR521141, SRR521142 and SRR521143.

3. Results

3.1. Culturing analysis of milk samples

Dilutions of all RM, PM and IPM samples were plated on non-selective PCAM and BHI rich media for the recovery of total culti-vable bacteria. After incubation at 30 �C for 48 h, the microbialcounts for the 22 RM samples ranged from 2.38 � 104 to6.82 � 105 cfu/ml. In most cases, the counts on PCAM were slightlyhigher than those on BHI, though the difference never reached alogarithmic unit. Counts for 20 of the 22 RM samples were withinthe range permitted in Spain for cheese made from raw milk(<1.0 � 105 cfu/ml; RD 1728/2007). Counts of PM samples at 42 �Cwere between two and three log units lower (average3.19 � 102 cfu/ml) as those of RM samples incubated at 30 �C.Counts for the IPM samples surpassed 1.0 � 109 cfu/ml in all cases.Incubation resulted in a coagulation of good appearance and a mildlactic flavor in all but two samples. The pH of the IPM samplesranged from 4.25 to 4.86, except for the same odd two samples(6.35e6.68). These had a strong rotten smell and were not furtheranalyzed by culturing.

Colonies from the counting plates of the remaining 20 samplesof RM (n ¼ 164), PM (n ¼ 110) and IPM (n ¼ 78) were randomlyselected from the PCAM (178) and BHI (174) media, purified andstocked. Variety in colony size, morphology and color was higher inplates from RM samples, implying that more colonies werenecessary from these samples to reveal their full bacterial diversity.In total, 352 colonies were molecularly identified by partialamplification of the 16S rRNA gene, sequencing and sequencecomparison. Table 1 shows the results obtained. In terms of thenumber of species, a similar diversity was found among the RM (13species), PM (11 species) and IPM (15 species) samples, althoughthe species profiles of the two latter samples were completelydifferent to those of RM samples (Table 1). In the RM samples,nearly 90% of the isolates belonged to Lactococcus species (147isolates), while these and other mesophilic species were replacedby thermophilic organisms in the PM and IPM samples. In fact, onlytwo species, S. thermophilus and Enterococcus durans/E. faecium,

Fig. 1. DGGE profiles of the V3 variable region of the bacterial 16S rRNA gene of 10samples (A through J, in Panels A and B) of raw milk (RM), pasteurized milk at 63 �C for30 min (PM), and pasteurized milk incubated at 42 �C for 24 h (IPM). Bands with anumber on the top were identified by sequencing and sequence comparison. Results ofthe identification are summarized in Table 2.

Table 1Number of isolates and their frequency of appearance (percentage in parenthesis) ofthe different genera and species identified in milk by culturing.

Species Analyzed samplea

RM PM IPM Total

Streptococcus thermophilus 4 (2.44) 62 (56.36) 40 (51.28) 106Lactococcus lactis subsp. lactis 58 (35.36) e e 58Lactococcus lactis

subsp. cremoris57 (34.75) e e 57

Lactobacillus delbrueckiisubsp. delbrueckii

e 15 (13.63) 14 (17.94) 29

Lactococcus garvieae 28 (17.07) e e 28Enterococcus

durans/E. faecium1 (0.60) 11 (10.00) 1 (1.28) 13

Streptococcus gallolyticussubsp. macedonicus

e 3 (2.72) 9 12

Streptococus bovis/S.equinus/S. suis

e 8 (7.27) 2 (2.56) 10

Lactobacillus delbrueckiisubsp. bulgaricus

e 5 (4.54) 2 (2.56) 7

Streptococcus agalactiae 6 (3.65) e e 6Lactococcus raffinolactis 4 (2.44) e e 4Enterococcus spp. e 2 (1.81) 1 (1.28) 3Bacillus licheniformis e e 2 2Enterococcus faecalis e 1 (0.90) 1 (1.28) 2Acinetobacter spp. 1 (0.60) e e 1Bacillus circulans e 1 (0.90) e 1Bacillus spp. e e 1 (1.28) 1Brevibacterium spp. 1 (0.60) e e 1Enterobacter spp. 1 (0.60) e e 1Hafina alvei 1 (0.60) e e 1Lactobacillus delbrueckii

subsp. lactise e 1 (1.28) 1

Lactobacillus helveticus e e 1 (1.28) 1Leuconostoc

pseudomesenteroides1 (0.60) e e 1

Lysinibacillus fusiformis e e 1 (1.28) 1Paenibacillus

lautus/P. ginsengagrie 1 (0.90) e 1

Streptococcus salivarius 1 (0.60) e 1Streptococcus sanguinis e e 1 (1.28) 1Streptococcus spp. e e 1 (1.28) 1Virgibacillus proomii e 1 (0.90) e 1Total 164 (100) 110 (100) 78 (100) 352Number of species detected 13 11 15 29

e, not recovered.a RM, raw milk; PM, pasteurized milk (63 �C for 30 min); IPM, pasteurized milk

incubated at 42 �C for 24 h.

S. Delgado et al. / Food Microbiology 36 (2013) 103e111106

were encountered in all three types of samples. In all occasions inwhich these species were identified in the RM sample, they weresubsequently recovered from the corresponding PM and IPMsamples. A majority of the species surviving the pasteurization step(PM)were also recovered after incubation at 42 �C (IPM). Only a fewspecies were exclusively identified in the IPM samples; thesebelonged mainly to the genera Bacillus, Lactobacillus, and Strepto-coccus, suggesting they survived pasteurization and grew in milk atthe (high) incubation temperature (42 �C). S. thermophilus wasfound as the sole thermophilic bacterium in five IPM samples, fourdifferent thermophilic species were identified in six IPM samples,and five and seven distinct species in one sample each. There istherefore a wide variation in thermophilic bacteria at the specieslevel in all the analyzed milk samples.

3.2. PCR-DGGE analysis of bacterial communities

To obtain an overview of the community structure of thedominant bacteria by a culture-independent technique, a PCR-DGGE analysis of the bacterial 16S rRNA gene was conducted on10 RM (A through J) and their derived PM and IPM samples usinguniversal primers. As shown in Fig. 1, the RM and PM samples

produced 6e10 bands, while the IPM samples produced only 3e4.The band patterns of the RM and PM samples were almost identical,although bands from latter samples seemed to be less intense.These patterns were completely different to those displayed by IPMsamples.

In total, 52 bands were identified by reamplification, sequencingand sequence comparison (bands with a number on top in Fig. 1).Table 2 summarizes the results of band identification. Most bandswere identified at the species level (15 different species wererecognized). Seven bands could only be identified at the genuslevel. One band (band 16) could not be identified (its DNA did notreamplify). Prominent bands in RM and PM samples were presentin most samples of these types and belonged to Lactococcus gar-vieae (band 2), Weissiella confusa/W. cibaria (band 3), Lactococcusraffinolactis (band 5), Streptococcus ssp. viridians group (band 7), Lc.lactis (band 8), and S. thermophilus (band 9). Note the migration tothe same position of bands corresponding to Lc. garvieae andW. confusa/W. cibaria. However, apparently they were never pre-sent together in the same sample; they were always identified asbelonging to one species or the other. The DGGE profiles for the IPMsamples were clearly dominated by a thick band corresponding toS. thermophilus, except in the two IPM rotten samples mentioned

0

50

100

150

200

250

300

350

OTUs Chao1 ACE Jackknife

Diversity rich

ness (

3%

o

f d

istan

ce)

Richness estimator

D (RM)

D (IPM)

C (IPM)

Fig. 2. Estimated OTU richness and diversity index for 16S rRNA gene sequences at 3%of divergence distance of the three pyrosequenced samples: milk D (RM), milk D (IPM)and milk C (IPM).

Table 2Identification of DGGE bands from RM, PM and IPM milk samples.

Band no. Numberof bandssequenced

% Nucleotideidentitya

Closest cultivable relative

1 2 95.3e96 Streptococcus spp.(S. infantarius/S. gallolyticus)

2 4 99e100 Lactococcus garvieae3 2 98e99 Weissella confusa/W. cibaria4 4 98.6e99 Leuconostoc citreum5 4 99e100 Lactococcus raffinolactis6 1 100 Lactobacillus brevis7 4 95.8e96.3 Streptococcus spp. (viridians group)8 6 99e100 Lactococcus lactis9 8 99e100 Streptococcus thermophilus10 2 96.3e96.7 Lactobacillus spp.11 1 99 Streptococcus salivarius12 1 99 Pseudomonas putida13 1 100 Pseudomonas fragi14 1 99 Pseudomonas fluorescens15 1 95.8 Macrococcus spp.16 2 eb e

17 1 100 Lactococcus plantarum18 1 100 Streptococcus infantarius19 2 96.4e96.6 Bacillus spp.20 1 95.3 Brevibacillus spp.21 1 99 Brevibacillus brevis22 1 99 Clostridium perfringens23 1 100 Clostridium mesophilum

a Percentage or range of nucleotide identity of sequences from the DGGE bandsand their closest cultivable relative in GenBank. Sequence differences in bandsbearing the same number are thought to be due to sequencing errors.

b DNA from bands at this position did not reamplify.

0

20

40

60

80

100

120

140

160

180

200

0 500 1000 1500 2000

Nu

mb

er o

f O

TU

s (3%

o

f d

istan

ce)

Number of sequences

D (RM)

D (IPM)

C (IPM)

Fig. 3. Rarefaction curves of the dataset reads of the bacterial 16S rRNA gene se-quences from the samples milk D (RM), milk D (IPM) and milk C (IPM).

S. Delgado et al. / Food Microbiology 36 (2013) 103e111 107

above [F (IPM) and G (IPM) in Fig. 1], which were dominated byBrevibacillus brevis and Clostridium perfringens, respectively.

3.3. Bacterial composition determined by pyrosequencing

To obtain a more complete inventory of the bacterial species inour samples, DNA from samples C (IPM), D (RM) and D (IPM) inFig. 1, was subjected to pyrosequencing of 16S rRNA gene ampli-cons. PM samples were not utilized, because as it happens with theDGGE profiles, similar results to those obtained for the RM sampleswere expected. A total of 42,951 raw reads were obtained, 3794reads for sample D (RM), 20,417 for sample D (IPM), and 18,740 forsample C (IPM). Of these, a total of 23,057 corresponded to high-quality partial 16S rRNA gene sequences longer than 300 bp, with2056 reads belonging to sample D (RM), 10,432 to D (IPM), and10,569 to C (IPM). In spite of this, all analyses (with the exception ofthe relative abundance of the different OTUs) were performed witha normalized number of sequences. Fig. 2 shows the number ofOTUs and the Chao1, ACE and Jacknife diversity richness indices forthe three samples. The bacterial diversity of the RM is clearly muchhigher than that of the IPM. Similar results were obtained whencalculating the Shannon index at 97% similarity, with values of 1.95,0.13 and 0.07 for samples D (RM), D (IPM) and C (IPM) respectively.In agreement, the rarefaction curves for the RM and IPM sampleswere rather dissimilar (Fig. 3). The rarefaction curves of thenormalized sequences showed that the sequence coverage wasvery good for all libraries. They also showed the diversity in sampleD (RM) to be greater than that of samples C (IPM) and D (IPM).

Sequences were assigned to five different phyla using the RDPclassifier: Firmicutes (22,763), Proteobacteria (261), Deinococcus-Thermus (12), Bacteroidetes (9) and Actinobacteria (8). However,reads belonging to the latter two phyla were never encounteredamong the two IPM samples. Firmicuteswere the most abundant inall three sample types. Moreover, the percentage of the sequencesfor this phylum rose from 87% in the RM sample to 99.8% in the two

IPM samples. Members of the class Bacilli (22,678 reads) weredominant among the Firmicutes. Fig. 4 shows the relative abun-dance of reads belonging to the class Bacilli at the genus level.Mesophilic LAB (Leuconostoc, Lactococcus) were present in the RMsample, but these were entirely replaced by Streptococcus (ther-mophilus) in both IPM samples. Reads belonging to Proteobacteria(of the classes Gamma-, Alpha-, and Beta-Proteobacteria) weremostly found in sample D (RM), although a few were also retrievedfrom the IPM samples.

Among the normalized 6168 high quality reads, 98 OTUs wereobtained at the 97% sequence similarity level (95 in the RM sampleand 13 in the two IPM samples), of which 53 were found to consistof a single read (singletons). In an attempt to identify the reads atthe species level, representative sequences of the most abundantOTUs were manually compared against those in the RDP andGenBank databases (Table 3). Sequences from several LAB speciesaccounted for 80 and 99.5% of the reads from the RM and IPMsamples, respectively. Mesophilic LAB species formed the majorityin the RM sample (Leuc. citreum, Lc. lactis, Lactobacillus plantarum),but, as in the culturing analysis, they were completely replaced byreads of S. thermophilus in the IPM samples. Gram-positive OTUswere a majority, but a number of sequences associated to the RMsample belonging to Gram-negatives (Vibrio spp., Citrobacter spp.)were also noted.

0%

10%

20%

30%

40%

50%

60%

70%

80%

90%

100%

D (RM) D (IPM) C (IPM)

Re

la

tiv

e a

bu

nd

an

ce

Sample

Streptococcus

Leuconostoc

Lactococcus

Bacillus

Geobacillus

Lactobacillus

Weissella

Tetragenococcus

Other

Fig. 4. The relative abundance at the genus level of the reads belonging to phylumFirmicutes, class Bacilli of the three analyzed milk samples using the RDP-Classifier.

S. Delgado et al. / Food Microbiology 36 (2013) 103e111108

4. Discussion

In the present work, milk samples were obtained from an area(Northern Spain) in which procedures for the selection of ther-mophilic microorganisms is not traditionally practiced. Therefore,the thermophilic species detected represent those normallydwelling in milk -they have never been enriched by technological(artificial evolutionary) pressure. The number and types of ther-moduric/aciduric bacteria detected were compared with thosepresent in raw milk.

From a bacteriological point of view, most milk samples wereconsidered to be within legal limits. The large number of isolates ofdifferent LAB species (particularly Lc. lactis) indicates that the milkexamined is appropriate for cheese making, even for the manu-facture of raw milk cheeses without added starters. Mastitis-

Table 3Identification of representative OTUs at the species level and comparison of the results o

OTU code No. of reads % of reads from samplea C

D (RM) D (IPM) C (IPM)

OTU1 4053 0.2 98.0 99.0 StOTU2 1292 61.2 1.0 0.6 LeOTU3 97 4.4 0.3 >0.1 LaOTU4 87 4.1 <0.1 0.1 VOTU5 77 3.7 nd nd LaOTU6 70 3.3 <0.1 >0.1 StOTU7 56 2.7 nd >0.1 LaOTU8 55 2.6 <0.1 nd LaOTU9 41 1.9 <0.1 nd COTU10 40 1.8 0.1 >0.1 LaOTU11 37 1.8 nd >0.1 WOTU12 26 1.3 nd nd AOTU13 21 1.0 <0.1 nd GOTU14 20 1.0 nd nd AOTU15 15 0.7 nd nd LaOTU16 15 0.7 nd nd MOTU17 15 0.7 nd nd MOTU18 9 0.4 nd nd StOTU19 8 0.4 nd nd ThOTU20 8 0.4 nd nd ROTU21 6 0.3 nd nd TeOTU22 5 0.2 nd nd AOTU23 5 0.2 nd nd StOTU24 5 nd 0.2 nd BaOTU25 4 0.2 nd nd StOTU26 4 0.2 nd nd BrOthers (72) 102 4.6 0.2 nd e

a RM, raw milk; PM, pasteurized milk (63 �C for 30 min); IPM, pasteurized milk incubb nd, non detected.

causing organisms and potential human pathogens, such as Strep-tococcus agalactieae and Brucella ssp., were only detected as mi-nority components in RM samples. As expected, they were killed bythe pasteurization process, as were all mesophilic LAB speciesexcept for some Enterococcus and Streptococcus species. The greaterthermotolerance shown by Enterococcus compared to Lactococcushas been used as a differential phenotypic property to distinguishbetween species of these two genera (Devriese et al., 1995). Thesame bacterial genera and species were recovered when culturingthe PM and IPM samples. This strongly suggests that all speciessurviving pasteurization (thermoduric) can grow in milk at 42 �Cand resist the low pH (aciduric) associated with such incubation.Therefore, these two selective methods are appropriate for therecovery of the most technologically-important thermophilic LABfrom milk. BHI agar plates were firstly utilized as a non-selective,rich medium, in an attempt to recover previously undetectedthermophilic bacteria from milk. However, counts in this mediumwere usually lower than those in PCAM, but a skew in the speciesrecovered from the two media was never observed.

S. thermophilus isolates were a majority from either the PM andIPM samples, followed by Lb. delbrueckii and Streptococcus mace-donicus (this last species has recently been reclassified as Strepto-coccus gallolyticus subsp. macedonicus; see Schlegel et al., (2003)).Though at different percentages, all these microorganisms areusually recovered from both whey starters and the correspondingcooked cheeses (Pacini et al., 2006; Rossetti et al., 2008). Incontrast, Lb. helveticus, one of the more aciduric LAB (Slattery et al.,2010), is usually found in larger numbers as those detected in thiswork. As for the mesophilic LAB species (Delgado and Mayo, 2004;Alegría et al., 2009), wide phenotypic and genetic diversity hasbeen reported among the thermophilic isolates (data not shown),indicative that adequate thermophilic starter candidates might beidentified. It was surprising to find that, in terms of the number ofspecies, the diversity was not reduced in the PM and IPM samples

btained in the same samples by pyrosequencing, DGGE and culturing.

losest cultivable species Detection by

DGGE Culturing

reptococcus thermophilus D (RM), D (IPM), C (IPM) D (IPM), C (IPM)uconostoc citreum D (RM) ndb

ctococcus plantarum nd ndibrio spp. nd ndctococcus plantarum nd ndreptococcus ssp. D (RM) D (RM), C (IPM)ctococcus raffinolactis D (RM) D (RM)ctococcus lactis D (RM) D (RM)itrobacter ssp. nd ndctococcus lactis nd D (RM)eissella confusa D (RM) ndcinetobacter johnsonii nd ndeobacillus toebii nd ndcinetobacter calcoaceticus nd ndctobacillus delbrueckii D (IPM), C (IPM) C (IPM)ethylobacterium ssp. nd ndethylobacterium populi nd ndreptococcus equinus nd D (IPM)ermus ssp. nd ndalstonia pickettii nd ndtragenococcus halophilus nd ndcinetobacter ssp. nd ndreptococcus ssp. nd D (RM)cillus subtilis nd ndreptococcus gallolyticus nd D (IPM)ucella ssp. nd nd

e e

ated at 42 �C for 24 h.

S. Delgado et al. / Food Microbiology 36 (2013) 103e111 109

as compared to the RM samples. In fact, although the number ofcolonies identified in the IPM samples was smaller (78 as comparedto 174 for PM and 110 for RM), the number of species detected washigher (n ¼ 15).

Pioneering use of the DGGE technique with traditional cheesesshowed that, at least some cheese systems were home to dominantand metabolically active microorganisms that had never beenrecovered by culturing (Ercolini et al., 2001; Randazzo et al., 2002).Furthermore, our group has detected DGGE bands assigned tocultivable thermophilic LAB species in cheeses in which these werenot expected and had never been reported, such as those traditionalmade from raw milk without added starters (Flórez and Mayo,2006; Alegría et al., 2009) and those made from pasteurized milkinoculated with mesophilic starters (Alegría et al., 2011). The DGGEprofiles of the present RM and PM samples were found to beidentical or very similar. Thus, even thoughmostmesophilic speciesdie during pasteurization (as shown by the preceding culturingresults), they still contribute to the DNA pool that is subsequentlyamplified and resolved by PCR-DGGE. Co-migration and double-banding are further well recognized limiting factors of the DGGEtechnique (vonWintzingerode et al., 1997; Becker et al., 2000), as isthe formation of uncharacterized artifacts (which hampers theidentification of specific bands). In the present work, bands for Lc.garvieae and W. confusa/W. cibaria both migrated to the same po-sition in the gels. Twenty two different species were identified byDGGE among the 52 bands sequenced. The intensity of an individualband is thought to be a semi-quantitativemeasure of the abundanceof its sequence in the population (Muyzer et al., 1993). In general,presence and abundance of a species is supported by both culturingand DGGE results. With respect to the RM samples, the predomi-nant species determined by these two techniques were the same:Lc. garvieae, Lc. raffinolactis, Lc. lactis, and Streptococcus ssp. How-ever, in the IPM samples, less diversity was found with the DGGEtechnique thanwith conventional culturing. Moreover, of the threebands observed in these samples, two (the upper and lower bands)belonged to a single species: S. thermophilus. The remaining band(band 10) -thought to belong to Lb. delbrueckii- could not be un-equivocally identified. The sequence of this band showed somenucleotide uncertainty, probably due to DNA contamination fromthe upper S. thermophilus band.

The bacterial diversity revealed by pyrosequencing was muchgreater than that established by culturing or PCR-DGGE. Pyrose-quencing is a very powerful tool that can be used to examine thestructure and dynamics of microbial populations in different eco-systems. It has already been used to examine kefir grains andbeverages (Dobson et al., 2011; Leite et al., 2012) as well as thepopulations of traditional (Alegría et al., 2012; Ercolini et al., 2012;Quigley et al., 2012) and industrial cheeses during manufacture(Masoud et al., 2012). In the present work, only one RM and twoIPM samples were subjected to pyrosequencing. Analysis of therarefaction curves obtained suggests that the bacterial communitywas well represented in all three samples. The technique identifiedLeuc. citreum as the dominant microorganism in sample D (RM),followed by Lc. lactis, Lc. raffinolactis, and S. thermophilus. Except forLeuc. citreum, all these species returned intense bands in DGGE andwere recovered by culturing. The most intense band associatedwith sample D (RM) belonged to W. confusa/cibaria. Weissella spe-cies were included until recently among the phylogenetically-related genus Leuconostoc (Collins et al., 1993). Differences in theidentifications made by DGGE and pyrosequencing may be due tothe shortness (180 bp) of the DGGE sequences and the differentpositions within the 16S rRNA gene returned by the two tech-niques. In fact, bacterial identification at the species level bycomparing partial 16S rRNA gene sequences is thought to betentative (Stackebrandt et al., 2002; Palys et al., 1997). Thus,

diversity indices and species richness should be given their dueimportance in terms of the number of OTUs scored by the software.Moreover, sequence differences in OTUs assigned to the samespecies (Table 3) are probably due to the arbitrary cut-off used(0.03%), although pyrosequencing errors may also contribute tothese assignments (Sundquist et al., 2007). Higher specificity ofDNA amplification and more accurate database identification(Sundquist et al., 2007; Petrosino et al., 2009) will help to describethe bacterial diversity of natural ecosystems. However, for certaingroups of related bacteria analysis of other gene sequences wouldbe necessary to unequivocally assess their identification andquantification (Stackebrandt and Ebers, 2006).

Among other minority species, Geobacillus toebii and Methyl-obacterium populi (Table 3), which may result from environmentalcontamination, have never been reported in dairy foods. Indeed,the large number of Vibrio spp. sequences, of which three wereretrieved from the IPM samples is noteworthy, yet it remains un-explained. The technological significance of the high bacterial di-versity present in milk is unclear, as is that of the sample-specificvariations. However, it might well be related to the consubstantialbatch to batch variation of fermented dairy products.

5. Conclusions

Culturing and two culture-independent methods were used toanalyze the thermophilic bacterial diversity present in milk from ageographical area in which thermophiles are not technologicallyselected. The dominant populations were investigated by culturingand PCR-DGGE, while pyrosequencing of 16S rRNA gene ampliconswas used to obtain an inventory of all bacterial types. In general, theresults obtained by all three techniques used in this work agreewell. They all identified mesophilic LAB as dominant in the RMsamples and thermophilic LAB (especially S. thermophilus) asdominant among the PM and IPM samples. Although this, differ-ences between culturing and culture-independent results werealso found, as it has been repeatedly reported elsewhere (Ercoliniet al., 2001; Randazzo et al., 2002; Duthoit et al., 2003; Flórezand Mayo, 2006; Delbés et al., 2007; Alegría et al., 2009, 2012).Discrepancies may be the result of difference in lysis efficiencyduring DNA isolation, preferential PCR amplification (whichmay bedifferent for different primer pairs), or interspecies differences in16S rRNA operon copy number. As seen in this work and others(Edalatian et al., 2012), detection of non-cultivatable and dead cellsby DNA-based techniques may account for further differences.

The results clearly indicate the usefulness of a multi-step com-bination of culture-dependent and culture-independent methods.Identification of uncultured, new microorganisms by culture-independent techniques would allow the design of culturing stra-tegies for their specific recovering. The recovery of thermophilicLAB species from not yet characterized milk-derived ecosystemswould ultimately allow the selection of new strains or strains withnovel properties for their use as dairy starters. The biochemical,genetic and technological properties of the isolates ofS. thermophilus, Lb. delbrueckii, and Lb. helveticus identified in thiswork is currently in progress.

Acknowledgments

The study was supported by projects from INIA (RM2011-00005-00-00) and the Spanish Ministry of Economy and Compet-itiveness (AGL2011-24300-ALI). E. Fernández and A. Alegría wereawarded a scholarship of the FPI program fromMICINN (BES-2008-002031) and the Severo Ochoa program from FICYT (BP08-053),respectively. S. Delgadowas supported by a research contract underJuan de la Cierva Program (JCI-2008-02391).

S. Delgado et al. / Food Microbiology 36 (2013) 103e111110

References

Alegría, A., Álvarez-Martín, P., Sacristán, N., Fernández, E., Delgado, S., Mayo, B.,2009. Diversity and evolution of majority microbial populations duringmanufacturing and ripening of Casín, a Spanish traditional, starter-free cheesemade of raw cow’s milk. International Journal of Food Microbiology 136, 44e51.

Alegría, A., González, R., Díaz, M., Mayo, B., 2011. Assessment of microbial pop-ulations dynamics in a blue cheese by culturing and denaturing gradient gelelectrophoresis (DGGE). Current Microbiology 63, 888e893.

Alegría, A., Szczesny, P., Mayo, B., Bardowski, J., Kowalczyk, M., 2012. Biodiversity inOscypek, a traditional Polish cheese, determined by culture-dependent and -in-dependent approaches. Applied and Environmental Microbiology 78, 1890e1898.

Becker, S., Böger, P., Oehlmann, R., Ernst, A., 2000. PCR bias in ecological analysis: acase study for quantitative Taq nuclease assays in analysis of microbial com-munities. Applied and Environmental Microbiology 66, 4945e4953.

Callanan, M.J., Beresford, T.P., Ross, R.P., 2005. Genetic diversity in the lactose op-erons of Lactobacillus helveticus strains and its relationship to the role of thesestrains as commercial starter cultures. Applied and Environmental Microbi-ology 71, 1655e1658.

Chao, A., Bunge, J., 2002. Estimating the number of species in a stochastic abun-dance model. Biometrics 58, 531e539.

Cocolin, L., Innocente, N., Biasutti, M., Comi, G., 2004. The late blowing in cheese: anewmolecular approach based on PCR and DGGE to study the microbial ecologyof the alteration process. International Journal of Food Microbiology 90, 83e91.

Cogan, T.M., Barbosa, M., Beuvier, E., Bianchi-Salvadori, S., Cocconcelli, P.S.,Fernandes, I., Gómez, J., Gómez, R., Kalantzopoulos, G., Lledda, A., Medina, M.,Rea, M.C., Rodríguez, E., 1997. Characterization of the LAB in artisanal dairyproducts. Journal of Dairy Research 64, 409e421.

Collins, M.D., Samelis, J., Metaxopoulos, J., Wallbanks, S., 1993. Taxonomic studies onsome leuconostoc-like organisms from fermented sausages: description of anew genus Weissella for the Leuconostoc paramesenteroides group of species.Journal of Applied Bacteriology 75, 595e603.

Delbès, C., Ali-Mandjee, L., Montel, M.C., 2007. Monitoring bacterial communities inraw milk and cheese by culture-dependent and -independent 16S rRNA gene-based analysis. Applied and Environmental Microbiology 73, 1882e1891.

Delgado, S., Mayo, B., 2004. Phenotypic and genetic diversity of Lactococcus lactisand Enterococcus ssp. strains isolated from Northern Spain starter-free farm-house cheeses. International Journal of Food Microbiology 90, 309e319.

Delorme, C., Bartholini, C., Bolotin, A., Ehrlich, S.D., Renault, P., 2010. Emergence of acell wall protease in the Streptococcus thermophilus population. Applied andEnvironmental Microbiology 76, 451e460.

Devriese, L.A., Pot, B., van Damme, L., Kersters, K., Haesebrouck, F., 1995. Identifi-cation of Enterococcus species isolated from foods of animal origin. Interna-tional Journal of Food Microbiology 26, 187e197.

Dobson, A., O’sullivan, O., Cotter, P.D., Ross, P., Hill, C., 2011. High-throughputsequence-based analysis of the bacterial composition of kefir and an associatedkefir grain. FEMS Microbiology Letters 320, 56e62.

Duthoit, F., Godon, J.J., Montel, M.C., 2003. Bacterial community dynamics duringproduction of registered designation of origin Salers cheese as evaluated by 16SrRNA gene single-strand conformation polymorphism analysis. Applied andEnvironmental Microbiology 69, 3840e3848.

Edalatian, M.R., Habibi, M.B., Mortazavi, S.A., Alegría, A., Nassiri, M.R., Bassam, M.R.,Mayo, B., 2012. Microbial diversity of the traditional Iranian cheeses Lighvanand Koozeh, as revealed by polyphasic culturing and culture-independent ap-proaches. Dairy Science and Technology 92, 75e90.

Ercolini, D., Moschetti, G., Blaiotta, G., Coppola, S., 2001. The potential of a poly-phasic PCR-DGGE approach in evaluating microbial diversity of natural wheycultures for water-buffalo Mozzarella cheese production: bias of culture-dependent and culture-independent analyzes. Systematic and Applied Micro-biology 24, 610e617.

Ercolini, D., Mauriello, G., Blaiotta, G., Moschetti, G., Coppola, S., 2004. PCR-DGGEfingerprinting of microbial succession during a manufacture of traditionalwater buffalo mozzarella cheese. Journal of Applied Microbiology 96, 263e270.

Ercolini, D., De Filippis, F., La Storia, A., Iacono, M., 2012. “Remake” by high-throughput sequencing of the microbiota involved in the production of waterbuffalo Mozzarella cheese. Applied and Environmental Microbiology 78, 8142e8145.

Flórez, A.B., Mayo, B., 2006. Microbial diversity and succession during the manufac-ture and ripening of traditional, Spanish, blue-veined Cabrales cheese, as deter-mined by PCR-DGGE. International Journal of Food Microbiology 110, 165e171.

Giannino, M.L., Marzotto, M., Dellaglio, F., Feligini, M., 2009. Study of microbial di-versity in rawmilk and fresh curd used for Fontina cheese production by culture-independentmethods. International Journal of FoodMicrobiology 130,188e195.

Giraffa, G., Neviani, E., 2001. DNA-based, culture-independent strategies for eval-uating microbial communities in food-associated ecosystems. InternationalJournal of Food Microbiology 67, 19e34.

Hébert, E.M., Raya, R.R., Tailliez, P., de Giori, G.S., 2000. Characterization of naturalisolates of Lactobacillus strains to be used as starter cultures in dairy fermen-tation. International Journal of Food Microbiology 59, 19e27.

Helinck, S., Le Bars, D., Moreau, D., Yvon, M., 2004. Ability of thermophilic LAB toproduce aroma compounds from amino acids. Applied and EnvironmentalMicrobiology 70, 3855e3861.

Jany, J.L., Barbier, G., 2008. Culture-independent methods for identifying microbialcommunities in cheese. Food Microbiology 25, 839e848.

Jensen, M.P., Ardö, Y., Vogensen, F.K., 2009. Isolation of cultivable thermophilic LABfrom cheeses made with mesophilic starter and molecular comparison withdairy-related Lactobacillus helveticus strains. Letters in Applied Microbiology 49,396e402.

Lane, D.J., 1991. 16S/23S rRNA sequencing. In: Goodfellow, M. (Ed.), Nucleic AcidTechniques in Bacterial Systematics. John Wiley and Sons Ltd., Chichester,pp. 115e176.

Leite, A.M., Mayo, B., Rachid, C.T., Peixoto, R.S., Silva, J.T., Paschoalin, V.M.,Delgado, S., 2012. Assessment of the microbial diversity of Brazilian kefir grainsby PCR-DGGE and pyrosequencing analysis. Food Microbiology 31, 215e221.

Martín, R., Heilig, H.G., Zoetendal, E.G., Jiménez, E., Fernández, L., Smidt, H.,Rodríguez, J.M., 2007. Cultivation-independent assessment of the bacterial di-versityofbreastmilk amonghealthywomen.Research inMicrobiology158, 31e37.

Masoud, W., Vogensen, F.K., Lillevang, S., Al-Soud, W.A., Sørensen, S.J., Jakobsen, M.,2012. The fate of indigenous microbiota, starter cultures, Escherichia coli, Listeriainnocua and Staphylococcus aureus in Danish raw milk and cheeses determinedby pyrosequencing and quantitative real-time (qRT)-PCR. International Journalof Food Microbiology 153, 192e202.

Mauriello, G., Moio, L., Genovese, A., Ercolini, D., 2003. Relationships betweenflavoring capabilities, bacterial composition, and geographical origin of naturalwhey cultures used for traditional water-buffalo mozzarella cheese manufac-ture. Journal of Dairy Science 86, 486e497.

Mills, S., O’Sullivan, O., Hill, C., Fitzgerald, G.F., Ross, R.P., 2010. The changing face ofdairy starter cultures research. From genomics to economics. InternationalJournal of Dairy Technology 63, 149e170.

Mora, D., Fortina, M.G., Parini, C., Ricci, G., Gatti, M., Giraffa, G., Manachini, P.L., 2002.Geneticdiversityand technologicalpropertiesofStreptococcus thermophilus strainsisolated from dairy products. Journal of Applied Microbiology 93, 278e287.

Muyzer, G., De Waal, E.C., Uitterlinden, A.G., 1993. Profiling of complex microbialpopulations by denaturing gradient gel electrophoresis analysis of polymerasechain reaction-amplified genes coding for 16S rRNA. Applied and Environ-mental Microbiology 59, 695e700.

Ogier, J.C., Son, O., Gruss, A., Tailliez, P., Delacroix-Buchet, A., 2002. Identification ofthe bacterial microflora in dairy products by temporal temperature gradientelectrophoresis. Applied and Environmental Microbiology 68, 3691e3701.

Ogier, J.C., Lafarge, V., Girard, V., Rault, A., Maladen, V., Gruss, A., Leveau, J.Y.,Delacroix-Buchet, A., 2004. Molecular fingerprinting of dairy microbial eco-systems by use of temporal temperature and denaturing gradient gel electro-phoresis. Applied and Environmental Microbiology 70, 5628e5643.

Pacini, F., Cariolato, D., Andrighetto, C., Lombardi, A., 2006. Occurrence of Strepto-coccus macedonicus in Italian cheeses. FEMS Microbiology Letters 261, 69e73.

Palys, T., Nakamura, L.K., Cohan, F.M., 1997. Discovery and classification of ecologicaldiversity in the bacterial world: the role of DNA sequence data. InternationalJournal of Systematic Bacteriology 47, 1145e1156.

Parente,E., Cogan,T.M.,2004.Startercultures:generalaspects. In:Fox,P.O. (Ed.),Cheese:Chemistry, Physics and Microbiology, third ed. Elsevier, Oxford, pp. 123e147.

Petrosino, J.F., Highlander, S., Luna, R.A., Gibbs, R.A., Versalovic, J., 2009.Metagenomicpyrosequencing and microbial identification. Clinical Chemistry 55, 856e866.

Quigley, L., O’Sullivan, O., Beresford, T.P., Ross, R.P., Fitzgerald, G.F., Cotter, P.D., 2011.Molecular approaches to analyzing the microbial composition of raw milk andraw milk cheeses. International Journal of Food Microbiology 150, 81e94.

Quigley, L., O’Sullivan, O., Beresford, T.P., Ross, R.P., Fitzgerald, G.F., Cotter, P.D., 2012.High-throughput sequencing for detection of subpopulations of bacteria notpreviously associated with artisanal cheeses. Applied and EnvironmentalMicrobiology 78, 5717e5723.

Quince, C., Lanzen, A., Davenport, R.J., Turnbaugh, P.J., 2011. Removing noise frompyrosequenced amplicons. BMC Bioinformatics 12, 38.

Randazzo, C.L., Torriani, S., Akkermans, A.L.D., de Vos, W.M., Vaughan, E.E., 2002.Diversity, dynamics, and activity of bacterial communities during production ofan artisanal Sicilian cheese as evaluated by 16S rRNA analysis. Applied andEnvironmental Microbiology 68, 1882e1892.

Rasmussen, T.B., Danielsen, M., Valina, O., Garrigues, C., Johansen, E., Pedersen, M.B.,2008. Streptococcus thermophilus core genome: comparative genome hybridiza-tion study of 47 strains. Applied and EnvironmentalMicrobiology 74, 4703e4710.

Rasolofo, E.A., St-Gelais, D., LaPointe, G., Roy, D., 2010. Molecular analysis of bac-terial population structure and dynamics during cold storage of untreated andtreated milk. International Journal of Food Microbiology 138, 108e118.

Rossetti, L., Fornassi, M.E., Gatti, M., Lazzi, C., Neviani, E., Giraffa, G., 2008. GranaPadano cheese whey starters: microbial composition and strain distribution.International Journal of Food Microbiology 127, 168e171.

Schlegel, L., Grimont, F., Ageron, E., Grimont, P.A., Bouvet, A., 2003. Reappraisal ofthe taxonomy of the Streptococcus bovis/Streptococcus equinus complex andrelated species: description of Streptococcus gallolyticus subsp. gallolyticussubsp. nov., S. gallolyticus subsp. macedonicus subsp. nov. and S. gallolyticussubsp. pasteurianus subsp. nov. International Journal of Systematics andEvolutionary Microbiology 53, 631e645.

Schloss, P.D., Westcott, S.L., Ryabin, T., Hall, J.R., Hartmann, M., Hollister, E.B.,Lesniewski, R.A., Oakley, B.B., Parks, D.H., Robinson, C.J., Sahl, J.W., Stres, B.,Thallinger, G.G., van Horn, D.J., Weber, C.F., 2009. Introducing mothur: opensource, platform-independent, community-supported software for describingand comparing microbial communities. Applied and Environmental Microbi-ology 75, 7537e7541.

Shannon, C.E., Weaver, W., 1949. The Mathematical Theory of Information. Uni-versity of Illinois Press, Urbana, IL, USA.

S. Delgado et al. / Food Microbiology 36 (2013) 103e111 111

Slattery, L., O’Callaghan, J., Fitzgerald, G.F., Beresford, T., Ross, R.P., 2010. Lactobacillushelveticus. A thermophilic dairy starter related to gut bacteria. Journal of DairyResearch 93, 4435e4454.

Smit, G., Smit, B.A., Engels, W.J.M., 2005. Flavour formation by LAB and biochemicalflavour profiling of cheese products. FEMS Microbiology Reviews 29, 591e610.

Stackebrandt, E., Frederiksen, W., Garrity, G.M., Grimont, P.A., Kämpfer, P.,Maiden, M.C., Nesme, X., Rosselló-Mora, R., Swings, J., Trüper, H.G., Vauterin, L.,Ward, A.C., Whitman, W.B., 2002. Report of the ad hoc committee for the re-evaluation of the species definition in bacteriology. International Journal ofSystematic and Evolutionary Microbiology 52, 1043e1047.

Stackebrandt, E., Ebers, J., 2006. Taxonomic parameters revisited: tarnished goldstandards. Microbiology Today 33, 152e155.

Sundquist, A., Bigdeli, S., Jalili, R., Druzin, M.L., Waller, S., Pullen, K.M., El-Sayed, Y.Y.,Taslimi, M.M., Batzoglou, S., Ronaghi, M., 2007. Bacterial flora typing with deep,targeted, chip-based pyrosequencing. BMC Microbiology 7, 108.

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5:molecular evolutionary genetics analysis using maximum likelihood, evolu-tionary distance, and maximum parsimony methods. Molecular Biology andEvolution 28, 2731e2739.

von Wintzingerode, F., Göbel, U.B., Stackebrandt, E., 1997. Determination of micro-bial diversity in environmental samples: pitfalls of PCR-based rRNA analysis.FEMS Microbiology Reviews 21, 213e229.

Wang, Q., Garrity, G.M., Tiedje, J.M., Cole, J.R., 2007. Naïve Bayesian classifier forrapid assignment of rRNA sequences into the new bacterial taxonomy. Appliedand Environmental Microbiology 73, 5261e5267.

Wouters, J.T.M., Ayad, E.H.E., Hugenholtz, J., Smit, G., 2002. Microbes from raw milkfor fermented dairy products. International Dairy Journal 12, 91e109.

Young, J.P.W., Downer, H.L., Eardly, B.D., 1991. Phylogeny of the phototrophicRhizobium strain BTAil by polymerase chain reaction-based sequencing of a 16SrRNA gene segment. Journal of Bacteriology 173, 2271e2277.