Dining on DNA - TeacherTubecdn-media1.teachertube.com/doc604/18423.pdf · Chocolate Flavored...

1

Dining on DNA

A food biotechnology unitfor high school students and teachers

1996. Created by the Montana State University Extension Service.

Introduction ........................................... 3

Summary of Unit Contents ................................ 4

Design of the Unit ....................................... 5

Welcome to the World of Biotechnology: It’s Time to Eat .......... 7

Laboratory: Making Yogurt, an Ancient Chinese Secret? ........... 24

Laboratory: Who Put the DNA in My Salad? ................... 36

Building Life: How Do You Think It Works? .................... 49

Chocolate Flavored Cherries: An Exercise in Recombinant

DNA Technology ..................................... 61

Risky Business or Stupendous Solutions? A Risk/Benefit Analysis

of Food Biotechnology .................................. 73

Investigating Careers in Biotechnology ...................... 94

To Label or Not to Label? A Food Biotech Labeling Exercise ........ 99

An Exploration0f Food Biotechnology

3

Tomatoes that ripen on the vine longer…frost-resistant

strawberries…low-fat potato chips...higher protein grains

for third-world countries…

All of these are applications of biotechnology in the area of food

production, processing and agriculture. We hear bits and pieces

about this subject on the evening news and read an occasional

headline, but what does it all mean to us and to the safety and

abundance of our food supply? This unit seeks to answer these

questions through laboratories and activities designed for the high

school biology and social studies classrooms. It is a constant teaching

challenge to effectively incorporate current topics and exciting new

technologies into an existing curriculum. It is the goal of this unit

to help teachers meet this challenge.

Since the first gene was recombined, the field of biotechnology has

sprung from the starting gate, rounding the corners of the scientific

track at a blistering pace. Biotechnology has and will continue to have

a profound impact on society, touching such issues as agricultural

practices, environmental pollution, world hunger and health care.

On a more day-to-day level, biotechnology will greet us as daily food

choices in the supermarket, or, for many, a career path. Scientific

literacy concerning biotechnology will ultimately affect the

individual’s ability to make informed decisions and choices.

The high school students of today are tomorrow’s primary consumers.

Many are already responsible for their own food choices as well as food

choices for their families. Through this unit, these students will gain

skills which will help them to evaluate and process the existing and

rapidly emerging information concerning biotechnology in food

and agriculture.

Introduction

4

Summaryof Unit Contents

In total, this unit contains eight individual activities. Each activity is

designed to be completed in one or two class periods. Hence, a two-

week time slot would be necessary to incorporate the entire module

into one course. An interdisciplinary approach in which different

activities are being conducted concurrently would shorten this

timeline. All activities may also be used individually as well.

The unit begins with an introduction to biotechnology and food.

During this introduction, students walk through a food biotechnology

timeline and gain a historical perspective regarding the applications of

biotechnology in food production throughout time. Food sampling is

a component of this activity which is sure to spark the students’

enthusiasm for the unit!

Next, the students create a commonly eaten food (yogurt) through

an ancient application of biotechnology (fermentation). Following this

laboratory, the students are exposed to today’s most current

applications. This journey begins with an introduction to DNA via

a laboratory in which the students extract this genetic material from

an onion.

A DNA modeling activity is next. During the modeling, students

learn the structural details of this important genetic material. Most

importantly, they initiate their quest in learning how DNA dictates

the form and function of an organism. Background information on

protein synthesis follows the modeling activity. Next, the students

are introduced to recombinant DNA technology through a simulation

activity in which they are given the instructions to create a chocolate

flavored cherry. The conceptual link between changes in DNA and

changes in an organism’s form and function is introduced through

this activity.

The final three activities move from the laboratory science arena

into the social science spectrum. However, even if the unit is being

conducted solely in the science classroom, these cumulative activities

are valuable in that they allow the students to apply their scientific

knowledge to a problem solving/critical thinking scenario.

The risk/benefit activity presents the students with actual applications

of food biotechnology which are currently being investigated in the

scientific world. The students, by assessing the risks and benefits of

these applications, come to conclusions as to whether or not to send

this food to market. Next, the students investigate career opportunities

in the field of biotechnology. Each student seeks out detailed

information on one particular career of interest and presents his

findings to the class, so all will gain exposure to a variety of

biotechnology career options. Finally, students will investigate topics

related to the labeling of genetically modified foods including

regulatory agencies, present legislation, consumer group concerns

and industry concerns.

Student activiy sheets are

identified by the logo:

STU

DENT ACTIVITY

DINI N G O N D

NA

Answer sheets and informationsheets directed to teachers areidentified by the logo:

5

Designof the Unit

The Interdisciplinary FactorThe Interdisciplinary FactorThe Interdisciplinary FactorThe Interdisciplinary FactorThe Interdisciplinary FactorThe subject matter related to biotechnology and food lends itself well

to being presented in an interdisciplinary educational setting. The

social sciences and biological sciences are well represented in the topics

of food biotechnology. The subject matter also is relevant in the family

and consumer science arena. Thus, this unit has been designed to be

optimally utilized in the interdisciplinary setting. It is important, at

this time, to define the term interdisciplinary as it applies to this

specific unit. Here, interdisciplinary is defined as a curriculum

approach that consciously applies methodology and language from

more than one discipline to examine a central theme, issue, problem,

topic or experience. The central theme here is food biotechnology, of

course.

It is suggested that if the unit is to be utilized concurrently in two

physically separate classroom settings, that the teachers use a common

prep time for the duration of the unit so that the individual classroom

activities will complement one another.

The Learning Cycle Educational ModelThe Learning Cycle Educational ModelThe Learning Cycle Educational ModelThe Learning Cycle Educational ModelThe Learning Cycle Educational ModelThis unit was developed with the Learning Cycle Model for science

teaching. The Learning Cycle Model closely mimics the actions of

scientists in the real world through its three- stage investigative

approach. Within the first stage of the Learning Cycle (the exploration

phase), the students are introduced to a new concept through their

observation or participation in an activity or laboratory exercise.

With little or no background information, the students develop the

concept for themselves through their experience with the activity.

During the second phase of the Learning Cycle, the concept which was

introduced in the exploration phase is studied, identified and verbally

specified by using the tools acquired in the exploration phase. This is

the invention stage. During the third and final phase of the Learning

Cycle (called the discovery phase), the student is given the opportunity

to deal with the learned concept in a variety of problem-solving

situations.

This three-stage approach to learning provides the students with the

opportunity to move from the concrete to the abstract level by

building mental structures. The role of the teacher is that of discussion

leader rather than information dispenser, nurturing the student’s

developing skills in creative problem solving and critical thinking.

The Learning Cycleexploration

discovery invention

7

Welcome tothe World ofBiotechnology

It’s Time to Eat!

Summary:Summary:Summary:Summary:Summary:This activity serves as an introduction to the entire unit on biotech-

nology and food. Here, students will gain an appreciation for the age

and diverse scope of biotechnology by observing applications to food

items throughout a long history of humankind’s utilization of living

systems in food preparation and production. Stations will be set up

around the classroom. At each station will be a food of a specific time

period which has an associated biotechnology application. A brief

description of the food/technology association and related questions

for students will also be at each station.

Objectives:Objectives:Objectives:Objectives:Objectives:• Students will gain an appreciation of the ubiquitousness of

biotechnology applications in food production and processing.

• Students will gain some perspective as to when various techniques

of biotechnology were introduced.

• Students will brainstorm as to how living systems/organisms

function to alter a food product.

Materials:Materials:Materials:Materials:Materials:• food item for each time period. The following are the foods

suggested in this activity. However, there are many other

appropriate examples. Teachers may want to customize this part

of the activity according to appropriate foods that are readily

available and not too expensive:

• B.C. time period: leavened bread

• 1 A.D. –1900 A.D. : peas

• 900–1970: corn (hybrids are the focus here)

• 1970–1996: milk

• Future: tomatoes, peanuts, potato chips, popcorn

(any or all of these may be represented for this time period)

• paper plates, cups, bowls, and utensils as needed for each station.

• informational 3 x 5 card for each time period

• Challenge Questions 3 x 5 card for each time period.

• Student Answer Sheet

• Teacher Additional Background Information Sheet

8

Welcome tothe World ofBiotechnology

It’s Time to Eat!

Procedure:Procedure:Procedure:Procedure:Procedure:Teacher sets up stations around the classroom prior to the beginning

of class. Each station will depict a specific time period through a food

representing the biotechnology applications of that time period.

The five time periods to be represented are:

• B.C.

• 1 A.D.–1900 A.D.

• 1900 A.D.–1970 A.D.

• 1970 A.D.–1996 A.D.

• Future

The individual time period stations should be set up as follows:

• food sample of the time period, enough for each

student to sample the food. For example, B.C. time

period would have a plate of leavened bread slices.

• any appropriate cup, plate, or utensil needed to sample the food.

• informational 3 x 5 card: Each time period station has a 3 x 5

information card which discusses the link between food and

biotechnology for that time period.

• Student Questions on a 3 x 5 card: Each time period station has a

3 x 5 card which has several questions for students to answer.

When the students enter the classroom, they will be:

• given a brief introduction to the activity,

• divided into five groups (group size dependent on class size),

• provided with the student answer sheet to fill in as they travel

through the stations.

Each group will begin at a different station. The group will sample the

food, read about the associated food/biotechnology link and answer

the student questions. Students should have approximately five to ten

minutes at each station. Teacher should announce when it is time to

switch stations. Groups should move in a sequential direction so that

all groups get to all five stations within the class period.

Class Discussion:Class Discussion:Class Discussion:Class Discussion:Class Discussion:At the next class period, the teacher asks each group to present to the

class the answers to the questions from a specific time period.

Teachers:Teachers:Teachers:Teachers:Teachers: In setting up the stations

around the room, you may

choose to present a “contrasting”

food at some of the stations.

This food would be one that

was produced without any

biotechnology application.

For example, at station one,

you could present matzo along-

side the leavened bread as a

comparison of the changes

which can be attributed to

the biotechnology application.

9

It’s Time to Eat

Station InformationStation InformationStation InformationStation InformationStation Informationand Questionsand Questionsand Questionsand Questionsand Questions

Station #1: Time Period = B.C.Station #1: Time Period = B.C.Station #1: Time Period = B.C.Station #1: Time Period = B.C.Station #1: Time Period = B.C.

Suggested Food: Leavened Bread

Food/Biotechnology LinkStation #1: Time Period = B.C.

Can you imagine life without bread as we know it? Before 2000 B.C., the

bread that people ate was flat and hard. Then Egyptians discovered yeast,

a living organism that makes bread rise. These ancient people used yeast

to modify bread, yet never fully understood how the process worked. In

fact, no one would understand exactly how yeast makes bread rise until

nearly 38 centuries later.

Student Challenge QuestionsStation #1: Time Period = B.C.

1. Would you consider the ancient Egyptians to be biotechnologists?

Why? Why not?

2. How do you think yeast causes bread to rise?

3. a. What do you think the Latin root “bio” means?

b. Define the word “technology”.

10

It’s Time to Eat


Station #2: Time Period = Station #2: Time Period = Station #2: Time Period = Station #2: Time Period = Station #2: Time Period = 1 A.D.–1900 A.D.1 A.D.–1900 A.D.1 A.D.–1900 A.D.1 A.D.–1900 A.D.1 A.D.–1900 A.D.

Suggested Food: Peas

Food/Biotechnology LinkStation #2: Time Period = 1 A.D.–1900 A.D.

An Introduction to Mendelian Genetics

Do you play with your food? Most of us get in trouble for playing with

food, but Gregor Mendel didn’t. In fact, Mendel spent his life playing with

peas. He noticed that not all peas looked alike and that some characteristics

or traits showed up more often than others. In other words, some traits are

“dominant” over others. Mendel also recognized that many peas from the

same family had similar characteristics. He then began to mix or breed

families of peas with desirable traits such as richer color, better texture

and more flavor. This mixing to produce a better crop is called

classical breeding .

Student Challenge QuestionsStation #2: Time Period = 1 A.D.–1900 A.D.

1. Some traits are dominant over others. However, simply because a

trait is dominant does not necessarily mean it is desirable. If you

were a plant breeder and wanted your plants to express (have the

phenotype of) a recessive trait, how would you conduct your

breeding experiments?

2. For the following foods, list one characteristic, or desirable trait

that may have been “bred” for in that food:

• oranges

• grapes

• turkeys

11

It’s Time to Eat


Station #3: Time Period = Station #3: Time Period = Station #3: Time Period = Station #3: Time Period = Station #3: Time Period = 1900–19701900–19701900–19701900–19701900–1970

Suggested Food: Corn

Food/Biotechnology LinkStation #3: Time Period = 1900–1970

Application of Mendelian Genetics

What do you get when you cross Lassie with a pit bull? A dog that bites off

you leg and then runs to get help! Seriously, scientists have been attempting

to combine the desirable characteristics of different plants or animals for

centuries. Traditionally, this has been done by classical breeding . The

application of Mendelian genetics to classical breeding has led to the

formation of hybrids , or plants containing the best traits from their two

different parents. The corn we eat today is a hybrid of many varieties

of corn plants.

Student Challenge QuestionsStation #3: Time Period = 1900–1970

1. If you could mix any two plants to form a hybrid , what two plants

would you mix? Why these two? What name would you give

your hybrid?

2. What food(s) have you eaten that may be considered to be

a hybrid(s)?

12

It’s Time to Eat


Station #4: Time Period = 1970–1996Station #4: Time Period = 1970–1996Station #4: Time Period = 1970–1996Station #4: Time Period = 1970–1996Station #4: Time Period = 1970–1996

Suggested Food: Milk

Food/Biotechnology LinkStation #4: Time Period = 1970–1996

The pituitary gland at the base of the brain in all mammals produces

growth hormones. Cow growth hormone is called bovine somatotropin

(BST) . Scientists have known since the 1930s that injecting dairy cows with

this pituitary substance increases milk yield. The production of BST in large

quantities could allow dairy farmers to produce milk at lower cost.

Biotechnologists can produce large quantities of a biosynthetic version of

the naturally occurring BST in the laboratory. Bovine somatotropin

prepared in the laboratory is called recombinant BST (or rBST).

Student Challenge QuestionsStation #4: Time Period = 1970–1996

1. Do you have any worries or concerns about drinking milk that has

come from cows injectedwith recombinant BST?

What are your concerns?

2. Some dairy farmers refuse to use recombinant BST.

Can you think of a reason why?

13

It’s Time to Eat


Station #5: Time Period = FutureStation #5: Time Period = FutureStation #5: Time Period = FutureStation #5: Time Period = FutureStation #5: Time Period = Future

Suggested Food: Any fruit or vegetable, potato chips, popcorn, etc.

Food/Biotechnology LinkStation #5: Time Period = Future

Here are some examples of some foods scientists are working onfor the not-too-distant future:

• fruits and vegetables with higher levels of nutrients suchas Vitamin C

• lower fat french fries and potato chips• garlic cloves with more allicin, a substance which helps to

lower a person’s cholesterol• popcorn that is modified to taste better so that people won’t

be so tempted to add lots of salt and butter.

Student Challenge QuestionsStation #5: Time Period = Future

1. List one of your favorite foods.

2. What new trait would make this food even better?

3. List one of your least favorite foods.

4. What new trait would make this food better?

5. Do you feel that changing foods to exhibit more desirabletraits is OK? Explain why or why not.

14

It’s Time to Eat Station 1: Time Period = B.C.Station 1: Time Period = B.C.Station 1: Time Period = B.C.Station 1: Time Period = B.C.Station 1: Time Period = B.C.

1. _____________________________________________________

______________________________________________________

______________________________________________________

2. _____________________________________________________

______________________________________________________

______________________________________________________

3 a. ____________________________________________________

______________________________________________________

______________________________________________________

3b. ____________________________________________________

______________________________________________________

__________________________________________________________________________________________________________________________________________________________________________________________________________________

Station 2: Time Period = Station 2: Time Period = Station 2: Time Period = Station 2: Time Period = Station 2: Time Period = 1 A.D.–1900 A.D.1 A.D.–1900 A.D.1 A.D.–1900 A.D.1 A.D.–1900 A.D.1 A.D.–1900 A.D.

1. _____________________________________________________

______________________________________________________

______________________________________________________

2. oranges: ______________________________________________

grapes: _______________________________________________

turkeys: ______________________________________________

STU

DENT ACTIVITY

DINI N G O N D

NA

Answer Sheet for StudentAnswer Sheet for StudentAnswer Sheet for StudentAnswer Sheet for StudentAnswer Sheet for StudentChallenge QuestionsChallenge QuestionsChallenge QuestionsChallenge QuestionsChallenge Questions

15

It’s Time to Eat Station 3: Time Period = Station 3: Time Period = Station 3: Time Period = Station 3: Time Period = Station 3: Time Period = 1900–19701900–19701900–19701900–19701900–19701. What two plants and why these two? ______________________

___________________________________________________

Name: ______________________________________________

2. ___________________________________________________

Station 4: Time Period = Station 4: Time Period = Station 4: Time Period = Station 4: Time Period = Station 4: Time Period = 1970–19961970–19961970–19961970–19961970–19961. ___________________________________________________

___________________________________________________

___________________________________________________

2. ___________________________________________________

___________________________________________________

___________________________________________________

Station 5: Time Period = FUTUREStation 5: Time Period = FUTUREStation 5: Time Period = FUTUREStation 5: Time Period = FUTUREStation 5: Time Period = FUTURE1. ___________________________________________________

2. ___________________________________________________

___________________________________________________

3. ___________________________________________________

4. ___________________________________________________

___________________________________________________

5. ___________________________________________________

___________________________________________________

___________________________________________________

Final Question:Final Question:Final Question:Final Question:Final Question:All of the foods at the stations were produced using some type of

biotechnology. In your own words, define biotechnology.

______________________________________________________________

_____________________________________________________

_____________________________________________________

_____________________________________________________

_____________________________________________________

_____________________________________________________

_____________________________________________________

STU

DENT ACTIVITY

DINI N G O N D

NA

16

It’s Time to Eat Station #1Station #1Station #1Station #1Station #1

1. Would you consider the ancient Egyptians to be biotechnologists?

Why? Why not?

This question is designed to provoke students to think about what

biotechnology is and what it entails. At this point in the unit, students

cannot comprehend the full scope of biotechnology, but they can

make judgements about what makes a person a biotechnologist.

In fact, the Egyptians were biotechnologists because they manipulated

a biological system to make a product. In general, biotechnology can

be defined as the use of living organisms to make a product or run

a process.

2. How do you think yeast causes bread to rise?

A wide variety of answers are possible here, but the actual process

should be explained at some point. Yeast, a fungus of the genus

Saccharomyces, has been used as a leavening agent for more than

six thousand years. Yeast metabolizes sugar in bread dough under

anaerobic conditions and converts the sugar to carbon dioxide.

As yeast releases carbon dioxide, the gas expands the gluten network

in the dough, displacing volume and making the dough rise.

3. What do you think the Latin root “bio” means? Define the word

“technology”.

“Bio” means life. “Technology” means the application of knowledge,

process, invention or method for practical ends.

17

It’s Time to Eat Station #2Station #2Station #2Station #2Station #2

1. Some traits are dominant over others. However, simply because a

trait is dominant does not necessarily mean it is desirable. If you

were a plant breeder and wanted your plants to express (have the

phenotype of) a recessive trait, how would you conduct your

breeding experiments?

Identify plants that express the recessive trait. They have two

alleles coding for the recessive trait. By breeding these two

plants, expression of the recessive trait is almost guaranteed.

2. For the following foods, list one characteristic that may have

been “bred” for in that food:

oranges

grapes

turkeys

oranges: seedlessness, size, sweetness

grapes: seedlessness, size, sweetness, color

turkeys: large breast section, overall more meat, size

Station #3Station #3Station #3Station #3Station #3

1. If you could mix any two plants to form a hybrid, what two

plants would you mix? Why these two?

What name would you give the hybrid?

Any thoughtful answer would be appropriate here. A good

“supermarket” example is the tangelo, a mix between tangerines

and grapefruit.

2. What food(s) have you eaten that may be considered to be a

hybrid(s)?

Again, the tangelo example is appropriate here. By definition, however,

many high-quality foods are hybrids because they have been bred to

contain the best traits from their two parents. Therefore, some students

may answer this question with foods like hybrid corns, peas, barley,

wheat, etc.

18


1. Do you have any concerns about drinking milk that has come

from cows injected with recombinant BST? What are your

concerns?

Any thoughtful answers would be appropriate here. Answers will most

likely come in two categories:

• Negative impacts of BST on cows that are injected with the

hormone. (Example: infections in the udders (mastitis) due to

engorgement with milk.)

• Negative effects BST may have on humans who consume milk of

cows that are injected with the hormone. (No known negative

effects on those who consume milk from BST treated cows have

been identified.)

2. Some dairy farmers refuse to use recombinant BST. Can you think

of a reason why?

This question should encourage some ethical debate. If discussion is

progressing slowly on its own you may want to have them consider the

following issues:

• consumer acceptance of this new product

• concerns about the viability of the small family farm

• have all health issues been addressed?


1. List one of your favorite foods?

Example: raspberries

2. What new trait would make this food even better?

Example: Why do raspberries have so many seeds? All those seeds get

stuck in my teeth! If I could get rid of the raspberry seeds, I would eat

raspberries more often.

3. List one of your least favorite foods?

Example: anchovies

4. What new trait would make this food better?

Example: Anchovies are too salty, and they smell too “fishy”. I would

grow salt- free, odorless anchovies.

It’s Time to Eat

19

It’s Time to Eat 5. Do you feel that changing foods to exhibit more desirable traits is

OK? Explain.

Most people are uneasy with change, so the students’ first instinct may

be that changing foods to exhibit more desirable characteristics might

somehow endanger human health. It should be explained that

knowing the facts prepares a person to make good decisions. This unit

will prepare students both to be informed consumers and to make

rational decisions about genetically altered foods.

Final Question:Final Question:Final Question:Final Question:Final Question:

All of the foods at the stations were produced using some type of

biotechnology. In your own words, define biotechnology.

Biotechnology is the use of living systems to make a product or run a

process. At this point, students may not be able to come up with a good

definition. That’s okay. You might want to ask this question several

times throughout the course of this unit, because students will develop

a better understanding of biotechnology as the unit progresses.

20

It’s Time to Eat Station 1: Time Period B.C.Station 1: Time Period B.C.Station 1: Time Period B.C.Station 1: Time Period B.C.Station 1: Time Period B.C.

Technology: Yeast for Leavened Bread

Yeast, a fungus of the genus Saccharomyces , has been used as a leavening

agent for more than six thousand years. Yeast metabolizes sugar in

bread dough and, under anaerobic conditions, converts the sugar into

carbon dioxide. As yeast releases carbon dioxide, the gas displaces

volume in the dough, and the dough begins to rise.

Possible concepts for expansion:

The use of yeast as a leavening agent is a classic example of

fermentation, the process by which microbes convert complex

compounds like sugar into simpler compounds like carbon dioxide,

alcohol, and lactic acid. In addition to (or in place of) the “Making

yogurt” lab, teachers may wish to further emphasize the concept of

fermentation through a hands-on activity like brewing rootbeer.

Brewing takes approximately two weeks, so teachers should begin

brewing at the start of the unit.

Another possible expansion avenue to explore during this activity

would be to have a dish with active yeast, warm water and sugar set up

at this station. Here students would see the gas production of the yeast

by viewing the bubbling of this mixture.

Station 2: Time Period Station 2: Time Period Station 2: Time Period Station 2: Time Period Station 2: Time Period 1 A.D.–1900 A.D.1 A.D.–1900 A.D.1 A.D.–1900 A.D.1 A.D.–1900 A.D.1 A.D.–1900 A.D.

Technology: Introduction to Mendelian Genetics

The “It’s Time to Eat” activity briefly introduces Mendel and the

concept of inheritance. By the end of the activity, students should

at least understand dominance . Teachers may wish to delve further

into Mendelian genetics by introducing the concepts of genes ,

alleles , homozygotes , heterozygotes , complete dominanc e,

incomplete dominance , recessive traits , codominance , phenotypes ,

and genotypes .

These concepts can be presented systematically via a description

of Mendel s garden pea (Pisum sativum) experiments and the

simultaneous development of either a Punnett square or a pedigree

diagram for the experiment. Most biology textbooks contain a

“genetics” section that goes through Mendel’s experiments and

introduces more advanced concepts than those presented in

this activity.

This sheet is designed toprovide the teacher withadditional informationabout the technologiespresented in the It’s Timeto Eat activity. This sheetmay be used by the teacheras an informational basisfor expanding the activityas he or she desires.

21

It’s Time to Eat Station 3: Time Period Station 3: Time Period Station 3: Time Period Station 3: Time Period Station 3: Time Period 1900–19701900–19701900–19701900–19701900–1970

Technology: Hybrids As An Application of MendelianGeneticsHybridization can be explained as an application of Mendelian

genetics. Hybrids are the offspring of two organisms of different

varieties, species, or genera. A monohybrid is the result of crossing

parents that differ in only one desirable trait. A dihybrid is the result

of crossing parents that differ in two desirable traits. A trihybrid is the

result of crossing parents that differ in three desirable traits. Classical

breeding is a biotechnology technique based on Mendelian genetics

in which hybrids are created by crossing two organisms expressing

desired traits. This technology has been utilized for centuries, even

prior to Mendel’s discoveries.

Possible concepts for expansion:A hands-on demonstration of Mendel’s hybridization method

may give students a better understanding of classical breeding as

biotechnology.

Explanation of Mendel’s Hybridization Method withPea Plants:In the case of pea plants, the pollen and eggs from a single flower

engage in self-fertilization. The stamen (containing pollen) and the

ovary (containing ovule s) are enclosed in a floral part called the keel

so pollen from one flower cannot reach the ovules of another flower.

Therefore, the keel must be removed and the stamens must be cut off

to pollenate one plant with another plant. If the ovaries are left

alone, pollen from one flower can be applied manually to another

flower. After fertilization, the ovary develops into the fruit or pod,

and its ovules develop into the seed or peas. Each pea may be

germinated to develop a hybrid plant of the next generation.

For more advanced classes, this may be a good time to present

transgenics by comparing and contrasting the use of hybridization

in classical breeding with the use of transgenics in modern breeding

techniques. Scientists today can insert foreign genes for insect

resistance into corn in order to reduce insect damage. A transgenic

organism is one that carries within its own genome DNA sequences

inserted by laboratory techniques. A trangene is one that was inserted

into a foreign genome by laboratory techniques. These concepts will

be examined in depth later in this unit.

22

It’s Time to Eat Station 4: Time Period Station 4: Time Period Station 4: Time Period Station 4: Time Period Station 4: Time Period 1970–19961970–19961970–19961970–19961970–1996

Technology: Bovine Somatotropin (BST)Somatotropin is a mammalian hormone produced in the anterior

pituitary gland beneath the brain. This hormone regulates growth

and affects the metabolism of all classes of nutrients. Insufficient

somatotropin production in humans leads to dwarfism, but medically

advanced countries do not have a problem with dwarfism because

babies diagnosed for insufficient somatotropin production may be

treated with human somatotropin injections. Somatotropin is not

orally active, so it is administered directly into the circulatory system.

Many farmers inject their dairy cows with somatotropin, called bovine

somatotropin. An abundance of the hormone in dairy cattle increases

milk yield by 10%-20%, increases productive efficiency (measured by

kilogram weight gain per kilogram feed) by 15%-35%, and reduces fatty

tissue by nearly 80%.

The Food and Drug Administration, the National Institutes of Health,

the United States Congress Office of Technology Assessment, and the

American Academy of Pediatrics have determined that bovine

somatotropin (BST) use is safe for three reasons:

• BST is a protein, and all plant and animal protein is degraded into

single amino acids in the stomach;

• nonprimate somatotropin does not affect humans; and

• the cooking process (pasteurization) denatures somatotropin and

renders the hormone biologically inactive.

Today, most of the BST administered to dairy cows is manufactured in

the laboratory via recombinant DNA technology. This allows for an

adequate supply of the hormone for all of the dairy farmers who wish

to utilize it. The students have not been introduced to recombinant

DNA technology at this time, however, you may choose to include the

fact that BST is a product of a more involved technology.

23

It’s Time to Eat Station 5: Time Period FUTUREStation 5: Time Period FUTUREStation 5: Time Period FUTUREStation 5: Time Period FUTUREStation 5: Time Period FUTURE

More and more researchers are looking into new ways of applying

techniques of modern molecular biology to practices in food

production, food processing and agriculture. It is projected that by the

year 2030, the world’s population will triple, but the number of

cultivated areas will not even double. This strain on agricultural

resources will undoubtedly result in greater world hunger (lack of food

security). Modifying plants to withstand environmental hardships

such as heat and drought has the potential for more plentiful, higher

quality crop yields. The development of pest-resistant crops may help

reduce overall chemical stress on the environment by reducing the

overall applications of chemical pesticides. Creating more nutrient

dense forms of staple foods in third world countries has the potential to

lessen disease states and enhance overall wellness of the world’s poor.

Yet, the questions remain, are we looking at the whole picture? Will the

practices of “genetic engineering” in agriculture negatively impact

ecosystems by limiting biodiversity? Could plants engineered to

contain virus particles in order to ward off pests pose a risk by having

the potential to create a new virus which could then go on to

negatively impact that or another crop? These questions are, as of yet,

unanswered, but thought provoking. The journey in which you will be

investigating food biotechnology promises to be one laden with

provocative questions and opportunities for creative problem-solving.

Keep in mind that food biotechnology is a subject area that can

be approached from many tacks such as history, economics,

environmental science, molecular biology, ethics, governmental/

legislative issues, food safety, and more. Many opportunities exist

for scintillating discussion regarding these issues. Enjoy!

Remember:

There’s lots of food biotechnology

information and ideas for classsroom

activities available online. See the

resource list at the end of the unit for

a few of these interesting cyberspace

references!

24

Laboratory:Making Yogurt,an AncientChineseSecret?

Humans began to realize the benefits of food biotechnology long ago.

In fact, as far back as 6000 B.C. the Sumerians and Babylonians utilized

yeast in beermaking. Today on the supermarket shelves we have the option

to buy yogurt with dinosaurs on the label or colored sprinkles neatly

packaged atop the lid. One would hardly guess that this seemingly modern

product has been around for thousands of years! Hold onto your hat! We

are traveling back in time to where we will harness some bacterial power

and make yogurt!

Summary:Summary:Summary:Summary:Summary:Students are exposed to traditional biotechnology techniques as

they observe and participate in the production of a fermented milk

product: yogurt.

Objectives:Objectives:Objectives:Objectives:Objectives:• Students will gain an appreciation for the long history of the

association between biotechnology and food production/

processing.

• Students will recognize biotechnology as the utilization of a

living organism to make a product or run a process.

• Students will discover fermentation as an application of

biotechnology.

• Students will examine the biochemical conversions that take

place during the fermentation of milk into yogurt and how

these changes contribute to food preservation.

• Students will learn about microorganisms considered to be

“beneficial”.

• Students will examine the physical characteristics of the

bacteria used in the yogurt production.

Suggested Time:Suggested Time:Suggested Time:Suggested Time:Suggested Time:Two class periods.

25


Materials Needed:Materials Needed:Materials Needed:Materials Needed:Materials Needed:• a container of commercial yogurt (this will be used as a

starter culture).

Teacher Note: Not all commercially available yogurt contains

live cultures. Some has been pasteurized. So be sure the yogurt

container you choose has the words “Contains Live Culture”

or “Contains Active Culture”.

• applicator sticks

• pH test paper

• slides

• Each lab group needs two 20 ml test tubes containing 10-15 ml of

whole milk fortified with 3–5% skim milk powder, freshly boiled

and cooled to 45ºC in a water bath.

Teacher Prep Hint: To fortify the whole milk with 3-5% skim

milk powder, add 3-5 g skim milk powder to 1 liter of whole milk.

Mix thoroughly until all the skim milk powder has been dissolved.

ppppp HHHHH

26


In utilizing the Learning Cycle model of science teaching, it is thought

best to allow the students to brainstorm some of the more complex “why”

questions on the post-laboratory question sheet. Therefore, it is suggested

that following this student activity, you then discuss the answers to these

questions with the whole class and allow the students to correct their own

answers prior to turning them in.

More Background Information for Teachers:More Background Information for Teachers:More Background Information for Teachers:More Background Information for Teachers:More Background Information for Teachers:The finished yogurt is the end product of a symbiotic culture of two

different bacteria, Streptococcus thermophilus and Lactobacillus

bulgaricus . This culture produces yogurt when incubated in milk

at a temperature range of 40–45°C. The optimal flavor and texture

of yogurt is achieved when these two cultures are present in equal

amounts. This 1:1 proportion of Streptococcus thermophilu s and

Lactobacillus bulgaricus is also considered to be optimal for use as

a starter culture.

At the beginning of the fermentation process, the Streptococcus

thermophilus grow faster, producing by-products which ultimately set

up a favorable environment for the Lactobacillus bulgaricus growth.

The major overall chemical change is the conversion of lactose to

lactic acid. The final pH of yogurt following fermentation is 4.2–4.3.

This acidic environment does not allow for the growth of many

pathogenic microbes and thus serves to preserve the food.

Note: Streptococcus thermophilus is a non-pathogenic strain of

streptococcus. It is not the strain responsible for “strep throat” and

other human illness.

Time (Hours)

The growth curves of S. thermophilus and L. bulgaricus during the

conversion of milk to yogurt.

27


Humans began to realize the benefits of food biotechnology long ago. In

fact, as far back as 6000 B.C. the Sumerians and Babylonians utilized yeast

in beermaking. Today on the supermarket shelves we have the option to

buy yogurt with dinosaurs on the label or colored sprinkles neatly packaged

atop the lid. One would hardly guess that this seemingly modern product

has been around for thousands of years! Hold onto your hat! We’re traveling

back in time where we will harness some bacterial power and make yogurt!

Background Information:Background Information:Background Information:Background Information:Background Information:Fermentation of food has been used as a method of preservation since

ancient times. This process allows for longer storage of food while

preserving valuable nutrients in the food. Fermentation is an anaerobic

process in which bacteria convert complex compounds, such as sugars,

into simpler compounds, such as alcohol, lactic acid or carbon dioxide.

The bacteria used in fermentation are often found in that food

naturally, yet not in high enough concentration to ensure that the

fermentation process will be successful for preservation. So, human-

kind has stepped in to use the natural power of these bacteria to

enhance food quality and availability.

Laboratory Procedure:Laboratory Procedure:Laboratory Procedure:Laboratory Procedure:Laboratory Procedure:Day One:1. Complete Pre-lab Questions.

2. Label the two test tubes A and B. Check the pH of both test tube

contents with the pH test paper and record your results on your

data sheet. Record the consistency, smell and taste (optional) of

the test tube contents on your data sheet.

3. Using an applicator stick, take some commercial yogurt (about

the volume of the tip of your finger, or approximately 1–2 ml.)

and put it into test tube A. This commercial yogurt is called the

starter culture . Cover it with a sterilized stopper or aluminum foil.

4. Mix the milk and the starter culture thoroughly by rolling the

tube between your hands and shaking gently.

5. Add no commercial yogurt to test tube B. Cover this test tube.

6. Put both test tubes into an incubator (oven) that is set at 45° C.

7. After four hours, the teacher will take the test tubes out of the

incubator and refrigerate.

STU

DENT ACTIVITY

DINI N G O N D

NA

28

Laboratory Procedure:Laboratory Procedure:Laboratory Procedure:Laboratory Procedure:Laboratory Procedure:Day Two:

1. Examine the test tubes observing the consistency and odor of

the contents. Record your observations on your data sheet.

2. Test the pH of the test tube contents for both test tubes A and B.

Record these values on your data sheet.

3. You may taste the contents of test tube A and record this

observation if you choose. Do not taste the contents of test tube B.

4. Put a tiny amount of the test tube A contents (< 1 ml) on a

microscope slide. Add a drop of mineral oil on top. Place a slip

cover over the slide contents. Examine the slide under the

microscope, recording your observations on the data sheet.

Repeat slide preparation and examination for test tube B contents.

(Note: Slide contents may be easier to view if they are stained with

crystal violet or safranin.)

5. Answer the post-laboratory questions.

6. Correct your own post-laboratory questions with teacher input.


STU

DENT ACTIVITY

DINI N G O N D

NA

29


Pre-lab QuestionsPre-lab QuestionsPre-lab QuestionsPre-lab QuestionsPre-lab Questions

The following questions are to be completed before beginning the

Making Yogurt laboratory activity:

1. In your own words, define biotechnology:

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

2. Describe how you think making yogurt is an application of

biotechnology?

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

3. In your own words, define fermentation.

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

4. Do you consider biotechnology a “new science”? Explain.

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

5. Read the laboratory procedure. Which treatment serves as the

control in this experiment? Why is it important to include

this control?

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

STU

DENT ACTIVITY

DINI N G O N D

NA

30


Laboratory Data SheetLaboratory Data SheetLaboratory Data SheetLaboratory Data SheetLaboratory Data Sheet

Pre-Yogurt Making Data:Pre-Yogurt Making Data:Pre-Yogurt Making Data:Pre-Yogurt Making Data:Pre-Yogurt Making Data:

Starter Culture Yogurt: Test Tube A Test Tube B

Consistency ________________ ________________

Smell ________________ ________________

Taste ________________ ________________

p H ________________ ________________

Milk: Test Tube A Test Tube B

Consistency ________________ ________________

Smell ________________ ________________

p H ________________ ________________

Post-Yogurt Making Data:Post-Yogurt Making Data:Post-Yogurt Making Data:Post-Yogurt Making Data:Post-Yogurt Making Data:Test Tube A Test Tube B

Consistency ________________ ________________

Smell ________________ ________________

Taste (Test Tube A only) ________________ ________________

p H ________________ ________________

Slide Observations:Slide Observations:Slide Observations:Slide Observations:Slide Observations:Test Tube A:

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________

Test Tube B:

______________________________________________________

______________________________________________________

______________________________________________________

STU

DENT ACTIVITY

DINI N G O N D

NA

31


Post-Lab QuestionsPost-Lab QuestionsPost-Lab QuestionsPost-Lab QuestionsPost-Lab Questions

The following questions are to be answered following completion

of the Making Yogurt laboratory activity:

1. How does the new yogurt compare to the commercial yogurt you

_ used as the “starter culture”? Do you notice any differences?

_ What might be some reasons for these?

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

2. Look at the yogurt under the microscope in an oil emersion slide.

What do you see? Can you identify any distinct shapes?

Describe them.

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

3. What chemical changes did the bacteria cause in the milk which

_ resulted in the formation of yogurt?

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

4. How does the chemical process that takes place during fermentation

_ help to preserve food?

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

5. Why should you not taste the contents of test tube B on Day Two?

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

STU

DENT ACTIVITY

DINI N G O N D

NA

32


6. Give an example of another food which is produced through the

process of fermentation.

___________________________________________________________________________

___________________________________________________________________________

___________________________________________________________________________

___________________________________________________________________________

7. Do you consider microbes in your food to be “bad”? Explain

your answer.

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

8. Going back to your definition of biotechnology in the pre-lab

questions, explain how making yogurt is an application of

biotechnology in food production.

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

STU

DENT ACTIVITY

DINI N G O N D

NA

33


Answers to Pre-Lab Questions:Answers to Pre-Lab Questions:Answers to Pre-Lab Questions:Answers to Pre-Lab Questions:Answers to Pre-Lab Questions:

1. In your own words, define biotechnology.

Of course a variety of answers is appropriate here. The intention

of the question is to initiate an association between the impending

laboratory exercise and biotechnology. Generally speaking,

biotechnology can be defined as the use of living organisms to

make a product or run a process.

2. Do you consider biotechnology to be a “new” science?

Explain your answer.

Once again a variety of responses is appropriate here. The primary

objective is to allow the student to gain an appreciation of food

biotechnology as a wide array of techniques used to change or create

a food product. Some of these techniques have been around for

thousands of years and some are state-of-the-art scientific applications.

3. Describe how you think making yogurt is an application of

biotechnology.

It is hoped that the student will recognize that some living organism

is being utilized in the yogurt making process. Any mention of a

microbe helping to change the milk to yogurt is an adequate answer.

4. In your own words, define fermentation.

Fermentation is the anaerobic process by which bacteria convert

complex compound, such as sugars, into simpler products, such as

alcohol, lactic acid and carbon dioxide.

5. Read the laboratory procedure. Which treatment serves as the

control in this experiment? Why is it important to include this

control?

Test tube B serves as the control. By including the control, the

outcome of the experimental test tube (test tube A) may be attributed

to influence of the starter culture instead of environmental variables.

In addition, controls help to identify any experimental error which

may occur.

34

Answers to Post-Lab Questions:Answers to Post-Lab Questions:Answers to Post-Lab Questions:Answers to Post-Lab Questions:Answers to Post-Lab Questions:

1. How does the new yogurt compare to the commercial yogurt you

used as the “starter culture”? Do you notice any differences?

What might be some reasons for these?

Student comparisons will be subjective. Some reasons for differences in

“starter culture” compared to “new yogurt” could be; the amount of

time new yogurt was allowed to ferment or the temperature at which

yogurt was allowed to ferment. The best flavored yogurt develops at a

point in incubation where the two bacteria in the culture are present in

approximately equal number. (See Teacher Background Information.)

Streptococcus thermophilus (the sphere-shaped bacteria) is the first to

grow in the culture. As it grows, it creates a more acidic environment.

Lactobacillu s bulgaricus (the rod-shaped bacteria) grows best in this

acidic environment (low pH) and therefore starts to grow best after the

Streptococcus thermophilus has lowered the pH. If the culture is allowed

to incubate for too long, a sour taste is created due to excessive acid

production. Refrigeration slows down the further growth of the two

bacteria and therefore prevents too much acid production.

2. Look at the yogurt under the microscope in an oil emersion slide.

What do you see? Can you identify any distinct shapes?

Describe them.

Students should be looking for the rod-shaped Lactobacillus and the

sphere-shaped Streptococcus . They should be encouraged to note the

amount of each of the bacteria. You could then take the question

further and have them assess what the amount of each of the cultures

means in terms of the outcome of the yogurt (flavor, texture). See

previous question.

3. What chemical changes did the bacteria in the starter culture

cause to take place in the milk and result in the formation of the

new yogurt?

The bacteria converted the lactose in the milk to lactic acid.

4. How does the chemical process that takes place during

fermentation help to preserve food?

The products of fermentation inhibit the growth of “food spoiling”

bacteria and fungi.


35


5. Why should you not taste the contents of test tube B on Day Two?

In test tube B, which has not been inoculated with the starter culture,

fermentation has not taken place. Therefore, the presence of

undesirable bacteria or bacteria responsible for causing food-borne

illness is likely. Fermentation helps to preserve food by lowering the

pH and therefore inhibiting the growth of these undesirable bacteria.

6. Can you give an example of another food which is produced

through the process of fermentation?

Sauerkraut, pickles, sourdough bread, kimchee, beer, wine.

7. Do you consider microbes in your food to be “bad”? Explain your

answer.

This is obviously a loaded question. It is hoped that at this point,

following the laboratory, the students will have gained an appreciation

for the positive things microbes can do in terms of food production

and preservation.

8. Going back to your definition of biotechnology in the pre-lab

questions, explain how making yogurt is an application of

biotechnology in food production.

Answer may be variable. Generally speaking, biotechnology is using

living organisms to make a product or run a process.

36

Laboratory:Who Put theDNA in MySalad?

Summary:Summary:Summary:Summary:Summary:Throughout the first activity, the students were exposed to many roles

that living organisms/systems have in the production of various foods.

The most recently discovered techniques in biotechnology are being

conducted at the molecular level. In order for the students to gain an

appreciation for this arena, they may benefit from actually seeing the

genetic material which is manipulated through today’s most state-of-

the-art techniques. In this activity, students will extract the DNA from

the cells of an onion and cause it to precipitate so that they may

actually “see” the DNA with the naked eye.

Objectives:Objectives:Objectives:Objectives:Objectives:• Students will confirm the presence of DNA in a food item

through extracting a visible mass of DNA from an onion.

• Students will gain an overview of the location of DNA in the

cell and the role of DNA in dictating the form and function of

an organism.

• Students will extrapolate how DNA can be manipulated to

change the characteristics of the food.

• Students will be introduced to modern techniques in

biotechnology and the importance of DNA in these techniques.

Suggested Time:Suggested Time:Suggested Time:Suggested Time:Suggested Time:Two class periods.

Day One: Lab preparation and introduction to DNA.

Day Two: Laboratory procedure and post lab discussion.

37


Materials Needed:Materials Needed:Materials Needed:Materials Needed:Materials Needed:

Day One (for entire class):• two 500 ml beakers

• one 1000 ml beaker

• blender

• thermometer

• large funnel

• paring knife

• cheese cloth (or #6 coffee filter)

• hot tap water bath (60 °C)

• ice water bath

• two L distilled water

• one container meat tenderizer

• one large onion

• 100 ml liquid dishwashing detergent

• 20 g NaCl (or non-iodized table salt)

• 95% ethanol ( Note: 70% isopropyl alcohol can be used

but expect a lower DNA yield. Isopropyl is readily

available in most stores.)

Day Two (for each lab group):• one 20 ml test tube with 6 ml onion filtrate

• one 10 ml test tube with 9 ml ice cold ethanol

• one test tube with 3.5 ml meat tenderizer solution

• one glass rod (200 mm long)

• test tube holders

• one 10 ml test tube with 3 ml 4% NaCl solution

• eyedropper for adding phenol red solution

38


Lab Material Hints:Lab Material Hints:Lab Material Hints:Lab Material Hints:Lab Material Hints:• Any kind of liquid dishwashing detergent will work, even if it

is colored.

• Any meat tenderizer will work as long as it contains papain,

so study the label before using it.

• For DNA to precipitate, a 95% ethanol solution is needed. This is a

more concentrated solution than is normally found on the drug

store shelf, so you may need to contact a chemical supply store or

talk to a pharmacist. However, 70% isopropanol can be found at

any grocery store and will work alright but will probably yield

less DNA.

Laboratory Procedure:Laboratory Procedure:Laboratory Procedure:Laboratory Procedure:Laboratory Procedure:It is recommended to involve students in some of the preparation for

the laboratory so that they make the association between the DNA

that they will eventually extract and the onion they viewed at the

beginning of the procedure. It is recommended that day 1 of this

activity should begin with an overview of DNA and its applicability

to biotechnology in agriculture and finish with the first seven steps of

the teacher lab prep. Students may complete their pre-lab questions

during the lag times during lab prep.

Each ingredient has a specific function in this experiment. Functions

are as follows:

liquid detergent: liquid soap is a lipid and protein emulsifier that

works by binding to the lipids and proteins and precipitating them

out of solution. The detergent/salt solution breads down the lipid cell

walls of the onion cells in order to release the cytosol.

NaCl: helps to precipitate the DNA out of the ethanol solution

because the Na+ ions surround the negative phosphorous ends of the

DNA and shields them from each other. This causes a decrease in

repulsive forces and allows the DNA to come closer together and

coalesce.

heat: denatures the DNAase enzymes which have the potential to

break genomic DNA into tiny pieces and prevent DNA from spooling.

cold: slows the rate of DNA breakdown.

blender: chops through cellular tissues like the cell wall, cell

membrane, and nuclear membrane, and thereby releases DNA.

39


papain: contains protease, a protein enzyme that helps clear proteins

away from DNA. This enzyme is found in contact lense cleaners as

well.

ethanol/isopropanol: because DNA is not soluble in ice-cold ethanol,

it precipitates out of solution.

Pre-Lab Questions:Pre-Lab Questions:Pre-Lab Questions:Pre-Lab Questions:Pre-Lab Questions:These questions are designed to get students to think about the

experiment before the lab begins. Make sure students have read the

lab procedure before attempting to answer, but allow creative freedom

in the answers. It may be a good idea to have students answer the

pre-lab questions again once the experiment has been completed.

Be sure to go over the correct answers as well.

40

Who Put theDNA in MySalad?

Do you realize that all of you are now biotechnologists? In the previous

activity, you traveled back in time to use living organisms to make a

product. Along with the nomad people living long ago in Asia, you used

bacterial power to make yogurt. Bring those ancients back to the future and

delve into the modern world of biotechnology! Will you and the people of

ancient Asia survive as biotechnologists in today’s world? Not unless you

know about DNA! Take the magnifying glass out of your pocket and

investigate! Who put the DNA in your salad?

Procedure: Day OneProcedure: Day OneProcedure: Day OneProcedure: Day OneProcedure: Day OneThis part of the lab will be led by the teacher, and the whole class will

observe. Pre-lab questions may be answered during the lag times in this

lab procedure.

Labratory Preparation Procedure:1. Add 15.0 g of NaCl to 100 ml liquid dish washing detergent.

Add approximately 900 ml distilled water to make a final

volume of 1000 ml.

2. Cut the onion into pieces which are approximately one cm 2 in size.

Place the onion pieces into one of the large (500 ml) beakers.

3. Cover the onion slices with 100 ml of the detergent solution.

4. Stir the mixture and let it sit in a hot water bath for 15 minutes.

(The temperature of the hot water bath should be diligently

maintained at >60°C but well below 80°C, as this range is

optimal for the breakdown of enzymes which would break

apart the DNA.

5. Transfer beaker to an ice water bath and cool for 5 minutes,

stirring frequently. The breakdown of the DNA itself is slowed

down by this cooling step.

6. Pour the mixture into a blender and blend it at low speed

for one minute.

7. Filter the mixture through four thicknesses of cheesecloth or a

#6 coffee filter. The filtration process may be very slow, so you may

want to transfer the entire set-up to the refrigerator to complete the

filtration over night. Attempt to keep the foamy part of the mixture

from getting into the filtrate.

8. Leave the 95% ethanol in the freezer overnight, because it must be

icy-cold for the second part of this experiment.

STU

DENT ACTIVITY

DINI N G O N D

NA

41


Pre-lab Questions:Pre-lab Questions:Pre-lab Questions:Pre-lab Questions:Pre-lab Questions:

1a. Is DNA found in all living organisms? ______________________

1b. Where is the DNA located within the cell?

________________________________________________________________________

_______________________________________________________________________

2. What do you think is the function of DNA?

________________________________________________________________________

________________________________________________________________________

_______________________________________________________________________

3. Read through the laboratory procedure and answer the following

questions:

a. What solution helps break down the outer cell wall of the onion?

______________________________________________________

______________________________________________________

b. What solution helps the DNA to come out of solution or to

“precipitate”?

________________________________________________________________________

________________________________________________________________________

4. What barriers do we need to get through to reach the DNA?

________________________________________________________________________

________________________________________________________________________

_______________________________________________________________________

STU

DENT ACTIVITY

DINI N G O N D

NA

42


STU

DENT ACTIVITY

DINI N G O N D

NA

Laboratory Procedure:Laboratory Procedure:Laboratory Procedure:Laboratory Procedure:Laboratory Procedure:Day Two

Teacher Preparation:

1. Place 6 ml of the onion filtrate into enough test tubes so that

each lab group has one.

2. Mix 3 g of meat tenderizer into 50 ml water, creating a 6%

solution.

3. Give each lab group 3.5 ml of the 6% meat tenderizer solution.

4. Prepare a 4% NaCl solution by adding 4g NaCl to 100 ml

distilled H2O.

5. Prepare the phenol red indicator solution by adding a “toothpick

tip” amount of phenol red powder in 100 ml distilled water.

The solution should be a light amber color.

Materials Needed:Materials Needed:Materials Needed:Materials Needed:Materials Needed:Each Lab Group:

• one 20 ml test tube with 6 ml onion filtrate

• one 10 ml test tube with 9 ml ice cold ethanol

• one 10 ml test tube with 3.5 ml meat tenderizer solution

• one glass rod (200 mm long)

• test tube rack

• one test tube containing 3 ml 4% NaCl solution

• eyedropper for adding phenol red indicator

Students:

1. Add the entire volume of meat tenderizer solution (3.5 ml) to the

20 ml test tube with your onion filtrate and mix it by swirling.

2. Immediately add 9 ml of ice cold ethanol to the 20 ml test tube

with the onion filtrate mixture by slowly pouring it down the

side of the test tube so that two distinct layers of liquid appear.

3. Let this test tube sit for 2-3 minutes without disturbing it.

You may see bubbles forming during this time and the DNA

will begin to precipitate out of the filtrate solution.

4. Swirl the interface between the two layers gently using the glass rod

until the bubbles no longer appear.

5. Using a twirling motion of the glass rod, move the glass rod slowly

through the interface of the two layers of liquid. Continue to twirl

while gently lifting the mucus-like DNA up out of the solution.

6. Carefully place the mucus-like DNA into the 10 ml test tube

containing the 4% NaCl solution.

7. Add five drops of phenol red indicator to the DNA solution.

43


STU

DENT ACTIVITY

DINI N G O N D

NA

Post-lab Questions:Post-lab Questions:Post-lab Questions:Post-lab Questions:Post-lab Questions:

1. Describe, in your own words, what the extracted onion DNA

looks like.

__________________________________________________________________

__________________________________________________________________

_________________________________________________________________

2. When phenol red indicator is added to an acid solution, it produces

a pink/red color.

a. What color change took place when you added the phenol red to

your extracted DNA?

_________________________________________________________________

_________________________________________________________________

b. What does this color change tell you about the DNA molecule?

_________________________________________________________________

_________________________________________________________________

3. Recombinant DNA technology is a modern day biotechnology

application that allows scientists to combine specific DNA

sequences from one organism with the DNA of another organism.

a. Why might a scientist want to add DNA to an organism?

__________________________________________________________________

__________________________________________________________________

_______________________________________________________

b. If you could use recombinant DNA technology to change the DNA

of an onion, what “new” characteristics would you want it to have?

W h y ?

__________________________________________________________________

__________________________________________________________________

__________________________________________________________________

_________________________________________________________________

c. To create this “new” onion, would you insert a gene (DNA sequence)

from another plant or animal? Explain.

__________________________________________________________________

__________________________________________________________________

__________________________________________________________________

44


STU

DENT ACTIVITY

DINI N G O N D

NA

Post-lab Questions (continued):Post-lab Questions (continued):Post-lab Questions (continued):Post-lab Questions (continued):Post-lab Questions (continued):4. Other biotechnology applications (similar to recombinant DNA

technology) allow scientists to “turn-off” or remove a sequence

of DNA.

a. Why might a scientist want to remove DNA from an organism?

__________________________________________________________________

__________________________________________________________________

_______________________________________________________

b. If you could use an application of biotechnology to remove a

specific characteristic of an onion, what characteristics would you

want to get rid of? Why?

__________________________________________________________________

__________________________________________________________________

__________________________________________________________________

_________________________________________________________________

Bonus Question:Bonus Question:Bonus Question:Bonus Question:Bonus Question:DNA dictates the form and function of an organism. How does it do

this?

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

_______________________________________________________________________

Vocabulary:Vocabulary:Vocabulary:Vocabulary:Vocabulary:1. enzyme ____________________________________________

__________________________________________________

2. denaturation ________________________________________

__________________________________________________

3. solubility ___________________________________________

__________________________________________________

4. precipitate __________________________________________

__________________________________________________

5. D N A ______________________________________________

45


Answers to Pre-lab Questions:Answers to Pre-lab Questions:Answers to Pre-lab Questions:Answers to Pre-lab Questions:Answers to Pre-lab Questions:

1. a. Is DNA found in all living organisms?

b. Where is the DNA located within the cell?

Yes, DNA is found in all organisms (both the living and, in most cases,

the once-living). DNA is located inside cells. In prokaryotes (those

one-celled organisms like bacteria that do not have a nucleus), DNA

is found floating around in the cytoplasm (“cyto” means cell and

“plasm” means fluid). In eukaryotes (organisms such as plants and

animals with a “eu-” or “true” nucleus), DNA is found within the

nucleus of the cell.

2. What do you think is the function of DNA?

Students might not yet understand the significance of DNA, so

students may respond with a variety of answers. The purpose of this

question is to get students to think about the significance of DNA

before the laboratory activity. DNA an informational molecule that

governs form and function for a single cell, and for the billions of

cells that make up an organism. DNA is the “blueprint” (or set of

instructions) that dictates the physical appearance as well as

biological function of the organism.

3. Read through the laboratory procedure and answer the following

questions:

a. How do you think the outer cell wall of the onion is broken down?

The blender chops up (breaks down) the cell wall, cell membrane, and

nuclear membrane. Teachers may wish to point out that as the cell

wall, cell membrane, and nuclear membrane are broken down, DNA is

released from the cell.

Teachers: You may choose to explain to students that the liquid

detergent also assists in cell wall breakdown. The liquid detergent

disrupts the polar interactions that hold the cell membrane together,

thereby suspending the lipids and proteins of the cell in its own soapy

liquids. Thus, the cell membrane begins to break down.

46


b. What solution helps the DNA to come out of solution or to

“precipitate”?

In the Day Two Laboratory procedure, students add 9 ml of ice cold

ethanol to the test tube with the onion filtrate mixture. In the

following step, students watch for a precipitate to form. Therefore,

students should be able to deduce that the ethanol helps the DNA

to come out of solution or to “precipitate”.

An in-depth look at what really happens: The NaCl solution

precipitates the DNA out of the ethanol solution because the Na+

ions surround the negative phosphorous ends of the DNA and shield

those ends from each other. This causes a decreases in repulsive forces

and allows the DNA to come closer together and coalesce.

4. What barriers do we need to get through to reach the DNA?

The onion is an eukaryote, so its DNA is in the nucleus. Therefore, we

need to go through the cell membrane, cell wall, all the cytoplasmic

proteins, and the nuclear membrane in order to reach the DNA.

Answers to Post-Lab Questions:Answers to Post-Lab Questions:Answers to Post-Lab Questions:Answers to Post-Lab Questions:Answers to Post-Lab Questions:1. Describe in your own words what the extracted onion DNA

looks like.

This is a subjective answer. Creativity is encouraged. One view is that

after the DNA has been precipitated, it looks like a big, cloudy, swirling

mass of cotton floating around in water.

2. When phenol red indicator is added to an acid solution it produces

a pink/red color.

a. What color change took place when you added the phenol red to

your extracted DNA?

Change should have been to pink/red.

b. What does this color change tell you about the DNA molecule?

It is acidic in nature. Hence, the name deoxyribonucleic acid (DNA).

47

3. Recombinant DNA technology is a modern day biotechnology

application that allows scientists to combine specific DNA

sequences from one organism with the DNA of another organism.

a. Why might a scientist want to add DNA to an organism?

A scientist might utilize recombinant DNA technology to add DNA to

an organism in order to give that organism the ability to do something

it could not do before, or to give the organism more desirable

characteristics.

b. If you could use recombinant DNA technology to change the DNA

of an onion, what “new” characteristics would you want it to have?

W h y ?

• A thicker skin so that you could peel the onion like an apple (or an

orange)!

• Make the outer skin soft and moist so that you don’t have to worry

about peeling the skin before you cut the onion.

• A new taste!

c. To create this “new” onion, would you insert a gene (DNA sequence)

from another plant or animal? Explain.

Yes. To make an onion with a thicker skin so that it would peel like an

apple, a scientist might add the DNA from an apple that codes for skin

thickness. To make the outer skin soft and moist so that it would not be

necessary to peel off the skin before eating the onion, a scientist might

combine the “skin genes” from a grape with the genes of the onion.

Teachers: These gene transfer scenarios are purely fictitious.

4. Other biotechnology applications (similar to recombinant DNA

technology) allow scientists to “turn-off” or remove a sequence

of DNA.

a. Why might a scientist want to remove DNA from an organism?

A scientist might want to remove DNA from an organism to get rid of

“undesirable” characteristics.

b. If you could use an application of biotechnology to remove a

specific characteristic of an onion, what characteristics would you

want to get rid of? Why?

• The smell of the onion so your eyes would not water as you cut up

the onion.

• The flavor of the onion so the taste does not linger in your mouth

for several hours after eating an onion.


48


Answer to the Bonus Question:Answer to the Bonus Question:Answer to the Bonus Question:Answer to the Bonus Question:Answer to the Bonus Question:DNA dictates the form and function of an organism. How does it

do this?

DNA is often called the “building block of proteins”, and it dictates the

form and function of an organism by coding for specific structural or

functional proteins.

Structural proteins eventually make up the physical “hardware” of an

organism while the functional proteins make up the “software” of an

organism. In mammals, the hair, skin, organs, and muscle are made up

of structural proteins, and functional proteins, such as hormones and

enzymes, run all biological systems.

Another analogy: Structural proteins are like the houses, buildings, cars

etc. that make up a town, while functional proteins are the people who

do things within the town.

Vocabulary:Vocabulary:Vocabulary:Vocabulary:Vocabulary:enzyme: a protein that works to speed up or initiate chemical

reactions; a protein that does something.

denaturation: breaking bonds within the structure of a protein

(via heat or increasing the alkalinity) so that the original properties

are greatly changed or eliminated.

solubility: the capability to be dissolved.

precipitate: a substance that is settled out of a solution.

DNA: deoxyribonucleic acid; an informational molecule that contains

the genetic code and transmits the hereditary pattern; an essential

component of all living cells.

49

Building Life:How Do YouThink It Works?

Now that we have observed the actual presence of DNA in a food (onion) we

will move on to examine this DNA in more detail. We have heard over and

over that DNA is an organism’s “blueprint”, that it determines what the

organism looks like as well as how it functions. Sounds interesting, but just

how does DNA achieve all of this? Look no further.

Summary:Summary:Summary:Summary:Summary:Through the building of a DNA model, the students will be exposed

to the structural details of this important genetic material which will

initiate their quest in learning how DNA dictates the form and

function of an organism. This knowledge will help the students make

the transition into how and why modern day technology is focused

on manipulating this genetic material in order to create desired

changes in an organism.

Objectives:Objectives:Objectives:Objectives:Objectives:• Students will investigate the detailed structure of the DNA molecule

by building a model of the structure.

• Students will attempt to link the structure of DNA with its primary

function of determining the form and function of an organism.

• Students will explore the association between the DNA structure

and protein synthesis.

• Students will better understand why present day biotechnology

efforts are focused on the manipulation of this genetic material for

the purpose of creating or eliminating specific traits of an organism.

Suggested Time:Suggested Time:Suggested Time:Suggested Time:Suggested Time:One class period

Materials:Materials:Materials:Materials:Materials:fishing line/string or heavy thread toothpicks needle

two different colored tape rolls scissors raisins

apple chunks grapes apricots

Procedure:Procedure:Procedure:Procedure:Procedure:The entire procedure is detailed on the Student Activity Sheet .

It is suggested that students work in pairs for this activity, so the teacher’s

pre-lab preparation simply involves gathering materials and dividing

those materials for the appropriate number of lab pairs. Following the

modeling the students should do the protein synthesis review sheet.

Some of the post-activity questions involve comparing the DNA model

to the actual structure of DNA (specifically, nucleotide names and

pairing of nucleotides). You may want to set aside time to go over this

information with the students or provide the resources and opportunity

for the students to seek these answers on their own.

50


STU

DENT ACTIVITY

DINI N G O N D

NA

As you learned in the “Who Put DNA in My Salad?” activity, DNA is

found in every cell of every organism. Once it is isolated, DNA looks the

same no matter what organism it comes from. You’ve seen the DNA from

an onion cloud up and spool like a fluffy strip of cotton candy, but do you

know exactly what DNA looks like up close?

In the 1950s, James Watson and Francis Crick (with the help of

experimental data from a woman named Rosalind Franklin) uncovered

the structure of DNA. Since then, scientists have used Watson and Crick’s

model as the basis of DNA research. As a result of Watson and Crick’s

discovery, it is possible to make a simple representation of DNA. Go to it!

Note: For more historical information on these DNA pioneers, go to

the “Access Excellence” homepage. The World Wide Web address for

this site can be found in the resource list at the end of the unit.

Materials:Materials:Materials:Materials:Materials:fishing line/string or heavy thread toothpicks needle

two different colored tape rolls scissors raisins

apple chunks grapes apricots

Modeling Activity Procedure:Modeling Activity Procedure:Modeling Activity Procedure:Modeling Activity Procedure:Modeling Activity Procedure:Part One

1. Cut one piece of fishing line three feet long. Tie five knots as close

together as possible in one end. Wrap a piece of the colored tape

around this end and write “5” on the tape. This will make your

5-knot end easier to identify.

2. With the open end, thread the needle. Pull the needle and fishing

line through a raisin until the raisin is close to the fifth knot or

colored tape.

3. Tie a knot around the raisin in order to “lock” the raisin into

position (approximately one inch from the uppermost knot).

4. Pull the needle and fishing line through a grape until it sits

approximately one inch above the raisin.

5. Tie a knot around the grape in order to “lock” the grape into

position (approximately one inch above the raisin).

6. Continue stringing fruits (in any order) until your fishing line has

twenty fruit pieces on it. Make sure all your fruits are approximately

the same distance from each other (one inch is a good distance).

51


STU

DENT ACTIVITY

DINI N G O N D

NA

8. Before making your second strand, lay STRAND I in front of you

with the 5-knot end of the left and the 3-knot end on the right.

9. You are going to “read” STRAND I from the 5-knot to the 3-knot

end (or left to right), and add the matching fruit to the second

strand accordingly.

10. Cut another three feet long piece of fishing line and tie three knots

in one end. Start adding fruit to this second strand as you read

STRAND I from left to right. Be sure you are pairing the fruit

appropriately as indicated in the box above.

11. Continue adding fruit until all twenty fruit pieces on STRAND I

have a “matching” fruit on the second strand.

12. Tie off the second strand with five knots.

Your fruit strand (let’s call it STRAND I) represents a sequence

of chemicals called nucleotides that are bonded together to

form one-half of the DNA molecule. To form the other half of

the DNA molecule, you need to make a second fruit strand.

Each fruit on the second strand must “pair with” or “match “

a corresponding fruit on STRAND I.

Because there are four different fruits and each fruit needs to

match up with another fruit, you can make two fruit pairs.

So that the entire class is consistent, the fruit should be paired

as follows: grapes with raisins

apples with apricots

7. After stringing the last fruit, tie off the open end of the fruit strand

with three knots. Wrap a piece of the colored tape not used yet

around this end. Write “3” on the tape. This will make your 3-knot

end easier to identify.

52


STU

DENT ACTIVITY

DINI N G O N D

NA

Congratulations!Congratulations!Congratulations!Congratulations!Congratulations!You have successfully created two separate strands of what will eventually

become your DNA model. Each fruit strand represents the sequence of

chemicals that bind together to form the one-half of the DNA molecule.

The chemicals (fruits) are called nucleotides. The nucleotides are linked by

chemical bonds. Next, you will link these two separate strands together to

complete the structure of the DNA molecule. At this point in time, answer

the questions below:

Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Part One:

Note: You may want to use your biology text book to assist you in

answering these questions.

1. Each of the fruit types on your “DNA” strand represents a nucleotide.

a. What are the names of the 4 different nucleotides which are on an

actual (real, not fruit) strand of DNA?

_________________________ ________________________

_________________________ ________________________

b. Of these 4 nucleotides, indicate which ones pair together on a DNA

molecule?

________________________ with _________________________

________________________ with _________________________

2. Each nucleotide can be broken down into three parts. What are

these three parts?

______________________________________________________

______________________________________________________

3. If the fruit pieces represent chemicals (or nucleotides) that must

bind together to form DNA, what materials represent the bonds

between these nucleotides on a single strand of DNA?

________________________________________________________________________

4. Somehow, the two strands must also bind together. What materials

will you use to bind the two strands to each other? Will these bonds

be different from the bonds that form the string? How?

________________________________________________________________________

________________________________________________________________________

5. You built your two DNA strands so that the first strand pairs

(matches) directly with the second strand. Do you know what this

phenomenon is called? If not, what would you call it?

________________________________________________________________________

________________________________________________________________________

53


STU

DENT ACTIVITY

DINI N G O N D

NA

Modeling Activity Procedure:Modeling Activity Procedure:Modeling Activity Procedure:Modeling Activity Procedure:Modeling Activity Procedure:Part Two:

1. You are going to use the toothpicks to link the two strands together.

As you may have guessed by now, the toothpicks will represent the

bonds between nucleotides (fruits) on the two strands of DNA.

2. Before you bond the nucleotides (fruits) on STRAND I to the

nucleotides on STRAND II, you should lay the two strands in front

of you. STRAND I should be oriented with the 5-knot end on your

left and the 3-knot end on your right. STRAND II should be oriented

with its 3-knot end on your left and its 5-knot end on your right.

3. Use the toothpick to connect the fruit on the 5-knot end of

STRAND I with the fruit on the 3-knot end of the STRAND II.

Just stick one end of the toothpick into one fruit and the other

end of the toothpick into the other fruit.

4. Make a toothpick bond (connection) between each fruit on

STRAND I and its corresponding fruit on the STRAND II.

5. You aren’t done yet! Tie the 5-knot end of STRAND I to the 3-knot

end of the STRAND II. Next, tie the 3-knot end of the STRAND I to

the 5-knot end of the STRAND II.

6. Using the tape, cover up these two final knots.

7. Next, grab the taped ends (one in each hand) and begin to twist the

model. Twist your left wrist in the opposite direction from

your right wrist.

Congratulations! You have completed the creation of your DNA model!

Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Part Two:

1. If one chain of a DNA molecule has the following sequence, in

the blank space below write the sequence of the opposite chain

of that DNA molecule

5' A T T C G G C A A T C G T A 3'

3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 5 '

54


STU

DENT ACTIVITY

DINI N G O N D

NA

Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Part Two:

2. Observing your DNA model, note the following bonds:

• The string represents bonds between the nucleotides on the

same strand of DNA.

• The toothpicks represent the bonds connecting the two

complementary strands of DNA.

a. Which of these two bonds do you think is weaker?

__________________________________________________________________

b. What is a possible reason for this particular bond being weaker?

__________________________________________________________________

__________________________________________________________________

__________________________________________________________________

3. Below, write down the sequence of one of your fruit DNA strands,

reading it from the 5' to the 3' end.

5' ____ _____ _______ _____ _____ _____

____ _____ _______ _____ _____ _____

____ _____ _______ _____ _____ _____

____ _____ 3 '

4. You are a world renowned food scientist attempting to eliminate an

allergy causing substance from the peanut. You have information

that the gene coding for this allergen contains the fruit sequence

grape, apple, apple, raisin, apricot, raisin.

a. Does your DNA strand (from question 3) contain the gene coding

for the allergen? (Remember: DNA is read from the 5’ end to the 3’

end.)

______________________________________________________

b. List three approaches you might take to eliminate the production of

this allergen from the genetic code of the peanut.

__________________________________________________________________

__________________________________________________________________

__________________________________________________________________

55


Answers Answers Answers Answers Answers Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Part Two:

1. Each of the fruit types on your “DNA” strand represent a nucleotide.

a. What are the names of the four different nucleotides which are on

an actual (real, not fruit) strand of DNA?

Adenine nucleotide, thymine nucleotide, guanine nucleotide,

cytosine nucleotide.

b. Of these four nucleotides, indicate which ones pair together on a

DNA molecule?

Adenine pairs with thymine. Guanine pairs with cytosine.

2. Each nucleotide can be broken down into three parts. What are

these three parts?

One of these parts is sugar. In DNA this sugar is called deoxyribose.

Another part of the nucleotide is a compound of phosphorus-

phosphoric acid (H3PO

4). The third part of the nucleotide is a ring-like

structure of carbon, hydrogen, and nitrogen called a nitrogenous base.

These bases are adenine, thymine, guanine and cytosine, and hence,

give the individual nucleotide their identity.

3. If the fruit pieces represent chemicals (or nucleotides) that must

bind together to form DNA, what materials represent the bonds

between these nucleotides on a single strand of DNA?

The fishing line.

4. Somehow, the two strands must also bind together. What

materials will you use to bind the two strands to each other?

Will these bonds be different from the bonds that form the

string? How?

The toothpicks. Yes, the toothpick bonds are different from the string

bonds. The toothpick bonds are weaker, easier to break.

5. You built your two DNA strands so that the first strand pairs

(matches) directly with the second strand. Do you know what this

phenomenon is called? If not, what would you call it?

Complementation is the preferred answer here. However, any answer

which reflects pairing or matching of strands may be acceptable.

56


Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Part 2:

1. If one chain of a DNA molecule has the following sequence, in

the blank space below write the sequence of the opposite chain

of that DNA molecule

5' A T T C G G C A A T C G T A 3'

3' T A A G C C G T T A G C A T 5'

2. Observing your DNA model, note the following bonds:

The string represents bonds between the nucleotides on the same

strand of DNA. The toothpicks represent the bonds connecting the

two complementary strands of DNA.

a. Which of these two bonds do you think is weaker?

The toothpicks. These toothpicks represent hydrogen bonds, which are

relatively easy to break.

b. What is a possible reason for this particular bond being weaker?

The two strands of DNA must readily “unzip” in order for DNA

replication or protein synthesis to occur.

3. Below, write down the sequence of one of your fruit DNA strands,

reading it from the 5' to the 3' end.

5' Answer dependent on the individual creation! 3'

4. You are a world renowned food scientist attempting to eliminate an

allergy causing substance from the peanut. You have information

that the gene coding for this allergen contains the fruit sequence

grape, apple, apple, raisin, apricot, raisin.

a. Does your DNA strand (from question 3) contain the gene coding

for the allergen?

Answer dependent on the individual creation!

b. List three approaches you might take to eliminate the production

of this allergen from the genetic code of the peanut.

1. Cut out the gene sequence coding for the allergen.

2. Insert an additional “fruit” to interrupt the sequence coding for

the allergen.

3. Reverse the sequence coding for the allergen.

57

DNA DeterminesForm & Function HOW?

Now that you have observed the structure of DNA through your food

model, it is time to explore just how this amazing material helps to

determine how organisms (including plants, animals, microbes and YOU)

look and function. The following background material will provide you

with some essential information for learning more about DNA and its

important role in life.

DNA is a molecule that contains hereditary information which passes

from parents to offspring. The molecule is found within the nucleus of

each cell in your body and within the cells of all living organisms.

Up close, DNA looks like a twisted ladder. Each rung of this ladder is

actually two chemicals (nucleotides) bonded to each other.

The DNA molecule is made up of a total of four nucleotides: adenine,

thymine, cytosine and guanine. We’ll just call them A, T, C and G.

The DNA ladder fits together in a very exact manner.

The rules for nucleotide bonding in the DNA double helix are:

A bonds only with T and C bonds only with G.

Background InformationBackground InformationBackground InformationBackground InformationBackground Information

58

DNA codes for the proteins that give cells structure and function.

Proteins are biologically important compounds that are found in all

plants, animals, and microbes. Structural proteins determine the

strength, shape, and elasticity of an organism’s cells. Functional

proteins dictate how cellular components act. One way of thinking

about this relationship is as follows:

• Structural proteins that make up a cell are like the houses,

buildings, streets and signs that make up a town.

• Functional proteins working within a cellular system are the

people who do things within the town.



DNAdouble strandunzips revealing

exposednucleotides

A

A

T

T

G

T

T

T

G

G

C

G

T

T

C

G

C

C

A

A

A

C

A

A

DNAStrand 1

DNAStrand 2

DNADouble Strand

A

A

A

A

C

A

C

T

C

G

C

T

T

G

T

T

T

G

G

C

A

G

A T

When it is time to make a protein, the

DNA molecule unzips—just like the

zipper on a coat. Once DNA unzips, a

“secret code” on the single DNA strand

is exposed. This secret code is simply

the order that the nucleotides are

arranged on that DNA strand.

59

Next, the newly formed mRNA acts as a messenger by carrying its code

outside the nucleus.

A similar molecule called RNA begins to “read” the DNA secret code.

The code is always read in the direction from the 5’ end of the strand

to the 3’ end. Two types of RNA are involved in the decoding process:

mRNA (messenger RNA ) and tRNA ( transfer RNA ).

In the first decoding step ( transcription ), mRNA “reads” the A,T,C,G

code from single stranded DNA. As mRNA reads, it forms its own

complementary code. The chemicals in this RNA code bond with

DNA like the pieces of a puzzle. The RNA code is similar to the DNA

code in that it is made up of four nucleotides. The only difference is

that the nucleotide uracil (U) on the RNA replaces T (thymine) on

the DNA.

mRNA forms ascomplementary strand offof DNA single strand

A

A

U

U

G

U

U

U

G

G

C

G

T

T

C

G

A

newly formedmRNA strand

DNAStrand 2

Note:U replaces Ton RNA

pore

A

C

A

A

A

C

C

completedmRNA leavesnucleus

nuclearmembrane



60


tRNA with attached amino acito complementary triplet on

UUGUUUGGCA GA

UU

AA

C

mRNA

tRNA a 3-nucleotide unit floats in cytoplasm. An amino acid, coded for by 3-nucleotide sequence,

attaches to appropriate tRNA

U CU G C C A A A

aminoacids

C A A

As tRNA’s "read" mRNA codesequentially, amino acidstrand grows formingprotein molecule

U

mRNA

UGUGCG

Growing chainof amino acid

eventually becoprotein molecu

A

A A G U U

AA

Here, another molecule called transfer RNA (tRNA) is present. tRNA

has three nucleotides on it. With the help of an organelle called a

ribosome , the three nucleotides of the tRNA bind to complementary

nucleotides on the mRNA. Attached to the end of the tRNA is a specific

amino acid (AA).

Note: The amino acid bound to the tRNA is determined by the

specific code or three nucleotides of that tRNA.

Tagging along with each tRNA is an amino acid. As several tRNAs are

bound along and then released the mRNA strand, these accompanying

amino acids also bind together and form an amino acid chain.

This amino acid chain is a protein. A

single protein may contain hundreds

of amino acids linked together.

61

ChocolateFlavoredCherries

An Exercise inAn Exercise inAn Exercise inAn Exercise inAn Exercise inRecombinant DNARecombinant DNARecombinant DNARecombinant DNARecombinant DNATechnologyTechnologyTechnologyTechnologyTechnology

Through the previous exercise, students were able to understand the

structure of DNA and how this structure related to the function of DNA

within an organism. In this activity, students will utilize this knowledge

of the DNA structure while exploring how today’s scientists are able

to manipulate this genetic material in efforts to produce desired

characteristics or products.

Summary:Summary:Summary:Summary:Summary:Students conduct a simulation of a recombinant DNA technique.

They attempt to create a chocolate flavored cherry by combining a

gene coding for chocolate with DNA from a cherry tree.

Objectives:Objectives:Objectives:Objectives:Objectives:• Students will gain an appreciation for the association between

modern biotechnology techniques and food production/processing.

• Students will understand one type of biotechnology as the

manipulation of a living organism’s genetic code to make a product

or run a process.

• Students will understand recombination as an application of

biotechnology.

• Students will gain an appreciation for the malleability of DNA and

how this characteristic has spawned the tremendous advancements

in genetic engineering.

Suggested Time:Suggested Time:Suggested Time:Suggested Time:Suggested Time:One class period.

Teachers:Teachers:Teachers:Teachers:Teachers:It is important that the students are reminded that the procedure

they will follow for this activity is simply for example. Any DNA

sequence used in this activity is not an actual gene sequence for

cacoa, chocolate flavoring, or a cherry tree.

Materials List:Materials List:Materials List:Materials List:Materials List:• cacao DNA (linear paper DNA)

• restriction Enzyme (scissors)

• plasmid DNA (circular paper DNA)

• ligase (tape)

• background information sheet: Recombinant DNA Technology

62


An ExerciseAn ExerciseAn ExerciseAn ExerciseAn Exercisein Recombinantin Recombinantin Recombinantin Recombinantin RecombinantDNA TechnologyDNA TechnologyDNA TechnologyDNA TechnologyDNA Technology

STU

DENT ACTIVITY

DINI N G O N D

NA

We know that a recipe is a set of directions which dictates what a final end

product will be like. Similarly, an organism’s DNA is a set of directions

which dictates the physical appearance and functions of an organism.

So if you want to make the organism better by changing the set of

directions, how do you go about this? This is precisely where modern

biotechnology techniques have arrived.

By combining DNA that contains the instructions for a desired trait with

the organism’s DNA, scientists are enabling that organism to express the

desired trait. Conversely, by removing a section of DNA from the organism

which codes for an undesirable or reversing the genetic sequence (antisense)

the end result may also be a more productive, functional organism.

Situation:Situation:Situation:Situation:Situation:A large candy company has hired your laboratory to conduct a very

important project. The company is attempting to develop a new

product, chocolate flavored cherries. Consumer surveys indicate that

people love the combination of chocolate and cherries and the ACME

Candy Company wants to be the first to put these delicious morsels on

the market. You are the laboratory technician given the task of altering

the DNA of a cherry tree so that it bears a fruit that has a chocolate

flavor to it. The “big shot” scientist in your laboratory has isolated a

gene in the cacao bean which codes for the delicious chocolate flavor.

It is up to you as laboratory technician to remove this gene from the

cacao bean and insert it into the cherry seedling so that the new

chocolate flavored cherry results. If you follow the directions below

closely, you are bound to get a promotion and probably a big raise too!

Fun Fact:Fun Fact:Fun Fact:Fun Fact:Fun Fact:Chocolate really does grow on trees! Well, at

least one of its most important ingredients does.

The cacao bean grows inside large pods that

sprout from the trunk of a large cacao tree or

Theobroma Cacao . Each pod contains between

20 to 60 cacao beans. The trees grow in regions

close to the equator where it is warm all

year round.

63

An Exercise inRecombinantDNA Technology

STU

DENT ACTIVITY

DINI N G O N D

NA

Plasmid DNA: VectorPlasmid DNA: VectorPlasmid DNA: VectorPlasmid DNA: VectorPlasmid DNA: Vector

direction

inwhichDNAsequenceshouldberead

→

cut out thismiddle section

GACT

CT

TT

AA

AG

AC

AA

AA

AA A T A A

CT

C

CA

TC

GA

TA

AA

CC

TCG

CTGAG

AAAT

TT

CT

GTT

TTT T T A T T G

AG

GTA

GC

TAT

TT

GG

AGC

ATGCTCGGCAAGCTTATTGAGGTAGCTGGCTACCGCT

TACGAGCCGTTCGAATAACTCCATCGACCGATGGCGA

Start

5’

5’

Star

Stop

3’

3’

Stop

Linear DNA fromLinear DNA fromLinear DNA fromLinear DNA fromLinear DNA fromthe Cacao Bean:the Cacao Bean:the Cacao Bean:the Cacao Bean:the Cacao Bean:

63

64



STU

DENT ACTIVITY

DINI N G O N D

NA

Procedure:Procedure:Procedure:Procedure:Procedure:

1. Before beginning your Nobel Prize winning procedure, please read

the background information sheet on Recombinant DNA. There is

lots of information here which will help you with your pre-activity

questions, the actual procedure and the post-activity questions.

2. Complete your Pre-Activity Questions .

3. Removing the desired gene from the linear cacao DNA:

a. Pick up your restriction enzyme (scissors).

b. Beginning on the top of your cacao DNA ladder at the end that

indicates “start” (the 5’ end) read the bases of the strand until you

have read an A G C T sequence all in a row in that order.

c. Use your restriction enzyme (scissors) to make a cut after the

A in the four base sequence.

d. Continue to make cuts after the A in every four-base A GC T

sequence.

e. Now begin reading the DNA on the bottom strand of your cacao

DNA ladder. Start reading from the end that indicates “start” and

look for an A GC T sequence all in a row in that order.

f. As before, make a cut after the A in every four-base A GC T

sequence.

g. One cut on the top cacao DNA strand should be two bases (rungs)

away from one cut on the bottom cacao DNA strand. Cut through

the hydrogen bonds right down the middle of the DNA ladder in

order to connect the two closest cuts.

h. Repeat this step on the opposite end of the DNA ladder. You should

make a total of two cuts down the middle of the ladder, right

through the hydrogen bonds.

i. Remove the strip of DNA that comes out of the DNA ladder. This

piece of DNA should have two exposed rungs and a central portion

of the ladder intact. It contains the chocolate-flavor gene and

should be shaped like this:

j. Put this DNA aside for the moment and move on to the plasmid.

GC

CG

65



STU

DENT ACTIVITY

DINI N G O N D

NA

4. Getting the plasmid ready for insertion of the gene

a. Cut your circular plasmid out so that it looks like a large doughnut

ring (make sure the middle of the doughnut ring is cut out).

b. Each of the two strands of the circular plasmid is to be read in a

certain direction as indicated by the arrows on the plasmid.

c. Beginning on the outside at the arrow, start reading along the

plasmid in the direction of the arrow until you come across an

A G C T sequence all in a row.

d. With your restriction enzyme (scissors), make a shallow cut (only to

the middle of the ring) after the A in every A GC T sequence.

e. Now going in the opposite direction read along the inside loop of

the plasmid, reading until you come across the A GC T sequence on

the inside DNA strand.

f. With your restriction enzyme, make a shallow cut after the A in

every A GC T sequence.

g. Once again, each cut on the inside loop should be two rungs

(bases G, C) away from a cut on the outside loop.

h. Cut through the hydrogen bonds right down the middle of the

plasmid loop in order to connect each of the two closest cuts.

i. With the final cut, open the loop and look closely at the two

exposed rungs.

5. Insertion of the New Gene into the Plasmid (Recombination)

a. Look at the strip of DNA that you removed from the cacao DNA.

b. Compare this strip with the cut-open plasmid DNA.

c. Can you see how they match together? The two pieces of

DNA fit together like a puzzle.

d. Match the shapes as well as the bases ( A goes with T and C

goes with G).

e. Take out your ligase (tape) and insert the cacao DNA into the

plasmid loop.

f. You just inserted the cacao gene for chocolate flavor into the

plasmid, and now the plasmid can be used to carry the cacao

chocolate-flavor gene into the cherry plant!

GCCG

Plasmid vector

with exposed nucleotides

66



STU

DENT ACTIVITY

DINI N G O N D

NA

Pre-Activity Questions:Pre-Activity Questions:Pre-Activity Questions:Pre-Activity Questions:Pre-Activity Questions:

1. Using a dictionary, textbook and your background information

sheet, define the following terms:

vector _________________________________________________

______________________________________________________

______________________________________________________

ligase __________________________________________________

______________________________________________________

______________________________________________________

restriction enzyme ________________________________________

______________________________________________________

______________________________________________________

plasmid ________________________________________________

______________________________________________________

______________________________________________________

2. Read through your laboratory procedure and answer the

following:

a. What on your materials list represents a vector? Why?

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

b. What on your materials list represents a restriction enzyme?

W h y ?

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

c. What on your materials list represents ligase? Why?

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

3. In your own words, state why scientists may want to use

recombinant DNA technology.

______________________________________________________________________________

________________________________________________________________________

______________________________________________________________________________

67

Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:1. Attach your plasmid containing the recombined gene sequence on the

back of this paper or on a blank sheet of paper.

2. Now that you have seen that DNA from unrelated organisms

can be combined, let’s use this knowledge and have some fun!

a. Below, write down your least favorite food:

_____________________________________________________________________

b. What characteristic would you add to this food to make it tolerable?

(ie, chocolate flavor, crunchiness, etc.)

________________________________________________________________________

______________________________________________________________________

c. Where would you take the DNA from to insert it into this food?

________________________________________________________________________

_____________________________________________________________________

________________________________________________________________________

________________________________________________________________________

d. Write a brief laboratory procedure for this experiment, starting with

extracting the DNA from the organism (plant, animal, microbe) that

contains the desired trait and ending with recombing the “new” gene

sequence into your least favorite food.

________________________________________________________________________

_____________________________________________________________________

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

_____________________________________________________________________

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

_____________________________________________________________________

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

____________________________________________________________________



STU

DENT ACTIVITY

DINI N G O N D

NA

68

Answers to Pre-Activity Questions:Answers to Pre-Activity Questions:Answers to Pre-Activity Questions:Answers to Pre-Activity Questions:Answers to Pre-Activity Questions:

1. Using a dictionary, textbook and your background information

sheet, define the following terms:

a. vector

In terms of biotechnology, a vector is an agent used to transfer genetic

information from one organism to another.

b. ligase

A ligase is an enzyme which functions to bind loose ends of genetic

material together.

c. restriction enzyme

Restriction enzymes are specific molecules that cut the DNA in

specific places. Examples of commonly used restriction enzymes

in biotechnology laboratories are EcoR1, Bam2.

d. plasmid

A plasmid is a circular ring of DNA which is found in some bacterium.

2. Read through your laboratory procedure and answer the following:

a. What on your materials list represents a vector? Why?

The circular plasmid DNA represents the vector because it will be

transferring the new genetic material into the plant.

b. What on your materials list represents a restriction enzyme? Why?

The scissors represent the restriction enzymes because they will be

cutting the DNA in the specific location indicated.

c. What on your materials list represents ligase? Why?

The tape represents the ligase because it will be binding together the

loose, exposed ends of the DNA which have been cut by the restriction

enzymes.

3. In your own words, state why scientists may want to using

recombinant DNA technology.

Answers to this question may be quite variable. We are looking to have

the students reiterate the capacity of recombinant DNA technology to

enable an organism to express a desired trait it would not have

expressed without this technology.


69

Answers to Answers to Answers to Answers to Answers to Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:

1. Attach your plasmid containing the recombined gene sequence

below.

Complementary DNA on the plasmid and “new” fragment should

match correctly.

2. Now that you have seen that DNA from unrelated organisms

can be combined, let’s use this knowledge and have some fun!

a. Below, write down your least favorite food:

Variable answer.

b. What characteristic would you add to this food to make it

tolerable? (ie, chocolate flavor, crunchiness, etc.)

Variable answer.

c. Where would you take the DNA from to insert it into this

food?

Variable answer.

d. On the back of this paper, write a brief laboratory procedure for

this experiment, starting with extracting the DNA from the

organism (plant, animal, microbe) that contains the desired trait

and ending with recombining the “new” gene sequence into your

least favorite food.

Student answers should overview DNA extraction procedure (from

onion laboratory). Then, they should indicate how they will cut the

desired gene sequence out of the extracted DNA (restriction enzymes

specific to the particular region of interest). They should then discuss

the vector for inserting the new DNA fragment into the food they are

interested in changing. This may be a plasmid or a virus. They then

should discuss how they will combine the new DNA fragment with

the vector and ultimately how it will be inserted in the chromosomal

DNA of the food they are changing.


70


Bonus Question:Bonus Question:Bonus Question:Bonus Question:Bonus Question:Here is a bonus question you may wish to pose to the students.

The content is difficult, however the concepts are important in terms

of laboratory practice of recombinant DNA techniques.

Can you think of a way to tell from the beginning if a particular

cherry cell has been transformed?

If students have a hard time with this question, ask them the following

question: A dog named Cocoa is running around a fenced-in yard with

1,000 other dogs. You must pick Cocoa up at night, but you don’t know

what Cocoa looks like. What could Cocoa’s owner do to help you find

Cocoa? Possible answer: Put a fluorescent dog-collar on Cocoa.

DNA can be labeled in the same way. To see if the piece of chocolate-

flavor DNA gets incorporated into the cherry cells, a scientist might

put a fluorescent label on it. The fluorescent label will go wherever

that piece of DNA goes, so if the cherry plant cell has been transformed,

it will fluoresce!

71

STU

DENT ACTIVITY

DINI N G O N D

NA

An Example ofRecombinantDNA Technology

Use of Use of Use of Use of Use of Agrobacterium

tumefaciens to ferry “new” to ferry “new” to ferry “new” to ferry “new” to ferry “new”genes into plant cells.genes into plant cells.genes into plant cells.genes into plant cells.genes into plant cells.

Background Information:Background Information:Background Information:Background Information:Background Information:You learned in the last activity that DNA is the material within the cell

that determines what an organism looks like and how it functions.

DNA does all of this via the proteins for which it codes.

Today, scientists are able to insert pieces of “foreign” DNA into an

organism’s DNA so that the organism will express a desired

characteristic, produce a certain substance, or even not express an

undesirable characteristic. This moving of DNA pieces between

unrelated organisms is called recombinant DNA technology.

There are many ways to insert a piece of DNA from one organism

into the cells of another organism. In recombinant DNA technology,

one of the most widely used mechanisms for DNA insertion is the

plasmid from Agrobacterium tumefaciens.

plasmidvector

gene

gene

restriction enzyme activit

gene

DNA moleculethat containsdesired gene

fragmentedDNA

molecule

gene putinto plasmid

gene

bacteria’schromosomal

DNA

plasmid

plasmid put intobacteria

A plasmid is a circular ring

of DNA which is found in

some bacteria. The Agro-

bacterium’s plasmid is

unique because it has a

DNA transforming region.

When the bacterium

bumps up against another

cell, the DNA within the

transfer region (T-DNA)

“jumps out” of the plasmid

and is inserted into the

other cell’s chromosome.

As a biotechnologist, you could use your knowledge about this special

capability of the T-DNA region of this plasmid in order to transfer

desirable genes into plant cells of your choice.

72

So how do you “recombine”

DNA using this technology?

Once you have found the

DNA that contains the

characteristics you want, you

must isolate or remove this

specific DNA section.

Restriction enzymes are special

molecules that cut the DNA in

specific places so that the

section you are looking for

may be removed.

Once the DNA fragment is cut,

it needs to be inserted into

the vector DNA ( the

Agrobacterium’s plasmid).

You must first isolate the

plasmid from the Agrobacterium,

and then expose the plasmid to

the restriction enzymes so that

a gap in this circular DNA opens

to combine with the new piece

of DNA.

The restriction enzymes must

be selected carefully so that:

1) it cuts the DNA fragment (the

new piece of DNA) that contains

the specific characteristics you

want, and 2) it splices the T-DNA

out of the plasmid, but leaves

the genes responsible for

transfer intact!

STU

DENT ACTIVITY

DINI N G O N D

NA

An Example ofRecombinantDNA Technology

Use of Use of Use of Use of Use of Agrobacterium

tumefaciens to ferry “new” to ferry “new” to ferry “new” to ferry “new” to ferry “new”genes into plant cells.genes into plant cells.genes into plant cells.genes into plant cells.genes into plant cells.aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaleaf diskaaaaaaaaaaaaaaaaaaaaAgrobacterium tumefac

new leaf cellswith new gene

Now you must “recombine” the plasmid with the DNA fragment coding

for the specific characteristic you want. Once the plasmid and new DNA

piece are mixed together, they must be joined. Ligase is a molecule which

helps to join the exposed ends of the plasmid with the new DNA piece.

Ligase functions like a piece of tape, binding the pieces together.

The “new” plasmid is then put back into the Agrobacterium and when the

bacterium replicates, this new DNA will replicate too. Very often, this

Agrobacterium plasmid is inserted into the plant in which the desired

changes are sought. When this Agrobacterium bumps up against a plant

cell, the new piece of DNA in the transfer region of the plasmid jumps

into the plant cell’s chromosomal DNA (linear DNA). Thus, the “desired”

piece of DNA and the trait it codes for are transferred into the plant cell.

73

Risky BusinessOr StupendousSolutions?

A Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit Analysisof Food Biotechnologyof Food Biotechnologyof Food Biotechnologyof Food Biotechnologyof Food Biotechnology

Summary:Summary:Summary:Summary:Summary:The class divides into groups of 2-4 students. Each group is then given

the background information on a specific scenario pertaining to a food

biotechnology application. The group discusses the scenario, answers

questions pertaining to the scenario and then lists some potential risks

and benefits associated with this application. As a group, they come to

a consensus on whether or not to send this new food to market.

Objectives:Objectives:Objectives:Objectives:Objectives:• Students will be exposed to current applications of biotechnology

in food and agriculture.

• Students will utilize critical thinking skills in assessing the positive

and negative aspects of these biotechnology applications.

• Students will draw on the scientific concepts they have been

exposed to in previous exercises in this unit to develop conclusions

related to the utilization of a specific biotechnology application.

• Students will be exposed to group discussion and consensus reaching.

Suggested Time:Suggested Time:Suggested Time:Suggested Time:Suggested Time:Two class periods (with homework time for question answering).

Materials Needed:Materials Needed:Materials Needed:Materials Needed:Materials Needed:• Background information scenario sheet

• Student Activity Sheets

Teacher Preparation:Teacher Preparation:Teacher Preparation:Teacher Preparation:Teacher Preparation:Familiarize yourself with the various food biotechnology applications

that the students will be investigating. Prepare copies of the Student

Activity Sheets.

Procedure:Procedure:Procedure:Procedure:Procedure:1. Class is divided into groups of 2-4 students.

2. Each group is then given a background information sheet

pertaining to a specific application of biotechnology in food

and agriculture.

The topics are:

• Lower Fat Potato Chips and French Fries

• The Flavr Savr™ Tomato

• Recombinant Bovine Somatotropin (BST)

• Frost-resistant Strawberries

• Virus-resistant Squash and Sweet Potatoes

• Herbicide-resistant Soybeans

• Peanut Protein

• Potato Plant-Pesticides

74

3. Group Discussion:

The group reads about the specific biotechnology application,

discusses it at length, focusing on the potential risks and benefits

this application may pose.

4. Answer Questions:

Each group answers all of the questions on the Student Activity

Sheet. Included are questions that relate to the details of the specific

food biotechnology application as well as inquiries regarding the

risks and benefits of this food biotechnology application. Questions

are to be completed for the homework assignment.

5. Group Discussion:

The next day in class, the group returns to discussion. They should

reach a consensus in terms of whether their specific biotechnology

application should be marketed to the general public.

6. Presentation:

Each group selects a spokesperson. The spokesperson gives a brief

overview of the food biotechnology application which was

reviewed by the group and then details the group’s assessment

of the risks/benefits and their ultimate conclusion in terms

of marketing.



75



STU

DENT ACTIVITY

DINI N G O N D

NA

Does DNA intrigue you? scare you? excite you? confuse you? Now that

you know what DNA is, what DNA does, and how DNA is altered, you

should be able to answer these questions rationally. Scientists today are

using biotechnology to change food either as it grows or as it is processed.

In the near future, your knowledge of the risks and the benefits involved

with biotechnology as it applies to food will help you make decisions as a

consumer. The following are eight food products (or potential food products)

developed via some application of biotechnology. Your group will either

select or be assigned one of these foods. Your task will be to discuss that

product, answer questions about it and ultimately decide if it should be

sent to the marketplace to be sold to consumers.

Heart disease is the number one

killer in the United States. Studies

have shown that a diet lower in fat

and cholesterol can reduce the

risks of heart disease. In 1992,

Monsanto Company genetically

altered a potato so that the starch

content of this potato would be

higher. A higher starch content

results in less oil absorption during

frying The cost of producing

french fries and chips from these

altered potatoes is potentially

lower due to decreased oil use, and

the end product also is considered

healthier due to its lower oil

content. This potato was produced

by the insertion of a gene from a

bacterium into a Russet Burbank

potato.

Lower FatLower FatLower FatLower FatLower FatPotato ChipsPotato ChipsPotato ChipsPotato ChipsPotato Chips

andandandandandFrench FriesFrench FriesFrench FriesFrench FriesFrench Fries

76

In the United States, tomato-

lovers spend $4 billion dollars on

tomatoes each year (this includes

tomatoes for salads, pastes, sauces,

ketchups, and soups). American

consumers expect to be able to

purchase fresh tomatoes all year

long, so during cold months

tomato growers have a hard time

keeping up with the demand.

Over the winter, tomatoes

grown in southern states are

picked while green and shipped

to northern states. The tomatoes

are then reddened and ripened in

containers filled with ethylene

gas. Northern consumers

complain because ethylene-

ripened tomatoes do not have the

“backyard summertime” flavor of

those in grocery stores during

warmer months. Another

problem is that because the

tomatoes were picked early, they

did not take up enough nutrients

from the soil and sun order to

gain vine-ripened flavor and

texture. What’s more, ethylene-

ripened tomatoes start rotting in

4-7 days, so many tomatoes spoil

before they can be sold.

Pectin, a naturally occurring

fiber substance, is what gives

tomatoes their firmness and keeps

tomatoes from getting mushy.

Tomatoes have a gene (section of

DNA) that codes for an enzyme

called polygalacturonase. Lets call

it “polyG” here for simplicity.

PolyG actually chews up the

pectin in the tomato and the end

result is a softer, mushier tomato.

A company called Calgene, Inc.

genetically engineered a tomato

by changing this gene that codes

for polyG. Basically, they “turned

off’’ the gene that codes for the

polyG enzyme so that the tomato

does not soften as quickly and can

stay on the vine longer to gain

some delicious flavor there. These

new, genetically altered

tomatoes were named Flavr

Savr™ tomatoes.

How did the scientists “turn

off “the polyG gene? They

introduced an “antisense” version

of the polyG gene into the

tomato plant cell. An antisense

gene is basically an inverted or

mirror image copy of the original

gene. When the antisense gene is

introduced into the cell it

attaches, like a puzzle piece to

the original polyG gene and

therefore does not allow the

polyG gene to code for the

polyG enzyme, The end result is

a tomato that stays firm even as

it continues to ripen.



STU

DENT ACTIVITY

DINI N G O N D

NA

TheTheTheTheTheFlavr SavrFlavr SavrFlavr SavrFlavr SavrFlavr Savr™

TomatoTomatoTomatoTomatoTomato

77



STU

DENT ACTIVITY

DINI N G O N D

NA

Ice Minus VersionBelieve it or not, bacteria are

found on all plants. Bacteria

thrive on plants because they

feed on plant material (leaves,

stems and fruit).

A particular bacteria, Pseudo-

monas syringae (soo-du-mone-us

sir-in-gay) is commonly found on

plants. Pseudomonas has a protein

in its cell membrane that

promotes ice crystal formation.

So when the Pseudomonas is

sitting on the leaves or fruit of a

strawberry plant and the

temperature dips, this protein

will result in ice crystals forming

on the strawberry plant. Once the

ice forms, the plant is damaged

and the Pseudomonas can have a

feast on the weakened plant. Not

such a dumb microbe, huh?

Well, scientists have isolated

the gene in Pseudomonas that

codes for the ice crystal forming

protein. They can remove the

gene, grow a new version of

Pseudomonas without the gene

called “ice-minus” Pseudomonas,

Frost-resistantFrost-resistantFrost-resistantFrost-resistantFrost-resistantStrawberriesStrawberriesStrawberriesStrawberriesStrawberries

and spray the strawberry plants

with the ice-minus Pseudomonas.

These plants can tolerate

temperatures down to 27 ° F with-

out freezing. The end result is

reduced loss to the farmer and

more undamaged strawberries for

you!

Artic Flounder Antifreeze

Version

Another way that scientists are

working to keep strawberries

from freezing is by using the help

of a fish called the Arctic

flounder. The Arctic flounder

makes an “antifreeze” protein to

protect itself against the chilly

waters in which it lives. Scientists

have isolated the gene that codes

for this antifreeze protein and are

now attempting to insert this

gene into the DNA of the

strawberry plant. If this insertion

is successful, the strawberry plant

should be able to make this

antifreeze protein and therefore

protect itself when the mercury

drops!

78



STU

DENT ACTIVITY

DINI N G O N D

NA

Potato PlantPotato PlantPotato PlantPotato PlantPotato PlantPesticidePesticidePesticidePesticidePesticide

Many different types of bacteria

find their homes on the leaves,

stems and fruit of plants. These

microbes must often compete for

their nutrients (food) with other

plant pests such as insects or

fungi. How do they compete?

They produce a substance called a

toxin which is harmful to their

opponents, the insects and fungi.

As scientists observed this

competitive relationship between

the plant pests, some came up

with the idea to allow the plant to

defend itself by producing this

toxin all on its own.

How did they do it? Let’s

explore the background in a little

more detail. There is a specific

bacteria known as Bacillus

thuringiensis or Bt for short. Bt

produces a substance which is

toxic to many insects. Scientists

identified the Bt genes responsible

for the production for this toxin

and transferred these genes into

certain crop plants such as

potatoes, corn and cotton. Now

these plants which have been

genetically engineered are able to

produce the toxin on their own

and protect themselves against

the damaging insects. The toxin

produced directly by the plant is

called a “plant pesticide”. Many

people who support this research

feel that by enabling plants to

protect themselves through

producing plant pesticides, the

use of conventional or chemical

pesticides will be reduced. The

U.S. Environmental Protection

Agency has approved some

limited use of the Bt plant

pesticide. Also, they have

determined that the use of the Bt

plant pesticide will not pose an

unreasonable risk to the health of

people or other organisms which

are not targeted by the plant

pesticide.

79



STU

DENT ACTIVITY

DINI N G O N D

NA

RecombinantRecombinantRecombinantRecombinantRecombinantBovineBovineBovineBovineBovine

SomatrotropinSomatrotropinSomatrotropinSomatrotropinSomatrotropin

Bovine somatotropin is a protein

hormone which is naturally

produced in dairy cows. It is also

known as BST. BST plays a role in

some vital functions of the cow

such as growth and milk

production. In the early 1980’s

scientists at a biotechnology

company called Genetech

isolated the genes that code for

the production of BST in cows. By

inserting these genes into

bacteria, scientists were able to

produce large quantities of BST in

the laboratory. This form of BST

which is produced through

genetic engineering is called

recombinant BST or rBST.

The next step was to see how

the rBST affected the cows. It was

found that when rBST is given

(via injections) to lactating cows,

milk production is increased by

about 10%. Since this discovery,

two companies (Monsanto and Eli

Lilly) have developed a

commercially available form of

rBST to be used by dairy farmers,

The U.S. Food and Drug

Administration (FDA) has

approved the use of rBST in dairy

cows. The FDA reported that rBST

does not change the composition

of milk and poses no health

threats to individuals who

consume the milk. According to

research conducted on rBST and

cows supplemented with rBST:

• The concentration of BST in

the milk of cows treated with

usual doses of rBST is not

higher than the concentration

in untreated cows

• When people ingest BST orally

or receive an injection of BST,

BST has no biological activity

in these people.

• BST is a protein and is digested

like other proteins in the

human digestive tract.

80



STU

DENT ACTIVITY

DINI N G O N D

NA

Viruses are ultramicroscopic

infectious agents. Scientists call

viruses “infectious agents” for two

reasons. First, viruses have both

living and nonliving features, so it

is difficult to call a virus an

organism. Second, viruses must

live inside the cells of a living host

in order to survive. Viruses infect

their living hosts (mainly

bacteria, plants, or animals) and

make the hosts sick. Hence,

viruses are infectious agents.

In plants, many viruses are

transmitted by aphids (little

insects that feed on plants).

Viruses can be detrimental to the

development of a plant and to the

success of a farmer’s crop. To

engineer a virus resistant plant,

scientists take a gene out of a virus

and then insert that gene into the

plant of choice. Once the virus

gene is inside the plant the gene

becomes part of the plant’s DNA

and acts as a vaccine. Virus

resistant squash and virus

resistant sweet potatoes are two

examples of plants which have

been genetically modified to

combat deadly plant viruses

In 1992, the Asgrow Seed

Company of Michigan developed

a yellow crookneck squash that

was resistant to two different

viruses. These two viruses can

wipe out up to 80 percent of an

annual squash crop. Disease

symptoms include fruit

discoloration and a distorted

shape. Because of the effects of the

virus, squash producers cannot

sell infected fruit. Thus virus-

resistant squash plants could

greatly impact how much of the

squash the farmer sells. (Note:

Scientists use the Agrobacterium

tumefacien s method of gene

transfer to produce the new

squash. See Chocolate Flavored

Cherry activity.)

In Africa, sweet potatoes are

one of the staple crops.

Unfortunately, a virus called

feathery mottle virus (FMV) kills

two-thirds of the typical sweet

potato crop every year. Many

African farmers cannot afford

chemical pesticides so the

development of a virus-resistant

sweet potato could have

tremendous value by reducing

hunger and enhancing

nutritional status.

Virus-resistantVirus-resistantVirus-resistantVirus-resistantVirus-resistantSquashSquashSquashSquashSquash

andandandandandSweet PotatosSweet PotatosSweet PotatosSweet PotatosSweet Potatos

81



STU

DENT ACTIVITY

DINI N G O N D

NA

How do modern farmers deal

with weed problems? One

solution is to use chemical

herbicides. Herbicides are

chemical substances used to

destroy plants or limit their

growth. One such herbicide is

called Roundup ®. Roundup ® has a

compound called glyphosate in it.

Glyphosate is called a broad

spectrum herbicide because it

negatively impacts many

different types of plants (for

example, broad leaf plants and

grasses). Therefore, Roundup® will

not only harm the pesky weeds, it

may also harm the desired crop

plant. So, scientists from a

company called Monsanto

identified a gene which enables a

plant to tolerate Roundup ®. They

transferred this gene into a

soybean plant and then, through

traditional plant breeding

methods, created many of these

Roundup ®-resistant soybean

plants. The name given to the

plants are Roundup ® Ready™

soybeans. Now, farmers are able to

apply Roundup ® to their fields to

get rid of the weeds yet do not

have to worry about harming

their soybean crop.

Those who advocate the use of

this application of biotechnology

note that Roundup ® is an

herbicide that is easily degraded

in the environment and that by

making the crop plants resistant

to Roundup ®, the end result will

be less overall volume of

herbicides used. Individuals

opposed to this technology

fear that the genes for

herbicide-resistance will be

somehow passed to the weeds.

Herbicide-resistantHerbicide-resistantHerbicide-resistantHerbicide-resistantHerbicide-resistantSoybeansSoybeansSoybeansSoybeansSoybeans

82



STU

DENT ACTIVITY

DINI N G O N D

NA

Peanuts are high in protein, but

are also high in fat. In order to

utilize the protein in a peanut and

avoid the fat, scientists and

nutritionists have suggested

putting the genes that code for

peanut protein into corn. Corn

that contains the peanut protein

will have a higher protein content

than normal corn. A high protein

corn has tremendous potential in

our country and in third world

countries as well.

In our country, corn is used in

processed food like cereals,

breads, and chips Increasing the

protein content in corn would

therefore increase the nutritional

value of these processed foods.

In third world countries,

malnutrition is a big problem.

Because corn is a staple crop in

most of these countries, a high-

protein corn could help combat

Peanut ProteinPeanut ProteinPeanut ProteinPeanut ProteinPeanut Proteinin Cornin Cornin Cornin Cornin Corn

protein calorie malnutrition

world-wide The condition of

protein calorie malnutrition in

people is called kwashiorkor

(kwash-ee-or-kor).

Now for the controversy! Yes,

it’s true that peanuts are high in

protein, yet this peanut protein

causes an allergic reaction in some

people. So if the gene coding for

the peanut protein is transferred

into another food, such a corn,

how is that person to know that

he/she should avoid eating the

corn? Other biotechnologists

argue that genetic engineering

techniques can actually be used

to reduce the presence of allergy

causing proteins in food since

scientists can isolate the gene

coding for the allergen and

reverse it or cut it out so that

protein will no longer be made.

83

Risky Businessor StupendousSolutions?

A Risk/BenefitA Risk/BenefitA Risk/BenefitA Risk/BenefitA Risk/BenefitAnalysis of FoodAnalysis of FoodAnalysis of FoodAnalysis of FoodAnalysis of FoodBiotechnologyBiotechnologyBiotechnologyBiotechnologyBiotechnology

STU

DENT ACTIVITY

DINI N G O N D

NA

Please answer all of the following questions as they apply to your

specific food biotechnology application:

Food Safety Concerns:

1. An allergen is any substance that can cause an allergic reaction in a

person. Does this application of biotechnology pose any problems

in terms of introducing an allergen to the food? Explain.

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

Nutrition Quality:

2. Does this application of biotechnology enhance or take away from

the nutritional quality of the original food? Explain.

________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

World Hunger:

3. Does this application of biotechnology have the potential to

impact world hunger? How?

________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

Environmental Issues:

4. Will this application of food biotechnology:

a. Increase the use of chemical pesticides? ________________

b. Decrease the use of chemical pesticides? ________________

c. Not impact chemical pesticide use? ___________________

Explain your answers.

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

_________________________________________________________________

_________________________________________________________________

_________________________________________________________________

84


A Risk/BenefitA Risk/BenefitA Risk/BenefitA Risk/BenefitA Risk/BenefitAAAAAnalysis of Foodnalysis of Foodnalysis of Foodnalysis of Foodnalysis of FoodBiotechnologyBiotechnologyBiotechnologyBiotechnologyBiotechnology

5. Biodiversity is a term which is used often when discussing whole

ecosystems. Biodiversity refers to the variability of animals, plants

and microorganisms within a specific ecosystem. Does introduction

of the genetically altered product you read about pose any

environmental risks in terms of biodiversity?

________________________________________________________________________

_________________________________________________________________

_________________________________________________________________

Economics:

6. Is this application of biotechnology needed from an economic

point of view? Explain.

________________________________________________________________________

_______________________________________________________________________

_______________________________________________________________________________________________________________________________________

7. Does this application of biotechnology have the potential to have

positive of negative economic impact on:

a. the farmer? Explain.

__________________________________________________________________

_________________________________________________________________

b. the food processor? Explain.

__________________________________________________________________

_________________________________________________________________

c. the consumer? Explain.

__________________________________________________________________

_________________________________________________________________

Aesthetics:

8. Will this application of biotechnology change the appearance of

the food to make it more marketable (desirable to the consumer)?

How?

________________________________________________________________________

________________________________________________________________________

_______________________________________________________________________________________________________________________________________

_______________________________________________________________________________________________________________________________________

STU

DENT ACTIVITY

DINI N G O N D

NA

85



Social Issues:

9. Might this application of biotechnology present problems to

consumers due to religious or moral beliefs? Explain.

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

_______________________________________________________________________

10. Now list five potential risks and five potential benefits of this

application.

Potential Risks:

a. _____________________________________________________

______________________________________________________

b. _____________________________________________________

______________________________________________________

c. _____________________________________________________

______________________________________________________

d. _____________________________________________________

______________________________________________________

e. _____________________________________________________

______________________________________________________

Potential Benefits:

a. _____________________________________________________

______________________________________________________

b. _____________________________________________________

______________________________________________________

c. _____________________________________________________

______________________________________________________

d. _____________________________________________________

______________________________________________________

e. _____________________________________________________

______________________________________________________

STU

DENT ACTIVITY

DINI N G O N D

NA

86



STU

DENT ACTIVITY

DINI N G O N D

NA

11. How might we minimize the risks and maximize the benefits of

this technology?

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

_____________________________________________________________________________

____________________________________________________________________________

____________________________________________________________________________

12. Prioritize your list of Potential Risks (rate the risks on a scale from

1 to 5, with 1 being most risky and 5 being least risky).

1. _____________________________________________________

2. _____________________________________________________

3. _____________________________________________________

4. _____________________________________________________

5. _____________________________________________________

13. Prioritize your list of Potential Benefits (rate on a scale of 1 to 5,

with 1 being the most beneficial and 5 being the least beneficial).

1. _____________________________________________________

2. _____________________________________________________

3. _____________________________________________________

4. _____________________________________________________

5. _____________________________________________________

14. Assess the priorities and state why you approve (or disapprove) of

this application of biotechnology.

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

____________________________________________________________________________

____________________________________________________________________________

15. Take a group vote to decide whether the group approves or

disapproves the application.

Number who approve? _________________________________

Number who disapprove? ______________________________

87

16. Discuss your reasons for supporting or opposing the application.

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

_____________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

_____________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

_____________________________________________________________________________

______________________________________________________________________________

_____________________________________________________________________________

______________________________________________________________________________

_____________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________



STU

DENT ACTIVITY

DINI N G O N D

NA

88



Students will answer questions in the following categories according to

the application of biotechnology they have chosen. Some general

answers in all categories are provided below.

Food Safety Concerns:1. Does this application of biotechnology pose any problems in terms

of introducing an allergen to the food? Explain.

The alteration of the genetic makeup of some plants may produce

unforeseen health risks through the introduction of an allergen into a

plant which previously contained no allergen. Hence, people who are

allergic need to be made aware that the “new” food does contain a

potential allergen. For example, many people are allergic to peanuts. A

protein for a peanut allergen that has been transferred into the corn

plant is not immediately apparent to the person who picks up that ear

of corn. This poses a potential danger for people who are allergic to this

peanut protein.

Nutrition Quality:2. Does this application of biotechnology enhance or take away from

the nutritional quality of the original food? Explain.

Genetically altering foods can make a big impact on certain foods.

Foods can be made more nutritious, already nutritious foods can be

made tastier, and perishable foods can be given a longer shelf-life. On

the other hand, concern has been voiced that genetically altering foods

may decrease the beneficial nutrient composition of that food.

However, at this point in time, there has been no approval sought for a

food which has significant compositional differences from the “parent”

(non-genetically altered) counterpart.

World Hunger:3. Does this application have the potential to impact world hunger?

How?

At present, there are 5.5 billion people inhabiting Earth. According to

statistics on population growth, approximately 11 billion people will

inhabit the world by the year 2030. Many people question whether or

not we will have the capability to feed an extra 5.5 billion mouths (plus

the 700 million people who presently do not have enough food to eat)

in the next forty years. Food biotechnology may be a part of the

solution to the many facets of world hunger. Increasing crop yields,

allowing crops to grow in regions presently not suited for adequate

growth, and enhancing the nutrient composition of a food are all

potential ways that biotechnology can help the world hunger problem.

89



Environmental Issues:4. Will this application of biotechnology:

a. Increase the use of chemical pesticides?

b. Decrease the use of chemical pesticides?

c. Not impact chemical pesticide use?

Explain your answer.

Many genetically altered foods are targeted at cutting the amount of

pesticide use in crop production. Some applications of biotechnology

are designed to protect the environment by producing crops that can

withstand environmental stresses. Examples:

a. In some cases, the goal is to reduce the need for pesticides by

enabling plants to kill any pests that endanger them. The plants,

themselves, are given the gene to produce whatever toxic substance

adversely affects the pest. Therefore, application of chemical

pesticides is lessened.

b. Biological control is another biotechnology application which has

environmential implications. Bacteria and viruses are directly applied

to the plant, as chemical pesticides presently are. The “live” pesticides

produce toxins to decrease pest damage on that particular plant. Once

again, the need for chemical pesticide application is lessened.

c. Pesticide, herbicide, fungicide tolerant crops are being created so

that the chemical can be applied on an entire field and the desired

crop plant will not be adversely affected. This application of

biotechnology has the potential to increase the use of a particular

pesticide on a field due to a more blanket approach to application.

However, it may also have the potential to decrease overall pesticide

use on that field because that one particular pesticide will be all that is

necessary and a less toxic chemical may be used.

5. Does introduction of this transgenic product pose any

environmental risks in terms of biodiversity?

Any mutation (natural or otherwise) in an organism affects variability

within the environment by altering the genetic makeup of a species.

When an organism’s genetic makeup is affected, that organism may

either be able to do something it couldn’t do before, or not do

something it could do before genetic manipulation. Because the

organism’s abilities may change, it impacts the environment

differently. Whether the impacts of genetic engineering benefit

or hinder environmental diversity is highly debatable.

90

Many people feel that genetic changes enhance the diversity within

the environment, because we are adding new characteristics to existing

organisms. Other people feel that genetic engineering threatens the

diversity within the environment by stifling natural selection and

letting engineered organisms out-compete natural organisms. The

argument has been made that genetic engineering lets man dictate

which organisms will live, so many “undesirable” natural species will

be allowed to become extinct. It has also been said that diversity

within the environment gives the ecosystem resilience, and any

decrease in nature’s biodiversity could be deadly.

Economics:6. Is this application of biotechnology needed from an economic

point of view?

The answer to this question will vary depending on the biotechnology

application in review. For example, a biotechnology application which

promises to decrease hunger in a third world country most definitely

would be viewed as “needed” from an economic stand point.

Additionally, any application which could boost crop yields could be

viewed as “needed” for that local economy. The only situation which

would not seem “needed” from an economic point of view would be

that which would increase the presence of a product which is already

in surplus in a market (for example, milk and BST in the U.S.). Yet, the

argument could be made that this application of biotechnology looks

to the future when the population to be fed will be greater and the

need for a greater food supply exists.

7. Does this application of biotehcnology have the potential to have

positive or negative economic impact on

a. the farmer?

b. the food processor?

c. the consumer?

Some applications of biotechnology will have an enormous impact

on a specific industry, a local economy or a broader economy.

Positive impacts may include: 1) the creation of a whole new industry

for an area, and 2) the creation of a more affordable food supply.

Negative impacts may include: 1) the downfall of an existing industry,

and 2) the creation of an exclusive product that would drive up prices.



91

Aesthetics:8. Will this application of biotechnology change the appearance of

the food to make it more marketable (desirable to the customer)?

How?

Some efforts in food biotechnology are in the creation of fruits and

vegetable which have a longer shelf-life. By delaying the softening

(ripening) of the food, the appearance is more “fresh” or desirable for

the consumer.

Social Issues:9. Might this application of biotechnology present problems to

consumers due to religious or moral beliefs? Explain.

Some people have religious or moral beliefs which inhibit them from

eating certain animal foods. For example, kosher food practices do not

allow for the consumption of pork or pork products. The religious and

moral debate focuses on issues like the following: If a pig gene were

introduced into a plant or animal to make a transgenically altered

food, would a person following kosher practices be allowed to eat that

food? Additionally, many people are opposed to any application of

biotechnology due to beliefs that genetically altering an organism is

“playing God” and that it is not man’s place to do this.

10. Now list five potential risks and five potential benefits of this

application.

The previous questions were designed to initiate thought and to enable

students to answer this question well. Again, answers here can be based

on thoughts generated above in the students’ work.

Potential Benefits:

a. Foods could be made more nutritious.

b. Already nutritious food could be made tastier.

c. Perishable foods can be given a longer shelf-life.

d. Decrease the number of food poisoning incidents by increasing the

detection of food borne pathogens.

e. Waste management: Enzyme bioreactors are being developed that

will pretreat certain components of disposable serviceware or waste

and allow their removal through the sewage system rather than

through solid waste disposal or convert them to biofuel for operating

generators.



92



f. Reduce the need for pesticides by transferring the genes that confer

resistance.

g. Make plants grow faster, therefore shortening the time to market

and reducing dependence on fertilizers and feed.

h. Make crops more drought tolerant, therefore increasing food

supplies in the world’s hungriest nations.

i. Non-food materials could be made from foods. For example,

research is being done so that plastics may be made from potatoes

by using a gene that creates a precursor of plastic in the tubers.

Potential Risks:

a. Allergic Reactions: Genes code for the creation of proteins and

proteins can set off allergic reactions. One concern is the possibility

that a new food would be created with a gene from another food

(like peanuts or shellfish) that contains allergy-provoking proteins.

b. Some people have religious or moral beliefs which inhibit them

from eating certain animal foods. Would the recombining of a gene

from these certain animals into a food that is okay to eat keep people

from eating the “new and improved” recombined food?

c. Marker genes are often inserted into the new host along with the

gene that confers the desired characteristics. The marker gene allows

scientists to determine if the gene transfer has, in fact, been successful.

Very often this marker is antibiotic resistant and it is through this

resistance that scientists are able to note the successful gene transfer.

However, some people worry that these antibiotic marker genes might

make consumers antibiotic resistant, either by getting into their genes

or into the microorganisms which inhabit their gut. These fears are

most likely unfounded since the protein dictated by this antibiotic

resistance gene would be quickly digested when eaten.

d. Environmental concerns: What about the possibility of

genetically altered “test” plants or animals getting out into the wild

and taking over, changing the nature of environments?

e. Some scientists fear that the introduced genes could adversely

affect other genes in the organism.

f. Ethical Concerns: Many concerns have been expressed that

genetically altering organisms is “playing God” and that it is not

man’s place to do this.

93



9. How might we minimize the risks and maximize the benefits of

this technology?

One possible way to minimize the risks might be to enforce strict

labeling requirements for genetically altered foods, and another

might be to follow a stringent approval process.

To maximize the benefits of genetically altered foods, scientists and

regulatory agencies must keep careful watch on preliminary testing.

Genetically altered foods may eventually help eliminate starvation

in third world countries and help us meet the food demands of the

twenty-first century.

Note: The remaining questionswill express the results ofthe group discussion andconsensus building.

94

Summary:Summary:Summary:Summary:Summary:Students will select a career that interests them from a list of possible

careers related to the field of biotechnology. They will create ten

provocative questions from which they will learn more about this

career. With these ten questions they have the option to conduct an

interview (in person or by phone) with a person working in this role

or close to it. Or, they may find the answers to their inquiries through

researching that particular career. All students will present the results

of their interviews/research projects to the class in a brief five minute

presentation so that the entire class will benefit from the individual

inquiries.

Objectives:Objectives:Objectives:Objectives:Objectives:1. Students will be exposed to many careers in biotechnology.

2. Students will examine a specific career in biotechnology and

assemble a list of provocative inquiries about the career.

3. Students will make a connection with a professional individual

who is actually employed in a biotechnology related field.

4. Students will assess their own individual skills, likes and dislikes

in terms of future professional desires and options.

5. Students will practice their writing and presentation skills.

Suggested Time:Suggested Time:Suggested Time:Suggested Time:Suggested Time:Homework and one class period for student presentation.

Note : This activity could serve as an extra credit activity if class time

does not allow it to be conducted in class.

Procedure:Procedure:Procedure:Procedure:Procedure:1. Students will read the list of biotech careers.

2. From the list, students will select one career to investigate in depth.

Students may choose a career not on the list with teacher approval.

3. Students will make up a list of ten questions which inquire about

various aspects of the career they wish to investigate.

InvestigatingCareers inBiotechnology

95


4. With the list of ten questions students have two options:

a. Contact an individual who is working in a position similar to

the one selected by the student and conduct an interview,

utilizing the ten questions developed. A written representation

of the interview must be turned in for a grade.

b. Research, at the library or from on-line sources through any

publications you can find, about the position you have selected.

Keep in mind, guidance counselors often have career

information software that may be useful for this activity.

Try to answer all ten of your questions through this research.

Additional Activities:Additional Activities:Additional Activities:Additional Activities:Additional Activities:Teacher could invite a representative of a biotech company

or university to speak to the class regarding his/her career in

biotechnology.

96

Have the questions started yet? “What do you want to be when you grow

up?”, “Where are you going to college?”, “What will be your major in

college?” If they haven’t, don’t worry, they will. But how do you ever know

the answers to these questions? There are so many exciting career

possiblities available. Biotechnology, a rapidly changing and growing area,

offers a wide variety of opportunites. Yet, how are you to know if this is the

field for you until you investigate what’s out there? Through this activity

you will look, in detail, at one of many possible career options related to

biotechnology. At the end of your investigation, you will present your

findings to the class and learn about all of the interesting careers your

fellow classmates chose to investigate. Have fun!

Before getting started on your career investigation, let’s look at some

general information about careers related to biotechnology:


STU

DENT ACTIVITY

DINI N G O N D

NA

What types of places hire people forWhat types of places hire people forWhat types of places hire people forWhat types of places hire people forWhat types of places hire people forbiotechnology related jobs?biotechnology related jobs?biotechnology related jobs?biotechnology related jobs?biotechnology related jobs?

As the field of biotechnology expands so do the employment

opportunities. Below is a list of possible employers.

Undoubtedly there are many more!

• colleges and universities

• research and development units of large corporations

• production units of large corporations

• hospitals

• pharmaceutical companies

• agricultural research or production companies

• food processing companies

Where are most of the biotechnology jobsWhere are most of the biotechnology jobsWhere are most of the biotechnology jobsWhere are most of the biotechnology jobsWhere are most of the biotechnology jobslocated in the United States?located in the United States?located in the United States?located in the United States?located in the United States?

The majority of biotechnology companies, at this time, are

located either in the Northeast or along the West Coast.

However, more and more small firms are cropping up all over

the country. Additionally, most major universities have quite

a few biotechnology related projects going on at all times

in various departments.

97

Investigate A Career:Investigate A Career:Investigate A Career:Investigate A Career:Investigate A Career:From the list that follows, select a career that you think interests you

and investigate it further:

• Make a list of ten questions which will provide you with

information about the career you are investigating.

• Find the answers to these questions via one of two avenues:

1. Identify a person who is employed in that specific job and

conduct an interview (either in person or by telephone) with

that person.

2. Research the specific career in your library using books,

magazines or internet resources to answer all of your interesting

questions.

• Once you have gathered all of the information on a particular

career, present your findings to your classmates in a 5–10 minute

presentation.

Note: It might be fun to dress the part when you give your

presentation.

List of Biotechnology Related Jobs:List of Biotechnology Related Jobs:List of Biotechnology Related Jobs:List of Biotechnology Related Jobs:List of Biotechnology Related Jobs:Here is a list of job titles within the field of biotechnology. Each of the

job titles is followed by a very brief overall description of the job.

lab assistant : performs day-to-day experiments in a laboratory under

the supervision of a research scientist.

bio-process engineer: designs and operates systems that will enable a

biotech company to produce a product on a large scale.

research scientist: directs experiments at a university, research facility

or biotech company. Experiments are usually designed to answer an

unknown question about biochemistry or to develop a new technique

or application of biotechnology.

marketing or public relations specialist: presents a positive image of

the biotechnology research or applications to the public.

CEO (Chief Executive Officer): runs the company; decides which

research is done, what products are developed and future directions

of the company.


STU

DENT ACTIVITY

DINI N G O N D

NA

98

plant breeder: designs, develops and conducts plant breeding research

projects.

regulatory affairs specialist: prepares documents which are to be

submitted to regulatory agencies (for example, when the company is

seeking approval of a new, genetically altered product).

market research analyst: investigates and analyzes how well a product

will sell and what the competition is like; makes presentations to

company executives on any changes in the market or technological

changes.

quality control engineer: develops standards through which high

quality materials are processed into the final product.

environmental health and safety specialist: develops, monitors and

conducts industrial safety programs to ensure a safe working

environment for all employees.

biostatistician: analyzes data statistically so that research may be

published in professional journals or presented at professional

meetings.

technical writer: writes and edits laboratory procedures, company

standard operating procedures, informational or instructional

documents.

product development engineer: designs, develops, modifies and

enhances products or processes within the company.

instrument/calibration technician: performs maintainance,

calibration and repair on the analytical instruments and equipment

used in the research and development laboratory.

systems analyst: maintains computer operating system; provides

technical computer support.

sales representative: responsible for the direct sale of a company’s

product.

human resources representative: responsibilities may include hiring

personnel, working with benefits, employee relations or training

programs.

patent administrator: prepares all documentation for patent filings

and applications.


STU

DENT ACTIVITY

DINI N G O N D

NA

99

To Label orNot to Label

Summary:Summary:Summary:Summary:Summary:Students will investigate several topics related to food labeling,

specifically as it applies to genetically modified foods. Following their

investigation of the topics as well as their examination of existing food

labels, student teams will decide whether or not they believe

genetically modified foods should be labeled and to what degree.

Objectives:Objectives:Objectives:Objectives:Objectives:• Students will examine the many issues which are continuously

being debated in regard to the labeling of genetically modified

foods.

• Students will identify the regulatory agencies and laws which

govern food labeling in the United States.

• Students will incorporate skills in risk/benefit analysis as they weigh

the various issues pertaining to the labeling of genetically modified

foods in forming an opinion on the issue.

Suggested Time:Suggested Time:Suggested Time:Suggested Time:Suggested Time:One class period

Procedure:Procedure:Procedure:Procedure:Procedure:1. Teacher sets up display of a variety of food labels found on products

in the local supermarket. This display should be varied. Some of the

food labels should represent foods which are produced through

biotechnology techniques (old or new).

Some possible examples are a label from a yogurt indicating the use

of live cultures in the product; a label from a meat product

indicating safe preparation techniques; a label from cheese

produced with chymosin; a label from a loaf of sourdough bread;

and if available, a label from a tomato grown from genetically

altered seeds.

2. Students examine label display, taking note of the various pieces of

information on the food labels and filling in the information

requested on the To Label or Not to Label student activity sheet.

3. Teacher goes over the Food Labeling background information

handout.

4. Students divide into pairs. Within each pair, one student is

designated as the consumer advocate and the other is designated as

a representative of a food processing company which is seeking to

send a genetically modified food product to market.

100


5. Student pairs complete the Labeling Issues to Address student activity

sheet.

6. With each student in the pair assuming his/her designated role,

the pair debates their final decision as to whether or not the food

label of genetically modified food products should indicate this

genetic modification, and if so, to what degree. For this stage of

the assignment, the student pair should complete the Labeling

Selections student activity aheet.

7. To conclude the activity, the teacher should review the actual

present policy set forth by the FDA concerning the labeling of

genetically modified foods.

Materials:Materials:Materials:Materials:Materials:Food Label display, prepared ahead of time by the teacher

• To Label or Not to Label student activity sheet

• Food Labeling background bnformation handout

• Labeling Issues to Address student activity sheet

• Labeling Selections student activity sheet

Note to Teachers:Note to Teachers:Note to Teachers:Note to Teachers:Note to Teachers:

The FDA policy on genetically modified foods, as of the

publication of this module (1996) follows. You may want to

update this information periodically, as the legislation is

rapidly changing in this period of technological advancement.

FDA requires labeling of any new plant varieties,

regardless of how they were derived if they contain

transferred allergenic proteins.

FDA reopened the labeling issue when flooded with

letters saying that consumers have a right to know how

their food is produced. However, as of the printing of this

material, no major changes in labeling requirements

have resulted from this public comment.

101


Now that you are experts in the area of Food Biotechnology, you are going to

be asked to complete an important task. In this activity you will be required

to decide on the proper food label that should appear on genetically

modified foods to be sold in the marketplace. Before making your final

decision, you will review some information on food labeling and some

important issues surrounding the labeling of genetically modified foods.

Procedure:Procedure:Procedure:Procedure:Procedure:1. Study the display on food labels which has been put together by

your teacher. Please take note of the following points:

What information appears on all of the food labels?

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

Does any of the label information indicate the use of any

biotechnology technique in the production or processing of the

food (old techniques or modern techniques)?

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

What information appears to be there simply for the purpose of selling

the food product?

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

2. Review the Food Labeling background information handout with

your teacher’s help.

3. The teacher will divide the class into pairs. With your partner,

decide who will play the role of the consumer advocate and who

will play the role of the representative of a food processing

company which is seeking approval to market a genetically

modified food product.

4. With your partner, complete the Labeling Issues to Address

student activity sheet.

5. Debate with your partner, each in the appropriate role, the final

decision on how the food going to market should be labeled. For

this stage of the assignment, you and your partner should complete

the Labeling Selections student activity sheet.

STU

DENT ACTIVITY

DINI N G O N D

NA

102S

TU

DENT ACTIVITY

DINI N G O N D

NA

To Labelor Not to Label

1. Introduction of Allergens

Biotechnology Example: Transfer of peanut protein into corn

Some improvement in the growing characteristics of corn may result

from copying a protein from the peanut plant into corn. However,

many people have allergic reactions to peanuts. If these individuals

were to eat the genetically modified corn unknowingly, they may

have an allergic reaction to the transferred peanut protein in the corn.

Since your present role requires that you make important decisions

regarding food labels, how would you address the potential problems

of transferring the peanut allergen into corn?

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

2. The Expense of Labeling: Will It Block the Benefits of the

New Food?

Biotechnology Example: Virus resistant squash

Scientists are developing a squash which is resistant to a virus which

normally wipes out 80% of the squash crop. When this “new” squash is

grown, less acreage will be required to plant a more productive crop.

Therefore, less water, fertilizer and chemical pesticides will be required

to achieve the same yield. These are all environmental advantages.

However, if labeling is mandatory, the growers will incur greater

production costs due to the need to keep the genetically modified

squash separate from the other squash. Separate facilities and bins

require money that these growers cannot afford. Therefore it is likely

that most squash growers will not opt to grow the genetically modified

variety despite its advantages.

From your point of view as a labeling policy maker, would you require

the squash growers to label their produce? Explain your reasoning.

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

103

3. Consumer Perception of Labels as Warnings

When you see a food label, do you view the information on this label

as a warning or simply as a source of information for your general

knowledge? There is concern that consumers have negative feelings

toward mandatory labels and that they do, in fact, interpret such labels

as warnings. Comment on how labeling could negatively impact future

advancement in food biotechnology if it is true that labels are

perceived as warnings.

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

4. Changes in Nutrient Content

What if the genetic alteration to the specific food changes the

nutrient content of this food? We know tomatoes are a major source

of vitamin C. Hypothetically, what if a tomato is created that no

longer has vitamin C? Should the label be required to indicate this

change in nutrient composition? Explain your answer?

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________

________________________________________________________________________


STU

DENT ACTIVITY

DINI N G O N D

NA

104

STU

DENT ACTIVITY

DINI N G O N D

NA

5. Consumers Have a Right to Know How Their Food is Produced

We take it for granted that when we purchase a box of corn flakes that

what is inside the box is, in fact, corn flakes; not puffed rice, not bran

cereal, but corn flakes. We trust the label we read on the food package.

Where does this need for information on the label end? Do we need to

know more than what is basically required by the FDA on all food

labels (name of product, amount, ingredient list, etc.)?

On one side of the argument, people say they have a right to know how

foods were produced so they can make food choices based on a variety

of factors. These factors may be social, economic or environmental

concerns or concerns directly related to the wholesomeness and safety

of the food.

Others say that when you open the door to mandatory labeling of

factors which are “non-scientific” there will be no end to the number

of items proposed for inclusion on a food label. Such social statement

such as “Made by Union Labor” or “Made by Vegetarians” could

eventually be required by law to appear on labels if certain consumer

groups voice such desires loudly enough.

What are your thoughts on this issue? How much information

should be required by law to be on the food label? Should any and

all information on how the food was produced be available to the

consumer on the label? Explain your reasons for your answers.


________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

105

STU

DENT ACTIVITY

DINI N G O N D

NA


Food LabelingFood LabelingFood LabelingFood LabelingFood LabelingBackground InformationBackground InformationBackground InformationBackground InformationBackground Information

What governmental agency is in charge of food labeling?

The Food and Drug Administration (FDA) and the Food Safety

Inspection Service (FSIS) of the U.S. Department of Agriculture are the

governmental agencies responsible for assuring that foods sold in the

United States are properly labeled. The FDA regulates the labeling of

most food products, except for meat and poultry products which are

regulated by the FSIS. The responsibilities of these agencies apply to

foods produced in the United States (domestic) and foods imported

from foreign countries.

What laws govern food labeling in the United States?

Three main pieces of legislation are used by the Food and Drug

Administration in the monitoring and enforcement of proper food

labeling. These are:

• Food, Drug and Cosmetic Act (1938): This major piece of legislation

was passed as a result of concern over the safety of food being sold in

the United States. This Act identifies the FDA as the federal agency

responsible for enforcing food labeling legislation. Through this act,

a minimum quality standard was designated for foods.

• Fair Packaging and Labeling Act (1966): This Act is an amendment to

the original Food, Drug and Cosmetic Act. Generally, it says that all

food labels must contain the same basic information (see next

question, “What are some features of the food label which are required

by the FDA?”).

• Nutrition Labeling and Education Act (1990): This Act is also an

amendment to the Food, Drug and Cosmetic Act. Through this

legislation, foods are required to have nutrition labels that contain

information on nutrient content.

What are some features of the food label which are required by the

FDA?

• name of food

• net quantity of contents

• ingredients list (in order by weight)

• nutrition labeling information (sodium content, fat content)

• any danger the packaging may present (for example, “contents

under pressure”)

• name and address of manufacturer, distributor or packager

• statement if any artificial color or flavor

What is prohibited from being on food labels?

Statements which are misleading. For example, if a statement implies

that this particular food is safer than the competitors, yet there is no

scientific proof to back this up, then the statement is prohibited.

106

Food LabelingSelections

Now that you have reviewed the background information on food labeling

as well as explored many of the complicated issues associated with the

labeling of genetically modified foods, it is time for you and your partner to

come to an agreement on the proper food label to appear on foods which

have been genetically modified. Below is a selection of possible labels from

which you may choose. If none of these fit your needs, please feel free to

design your own label. At the bottom of the sheet is space for you to explain

your rationale.

Choice #1: Require a label only if the modified food might present a

health or safety issue to consumers. (For example: allergic reaction).

Choice #2: Require a mandatory label on all foods which have been

genetically modified in some way.

Choice #3: Require a label on all products containing any ingredients

which were modified through biotechnology.

Choice #4: Require no labeling at all for genetically modified foods.

Choice #5: Require a label only if the nutrient composition varies

greatly from the original food.

Choice #6: Your own custom label:

__________________________________________________________________

__________________________________________________________________

_________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

Give a summary of the discussion which took place between you and

your partner in coming to a consensus on which way to label the food.

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

STU

DENT ACTIVITY

DINI N G O N D

NA

107

References Additional Sources of InformationAdditional Sources of InformationAdditional Sources of InformationAdditional Sources of InformationAdditional Sources of Informationfor Your Reading Enjoyment:for Your Reading Enjoyment:for Your Reading Enjoyment:for Your Reading Enjoyment:for Your Reading Enjoyment:Alcamo, I. Edward. DNA Technology: The Awesome Skill,

Times Mirror Higher Education Group, Inc., IA, 1996.

Brown, Sheldon S. Opportunities in Biotechnology Careers ,N T C Publishing Group, IL, 1994.

Campbell, G.R. Biotechnology: An Introduction, American Councilon Science and Health, NJ, 1988

Food Biotechnology , International Food Information Council,Washington DC, 1993.

Kelfler, George H. Biotechnology, Genetic Engineering and Society(Monograph Series: III), National Association of BiologyTeachers, VA. 1987.

Rissler, Jane and Margaret Mellon. Perils Amidst the Promise ,Union of Concerned Scientists, MA. 1993.

Voichick, Jane and Tom Zinnen. Biotechnology and Food,University of Wisconsin Biotech Center, WI 1993.

Online Resources for Biotechnology Information:*Online Resources for Biotechnology Information:*Online Resources for Biotechnology Information:*Online Resources for Biotechnology Information:*Online Resources for Biotechnology Information:**The following addresses were current as of the publication date.

Access Excellencehttp://www.gene.com/ae

A multifaceted resource. A great communications networkfor teachers plus a wealth of online information and ideasfor classroom activities.

Internet Directory of Biotechnology Resourceshttp://biotech.chem.indiana.edu

Biotechnology Information Center (BIC)http://www.nal.usda.gov/bic

An organization within the U.S. Dept. of Agriculture,National Agriculture Library.

The Biology Placehttp://www.biology.com

Designed for biology educators by biology educators.Has an active genetics area.

The Biotech BiblioNethttp://schmidel.com/biotech.htm

A free monthly online bibliography of recently publishedbiotechnology articles, review and commentaries.

Global Agriculture Biotech Associationhttp://www.lights.com/gaba/index.html

Australian Biotechnology Associationhttp://www.aba.asn.au

108

Notes

Dining on DNA - TeacherTubecdn-media1.teachertube.com/doc604/18423.pdf · Chocolate Flavored...

Documents

Transcript of Dining on DNA - TeacherTubecdn-media1.teachertube.com/doc604/18423.pdf · Chocolate Flavored...