Direct development of neurons within foregutendoderm of sea urchin embryosZheng Wei, Robert C. Angerer, and Lynne M. Angerer1

National Institute for Dental and Craniofacial Research, National Institutes of Health, Bethesda, MD 20892

Edited* by Eric H. Davidson, California Institute of Technology, Pasadena, CA, and approved April 21, 2011 (received for review December 10, 2010)

Although it is well established that neural cells are ectodermalderivatives in bilaterian animals, here we report the surprisingdiscovery that some of the pharyngeal neurons of sea urchinembryos develop de novo from the endoderm. The appearance ofthese neurons is independent of mouth formation, in which thestomodeal ectoderm joins the foregut. The neurons do not derivefrom migration of ectoderm cells to the foregut, as shown bylineage tracing with the photoactivatable protein KikGR. Theirspecification and development depend on expression of Nkx3-2,which in turn depends on Six3, both of which are expressed in theforegut lineage. SoxB1, which is closely related to the vertebrateSox factors that support a neural precursor state, is also expressedin the foregut throughout gastrulation, suggesting that thisregion of the fully formed archenteron retains an unexpectedpluripotency. Together, these results lead to the unexpectedconclusion that, within a cell lineage already specified to beendoderm by a well-established gene regulatory network [PeterIS, Davidson EH (2010) Dev Biol 340:188–199], there also operatesa Six3/Nkx3-2–dependent pathway required for the de novo spec-ification of some of the neurons in the pharynx. As a result, neuro-endoderm precursors form in the foregut aided by retention ofa SoxB1-dependent pluripotent state.

cell fate specification | embryonic development | neurogenesis |enteric nerve

The nervous system of the sea urchin consists of an highlyordered array of neurons that develop sequentially in the

anterior neuroectoderm, within or near the ciliary band, and inthe pharyngeal region (1, 2) (Fig. 1). During embryogenesis, theanterior neuroectoderm is localized to the animal pole by con-trolled canonical Wnt-dependent processes (3, 4), and the ciliaryband is positioned by TGF-β signaling through nodal and bonemorphogenetic protein pathways (5–8). However, the mecha-nisms regulating development of pharyngeal neurons have notbeen explored. In other bilaterian animals, the nerves that in-nervate the gut are thought to develop from cells that migratefrom either the ventral or dorsal ectoderm. In arthropods, in-dividual cells and cells in epithelial vesicles arising from theventral stomodeal ectoderm and presumptive nerve cord migrateto give rise to the stomatogastric nervous system (9), whereas inchordates, neural crest cells exit the neural tube and populatethe enteric nervous system (10). Currently there is no evidence ofa comparable ectodermal cell population in embryos of echino-derms or other invertebrate deuterostomes (11).The pharnyx is derived from both oral (stomodeal) ectoderm

and foregut endoderm. Although all of the pharyngeal neuronsare expected to come from the ectoderm, unexpectedly we foundthat some cells in the foregut expressed the neural marker syn-aptotagmin B (SynB) in embryos in which the foregut was sep-arated from the stomodeal ectoderm. Here we present theseobservations as well as the results of further tests that stronglysupport the surprising conclusion that some pharyngeal neuronsdevelop directly from tissue specified as endoderm. Using anectodermal cell-tracking approach with the photoactivatableprotein KikGR (12), we eliminate the possibility that theseneurons are derived from ectodermal precursors that migrated to

the foregut. We demonstrate that the transcription factor Six3,which is required for these foregut neurons and all embryonicneurons, is transiently expressed in the foregut lineage. We alsoshow that a Six3-dependent gene, Nkx3-2, which is expressedonly in the oral anterior ectoderm and the foregut, is also es-sential for the development of pharyngeal neurons. Importantly,the Six3/Nkx3-2 pathway operates in foregut precursors well af-ter deployment of the endoderm gene regulatory network (13),but foregut cells also express SoxB1, a transcription factorpresent in cells whose fates are not fully committed. Thesefindings demonstrate that neurons develop directly from cells inendodermal tissue.

ResultsNeurons Develop in the Foregut of Exogastrulae and in EmbryosLacking a Mouth. Some foregut neurons were observed in twokinds of embryos that develop at very low frequencies in pop-ulations of normal embryos. In 4-d embryos in which the gut hadevaginated at the beginning of gastrulation, SynB-expressingcells were observed in the foregut region (Fig. 2A). The same wasobserved in embryos in which the foregut and stomodeal ecto-derm failed to join and form the mouth opening (Fig. 2B).Furthermore, as in the animal pole and ciliary band neurogenicfields, cells in the foregut are subject to Notch-mediated lateralinhibition. Treatment with the γ-secretase inhibitor DAPT (N-[N-(3,5-difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl es-ter), which often causes exogastrulation, results in significantlymore neurons not only in animal pole and ciliary band ectoderm,but also in the foregut (Fig. 2D), compared with normal larvae(Fig. 2 A and C). Close examination reveals that processes ex-tend from these cells throughout the foregut (Fig. S1). Longprocesses connecting foregut neurons to other pharyngeal neu-rons derived from the ectoderm can be seen in embryos in whichthe mouth has formed normally (Fig. 2 F–H). Together, thesedata indicate that neurons are present in the foregut.

Neural Precursors Do Not Migrate to the Foregut from Ectoderm. Totest whether the foregut neurons are derived from neural pre-cursors that migrated from the ectoderm to the foregut, wetracked ectoderm cells using the photoactivatable protein KikGR(12), introduced by mRNA injection at the single-cell stage. Be-cause these neurons depend on Six3 (4), and because Six3 isexpressed predominantly in animal pole ectoderm, we believedthat such precursors likely would be derived from this region ofthe embryo. Consequently, we created embryos in which animalpole ectoderm was labeled red by KikGR photoactivation atearly mesenchyme blastula stage, while the rest of the embryo

Author contributions: Z.W. and L.M.A. designed research; Z.W. performed research; Z.W.,R.C.A., and L.M.A. analyzed data; and Z.W., R.C.A., and L.M.A. wrote the paper.

The authors declare no conflict of interest.

*This Direct Submission article had a prearranged editor.

Freely available online through the PNAS open access option.1To whom correspondence should be addressed. E-mail: langerer@mail.nih.gov.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1018513108/-/DCSupplemental.

www.pnas.org/cgi/doi/10.1073/pnas.1018513108 PNAS | May 31, 2011 | vol. 108 | no. 22 | 9143–9147

DEV

ELOPM

ENTA

LBIOLO

GY

Dow

nloa

ded

by g

uest

on

Aug

ust 1

, 202

0

remained green (Fig. 3 A–C). At 4 d, after the time when neu-rons appear in the pharyngeal region, we observed no red cellsthere, although many migrating green mesenchyme cells wereevident (Fig. 3 D–F; see Fig. S2 for a series of 2-μm opticalsections through the gut region). The absence of migratory (red)ectoderm cells is not related to deleterious effects of photo-activation of KikGR, as demonstrated by the normal develop-ment of pharyngeal neurons, as well as the rest of the embryo(Fig. 3 G–I).To explore whether the foregut neurons come from other ec-

todermal regions, we produced embryos in which the endomeso-derm cells were labeled red by photoactivation and the remainingcells that give rise to ectoderm were green (Fig. 3 J–L). In thisexperiment, we performed assays at an earlier stage when theforegut is easier to analyze, but after the time at which neuronsbegin to differentiate there, as determined by SynB in situ hy-bridization (ISH) (Fig. S3A). Again, no cells of ectodermal originwere detected in the gut (Fig. 3 M–O). In contrast, red migratoryskeletogenic mesenchyme and nonskeletogenic cells were readilydetected (Fig. 3M, arrows). These results provide strong evidencethat foregut neurons do not arise from the presumptive ciliatedband, the stomodeal ectoderm, or indeed from any ectodermalsource, but instead develop in situ in the gut.

Six3 and Nkx3-2 Are Expressed in Foregut and Required for Pha-ryngeal Neuron Development. Previous studies clearly showed thatSix3 is required for development of pharyngeal neurons at 3 d(4); this is also the case a day later, long after these neuronsnormally develop (Fig. S3 B and C). Although Six3 transcriptsare not detectable in the foregut endoderm at gastrula stages (4,14), they are present at mesenchyme blastula stage in the pre-cursors to this part of the gut (Fig. 4 A and B, red), which areadjacent to nonskeletogenic mesenchyme expressing gcm (15)(Fig. 4 A and B, green), the same criterion used to show thatmembers of the endoderm gene regulatory network are ex-pressed in the presumptive foregut (13).The expression of Six3 in foregut precursors and the appear-

ance of the first SynB-expressing neurons in the foregut (Fig.S2A) are separated by at least a day of development, implyingintermediate steps in this process. Thus, we examined the ex-pression of Six3-dependent regulatory genes (4) and found that

one, Nkx3-2, is expressed in the animal pole ectoderm starting atthe mesenchyme blastula stage (Fig. S3E) and then in the oralanimal pole ectoderm and foregut of gastrulating embryos (Fig.4C and Fig. 3 F and G), that is, the same regions in whichpharyngeal neurons develop (Fig. 1 A and B). Nkx3-2 expressionis detectable only in these territories, and in each territory itdepends on Six3 (Fig. 4D). It is required for the development ofall pharyngeal neurons, as shown in two different Nkx3-2 mor-phants (Fig. 4E and Fig. S3 H and I; compare with normal em-bryos shown in Fig. 1 A and B). These results suggest that Nkx3-2has a cell-autonomous role in promoting neurogenesis in theforegut, a conclusion strongly reinforced by the finding of thatNkx3-2 and SynB are coexpressed in the gut (Fig. 4 F–H, whitearrows). Although the connection between Nkx3-2 and SynBtranscription may be direct, that between Six3 and Nkx3-2transcription likely is not direct, given that expression of Six3precedes that of Nkx3-2 by at least 12 h and accumulation oftheir mRNAs does not overlap during gastrula stages (4) (Fig.4C). If there were a direct connection, then the appearance ofSix3 and Nkx3-2 transcripts likely would be separated by onlyseveral hours in this system (16). Taken together, these resultsindicate that Six3 supports expression of Nkx3-2, which is re-quired for differentiation of pharyngeal neurons not only in theoral animal pole ectoderm, but also in the foregut.

Fig. 1. The structure of the sea urchin embryonic nervous system. (A and B)A 4-d embryo immunostained for serotonin (green), SynB (red), and nuclei(DAPI; blue). (C) Schematic indicating the three parts of the nervous systemfrom an oral-vegetal view (OVV). These regions are the anterior neuro-ectoderm, located at the animal pole (AP; dark blue) and containing sero-tonergic neurons (green) and nonserotonergic neurons (purple in C and redbetween the dashed arrows in B); the ciliary band (CB; medium blue), whichforms between oral (white) and aboral (light blue) ectoderm and containsnonserotonergic neurons (orange ovals); and the pharyngeal neurons closeto the lower lip of the mouth (M in A and C) (curved white arrow in A; redovals in C). (Scale bar in B: 20 μm.)

Fig. 2. Pharyngeal neurons develop in the foregut. Embryos are labeled asin Fig. 1A. (A) Development of pharyngeal neurons is independent of mouthformation. Neurons are present in the foregut of an exogastrulated 4-dembryo (red arrow; lateral view). (B) A 4-d embryo in which the foregut didnot contact the oral ectoderm (red arrows; lateral view). FG, foregut; MG,midgut; HG, hindgut. (C) Same embryo as in A, rotated 90 degrees to fa-cilitate comparison with D. (D) DAPT-treated 4-d pluteus (oral views).Hindguts in A, C, and D are out of the plane of focus. (E–H) Normal 6-dpluteus. (E) Differential interference contrast images. M, mouth; MG, mid-gut; brackets, coelomic pouches adjacent to foregut; dashed trapezoid,foregut. (F) confocal stack. (G and H) Higher-magnification confocal sectionsof pharyngeal region (dotted rectangle in F) illustrating connections ofneural cells (white arrows) on the left (G) and right (H) sides of the foregut toother nerves around the mouth (M). Cells to the left (G) or right (H) of thearrows are coelomic pouch cells adjacent to the foregut. (Scale bars in A, F,and G: 20 μm.)

9144 | www.pnas.org/cgi/doi/10.1073/pnas.1018513108 Wei et al.

Dow

nloa

ded

by g

uest

on

Aug

ust 1

, 202

0

Foregut Endoderm Expresses SoxB1. At the time when Nkx3-2 andSynB are expressed in the foregut, SoxB1 also is expressed in thisregion, as demonstrated by comparison with Endo1, a marker ofmidgut and hindgut (Fig. 5 A and B). Interestingly, SoxB1 is mostclosely related to Sox1, Sox2, and Sox3, which have been shownto maintain a neural precursor state in mouse embryos (17, 18).Just as these factors disappear when neurons differentiate inmouse embryos, so also is SoxB1 eliminated from differentiatingneurons in ectoderm and foregut endoderm in sea urchin em-bryos. These cells contain SynB (red), but they are devoid ofSoxB1 (green) (Fig. 5D, white arrows). As expected, if SoxB1supports an uncommitted neural precursor state within foregut

endoderm, then its expression should not depend on Six3, and infact this is the case (Fig. 5C). Because the loss of SoxB1 resultsin gastrulation defects (19), we cannot determine whether it isrequired for foregut neural development or Nkx3-2 expression.

DiscussionHere we demonstrate that, in bilaterian embryos, unexpectedly,neurons develop de novo in cells already specified as endoderm,challenging the dogma that they always originate from ectoderm.Endodermal neurogenesis is mediated by Six3 and Nkx3-2, thesame factors required for neurogenesis in the oral animal poleectoderm. However, the Six3/Nkx3-2 pathway is able to operatein the context of a fully functional endomesoderm regulatorynetwork that has driven cells far down the endoderm specifica-tion pathway (13). We propose that endodermal neurogenesis inthe sea urchin embryo uses the initial underlying neural potentialof early blastomeres (3, 4) that may be preserved in foregutendoderm by selective SoxB1 perdurance.The early endoderm gene regulatory network is directly acti-

vated by canonical Wnt signaling, which is required for endo-derm development (20). Expression of all components of thisnetwork becomes restricted to endoderm precursors by theeighth cleavage, when endoderm and nonskeletogenic mesodermsegregate (13). At this time, specification of endoderm is wellunderway because, in addition to positive inputs directly fromnuclear β-catenin, cross-regulatory interactions among the earlyendoderm network genes have been established. Importantly,expression of these genes is uniform in the ring of foregut pre-cursors (13), indicating that at the hatching blastula stage, thereis no evidence of separate populations of endodermal and neuralcells. It is not until ninth cleavage, several hours later, that Six3expression is activated in presumptive foregut cells by an as-yetundefined mechanism. In previous work, we established that Six3functions near the top of the neurogenic regulatory hierarchy inthe anterior neuroectoderm at the animal pole (4) and likely hasa similar role in the endoderm. Consequently, we propose thatSix3 also is necessary to generate neuroendodermal precursorcells, several of which give rise to neural progeny well aftermorphogenesis of the endoderm has begun.The Six3-dependent foregut neural specification pathway ini-

tially operates in more cells than will give rise to neurons. TheSix3-dependent gene Nkx3-2 is expressed initially throughouta significant fraction of the foregut endoderm but later in onlya subset of these cells. How restriction of Nkx3-2 expression andneural capacity occurs between gastrula and pluteus larval stagesis unclear, but Notch-mediated lateral inhibition is at least partlyinvolved.The finding that SoxB1 is expressed exclusively in the foregut

region of the archenteron may provide an important clue tounderstanding how neurons can develop there. We propose thatSoxB1 function supports retention of pluripotency in this region,at least in part by antagonizing canonical Wnt signaling thatdrives endomesoderm development. Previously, we showed thatSoxB1 suppresses β-catenin activity in normal embryos duringthe period when early endoderm is specified and Six3 expressionbegins, and that misexpression of SoxB1 can completely blockendomesoderm development (19). Thus, persistent SoxB1 ex-pression specifically in the foregut could delay progression toa stable endodermal fate, which precludes neurogenesis. Sub-sequently, the combination of reduced endoderm network func-tion via SoxB1 and expression of Six3 and Nkx3-2 could specify theforegut as neuroendoderm. If SoxB1 functions to maintain pluri-potency, then the transition to a terminally differentiated stateshould require elimination of SoxB1. This appears to be the case,given that SoxB1 is successively down-regulated in all endomeso-derm cell lineages except the foregut as they commit to specificfates: first skeletogenic mesenchyme (21), then nonskeletogenicmesoderm (21–23), and then midgut and hindgut (this study).

Fig. 3. Ectodermal cells do not migrate to the pharynx. (A–C) Animal polecells of early mesenchyme blastulae were labeled by photoactivating KikGR(from green to red in C) synthesized from mRNA injected at the one-cellstage. (D–F) The same embryo as in A–C at 4 d lacks red cells in the mouthregion (M; curved arrows in E and F). Arrowheads in E indicate migratorymesenchyme cells. (G–I) This same embryo developed normally, and differ-entiated neurons in the mouth and ciliary band and at the animal pole(SynB, red; serotonin, green; DAPI, blue; cf. Fig. 1 A and B). (J–L) Presumptivemesenchyme and endoderm cells in an early mesenchyme blastula were la-beled by photoactivating KikGR (red; L), whereas ectoderm cells remainedgreen. (M–O) In this embryo, no green ectoderm progeny were visible in theforegut 1 d later; however, red mesenchyme cells that migrated from thevegetal plate were detected (white arrows in M and O). One of these,a pigment cell that intercalates into the ectoderm, is visible in M (yellow).(Scale bars in A and J: 20 μm.) A, D, G, and J are differential interferencecontrast images.

Wei et al. PNAS | May 31, 2011 | vol. 108 | no. 22 | 9145

DEV

ELOPM

ENTA

LBIOLO

GY

Dow

nloa

ded

by g

uest

on

Aug

ust 1

, 202

0

This pattern of early ubiquitous SoxB1 expression followed bydown-regulation through cell signaling is similar to that of theapparent SoxB1 ortholog Sox2 (19, 21, 24, 25), whose role inmaintaining pluripotency in mouse embryonic and induced plu-ripotent stem cells is nowwell established (26, 27). The other SoxB1class factors, Sox1 and Sox3, also maintain neural progenitors in an

undifferentiated state, and their removal is also required for neuraldifferentiation (17, 18). Similarly, SoxB1 is present throughout theectoderm and foregut endoderm, but disappears from differentiat-ing neurons in each of these regions. Our data suggest that SoxB1executes at least some of the same functions in sea urchin em-bryos as the SoxB class factors do in vertebrate embryos.

Fig. 4. A Six3 > Nkx3-2 > SynB neural pathway operates in theforegut. (A) Double FISH shows that in a 24-h mesenchymeblastula, Six3 (red) is expressed in foregut precursors adjacentto those expressing gcm (green) in nonskeletogenic mesen-chyme; vegetal view (vv). (B) Schematic of the foregut lineage(red). AP, animal pole; LV, lateral view; SM, skeletogenic mes-enchyme; NSM, nonskeletogenic mesenchyme; FgEn, foregutendoderm. (C and D) ISH shows that Nkx3-2 is expressed in oralanimal pole ectoderm and foregut endoderm during gastrula-tion (C), but not in Six3 morphants (D). (E) Nkx3-2 morphantslack neurons in the foregut (curved arrow), as well as non-serotonergic neurons (red; anti-SynB) that develop on the oralside of animal pole ectoderm (dashed arrows; compare withregions between dashed arrows in Fig. 1B); serotonergic neu-rons (green). (F–H) Double FISH shows that Nkx3-2 (red) andSynB (green) mRNAs are coexpressed in the foregut (whitearrows). (H) Higher-magnification image of the mouth shown inF. (Scale bar in C: 20 μm.)

Fig. 5. SoxB1 mRNA accumulates in the foregut, disappears from differentiating neurons and does not depend on Six3. (A–C) Immunostaining of a normal2-d embryo (A and B) or a Six3 morphant (C), lateral views, for SoxB1 (green) and Endo1 (A and C, red), which labels midgut and hindgut, and DAPI (A and C,nuclei). (D) SoxB1 protein disappears from differentiated nerve cells: SoxB1- (green), SynB- (red), and DAPI-labeled (blue) 4-d embryo, oral view. Opticalsections of regions outlined in white (animal pole ectoderm), orange (mouth region), and yellow (ciliary band) rectangles are shown in three (left) or two(right) combined color channels. Arrows indicate that differentiated nerve cells (red cytoplasm) lack SoxB1 (green nuclei). (Scale bar in E: 20 μm.)

9146 | www.pnas.org/cgi/doi/10.1073/pnas.1018513108 Wei et al.

Dow

nloa

ded

by g

uest

on

Aug

ust 1

, 202

0

In the absence of signaling, the initial regulatory state of earlyblastomeres supports neural fate specification in all embryos inwhich it has been examined (28), as well as in embryonic stem cells(29). Our work suggests that this basal neural regulatory state isnot lost in some endoderm lineages of sea urchin embryos, just asit is not lost in some mesoderm lineages of mouse embryos (30).Whether persistence of neural capacity in endoderm lineages isa property of other metazoans or is a derived character in echi-noderms is not yet known. However, intriguingly, in mouse adultgut mucosa, cryptic neural stem cells have been detected aftertreatment of mice with the neural-inducing agent 5-HT4 (31). Ifvertebrate neuroendoderm precursor cells do exist, they likely arerare and escape detection because of the large contributions of theneural crest to the enteric nervous system.In sea urchin embryos, the challenges now are to understand

the gene regulatory mechanism that maintains latent neurogeniccapacity in cells already running nonectodermal developmentalprograms and that which triggers progression of the neural generegulatory program in a few of these cells, leading them to be-come neurons.

Materials and MethodsEmbryo Culture. Adult sea urchins, Strongylocentrotus purpuratus, weremaintained in seawater at 10 °C. Embryos were cultured by standardmethods in artificial seawater at 15 °C. In some experiments, embryos werecultured in 5 μM DAPT.

Microinjection of Morpholino Antisense Oligonucleotides. Eggs were preparedas described previously (4). Approximately 2 pL of solution containing 22.5%glycerol and morpholinos (MOs; Gene Tools) were injected. For Nkx3-2MO1

(5′CGTTCATGTTGGTCTGAAATGATGC3′) and MO2 (5′GCGATCCAAATGGAT-TCCAATTTCG), the concentrations were 0.4 mM. For Six3MO (4), the con-centration was 0.75 mM.

Green-to-Red KikGR Fluorescence Protein Photoactivation. The pKikGR plasmidwas a gift from Dr. Atsushi Miyawaki (RIKEN Brain Institute, Saitama, Japan).Synthesized mRNA (mMessageMachine, 0.5 μg/μL; Ambion) was injected intofertilized eggs. At 24 h postfertilization, embryos were immobilized in hy-pertonic artificial seawater (32 mg/mL NaCl) for 2 min and photoactivated byilluminating with 360-nm UV light for one 3-s pulse at the desired region.Embryos continued development to 2–4 d in normal artificial seawater, atwhich point they were checked for migration of labeled cells. Photo-activation and photography were carried out with a Zeiss Axiovert 200Mmicroscope. Optical sections were obtained with an ApoTome unit (Zeiss),and stacked images were prepared using Adobe Photoshop. This experi-ment was carried out on 30 different embryos derived from three differ-ent matings.

Whole-Mount in Situ Hybridization. Embryos were fixed, hybridized, andstained as described previously (4). Two-color FISH was performed as de-scribed previously (32) at probe concentrations of 0.1 ng/μL.

Immunohistochemistry. Embryos were fixed in 2% formaldehyde. Primaryantibodies were incubated overnight at 4 °C using the following dilutions:serotonin, 1:1,000 (Sigma-Aldrich); Endo1, 1:250 (33); SynB (1e11), 1:1,000(34); and SoxB1, 1:1,000 (21). Bound primary antibodies were detected byincubation with Alexa-coupled secondary antibodies for 1 h.

ACKNOWLEDGMENTS.We thank Dr. Sarah Knox for assistance with confocalmicroscopy and Dr. Robert Burke for the SynB antibody. This work wassupported by the Intramural Research Program, National Institute of Dentaland Craniofacial Research.

1. Nakajima Y, Kaneko H, Murray G, Burke RD (2004) Divergent patterns of neuraldevelopment in larval echinoids and asteroids. Evol Dev 6:95–104.

2. Burke RD, et al. (2006) A genomic view of the sea urchin nervous system. Dev Biol 300:434–460.

3. Yaguchi S, Yaguchi J, Burke RD (2006) Specification of ectoderm restricts the size ofthe animal plate and patterns neurogenesis in sea urchin embryos. Development 133:2337–2346.

4. Wei Z, Yaguchi J, Yaguchi S, Angerer RC, Angerer LM (2009) The sea urchin animalpole domain is a Six3-dependent neurogenic patterning center. Development 136:1179–1189.

5. Bradham CA, et al. (2009) Chordin is required for neural but not axial development insea urchin embryos. Dev Biol 328:221–233.

6. Lapraz F, Besnardeau L, Lepage T (2009) Patterning of the dorsal-ventral axis inechinoderms: Insights into the evolution of the BMP-chordin signaling network. PLoSBiol 7:e1000248.

7. Yaguchi S, Yaguchi J, Angerer RC, Angerer LM, Burke RD (2010) TGFβ signalingpositions the ciliary band and patterns neurons in the sea urchin embryo. Dev Biol347:71–81.

8. Saudemont A, et al. (2010) Gene regulatory network analysis in an echinoderm revealsancestral regulatory circuits regulating ectoderm patterning and morphogenesisdownstream of nodal and BMP2/4. PLoS Genet 6:e1001259.

9. Hartenstein V (1997) Development of the insect stomatogastric nervous system.Trends Neurosci 20:421–427.

10. Burns AJ, Pachnis V (2009) Development of the enteric nervous system: Bringingtogether cells, signals and genes. Neurogastroenterol Motil 21:100–102.

11. Nikitina N, Sauka-Spengler T, Bronner-Fraser M (2009) Chapter 1: Gene regulatorynetworks in neural crest development and evolution. Curr Top Dev Biol 86:1–14.

12. Poustka AJ, et al. (2007) A global view of gene expression in lithium- and zinc- treatedsea urchin embryos: New components of gene regulatory networks. Genome Biol8:R85.1–18.

13. Tsutsui H, Karasawa S, Shimizu H, Nukina N, Miyawaki A (2005) Semi-rational engineeringof a coral fluorescent protein into an efficient highlighter. EMBO Rep 6:233–238.

14. Peter IS, Davidson EH (2010) The endoderm gene regulatory network in sea urchinembryos up to mid-blastula stage. Dev Biol 340:188–199.

15. Ransick A, Rast JP, Minokawa T, Calestani C, Davidson EH (2002) New early zygoticregulators expressed in endomesoderm of sea urchin embryos discovered bydifferential array hybridization. Dev Biol 246:132–147.

16. Bolouri H, Davidson EH (2003) Transcriptional regulatory cascades in development:Initial rates, not steady state, determine network kinetics. Proc Natl Acad Sci USA 100:9371–9376.

17. Bylund M, Andersson E, Novitch BG, Muhr J (2003) Vertebrate neurogenesis iscounteracted by Sox1–3 activity. Nat Neurosci 6:1162–1168.

18. Graham V, Khudyakov J, Ellis P, Pevny L (2003) SOX2 functions to maintain neuralprogenitor identity. Neuron 39:749–765.

19. Kenny AP, Oleksyn DW, Newman LA, Angerer RC, Angerer LM (2003) Tight regulationof SpSoxB factors is required for patterning and morphogenesis in sea urchinembryos. Dev Biol 261:412–425.

20. Davidson EH, et al. (2002) A genomic regulatory network for development. Science295:1669–1678.

21. Kenny AP, Kozlowski D, Oleksyn DW, Angerer LM, Angerer RC (1999) SpSoxB1,a maternally encoded transcription factor asymmetrically distributed among early seaurchin blastomeres. Development 126:5473–5483.

22. Oliveri P, Davidson EH, McClay DR (2003) Activation of pmar1 controls specification ofmicromeres in the sea urchin embryo. Dev Biol 258:32–43.

23. Sethi AJ, Angerer RC, Angerer LM (2009) Gene regulatory network interactions in seaurchin endomesoderm induction. PLoS Biol 7:e1000029.

24. Wood HB, Episkopou V (1999) Comparative expression of the mouse Sox1, Sox2 andSox3 genes from pre-gastrulation to early somite stages. Mech Dev 86:197–201.

25. Reversade B, Kuroda H, Lee H, Mays A, De Robertis EM (2005) Depletion of Bmp2,Bmp4, Bmp7 and Spemann organizer signals induces massive brain formation inXenopus embryos. Development 132:3381–3392.

26. Masui S, et al. (2007) Pluripotency governed by Sox2 via regulation of Oct3/4expression in mouse embryonic stem cells. Nat Cell Biol 9:625–635.

27. Yamanaka S, et al. (2008) Pluripotency of embryonic stem cells. Cell Tissue Res 331:5–22.

28. Levine AJ, Brivanlou AH (2007) Proposal of a model of mammalian neural induction.Dev Biol 308:247–256.

29. Tropepe V, et al. (2001) Direct neural fate specification from embryonic stem cells: Aprimitive mammalian neural stem cell stage acquired through a default mechanism.Neuron 30:65–78.

30. Tzouanacou E, Wegener A, Wymeersch FJ, Wilson V, Nicolas JF (2009) Redefining theprogression of lineage segregations during mammalian embryogenesis by clonalanalysis. Dev Cell 17:365–376.

31. Liu MT, Kuan YH, Wang J, Hen R, Gershon MD (2009) 5-HT4 receptor-mediatedneuroprotection and neurogenesis in the enteric nervous system of adult mice. JNeurosci 29:9683–9699.

32. Yaguchi S, Yaguchi J, Angerer RC, Angerer LM (2008) A Wnt-FoxQ2-nodal pathwaylinks primary and secondary axis specification in sea urchin embryos. Dev Cell 14:97–107.

33. Wessel GM, McClay DR (1986) Two embryonic, tissue-specific molecules identified bya double-label immunofluorescence technique for monoclonal antibodies. J HistochemCytochem 34:703–706.

34. Burke RD, et al. (2006) Neuron-specific expression of a synaptotagmin gene in the seaurchin Strongylocentrotus purpuratus. J Comp Neurol 496:244–251.

Wei et al. PNAS | May 31, 2011 | vol. 108 | no. 22 | 9147

DEV

ELOPM

ENTA

LBIOLO

GY

Dow

nloa

ded

by g

uest

on

Aug

ust 1

, 202

0