Dissection of the Drosophila pourquoi-pas? promoter: Complex ovarian expression is driven by...

Mechanisms of Development 47 (1994) 241-251

Dissection of the Drosophila pourquoi-pas? promoter: Complex ovarian expression is driven by distinct follicle cell- and germ

line-specific enhancers

L a u r e n t S6galat, Gui l l emet te Berger, J e a n - A n t o i n e Lepesan t*

Institut Jacques Monod. CNRS et Universit~ Paris 7. 2. place Jussieu. 75251 Paris Cedex 05. France

Received I October 1993; revision received 18 April 1994; accepted 2 May 1994

Almraet

The pourquoi-pas? (pqp) gene of Drosophila melanogaster encodes a zinc finger protein present in the oocyte nucleus, the nurse cells and, at a lower level, in the follicle ceUs. Null mutations of the pqp gene lead to female sterility. We have undertaken a functional dissection of the pqp promoter by following the expression of the lacZ reporter gene in the ovaries of transgeni¢ flies, pqp sequences, necessary for expression of the lacZ gene in a pattern similar to that of the endogenous pqp gene, are located between positions -210 and +30, relative to the transcription start site. These sequences, subdivided in follicle cell- and germ line-specific regions, appear to function in a direction-independent and distance-sensitive manner. The -210/-40 region, sharing stretches of sequence similarity with 5' sequences of follicle cell-specific genes, promotes lacZ expression only in the follicle cells. The -80/+30 region is germ line-specific. The promoter limits, deduc~ from the deletion experiments presented here, are in accordance with the molecular analysis of pqp mutants.

Keywords: Drosophila; Oogenesis; Promoter

1. Introduction

Drosophila oogenesis has been studied in detail because of its influence on embryogenesis. It also con- stitutes a good model for the study of determination and differentiation. Oogenesis has been subdivided in 14 stages, from the germarium to the mature egg, that were described in detail by Mahowald and Kambysellis (1980). The basic functional unit of oogenesis, the egg chamber, is composed of two types of cells; the germ ceils, derived from the embryonic pole cells and con- sisting of 15 nurse cells and the oocyte and, surrounding these, the somatically-derived follicle cells (King, 1970; Mahowald and Kambysellis, 1980). However, beyond this apparent histological simplicity, gene transcription in the ovary is under complex regulation. The analysis of scores of enhancer-trap lines has revealed that gene activity in the ovary can follow dozens of different

* Corresponding author, Tel.: 331 44276950; Fax: 331 44275265.

spatio-temporal patterns (Fasano and Kerridge, 1988; G-rossnildaus et al., 1989), thus suggesting the existence of numerous ovarian-specific enhancers. Few of them have been characterized molecularly. Their identification is of interest, not only for the comprehension of gene regulation, but also because they could serve as useful tools for genetic analysis. Follicle cell-specific enhancers have been identified in the promoter of the vitelline membrane protein genes, the chorion protein genes and the yolk protein genes (Tolias and Kafatos, 1990; Logan and Wensink, 1990; Gargiulo et al., 1991; Jin and Petri, 1993). All three classes of genes are expressed only in the second half of oogenesis. Early stage- follicle cell enhancers are not known. Germ line-specific enhancers have been identified in 5' regions of the heat shock protein hap26 gene (Frank et al., 1992) and, with a lower definition, in the ovarian tumor (otu) gene (Comer et al., 1992).

The pourquoi-pas? (pqp) gene of Drosophila melanogaster was cloned as a member of the zinc finger protein

0925-4773/94/$07.00 © 1994 Elsevier Science Ireland Ltd. All rights reserved SSDI 0925-4773(94)00264-N

242 L. S~galat et al./Mech. Dev. 47 (1994) 241-251

family (Vincent et al., 1988). It encodes a 868 amino- acid zinc finger protein with distinctive features of transcription factors (Vincent et al., 1988). In the ovary, the pqp protein can be detected with anti-pqp antibodies in the nucleus of the nurse cells from stages 1-6 and 9-11, in the nucleus of the oocyte from stages 7-11 and, at a lower level, in the nucleus of the follicle cells from stages 1-13 (Srgalat et al., 1992). The functional importance of the pqp protein is revealed by the strict maternal-effect embryonic lethality affecting pqp mutants (Srgalat et al., 1992). We were interested in determining whether such a broad expression within the ovary was driven by a single multi-specific promoter or by separable cell type- specific enhancers. For that purpose, we have undertaken a functional dissection of the pqp promoter region by using the lacZ gene as a reporter gene in transgenic flies. We report here that DNA sequences necessary for correct pqp expression are contained in a 240-bp fragment composed of distinct follicle cell- and germ line- specific enhancers.

2. Results

2.1. Sequence similarity between the 5' sequences of pqp and o f follicle cell-specific genes

The pourquoi-pas? gene belongs to the TATAA box- less class of genes. Its transcription start site has been defined by SI nuclease protection assay and by the sequence of cDNAs (Vincent et al., 1988). Comparison of pqp 5' sequences with sequences of follicle cell-specific genes revealed several regions of similarity. Most significant regions are located between position -330 and -70 (relative to the transcription start site) as shown on Fig. 1. Three regions of pqp resemble 5' regions of the VMP32E gene (Gargiulo et al., 1991), two resemble regions in the first exon of the VM3C gene (Burke et al., 1987) and one resembles a 5' region of the YP3 yolk protein gene (Garabedian et al., 1987). These regions do not encompass the CF1/USP binding site present in vitelline membrane protein and chorion protein genes (Khoury Christianson et al., 1992; Gargiulo et al., 1991).

- 3 2 9 pqp -3or

ACCATAAATAATTCTTAATGAAA ....... e e * e , e e e e , e e o , e , o . e e e e o e

TAAGTAATACTTAA

. 328 v m p 3 2 E .315

-189 pqp . 1 7 0

.... TGTAAATGGAATTGGTAAGT

GGAATTGG

+386 vmp3C +393

-169 pqp .124

AAAATGTTTCCTTGTCGGACGAGATTTCTTTTTGAGTCAAGAAATC : : : : " : : : . : : . . . . . . . . . . . . .

• e o , , e o , e . , e •

ATGTTTCCCTG GCCGAGTTTTGTTATTAA

+399 vmp3C+4o7 .60 vmp32E -43

-123 pqp 4 2

TC TTTAAATGTTATTTAGAATGGTGAATCCAGTCGTGAATTAAATATAGCTA :::::::::" ::::: ::::: ::::

ATTAAATGTTA GTGAAATAAATCCGGCTA

-376 vmp32E-366 -288 YP3 -271

Fig. 1. Sequence comparison between pqp 5 ' re~ons and follicle ceil-specific genes. Positions are given relative to the transcription start site. Se- quences are taken from Vincent et al. (1988; pqp), Gargiulo et al. (1991; VMP32E), Burke et al. (1987; VMP3C) and Garabedian et al. (1987; YP3).

L. Sdgalat et al. / Mech. Dev. 47 (1994) 241-251 243

Comparison of pap sequences with those of genes expressed in the germ-line gave no significant results. Sur- prisingly, the 5' region of pap contains no detectable resemblance with either the hsp26 or the otu gene regulatory regions. Moreover, sequences defined by DNAse protection assays and mutation analysis as key motifs of the hsp26 ovarian regulatory element were not detected in pqp.

2.2. pap-lacZ translation fusions In the following, all positions are given with reference

to the transcription start site as defined in Vincent et al. (1988). Several DNA constructs encoding a chimeric ixlp-~-galactosidase have been made to localize pap regulatory regions (Fig. 2). As these regions were previously unknown, we first introduced a very large fragment of the gene in the construction. For cloning reasons, a Sall- XhoI 4.8-kb (-3000/+1816) fragment was selected and cloned in the pSDL1 vector (Payre et al., 1989) leading to the AX construct. Flies carrying one copy of the AX transgene display high ~-galactosidase expression in both germ line and follicle cell types. The pattern observed (Fig.

A pap

S R Sp X R X

-3~00 +1 +3100

B

-3000

P q P

+lS00

lac Z

f . c . n . c . - o

A X ; ' : " ~

-450 +lB00

C X - ' : ; 444-

-40O +1800

D X : : : ++

-210 +lSOO

H X ,. ; ; 4.4.

4 0 +IS00

JX +/-(1) ++(2)

LX

+I0 +1800

Fig. 2. Schematic diagram ofpqp-lacZ translational fusions (A) Diagram of the pap locus redrawn from Vincent et al. (1988). Bold line indicates the 6.3-kb (-3000/+3300) fragment able to rescue pap phenotypes in a transgenic assay. Positions are given relative to the transcription start site. Boxed areas indicate pap exons. Stippled boxes correspond to the ORF. Dark stippled area indicates the zinc finger coding region. S: San, R: EcoRI, Sp: Spel, X: XhoI. (B) Diagram of pqp-lacZ translational fusions and summary of the expression patterns. Various pap fragments were fused in frame with the lacZ gene of E. coll. f.c.: expression in the follicle cells (columnar, squamous and border cells); n.c.-o.: expression in the nurse cell- oocyte complex. The number o f+ indicates the relative intensity of staining. (1): 3/5 lines showed no staining in the follicle cells, whereas 2/5 lines showed weak staining until stage 8. (2): Staining of the oocyte nucleus is very faint or absent.

v~

~q

L. S~galat et at/Mech. Dev. 47 (1994) 241-251 245

_Xbal ~. EcoRI

12.35 Kb hsppo d~rl-Xhol ~ L BamHI

Fig. 4. Map of the pX27 enhancer testing vector. The pX27 vector was constructed from the pCasper./~gal (Gene, 74, 448) and HZSOPL (Cell, 50, 963) vectors (see Materials and methods for details). Map is deduced from original vectors. The pX27 vector contains unique Xbal, EcoRl, XhoI and BamHI cloning sites upstream of the hsp70 basal promoter.

3a, b and c) is similar to that known for the pqp protein (S~galat et al., 1992). Expression is strong in the nurse cells from stage 1 (Fig. 3a) to stage 11, at which time nurse cells degenerate (Fig. 3c)./~-Galactosidase expression is present in the oocyte nucleus from stage 6/7 onwards. In the follicle cells, staining is observed at all stages and is uniform. After stage 8, follicle cells can be subdivided in three subtypes: the columnar follicle cells, which are densely packed over the oocyte in the posterior part of the egg chamber; the squamous cells, which are scattered above the nurse cells; and the border cells, which migrate from the anterior end of the egg chamber to the nurse cell-oocyte border at stage 9 and remain there later. All three subtypes express/~-galactosidase (Fig. 3b), although squamous and border cells staining is often masked by that of the underlying nurse cells. The only difference between the pqp protein pattern and the AX pattern is a transient absence of the pqp protein (as can be detected by an anti-pqp antibody) in the nurse cells at stages 7 and 8 which is not seen in AX. It is likely that this is due to a greater stability of the chimeric pqp-/3-galactosidase protein than of the pqp protein because of the stability of its/~-galactosidase moiety (Ashburner, 1989a). Thus, the pattern displayed by AX reveals that the -3000/+1816 fragment is sufficient for correct expression of pqp.

Therefore, the AX construct can be considered as a reference for further promoter analysis.

In order to define the left (5 ' ) border of pqp regulatory elements, we have analysed the expression of a number of other constructions differing from AX by their 5' end (Fig. 2). The expression pattern of the CX (-450/ +1816), DX (-400/+1816) and HX (-210/+1816) constructs (Fig. 3d-g) do not differ qualitatively from that of AX./3-galactosidase expression may be a little lower in the germ cells of the DX and HX lines, but this might be due to position effect only (see Material ad methods). These results indicate that all DNA sequences located upstream of position -210 are dispensable for a qualitatively correct pqp expression. The JX construct (-80/+1816) is expressed in the nurse cells, but its expression is extremely reduced or negative in the follicle cells (Fig. 3h and i). Three out of five lines analysed show no expression at all in the follicle cells (Fig. 3h), whereas the remaining two lines show a very faint expression in the follicle cells and until stage 8 only (Fig. 3i). Because of /~-galactosidase stability, it is not possible to ascertain when transcription of the transgene really stops in these two lines. The results obtained with the JX lines, compared to the HX lines, mean that key regulatory sequences for follicle cell expression are located between positions -210 and -80. It should also be noted that oocyte staining is very weak in JX compared to the AX, CX, DX and HX constructs. In the LX construct, all expression, either in the germ line cells or the follicle cells, is abolished. It implies that sequences downstream of position + 10 are not sufficient to govern pqp expression in any ovarian cell.

2.3. pqp-hsp70-lacZ fusions In order to refine the results presented above and to

unambiguously define the 3 ' limit ofpqp regulatory sequences, we have made another series of pqp-lacZ constructs. For that purpose, we constructed the pX27 vector (Fig. 4), in which the basal promoter of the hsp70 gene, the 5' untranslated transcribed region (UTR) of the hsp 70 gene and a translation initiation site are provided upstream of the ~-galactosidase coding sequence. It has been shown that, in such a combination, the hsp70 basal promoter is inactive and does not promote/~-galactosidase expression, unless an enhancer-like sequence is present in its vicinity (Hiromi and Gehring, 1987; Laval et al., 1993). The pX27 vector can serve for the same purposes

Fig. 3. Expression pattern of pqp-lacZ translational fusions flies carrying one copy of constructs presented in Fig. 2 were dissected and ovaries were incubated with Xgal to reveal/~-galactosidase expression. Since the pqp-/3-galactosidase protein is nuclear, only the nucleus of cells is stained. Stages are given according to Mahowaid (1980). (a, b and c) AX construct. Staining is observed as early as the germarium stage (a, top) and is clearly visible in the nucleus of all cell types at stage 8 (a, bottom) and 10 (b). Legend for (a): n, nurse cell; o, oocyte; f, follicle cells. Legend for (b): n, nurse cells; o, oocyte; s, squamous follicle cells; b, border cells; f, columnar follicle cells. (c) At stage 11, nurse cells are heavily stained. The oocyte nucleus is not in the focal plane. The blue area at the anterior end of the oocyte is due to/~-galactosidase diffusion during degenerescence of the heavily stained nurse cells. (d) DX construct. (e) HX construct. (f and g) CX construct. In all three cases, the pattern displayed is similar to that of AX. (h and i) JX construct. Expression is strong in the nurse cells and absent (h) or weak (i) in the follicle cells. When positive, follicle cell staining can be detected until stage 7-8 only (marked by a star in i). Staining of the oocyte nucleus is very faint in all JX lines.

246 L. S~galat et al. / Mech. Dee. 47 (1994) 241-251

A

.,~o

p a p

s . s 1 I I R I

-~oo -=~ -1o~

fc-sp, e l . . . , , . . . . . . . . . . . . . . .

Sl.-sp. el.

i l m m

| a m p

+1 +100

B m m m

-3000

-450

i i

-1000

-450

PaP h ~ 7 0 NZS h c Z ~ L 4 " . - ,, -Irf.Ge/,f.fjZ~i.dlnr/.,I'/.gflr.1.,°'.,°J

+10 A L

C l ;,., ¢. ~~ . ,O~¢ , . - , r - f a~¢-¢] l

+I0 CL

; ' , I I I l l l i l ~ l l l l t ] BO . +80

! - : :~ . - -~ . ' .V / , , ' / / . , v /Um/L~- / / / / / ,~ ~ 2 +80O

f . c . n . c . - o

+/-(1)

+ / - (1)

+4-1- 4-1"4-

+(2)

-4($0

- 4 ~

+100

I I l ~ . . . , j ~ , f _ f a 6 C ~ l . , g f ~ l i . A D P

I ~ ) l l ~ . . . . D , l i , w~, ,w=w/.¢l ,~ D N +30

i, DK u ~,b- , , lY/ / / / / / . f ,~,~/ / / / / / / / ,d l -40

+4"4- 4-t"4-

+++(3)

: : : +++(3)

++(4)

r"'"P~.'."r,r,,.~-h'H~-'/H,'/.,r,'.,J H P -H-+ +++(3) -z;o ~0

. I . . . . P H .H.+ -H.+ +60 -210

~ : : ~ . . . ~ , ' . - I z , e.f.~.,r/i.~.,ir/,,'.r,,,'/,6,'J,,,J I - IN : : : +..i.+ - 2 1 0 +30

+30 -210

Fig, 5. Schematic diagram ofpqp-hsp70-lacZ fusions made in the pX27 vector. (A) Diagram of the promoter region of the pqp gene. Open box indicates the transcribed region. +1 indicates the transcription start site. The ORF (beginning at +250) is not represented on this diagram. Square boxes in the pqp promoter indicate regions of similarity with the VMP32E gene; the rectangular box, similarity with the VMP3C gene, and the oval box, similarity with the YP3 gene. fc-sp, el., gl-sp, el.: indicate the position and maximum extent of the follicle cell-specific and germ line- specific elements deduced from this study. (B) Diagram ofpqp-hsp70-lacZ fusions and summary of the expression pattern. Various pqp fragments were cloned in the pX27 vector. In each construct, the vertical line indicates the site of fusion between pqp sequences and the hsp70-lacZ sequences of the vector. Sequences of the pX27 vector are not drawn to scale. A triangle indicates the hsp70 TATAA box, which is located from 25 to 45 bp downstream of the site of fusion, depending on the cloning site used. Stippled box indicates hsp70 5' untranslated transcribed region (5'UTR). Dashed box indicates the lacZ ORF to which a nuclear localization signal (NLS) was added to render B-galactosidase nuclear. The effective transcription start site of constructs carrying both pop and hsp70 transcription start sites was not determined (sec text), f.c.: expression in the follicle cells (columnar, squamous and border cells); n.c.-o.: expression in the nurse cell-oocyte complex. The number of + indicates the relative intensity of the staining. (1) Expression pattern varying greatly from one line to another. (2) Expression level in different cells is heterogenous, forming a patchy pattern. (3) In some lines, expression is heterogenous in nurse cells of the same egg chamber. (4) Expression appears only around stage 9 and is restricted to the squamous and columnar follicle cells.

L. Sdgalat et ai./ Mech. Dev. 47 (1994) 241-251 247

as its parent-vector HZ50PL (Hiromi and Gehring, 1987). It differs from HZ50PL in that pX27 ~-galactosidase has been rendered nuclear by addition of a nuclear localization sequence (NLS) in order to facilitate pattern analysis (see Materials and methods for details on pX27 construction). It contains unique XbaI, EcoRI, XhoI, and BamHI sites that have been used to generate the pqp- hsp70-lacZ constructs presented in Fig. 5.

To ascertain that the pX27 enhancer-testing vector was functional and behaves as intended to, we first cloned in it a known enhancer, the oel ovarian specific enhancer of the YP1/YP2 genes (Logan and Wensink, 1990). In all five lines tested, the oel/X27 construct shows a /5- galactosidase expression corresponding exactly to the one previously described for oe 1 (Logan and Wensink, 1990; Fig. 6a and b). Expression is null until stage 6, starts at the end of stage 7 (Fig. 6a) and is very strong at stages 8, 9 and 10 (Fig. 6b). It is limited to the follicle cells (columnar, squamous and border cells). This indicates that the pX27 vector is a reliable vector for promoter analysis.

Fig. 6 shows the results obtained from the analysis of the lines carrying the various constructs described in Fig. 5. The BQ (-1000/+80) construct displays a pattern similar to that of the endogenous pqp gene (Fig. 6c and d). It shows strong 0-galactosidase expression in the nurse cells, in the oocyte nucleus and in the follicle cells. It can therefore be considered as a reference for other pqp-hsp70- lacZ constructs in pX27, in the same manner as the AX construct was a reference for the first series of constructs (Fig. 2). Conversely, the CW2 (-450/+800) construct, in which pqp regulatory sequences are approximately 800 bp away from the basal hsp70 promoter, shows only a weak and patchy expression in the follicle cells (Fig. 6e and f). Since we know from the AX-LX series of constructs that seqt/ences upstream of -450 are dispensable for pqp expression, the results with CW2 may imply that the action of pqp regulatory sequences is distance-sensitive.

The DR (-400/+ 100), DP (-400/+60), DN (-400/+30) and DK (-400/-40) constructs were designed to define the 3' limit ofpqp regulatory elements. DR, DP and DN constructs display similar patterns that are not distinguishable from BQ and AX, with strong /3- galactosidase expression in the follicle cells, in the nurse cells and in the oocyte (Fig. 6g-i). These results mean that there are no sequences indispensable for pqp expression downstream of position +30. DK, however, shows /~-galactosidase expression in the follicle cells only (Fig. 6j and k). This implies that sequences necessary for expression in the germ cells and present in DN have been deleted (or are ineffective) in DK. Moreover, in all five lines analyzed, follicle cell expression begins only at stage 9. This may indicate that different early stage- and late stage-follicle cell-enhancers have been separated in the DK construct.

The HP, PH, HN, and NH constructs were designed to test whether elements governingpqp expression are able

to function in any orientation. HP and PH consist of the -210/+60 fragment cloned in pX27 in the direct or the reverse orientation, respectively. HN and NH consist of the -210/+30 fragment cloned in pX27 in the direct or the reverse orientation, respectively. All four lines show similar O-galactosidase expression, comparable to BQ and to the endogenous pqp pattern. The results for the HN and NH lines are presented in Fig. 6n and 61-m, respectively. Thus, this is an additional demonstration that all sequences necessary for correct pqp expression are located in the 240-bp fragment extending from positions -210 to +30. In addition, it proves that the regulatory elements contained in the 240-bp (-210/+30) fragment can function in any orientation.

The results concerning the AL (-3000/+10) and CL (-450/+10) constructs were surprising. For each of the eight lines analysed, there was no expression in the germ cells. All the lines expressed/~-galactosidase in subsets of follicle cells, but strikingly, no two patterns were iden- tical. For example, in one line, expression was restricted to two cells at the anterior tip of the egg chamber; in another line, border cells were stained and in another line, columnar follicle cells were stained at stages 13-14 only, etc. However, no variation was seen among flies of the same line. This strong position effect was not observed for any of the other constructs analysed. Since pqp is expressed in all follicle cell subtypes at all stages of oogenesis, it is not possible to say whether pqp sequences present in the AL and CL constructs are completely inactive and the construct behaves like a true enhancer trap (Bier et al., 1989) or if the/~-galactosidase patterns reflect the activity of a subset of position-sensitive elements of the pqp promoter.

3. Discussion

P-element transformation of flies with various reporter- gene-carrying vectors is a powerful way to identify tissue- and stage-specific regulatory elements (Hiromi and Gehr- ing, 1987; Pankratz et al., 1990; Logan and Wensink, 1990; Tolias and Kafatos, 1990). An advantage of this method is its temporal and spatial resolution. In this study, we have used such an approach to broadly define the position of the regulatory elements governing the expression of the pqp gene. The pqp gene is expressed in almost all cells of the ovary. As the molecular analysis of some pqp mutants suggested that pqp regulatory regions might be short (see below), the question arose of how its promoter was structured. Two alternative hypotheses could be made: either the pqp promoter contains only one (or few) regulatory element(s) with a large spectrum of activity, or pqp broad expression is driven by the composite assembly of several single cell-type-elements. The latter hypothesis was supported by several studies show- ing that promoters generating complex expression patterns can be decomposed into simple elements, as it has

~r t~

~q

L. S$galat et al. / Mech. Dev. 47 (1994) 241-251 249

been highlighted by the paradigm of stripe formation in early embryogenesis (Pankratz et al., 1990). In the follicle cells, it has been shown for the chorion gene s36 and the vitelline membrane protein gene VMP32E that ap- parently uniform expression is, in fact, driven by the con- comitant activity of several spatially-restricted enhancers (Tolias and Kafatos, 1990; Gargiulo et al., 1991).

The results of our analysis of the pqp gene are in accordance with such a composite promoter organization. We show that pqp expression in the ovary is governed by distinct follicle cell- and germ line-specific elements. These elements can function in any orientation. They appear to be also distance-sensitive. When they are placed approximately 800 bp away from the basal hsp70 promoter (construct CW2), expression is abolished in the germ cells and greatly reduced in the follicle cells. It cannot be exclud- ed, however, that the CW2 construct revealed a distance- dependent interference between the hsp and the pqp promoters. The DK(-400/-40) and JX(-80/+1816) constructs show that the follicle cell element is distal and that the germ line element is proximal to the transcription start site. Altogether these results indicate that the -210/-40 region can drive the expression of the lacZ reporter gene in the follicle cells but not in the germ cells, while the -80/+30 region can promote expression in the germ cells similar to the endogenous pqp pattern but not in the follicle cells.

The fact that pqp regulatory regions do not extend further away than 210 bp from the transcription start site is in accordance with the molecular analysis of deletions affecting the pqp locus. In previous work (S~galat et al., 1992), we have shown that a -700/-280 deletion of the gene leads to a silent mutation, meaning that this fragment is dispensable for pqp expression. Conversely, a -700/-30 deletion leads to a phenotype as severe as that of a null allele, indicating that the -280/-30 region is crucial for pqp gene expression and that sequences downstream of -30 are not sufficient (S~galat et al., 1992).

The enhancer limits deduced from the analysis of the pqp-lacZ constructs also corroborate the results of sequence comparisons between pqp and follicle cell-specific genes (Fig. 1). Whereas we have demonstrated in vivo that regulatory elements necessary for follicle-cell expression are included in the -210/-40 fragment, five stretches of partial sequence identity with the follicle cell-specific VMP32E VMP3C and YP3 gene are located in the same

region, between -190 and -70. On the contrary, as to the germ line-specific enhancer, we have detected no sequence similarity with the two previously identified hsp26 and otu elements.

The results of the AL (-3000/+ 10) and CL (-450/+ 10) constructs were surprising. Flies carrying these constructs behave like enhancer-trap lines, each line displaying a different pattern. As a comparison, the HN (-210/+30) lines seem to possess all pqp regulatory elements (Fig. 5). Two hypothesis could explain the peculiar behavior of the AL and CL constructs. Key sequences, that would be absent in these two constructs, might be located between +10 and +30. However, if this argument stands for.germ cell expression, it does not fit well for follicle cells since the DK (-400/-40) construct can drive follicle cell expression. Alternatively, regulatory elements might be present in AL and CL, but inactive, for conformational or ac- cessibility reasons (Kornberg and Lorch, 1992). In most of the constructs made with the pX27 vector (Fig. 5), two potential transcription start sites coexist : the one from pqp and the one from hsp70 present in the vector. We have not verified which one actually serves for the initiation of transcription. Except in the cases of AL and CL, at least one of the start sites is fully functional, as can be judged by/3-galactosidase expression. A third hypothesis, related to the previous one, that could explain the results of AL and CL, would be that a minimal distance is required between the TATAA box of the hsp70 basal promoter and functional enhancers. This may explain why, in some lines carrying the DP (-400/+60), HP (-210/+60) or DN (-400/+30) construct, nurse cell expression is slightly heterogenous, some cells being ran- domly more stained than others in the same egg chamber.

In summary, our results indicate that pqp expression in the ovary is regulated by at least two cell-type-specific enhancers that direct a complex pattern of transcription. Further studies will help refine the limits of these enhancers and may lead to the identification of more specific ones. Such an approach may shed light on the con- troversial issue of ooeyte nucleus transcription.

4. Materials and methods

4.1. DNA constructions The starting clone of all constructs was the SS3 plas-

mid, which contains a SaII-SalI 6.1 kb of the pqp gene

Fig. 6. Expression pattern ofpqp-hsp70-lacZ fusions. Flies carrying one copy of constructs presented in Fig. 5 were dissected and ovaries were incubated with Xgal to reveal B-gaiactosidase expression. Stages are given according to Mahowald (1980). (a and b) Pattern of expression of the oel/X27 control construct. Staining is completely absent in the early stages, appears in the follicle cells at stage 7 -8 (a, bottom) and is intense in all follicle cell subtypes at stage 9 (b). s, squamous follicle cells; b, border cells; f, columnar follicle cells. (c and d) BQ construct. Staining is strong in all cell types; n, nurse cell; o, oocyte; f, follicle cells. (e and f) CW2 construct. Staining is restricted to the follicle cells. Note the heterogenous staining among those, resulting in a patchy pattern. No staining is observed in the nurse cells (the triangle indicates a nurse cell nucleus). (g- i) DN construct. Staining is strong in all cell types, from the early stages (g), in a pattern similar to the BQ construct (c and d). (j and k) DK construct. Staining is restricted to the follicle cells after stage 8. No staining is observed in the nurse cells (triangle). (1 and m) NH construct. Intense staining is observed in all cell types, as in DN. Oocyte staining appears as soon as stage 5 -6 (1, top). (n) HN construct (same fragment as in NH, but in opposite orientation). Staining is similar to that of NH at all stages.

250 L. S~galat et al. / Mech. Dev. 47 (1994) 241-251

(Vincent et al., 1988) cloned into the Sail site of the pEMBLI8 vector so that the EcoRI site of the polylinker is upstream of the 5' end of the pqp gene. This provides unique KpnI, SmaI, BamHI, and XbaI sites at the 5' side of the pqp fragment. All positions are given with reference to the transcription start site as defined in Vincent et al. (1988).

pqp-f3-Galactosidasefusion proteins. The AX construct was made by inserting a XbaI-XhoI 4.8-kb (-3000/+1800) fragment, obtained by partial digestion of SS3, into the XbaI and Sail unique sites of the pSDL1 vector (Payre et al., 1989). This created an in-frame fusion gene encoding the first two thirds (a.a. 1-501) of the pqp protein (including the zinc fingers) and the B-galactosidase. The CX construct was made by XbaI and SpeI digestion and ligation of the AX plasmid, thus removing the 2.55- kb 5' most region ofpqp present in AX and letting 460 bp of 5' pqp sequences. The LX construct was made by Sail and XhoI partial digestion and ligation of the AX plasmid, so that the Sail-XhoI 3-kb (-3000/+ 10) fragment ofpqp was excised. The DX construct was made by PCR synthesis of the -400/+ 1 fragment of the pqp gene with XbaI-Sail-400/-380 and XbaI+ 1/-20 primers. The PCR- amplified fragment was digested by Xbaland cloned into the XbaI site of CX (just upstream of the Sail/XhoI ligation site). The Sail site introduced in the fragment serv- ed to determine its orientation after ligation. The resulting DX construct contains -400/+ 1816 sequences of the pqp gene fused in frame to lacZ. Because of the cloning strategy, the pqp sequence was slightly modified between positions +1 and +10 (ATCTAGAGTC instead of ATGC~GACTC). Theses changes do not affect the ORF and the fusion protein produced should be the same as in the AX and CX constructs. The HX and JX constructs were made following the same strategy. For HX, a -210/+1 fragment was PCR-synthesized with XbaI- Sail-210/- 190 and XbaI+ 1/-20 primers and cloned into the XbaI site of CX. For JX, a -80/+ 1 fragment was PCR- synthesized with XbaI-SpeI-Sail-80/-60 and XbaI + 1/-20 primers and cloned into the XbaI site of CX. In HX and JX, the pqp sequence was modified as in DX. All these constructs were injected in eggs of ry 5°6 flies following standard protocols (Ashburner, 1989b).

Creation of the pX27 enhancer testing vector, pX27 is a transformation vector designed to test the enhancer-like capacities of DNA sequences to drive gene expression in Drosophila. Its major features are that it contains the basal promoter and 5' untranslated transcribed region (UTR) of the hsp70 gene, the lacZ gene as a reporter gene, the white gene as a marker gene and pUC sequences for the cloning steps. A nuclear localization signal (NLS) was added to the B-galactosidase to render it nuclear, conversely to the cytoplasmic B-galactosidase made from the pCasper-AUG-/~gal (Thummel et al., 1988) and HZ50PL vectors (Hiromi and Gehring, 1987). It was constructed by PCR synthesis of a BamHI-BgllI 300-bp fragment con-

taining the -50/+250 region of the hsp70 gene using HZ50PL as template and 5'-GGAAGGATCCGGAAT- ATTCGAAAAGAGCGCGGGAG and 5'-CCTT- AGATCTTTCAGCTTGCGCTTCTTCTTGGGGAT- TCCAATAGCAGGCAT primers. The second primer contains the NLS sequence of the SV40 T-antigen (PKKKRKV). After BamHI and BgilI digestion, this PCR fragment, containing the hsp70 TATAA region plus the 5'UTR, the ATG signal and the NLS, was inserted in the BamHI site of the pCasper-Bgal vector to create an in-frame fusion with the B-galactosidase ORF. The resulting intermediate vector, named pX26, possesses XbaI and BamHI cloning sites, pX27 was created by replacing the XbaI and BamHI sites of pX26 by a XbaI- EcoRI-XhoI-BamHI polylinker. The 3' end of the BamHl site is 25 bp away from the TATAA box. The PstI site present in pCasper-Bgal can no longer be used for cloning because of another PstI site in hspTO, pX27 was named after Marlene Dietrich's character in Joseph von Stern- berg's movie 'Dishonoured', a Charcot's favorite.

Constructions usingpX27. The oe l/pX27 construct was cloned by inserting a Sail-Sail 300-bp fragment corresponding to the oel ovarian-specific enhancer of the ypl/yp2 genes (Logan and Wensink, 1990) in the XhoI site of pX27. The AL construct was made by placing the Sail. XhoI 3-kb fragment of SS3 coveringpqp-5' regions in the XhoI site ofpX27. CL was made by placing the SpeI-XhoI 460-bp fragment of SS3 in Xbal-XhoI. BQ was made by inserting a MboI-MboI 1.1-kb fragment (-1000/+80) obtained by partial digestion of SS3 in the BamHI site of pX27. CW2 was made by inserting a SpeI-PvulI 1.26-kb (-460/+800) fragment in XbaI-EcoRI. The EcoRI site was blunted by filling with Klenow enzyme. The DR construct was made by PCR synthesis of the -400/+100 fragment with Xbal-Sail-400/-381 and EcoRI+ 100/+81 primers. The PCR-amplified fragment was digested by XbaI and EcoRI and cloned into the XbaI-EcoRl site of pX27. DP, DN and DK were cloned the same way with EcoRI+ 60/+41, EcoRI+30/+ll and EcoRI-41/-60 primers, respectively. HP was constructed by PCR synthesis of a -210/+60 fragment with XbaI-SalI-190/-210 and EcoRI+60/+41 primers. The PCR-amplified fragment was digested by XbaI and EcoRI and cloned into the XbaI- EcoRI sites of pX27. The same PCR product was digested by Sall and EcoRI and cloned in the reverse orientation in the EcoRI-XhoI sites of pX27 as PH. HN was con- strutted similarly as HP with Xbal-Sail-190/-210 and EcoRI+30/+ 11 primers. NH was cloned in the reverse orientation in EcoRI-XhoI. All constructs in pX27 were injected in eggs of w m8 flies following standard protocols (Ashburner, 1989b).

4.2. B-Galactosidase staining of ovaries At least five independent lines carrying one copy of the

transgene were analysed for each construct, except for AX (2) and DR (l). Unless otherwise stated, no qualitative

L. Skgalat et aL /Mech. Dev. 47 (1994) 241-251 251

difference was observed between independent lines carrying the same construct. However, sfight quantitative dif- ferences, due to position effect, occur that may cause some descriptions of the level of expression to be approximate. These discrepancies do not change the interpretation of the results. Whole ovaries from 3-7 day flies were dissected in PBS, fixed 5 rain by glutaraldehyde 0.5% in PBS, washed in PBS and subsequently treated as described by Fasano and Kerridge (1988). After overnight in- cubation in X-gal, ovaries were rinsed twice in PBS, incubated 20 min minimum in PBS/Glycerol (1:2), dissected to separate ovarioles and mounted in the same medium.

Acknowledgements

We thank P. Feynerol and K. Taalba for technical assis- tance, P. Wensink for the gift of the oel enhancer, H. Doerflinger for her help in compiling the results, R. Schwartzman for photographic work and R. Dettman for improving the English. This work was supported by grants from the Centre National de la Recherche Scien- tifique (CNRS) and the Ligue Nationale contre le Cancer to J.A.L.

References

Ashburner, M. (1989a) Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1331 pp.

Ashburner, M. (1989b) Drosophila: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 434 pp.

Bier, E., Vaessin, H., Sheperd, S., Lee, K., McCall, K., Barbel, S., Acker- man, L., .Carretto, R., Uemura, T., Grell, E., Jan, L.Y. and Jan, Y.N. (1989) Genes Dev. 3, 1273-1287.

Burke, T., Waring, G.L., Popodi, E. and Minoo, P. (1987) Dry. Biol. 124, 441-450.

Comer, A.R., Searle~ L.L. and Kalfayan, L.J. (1992) Gene 118, 171-179. Fasano, L. and Kerridse, S. (1988) Development 104, 245-253. Frank, L.H., Cheung, H.K. and Cohen, R.S. (1992) Development 114,

481-491. Garabedian, M.J., Shirras, A.D., Bownes, M. and Wensink, P.C. (1987)

Gene 55, 1-8. Gargiulo, G., Gigliotti, S., Malva, C. and Graziani, F. (1991) Mech.

Dry. 35, 193-203. Grossniklaus, U., lkllen, H.J., Wilson, C. and Gehring, W.J. (1989)

Development 107, 189-200. Hiromi, Y. and Gehring, W.J. (1987) Cell, 50, 963-974. Jin, J. and Petri, W.H. (1993) Dev. Biol. 156, 557-565. Khoury Christianson, A.M., King, D.L., Hatzivassiliou, E., Casas, J.E.,

Hallenbeck, P.L., Nikodem, V.M., Mitsialis, S.A. and Kafatos, F.C. (1992) Proc. Natl. Acad. Sci. USA 89, 11503-11507.

King, R.C. (1970) Ovarian Development in Drosophila melanogaster, Academic Press, New York.

Kornberg, R.D. and Lorch, Y. (1992) Annu. Rev. Cell Biol. 8, 563-587. Lava], M., Pourrain, F., Deutsch, J. and Lepesant, J.A. (1993) Mech.

Dry. 44, 123-138. Logan, S.K. and Wensink, P.C. (1990) Genes Dry. 4, 613-623. Mahowald, A.P. and Kambysellis, M.P. (1980) In Ashburner, M. and

Wright, T.R.F. (eds.), The Genetics and Biology of Drosophila, Academic Press, London, Vol. 2d, pp. 141-224.

Pankratz, M.J., Seifert, E., Gerwin, N., Bllli, B., Nauber, U. and Jickle, H. (1990) Cell 61, 309-317.

Payre, F., Yanicostas, C. and Vincent, A. (1989) Dry. Biol. 136, 469-480. S~galat, L., P~richon, R., Bouly, J.P. and Lepesant, J.A. (1992) Genes

Dev. 6, 1019-1029. Thummel, C.S., Boulet, A.M. and Lipshitz, H.D. (1988) Gene 74,

445-456. Tolias, P.P. and Kafatos, F.C. (1990) EMBO J. 9, 1457-1464. Vincent, A., Kejzlarovtt-Lepesant, J., Segalat, L., Yanicostas, C. and

Lepesant, J.-A. (1988) Mol. Cell. Biol. 8, 4459-4468.

Dissection of the Drosophila pourquoi-pas? promoter: Complex ovarian expression is driven by...

Documents

Transcript of Dissection of the Drosophila pourquoi-pas? promoter: Complex ovarian expression is driven by...