Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays...
Transcript of Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays...
![Page 1: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/1.jpg)
Different types of microarrays
cDNA spotted arrays(Stanford)
Affymetrix (25-mer)NimbleGen (50-75-mer)
Agilent (60-mer)Illumina (50-mer)
NimbleGenAgilentIllumina
Met
hod
ofge
nera
ting
prob
es# of samples
hybridizedSingle-channel Dual-channel
cDN
ALi
brar
ySy
nthe
size
d
![Page 2: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/2.jpg)
What Is Microarray Technology?
• Different Approaches
OligonucleotidescDNA(Complete sequences)
Length of DNAsequences
PhotolithographySpottingHow DNAsequences arelaid down
AffymetrixStanford/Pat Brown
![Page 3: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/3.jpg)
complementary DNA (cDNA)• cDNA is a strand of DNA that is complementary to part of an mRNA
sequence.
• cDNA can be formed by extracting mRNA and then using mRNA asa template for formation of cDNA
• cDNA sequences can be copied rapidly using PCR (polymerasechain reaction).
• These sequences can be spotted on glass slides to serves asmicroarray probes.
• Sequence length varies from a few hundred bases to a thousand orso.
...CCUGAUAGAUGG...mRNA
...GGACTATCTACC...cDNA
![Page 4: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/4.jpg)
cDNA Microarrays• Glass slides or similar supports containing cDNA
sequences that serve as probes for measuring mRNAlevels in target samples
• cDNAs are arrayed on each slide in a grid of spots.
• Each spot contains thousands of copies of a sequencethat matches a segment of a gene’s coding sequence.
• A sequence and its complement are present in the samespot.
![Page 5: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/5.jpg)
cDNA Microarray (continued)• Different spots typically represent different
genes, but some genes may berepresented by multiple spots
• The spotted sequences are known (or canbe determined) and their locations on thearray are known.
• The sequence locations do not changefrom slide to slide.
• A single slide typically contains thousandsof spots.
![Page 6: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/6.jpg)
cDNA microarray slide 2cDNA microarray slide 1
TTCCAG...TTCCAG...
TTCCAG...
...
GATATG...GATATG...
GATATG...
...
Each spot contains many copies of a sequence along with its complement (not shown).
spot forgene 201
spot forgene 576
TTCCAG...TTCCAG...
TTCCAG...
...
GATATG...GATATG...
GATATG...
...spot for
gene 201
spot forgene 576
![Page 7: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/7.jpg)
Spotting cDNA Probes on Microarrays• Solutions containing probes are transferred from a plate to a
microarray slide by a robotic arrayer.
• The robot picks up a small amount of solution containing a probe bydipping a pin into a well on a plate.
• The robot then deposits a small drop of the solution on themicroarray slide by touching the pin onto the slide.
• The pin is washed and the process is repeated for a different probe.
• Most arrayers use several pins so that multiple probes are spottedsimultaneously on a slide.
• Most arrayers print multiple slides together so that probes aredeposited on several slides prior to washing.
![Page 8: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/8.jpg)
Plate with wellscontaining probes
microarray slides
vacuumwash
station
Cartoon of Printing Process(side view from the table top)
![Page 9: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/9.jpg)
Spotting the Probes on the Microarray8 X 4 Print Head microarray slide
plate with wells holding probes in solution
All spots of the same color are made at the same time.
All spots in the same sector are made by the same pin.
![Page 10: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/10.jpg)
Using cDNA Microarrays to Measure mRNA Levels
• RNA is extracted from a target sample of interest.
• mRNA are reverse transcribed into cDNA.
• The resulting cDNA are labeled with a fluorescent dye.
• The dyed cDNA are placed on a microarray slide.
• Dyed cDNA sequences hybridize to complementary probes spottedon the array.
• A laser excites the dye and a scanner records an image of the slide.
• The image is quantified to obtain measures of fluorescence intensityfor each pixel.
• Pixel values are processed to obtain measures of mRNA abundancefor each probe spotted on the array.
![Page 11: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/11.jpg)
Using cDNA Microarrays to Measure mRNA Levels (ctd.)
• Usually two samples, dyed with different dyes, arehybridized to a single slide.
• The dyes fluoresce at different wavelengths so it ispossible to get separate images for each dye.
• Cyanine 3 (Cy3) and Cyanine 5 (Cy5) are currently thetwo most commonly used dyes.
• Images from the scanner are black and white, but it istypical to display Cy3 images as green and Cy5 imagesare displayed as red.
• It is common to superimpose the two images usingyellow to indicate a mixture of green and red.
![Page 12: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/12.jpg)
![Page 13: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/13.jpg)
There are many ways to obtain a labeled target sample.Here’s a simplified version of one method.
...GGCUUAAUGAGCCUUAAAAAA...AmRNATTTTTT...T
viral enzyme reverse transcriptaserecognizes poly-T bound to poly-Aand begins to add complementaryDNA nucleotides. The C nucleotidesare dyed.
AAA GGCTCTTAAGCC...poly-A tail
poly-T primer
cDNA target
![Page 14: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/14.jpg)
Difficult to Make MeaningfulComparisons between Genes
• The measures of mRNA levels are affected by severalfactors that are partly or completely confounded withgenes (e.g., cDNA source plate, cDNA well, print pin,slide position, length of mRNA sequence, basecomposition of mRNA sequence, specificity of probesequence, etc.).
• Within-gene comparisons of multiple cell types or acrossmultiple treatment conditions are much more meaningful.
![Page 15: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/15.jpg)
Using cDNA Microarrays to Measure mRNA Levels
ACCTG...GACCTG...GACCTG...G
TTCTG...ATTCTG...ATTCTG...A
GGCTT...CGGCTT...CGGCTT...C
ATCTA...AATCTA...AATCTA...A
ACGGG...TACGGG...TACGGG...T
CGATA...GCGATA...GCGATA...G
??????????
??????????
????????????????????
??????????
??????????
????
????
??????
????
??
??????????
??????????
Sample 1
Sample 2
Microarray Slide
Spots(Probes)
UnknownmRNA
Sequences(Target)
![Page 16: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/16.jpg)
Extract mRNA
ACCTG...GACCTG...GACCTG...G
TTCTG...ATTCTG...ATTCTG...A
GGCTT...CGGCTT...CGGCTT...C
ATCTA...AATCTA...AATCTA...A
ACGGG...TACGGG...TACGGG...T
CGATA...GCGATA...GCGATA...G
??????????
??????????
????????????????????
??????????
??????????
????
????
??????
????
??
??????????
??????????
Sample 1
Sample 2
![Page 17: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/17.jpg)
Convert to cDNA and Label withFluorescent Dyes
ACCTG...GACCTG...GACCTG...G
TTCTG...ATTCTG...ATTCTG...A
GGCTT...CGGCTT...CGGCTT...C
ATCTA...AATCTA...AATCTA...A
ACGGG...TACGGG...TACGGG...T
CGATA...GCGATA...GCGATA...G
Sample 1
Sample 2
??????????
??????????
??????????
??????????
??????????
??????????
??????????
??????????
??????????
??????????
??????????
??????????
??????????
??????????
??????????
??????????
??????????
??????????
??????????
??????????
Sample 1
Sample 2
![Page 18: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/18.jpg)
Mix Labeled cDNA
ACCTG...GACCTG...GACCTG...G
TTCTG...ATTCTG...ATTCTG...A
GGCTT...CGGCTT...CGGCTT...C
ATCTA...AATCTA...AATCTA...A
ACGGG...TACGGG...TACGGG...T
CGATA...GCGATA...GCGATA...G
Sample 1
Sample 2??????????
??????????
??????????
??????????
??????????
??????????
??????????
??????????
??????????
??????????
![Page 19: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/19.jpg)
ACCTG...GACCTG...GACCTG...G
TTCTG...ATTCTG...ATTCTG...A
GGCTT...CGGCTT...CGGCTT...C
ATCTA...AATCTA...AATCTA...A
ACGGG...TACGGG...TACGGG...T
CGATA...GCGATA...GCGATA...G
Sample 1
Sample 2
Hybridize cDNA to the Slide
??????????
??????????
??????????
??????????
??????????
??????????
??????????
??????????
??????????
??????????
![Page 20: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/20.jpg)
ACCTG...GACCTG...GACCTG...G
TTCTG...ATTCTG...ATTCTG...A
GGCTT...CGGCTT...CGGCTT...C
ATCTA...AATCTA...AATCTA...A
ACGGG...TACGGG...TACGGG...T
CGATA...GCGATA...GCGATA...G
Sample 1
Sample 2
Excite Dyes with Laser
?????????? ??????????
?????????? ???????????????????? ???????????????????? ??????????
?????????? ??????????
?????????? ???????????????????? ?????????? ?????????? ??????????
?????????? ??????????
?????????? ??????????
![Page 21: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/21.jpg)
ACCTG...GACCTG...GACCTG...G
TTCTG...ATTCTG...ATTCTG...A
GGCTT...CGGCTT...CGGCTT...C
ATCTA...AATCTA...AATCTA...A
ACGGG...TACGGG...TACGGG...T
CGATA...GCGATA...GCGATA...G
Sample 1
Sample 2
Scan
?????????? ??????????
?????????? ???????????????????? ???????????????????? ??????????
?????????? ??????????
?????????? ???????????????????? ?????????? ?????????? ??????????
?????????? ??????????
?????????? ??????????
![Page 22: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/22.jpg)
Quantify Signals
ACCTG...G76527652138138
TTCTG...A5708570843884388
GGCTT...C85668566765765
ATCTA...A120812081344213442
ACGGG...T6784678497629762
CGATA...G6767239239
Sample 1
Sample 2
![Page 23: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/23.jpg)
cDNA Arrays: Advantages
• Non-redundant clone sets are available fornumerous organisms (humans, mouse, rats,drosophila, yeast, c.elegans, arabidopsis)
• Prior knowledge of gene sequence is notnecessary: good choice for gene discovery
• Large cDNA size is great for hybridization• Glass or membrane spotting technology is readily
available
![Page 24: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/24.jpg)
cDNA Arrays: Disadvantages
• Processing cDNAs to generate “spotting-ready” materialis cumbersome
• Low density compared to oligonucleotide arrays• cDNAs may contain repetitive sequences (like Alu in
humans)• Common sequences from gene families (ex: zinc fingers)
are present in all cDNAs from these genes: potential forcross-hybridization
• Clone authentication can be difficult
![Page 25: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/25.jpg)
Oligonucleotides• An oligonucleotide is a short sequence of nucleotides.
(oligonucleotide=oligo for short)
• An oligonucleotide microarray is a microarray whoseprobes consist of synthetically created DNAoligonucleotides.
• Probes sequences are chosen to have good andrelatively uniform hybridization characteristics.
• A probe is chosen to match a portion of its target mRNAtranscript that is unique to that sequence.
• Oligo probes can distinguish among multiple mRNAtranscripts with similar sequences.
![Page 26: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/26.jpg)
Simplified Examplegene 1
gene 2
shared blue regions indicatehigh degree of sequence similaritythroughout much of the transcript
ATTACTAAGCATAGATTGCCGTATAoligo probefor gene 1
GCGTATGGCATGCCCGGTAAACTGG
oligo probe for gene 2
...
... ...
...
![Page 27: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/27.jpg)
Oligo Microarray Fabrication• Oligos can be synthesized and stored in solution for spotting as is
done with cDNA microarrays.
• Oligo sequences can be synthesized on a slide or chip using variouscommercial technologies.
• In one approach, sequences are synthesized on a slide using ink-jettechnology similar to that used in color printers. Separate cartridgesfor the four bases (A, C, G, T) are used to build nucleotides on aslide.
• The company Affymetrix uses a photolithographic approach whichwe will describe briefly.
![Page 28: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/28.jpg)
Affymetrix GeneChips• Affymetrix (www.affymetrix.com) is a company that manufactures
GeneChips.
• GeneChips are oligonucleotide arrays.
• Each gene (more accurately sequence of interest or feature) isrepresented by multiple short (25-nucleotide) oligo probes.
• Some GeneChips include probes for around 60,000 genes.
• mRNA that has been extracted from a biological sample can belabeled (dyed) and hybridized to a GeneChip in a manner similar tothat described for cDNA microarrays.
• Only one sample is hybridized to each GeneChip rather than two asin the case of cDNA microarrays.
![Page 29: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/29.jpg)
Affymetrix Probe Sets• A probe set is used to measure mRNA levels of a single gene.
• Each probe set consists of multiple probe cells.
• Each probe cell contains millions of copies of one oligo.
• Each oligo is intended to be 25 nucleotides in length.
• Probe cells in a probe set are arranged in probe pairs.
• Each probe pair contains a perfect match (PM) probe cell and amismatch (MM) probe cell.
• A PM oligo perfectly matches part of a gene sequence.
• A MM oligo is identical to a PM oligo except that the middlenucleotide (13th of 25) is intentionally replaced by its complementarynucleotide.
![Page 30: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/30.jpg)
A Probe Set for Measuring ExpressionLevel of a Particular Gene
probepair
probecell
gene sequence...TGCAATGGGTCAGAAGGACTCCTATGTGCCT...AATGGGTCAGAAGGACTCCTATGTGAATGGGTCAGAACGACTCCTATGTG
perfect match sequencemismatch sequence
probe set
![Page 31: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/31.jpg)
Different Probe Pairs Represent DifferentParts of the Same Gene
gene sequence
Probes are selected to be specific to the target geneand have good hybridization characterictics.
![Page 32: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/32.jpg)
Affymetrix’s Photolithographic Approach
GeneChip
maskmaskmaskmaskmaskmaskmask
mask
A ACC
GG
TT
TA
TT A
A C C
![Page 33: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/33.jpg)
Sou
rce:
ww
w.a
ffym
etrix
.com
![Page 34: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/34.jpg)
Source: www.affymetrix.com
![Page 35: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/35.jpg)
Source: www.affymetrix.com
![Page 36: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/36.jpg)
Obtaining Labeled Target
1. RNA single strand cDNA
2. single strand cDNA double strand cDNA
3. double strand cDNA labeled single strand cRNAcomplementary to coding sequence
Number of copies of each sequence gets amplifiedin conversion to cRNA.
![Page 37: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/37.jpg)
Source: www.affymetrix.com
Image from Hybridized GeneChip
![Page 38: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/38.jpg)
Affymetrix Microarrays
50um
1.28cm
~107 oligonucleotides,half Perfectly Match mRNA (PM),half have one Mismatch (MM)Raw gene expression is intensitydifference: PM - MM
Raw image
![Page 39: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/39.jpg)
Hybridization Process
![Page 40: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/40.jpg)
Tumor Cell Analysis
![Page 41: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/41.jpg)
Sources of Error
• Systematic• Random
log
sign
al in
tens
ity
log RNA abundance
![Page 42: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/42.jpg)
Heatmap Visualization of Selected Fields
ALL AML Heatmap visualizationis done by normalizingeach gene to mean 0, std.1 to get a picture like this.
Good correlation overall
AM
L-re
late
dA
LL-r
elat
edPossible outliers
![Page 43: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/43.jpg)
Microarray Data Processing
quality & intensity filtering
normalizationbackground correction
expression ratios (treated / control)
![Page 44: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/44.jpg)
Analysis Tasks
• Identify up- and down-regulated genes.• Find groups of genes with similar
expression profiles (++ / -- , fold change).• Find groups of experiments (tissues) with
similar expression profiles (++ / -- genes).• Find genes that explain observed
differences among tissues (featureselection), and new pathways.
![Page 45: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/45.jpg)
Gene Expression• Cells are different because of differential gene
expression.• About 40% of human genes are expressed at any
one time.• Gene is expressed by transcribing DNA exons into
single-stranded mRNA• mRNA is later translated into a protein• Microarrays measure the level of mRNA expression
by analyzing cDNA binding
![Page 46: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/46.jpg)
Analysis of Gene Expression
• Examine expression during development or indifferent tissues
• Compare genes expressed in normal vs. diseasedstates
• Analyze response of cells exposed to drugs ordifferent physiological conditions
![Page 47: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/47.jpg)
Monitoring Changes in Genomic DNA
• Identify mutations• Examine genomic instability such as in
certain cancers and tumors (geneamplifications, translocations, deletions)
• Identify polymorphisms (SNPs)• Diagnosis: chips have been designed to
detect mutations in p53, HIV, and thebreast cancer gene BRCA-1
![Page 48: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/48.jpg)
Applications in Medicine
• Gene expression studies– Gene function for cell state change in
various conditions (clustering, classification)• Disease diagnosis (classification)• Inferring regulatory networks• Pathogen analysis (rapid genotyping)
![Page 49: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/49.jpg)
Microarrays: An Example
• Leukemia: Acute Lymphoblastic (ALL) vs AcuteMyeloid (AML), Golub et al, Science, v.286, 1999– 72 examples (38 train, 34 test), about 7,000 genes– well-studied (CAMDA-2000), good test example
ALL AML
Visually similar, but genetically very different
![Page 50: Different types of microarrays - biomol.it · Different types of microarrays cDNA spotted arrays (Stanford) ... (continued) • Different spots ... • Low density compared to oligonucleotide](https://reader031.fdocuments.us/reader031/viewer/2022022012/5b1c9fb67f8b9aef288b4c93/html5/thumbnails/50.jpg)
Applications in Drug Discovery• Drug Discovery
– Identify appropriate molecular targets for therapeuticintervention (small molecule / proteins)
– Monitor changes in gene expression in response to drugtreatments (up / down regulation)
– Analyze patient populations (SNPs) and response
• Targeted Drug Treatment– Pharmacogenomics: individualized treatments– Choosing drugs with the least probable side effects