Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for...
-
Upload
dr-mohammed-abdalla -
Category
Documents
-
view
120 -
download
2
description
Transcript of Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for...
![Page 1: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/1.jpg)
DEVELOPMENT OF RECOMBINANT SUBUNIT
VACCINE AND MONOCLONAL ANTIBODY
BASED DIAGNOSTIC TEST FOR INFECTIOUS
BURSAL DISEASE IN CHICKENS
A THESIS
Submitted by
SATYA NARAYAN PRADHAN
in partial fulfilment for the award of the degree
of
DOCTOR OF PHILOSOPHY
FACULTY OF TECHNOLOGY
ANNA UNIVERSITY
CHENNAI 600 025
DECEMBER 2011
![Page 2: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/2.jpg)
CERTIFICATE
This is to certify that no corrections/suggestions were pointed out by the
Indian/foreign Examiners in the thesis titled “Development of recombinant
subunit vaccine and monoclonal antibody based diagnostic test for infectious
bursal disease in chickens” submitted by Mr. Satya Narayan Pradhan, Ph.D.
Scholar (Reg. No. 2006529715).
Place: Chennai (Dr. Usha Antony)
Date: 17.07.2012 SUPERVISOR
![Page 3: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/3.jpg)
![Page 4: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/4.jpg)
![Page 5: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/5.jpg)
iii
ABSTRACT
Infectious bursal disease (IBD) also known as Gumboro disease
after the geographical location of the first outbreak in 1962 is an acute, highly
contagious disease of young chickens caused by Infectious bursal disease
virus (IBDV), characterized by immunosuppression and mortality generally at
3-6 weeks of age. It has contributed significantly in overall losses to poultry
industry because of increased mortality due to IBD and other diseases
occurring as a result of vaccination failures due to immunosuppressive effect
of the disease. Early detection is an indispensable tool, particularly in the
absence of any treatment for IBDV.
The aim of this work was to develop a simple and reliable detection
method and to explore the potential of vaccination as an intervention strategy
against IBDV. The major structural protein VP2 of IBD virus was selected as
host-protective antigen of immunoprophylactic studies. It contains different
independent epitopes responsible for the induction of neutralizing antibody. In
this study, we report the efficacy of an immunodominant fragment of VP2
which induces both humoral and cellular immunity against infectious bursal
disease. A 366 bp fragment (52- 417 bp) of the VP2 gene from an IBDV field
isolate was amplified and cloned and expressed in T7 prokaryotic expression
system and purified by immobilized nickel affinity chromatography. The
efficacy of 21 kDa rVP252-417 antigen was compared with commercial IBDV
![Page 6: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/6.jpg)
iv
whole virus vaccine strains. Following immunization, the sera from chickens
were collected. The anti-rVP252-417 sera showed significantly high reactivity
with commercial vaccine (P < 0.0001) and likewise the reactivity of rVP252-
417 was high against sera raised against commercial vaccine (P < 0.05). Two
weeks after the vaccination, chickens were inoculated with standard challenge
strain of IBDV by the intranasal route, observed clinically for 10 days. The
subunit vaccine of recombinant VP252-417 conferred protection for 90 –100%
chickens. In order to facilitate the quantification of antibodies and to screen a
large number of serum samples, an ELISA based on this recombinant VP252-
417 protein was developed. The anti – IBDV IgY antibodies present in field
sera were assessed and analyzed. The IgY-ELISA based on recombinant
VP252-417 protein recommended the possible use of this protein in the sero-
diagnosis of IBD.
In order to prolong the protective effect induced by protein
immunization, the prospect of utilizing DNA vaccines for long-term in vivo
antigen expression was explored. The VP252-417 genes fragment was cloned
into CMV promoter based DNA vaccine vector pVAX and the in vitro
expression of the DNA encoded antigens was confirmed by transfection of
CHO cells with the vaccine constructs followed by RT-PCR and western blot
analysis with IBDV-antiserum. The in vivo expression was checked by RT-
PCR analysis of the DNA injected muscle tissue at different intervals post
injection. Chickens were vaccinated with plasmid DNA encoding VP252-417
and challenged with IBDV. DNA immunization with plasmids encoding
VP252-417 showed a significantly protection of 75%. Despite the initial low
![Page 7: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/7.jpg)
v
degree of protection compared to that of protein vaccination, the duration of
protection was longer in DNA vaccinated chickens.
Presently, problems in the immuno-diagnosis are the specificity to
detect IBDV antigen, stability of diagnostic lines, cost of assays, time and
manpower associated with use of ELISA kit and PCR etc. The possible
application of monoclonal antibodies developed against this IBDV protein for
the detection of IBDV from any infected samples. Monoclonal antibodies
(MAb) were developed against rVP252-417 to achieve the objective of
development of antigen based diagnostic kit. Two monoclonal antibodies
namely 3A11A2 and 1C7F12 with better sensitivity were selected for
validating capture ELISA. Sandwich ELISA was developed with rVP252-417
monoclonals as capture antibody and rabbit anti- rVP252-417 polyclonal as
detection antibody and validated against recombinant as well as purified
IBDV antigen. The efficiency of sandwich ELISA was analyzed with IBDV
infected bursal samples and used uninfected bursal sample as control. The
evaluated results of sandwich assay showed 100% sensitivity in the data
obtained from experimental test groups.
![Page 8: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/8.jpg)
vi
ACKNOWLEDGEMENT
I immensely thank and express my deep gratitude to my supervisor
Dr. Usha Antony, for giving me complete freedom in my work, for her
constant guidance, encouragement and support for my Ph.D.
I am grateful to Prof. R. B. Narayanan and Prof. C. D.
Damodharan for their advice and support. I sincerely thank my doctoral
committee members, Dr. Parimal Roy, Professor and Head, Central
University Laboratory, Tamil Nadu Veterinary and Animal Sciences
University and Dr. B. Nagarajan, Professor and Head, Department of
Tumour Microbiology and Biochemistry, Cancer Institute (WIA) Chennai, for
their scientific advice and suggestions.
I am grateful to my friends Dr. Prince, Dr. Madhumathi,
Dr. Vivek, Dr. Sharmila, Dr. Shakti, Dr. Vaishnavi and Mr. Ravikant for
their incredible support and encouragement. I sincerely thank my juniors
Mr. Arun, Ms. Anugraha, Ms. Jeyaprita, Ms. Aparnaa, Ms. Christiana,
Mr. Bhuvanesh and Ms. Gayathri for their kind help and support. I thank
my seniors Dr. Muthukumaran and Dr. Pandiaraja for their valuable
discussions.
My special thanks to my parents, sisters, nephew and nieces for
their motivation and support. I thank Department of Biotechnology (DBT) for
granting me the fellowships during my research tenure.
SATYA NARAYAN PRADHAN
![Page 9: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/9.jpg)
vii
TABLE OF CONTENTS
CHAPTER NO. TITLE PAGE NO.
ABSTRACT iii
LIST OF TABLES xvii
LIST OF FIGURES xviii
LIST OF SYMBOLS AND ABBREVIATIONS xx
1. INTRODUCTION 1
1.1 INTRODUCTION 1
1.2 OBJECTIVES 6
1.3 OVERVIEW OF THE THESIS 7
1.4 REVIEW OF LITERATURE 9
1.4.1 Etiology 9
1.4.2 Structure and Molecular Biology of
IBD Virus 9
1.4.3 Physical and Chemical Properties of
the Virus 10
1.4.4 Genome Organization 10
1.4.5 Viral Proteins 12
1.4.6 Virus Replication and Transcription 14
1.4.7 Persistence of Virus in Chicken Tissues 15
1.4.8 Target Organ 15
1.4.9 Pathogenesis 16
1.4.10 Immunology 18
1.4.11 IBDV Detection Methods 20
![Page 10: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/10.jpg)
viii
CHAPTER NO. TITLE PAGE NO.
1.4.11.1 In situ Hybridization 21
1.4.11.2 Reverse Transcription and
Polymerase Chain Reaction 23
1.4.11.3 Immunofluroscence 26
1.4.11.4 Agar Gel Immuno-Diffusion
(AGID) 27
1.4.11.5 Dot Blot Assay 28
1.4.11.6 Enzyme Linked Immunosorbent
Assay (ELISA) 29
1.4.11.7 Latex Agglutination Test 30
1.4.11.8 Immunohistochemical
Staining 31
1.4.11.9 Immunochromatographic
Assay 32
1.4.12 IBDV Control Methods 33
2. MATERIALS AND METHODS 40
2.1 MATERIALS 40
2.1.1 Reagents and Chemicals 40
2.1.2 Culture Media 41
2.1.3 Bacterial Strains and Plasmids 42
2.1.4 Expression System Used in this Study 42
2.1.5 Primers Used for the Amplification
and Cloning of Capsid Gene Fragment 44
2.1.6 Animals 45
2.1.7 Virus 45
2.2 BURSAL PROCESSING 45
![Page 11: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/11.jpg)
ix
CHAPTER NO. TITLE PAGE NO.
2.3 IN VIVO TITRATION FOR IBDV
CHALLENGE 46
2.4 EXPERIMENTAL INFECTION IN
CHICKENS 46
2.5 PURIFICATION OF IBDV 46
2.6 PARTIAL PURIFICATION OF IBDV 47
2.7 PRODUCTION OF ANTISERUM
AGAINST WHOLE VIRUS 47
2.8 RECOMBINANT CLONES USED IN
THE PRESENT STUDY 47
2.9 BIO-INFORMATIC ANALYSIS OF
CAPSID GENE 48
2.10 CLONING OF VP2 GENE FRAGMENT 48
2.10.1 Confirming the Orientation of
the Insert 49
2.10.2 Sequence Analysis 49
2.11 EXPRESSION OF THE
RECOMBINANT PROTEINS 49
2.12 PURIFICATION OF RECOMBINANT
PROTEINS USING IMMOBILIZED METAL
AFFINITY CHROMATOGRAPHY (IMAC) 50
2.13 LARGE-SCALE PRODUCTION OF
THE DNA VACCINES 51
2.14 TRANSIENT TRANSFECTION OF CHINESE
HAMSTER OVARY (CHO) CELL LINE BY
DNA VACCINE CONSTRUCTS 53
2.15 GENERAL MOLECULAR BIOLOGY
TECHNIQUES 55
![Page 12: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/12.jpg)
x
CHAPTER NO. TITLE PAGE NO.
2.15.1 Reverse Transcription and Polymerase
Chain reaction (RT-PCR) 55
2.15.1.1 RNA extraction 55
2.15.1.2 Reverse transcription reaction 56
2.15.1.3 Polymerase chain reaction of
cDNA 57
2.15.2 Agarose Gel Electrophoresis 57
2.15.3 Purification of DNA from Agarose Gel 58
2.15.4 Restriction Digestion 59
2.15.5 Ligation 60
2.15.6 Screening the Clones by Lysate PCR 60
2.15.7 Plasmid DNA Extraction 61
2.15.8 Transformation of E. coli 62
2.15.9 SDS-Polyacrylamide Gel Electrophoresis 63
2.15.10 Western Blotting 64
2.16 IMMUNOLOGICAL STUDIES 66
2.16.1 Chicken Sera Samples 66
2.16.2 Immunoreactivity with Field Sera 66
2.16.3 Animals, Immunization and Sera
Collection 67
2.16.4 Measurement of Total IgY 67
2.16.5 Direct Binding Assay 68
2.16.6 Splenocyte Proliferation Assay 68
2.16.7 Tissue Distribution 69
2.16.8 DNA Isolation from Different
Tissues 70
2.16.9 RT-PCR for Expression of the DNA
Vaccines in Immunized Chicken
Muscle 70
![Page 13: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/13.jpg)
xi
CHAPTER NO. TITLE PAGE NO.
2.17 IMMUNOPROPHYLACTIC STUDIES 71
2.17.1 Animals for Protection Study and
Immunization 71
. 2.18 MONOCLONAL ANTIBODY PRODUCTION 72
2.18.1 Immunization of Mice with rVP252-417
for Hybridoma 72
2.18.2 Preparation of Myeloma Cells and
Splenocytes 73
2.18.3 Preparation of Macrophage Feeder
Layer 73
2.18.4 Fusion of Cells 73
2.18.5 Cell Viability Test 74
2.18.6 Selection of Hybridoma 74
2.18.7 Analysis of Serum Samples and
Monoclones by rVP252-417 Antigen
Based ELISA 75
2.18.8 Expansion of Secretor Clones 76
2.18.9 Cloning under Limited Dilution
(Subcloning) 76
2.18.10 Subclass Isotyping of Monoclonal
Antibodies 77
2.18.11 Maintenance of Cell-Lines 77
2.18.12 Cryopreservation of Cells 77
2.18.13 Affinity Measurement of
Monoclonal Antibodies 77
2.18.14 Avidity Measurement of
Monoclonal Antibodies 79
2.18.15 Production of Polyclonal Antibody
against rVP252-417 81
![Page 14: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/14.jpg)
xii
CHAPTER NO. TITLE PAGE NO.
2.18.16 Purification of Monoclonal
Antibody 81
2.18.17 Enrichment of mAbs and
Polyclonal Antibodies 82
2.18.18 Standardization of IBDV Antigen
Capture ELISA 82
2.19 DEVELOPMENT OF RAPID DIPSTICK
DIAGNOSTIC ASSAY FOR DETECTION 83
2.19.1 Preparation of Colloidal Gold 84
2.19.2 Preparation of Gold-Antibody Conjugate 84
2.20 STATISTICAL ANALYSIS 85
3. RESULTS 86
3.1 CLONING, EXPRESSION, PURIFICATION
AND IMMUNOPROPHYLACTIC EFFICACY
OF RECOMBINANT VP2 FRAGMENT 86
3.1.1 Amplification and Analysis of
VP252-417 Gene 87
3.1.2 Cloning of VP252-417 Gene 87
3.1.3 Restriction Profile Analysis 89
3.1.4 Confirming the Orientation of the Insert
in pRBVP252-417 89
3.1.5 Expression of rVP252-417 Fragment
Protein 93
3.1.6 Purification of Recombinant VP252-417
Protein 96
3.1.7 Antibody Titer of rVP252-417 Protein in
Mice 99
![Page 15: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/15.jpg)
xiii
CHAPTER NO. TITLE PAGE NO.
3.1.8 Characterization of rVP252-417 protein 99
3.1.9 Humoral Responses of rVP252-417
in chickens 101
3.1.9.1 Antibody titer in chicken 101
3.1.9.2 Reactivity with commercial IBDV
strains 101
3.1.9.3 Reactivity with field isolates 103
3.1.10 Cellular Response of rVP252-417 106
3.1.11 Protection against Virulent IBDV
Challenge 107
3.2 CLONING, IN VIVO EXPRESSION AND
IMUNOPROPHYLACTIC EFFICACY OF
VP2 FRAGMENT (VP252-417) AS DNA
VACCINE 110
3.2.1 Sub Cloning of VP252-417 in pVAX1
Vector 110
3.2.2 Restriction Digestion Analysis 111
3.2.3 In Vitro Expression of the DNA
Vaccine Construct in CHO Cell Line 111
3.2.4 In Vivo Expression of the DNA
vaccine Constructs in Chicken
Muscle Tissue 114
3.2.5 Tissue Distribution and Persistence
of DNA Vaccine in Immunized
Chickens 115
3.2.6 Immune Response Studies of DNA
Vaccine (pVAXVP252-417) in Chickens
Antibody titer in chicken 117
![Page 16: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/16.jpg)
xiv
CHAPTER NO. TITLE PAGE NO.
3.2.6.2 Cellular Response of
pVAXVP252-417 117
3.2.7 Protection Studies of pVAXVP252-417
against Virulent IBDV Challenge 118
3.3 DEVELOPMENT OF MONOCLONAL
ANTIBODIES TO RECOMBINANT VP2
FRAGMENT (rVP252-417) 121
3.3.1 Immunization and Antibody Titre 121
3.3.2 Harvest of Myeloma Cells 121
3.3.3 Harvest of Mouse Feeder Cells 122
3.3.4 Cell Fusion and Hybrid Yield 122
3.3.5 Scale-Up of the Clones 123
3.3.6 Sub-Cloning: Cloning by Limiting
Dilution and Derivation of
Stable Clones 124
3.3.7 Selection of Monoclones 125
3.3.8 Characterization of the mAbs 125
3.3.9 Confirmation of mAbs against
rVP252-417 in Western Blot 127
3.3.10 Isotyping of Monoclones 128
3.3.11 Affinity of Anti-VP252-417
Monoclonal Antibodies 128
3.3.12 Avidity of Anti-VP252-417
Monoclonal Antibodies 129
3.4 DEVELOPMENT OF SANDWICH ELISA
FOR IBDV DETECTION 130
3.4.1 Optimization of Various Parameters for
the Development of Sandwich ELISA 130
![Page 17: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/17.jpg)
xv
CHAPTER NO. TITLE PAGE NO.
3.4.2 Sensitivity of the Sandwich ELISA
Using Recombinant VP252-417 and
Purified IBDV Antigen 131
3.4.3 Determination of the Titers of
Anti-VP252-417 Polyclonal Antibodies 133
3.5 SUMMARY 134
4. DISCUSSION 137
4.1 SUBUNIT PROTEIN VACCINE
(VP252-417) 137
4.2 VP2 SUBUNIT DNA VACCINE
(VP252-417) 143
4.3 DEVELOPMENT OF VP2 MONOCLONAL
ANTIBODIES FOR ANTIGEN DETECTION 146
4.4 DEVELOPMENT OF PROTOTYPE
ANTIGEN BASED IMMUNO-DIAGNOSTICS
FOR INFECTIOUS BURSAL DISEASE 149
5. CONCLUSION 152
5.1 CHARACTERIZATION OF RECOMBINANT
VP252-417 AND IMMUNE RESPONSE
STUDIES IN CHICKEN 152
5.2 CHARACTERIZATION OF RECOMBINANT
VP252-417 AS DNA VACCINE 153
5.3 DEVELOPMENT OF MONOCLONAL
ANTIBODY FOR THE DETECTION OF
IBDV 153
![Page 18: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/18.jpg)
xvi
CHAPTER NO. TITLE PAGE NO.
5.4 FUTURE DIRECTIONS 155
5.4.1 Part I – Bimodal Vaccine
(Combination of rVP252-417 and
pVAXVP252-417 155
5.4.2 Part II – Development of monoclonal
antibody using immunodominant
region of VP3 155
APPENDIX 1 GENOTYPES OF
BACTERIAL STRAINS 156
APPENDIX 2 VECTOR MAP OF pRSET 157
APPENDIX 3 VECTOR MAP OF pVAX1 158
REFERENCES 159
LIST OF PUBLICATIONS 191
VITAE 192
![Page 19: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/19.jpg)
xvii
LIST OF TABLES
TABLE NO. TITLE PAGE NO.
2.1 Primers Used for Cloning the Capsid Gene
Fragment 44
3.1 The Antigenic Determinants Identified in 122 aa
Region by BcePRED and IEDB 89
3.2 BLASTN Analysis of 366 bp of VP2 Gene
Fragment 92
3.3 BLASTP Analysis of the Deduced Amino
Acid of 366 bp 93
3.4 Protection Efficacy of rVP252-417Protein Vaccine after
Virus Challenge in Immunized Chickens 109
3.5 In Vivo Tissue Distribution of pVAXVP252-417 116
3.6 Protection Efficacy of rVP252-417 DNA Vaccine
after Virus Challenge in Immunized Chickens 120
3.7 Affinity of Anti-VP252-417 Monoclonal Antibodies 128
3.8 Avidity Index of mAbs with rVP252-417 and purified
IBDV Antigen Monoclonal Antibodies 129
![Page 20: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/20.jpg)
xviii
LIST OF FIGURES
FIGURE NO. TITLE PAGE NO.
1.1 Structure and Genome Organization of Infectious
Bursal Disease Virus 11
3.1 Amplification and Cloning of VP2 Gene Fragment 88
3.2 Confirmation of the Insert and its Orientation in the
Recombinant Plasmid, pRBVP252-417 90
3.3 Nucleotide and the Deduced Amino Acid Sequence
of 366 bp N-terminal Region of VP2 Protein 91
3.4 Expression of Recombinant VP2 Fragment Protein and its
Confirmation by Western Blotting 95
3.5 Purification of Recombinant VP252-417 Protein by IMAC
and Gel-Elution 97
3.6 Immunoblot Analysis of Purified Recombinant
VP252-417 Protein 98
3.7 Determination of Antibody Titre and the Specificity of
Mouse Anti-rVP252-417 Sera 100
3.8 Humoral Responces of rVP252-417 in Chickens 102
3.9 Reactivity with Commercial IBDV Strains 104
3.10 Reactivity with field isolates and commercial strains 105
3.11 Splenocyte Proliferation Assay in Chickens 107
3.12 Cloning of VP252-417 in pVAX1 Plasmid 112
3.13 In Vitro Expression of pVAXVP252-417 Construct in
CHO Cell Line 113
3.14 Expression of the DNA Vaccine Constructs in
Muscle Tissue 114
![Page 21: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/21.jpg)
xix
FIGURE NO. TITLE PAGE NO.
3.15 Tissue Distribution Analyses for pVAXVP252-417
DNA in Immunized Chickens 116
3.16 Measurement of Antibody Titer for Recombinant
DNA Vaccine in Chickens 119
3.17 Splenocyte Proliferation Assay in Chicken Immunized
with DNA Vaccine 119
3.18 Primary Screening of Hybrids 123
3.19 Secondary Screening of Hybrids from 24 Well
Plates 124
3.20 Screening of the Clones Secreting Monoclonal
Antibody for rVP252-417, Partially purified and
purified IBDV 125
3.21 Reactivity of mAbs against rVP252-417 in ELISA 126
3.22 Reactivity of Monoclonal Antibodies against rVP252-417
using ELISA 126
3.23 Western Blot Analysis of Hybridoma Culture
Supernatant against rVP252-417 127
3.24 Sandwich ELISA with rVP252-417 and Purified IBDV 131
3.25 Capture Assay with Different Amounts of
rVP252-417 Antigens 132
3.26 Capture Assay with Different Amounts of Purified
IBDV Antigen 133
3.27 Reactivity of Rabbit rVP252-417 Polyclonal Antibody 134
3.28 Dipstick Prototype Device 135
![Page 22: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/22.jpg)
xx
LIST OF SYMBOLS AND ABBREVIATIONS
SYMBOLS
- Alpha
- Beta
- Gamma
µ - Mu
g - microgram
L - microlitre
ABBREVIATIONS
AC-ELISA - Antigen-Capture ELISA
Ag-Ab - Antigen-Antibody
ALP - Alkaline Phosphatase
ANOVA - Analysis of Variance
APC - Antigen Presenting Cells
APS - Ammonium Persulphate
ATP - Adenosine Triphosphate
BCA - Bicinchoninic acid
BCIP - 5- bromo 4-chloro 3-indolyl phosphate
BF - Bursa of Fabricius
BLAST - Basic local alignment search tool
BME - -mercaptoethanol
bp - base pairs
BSA - Bovine Serum Albumin
CBB - Coomassie Brilliant Blue
CD4 - Cluster of Differentiation
CHO - Chinese Hamster Ovary
cDNA - Complementary DNA
CEF - Chicken Embryo Fibroblast
![Page 23: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/23.jpg)
xxi
CEP - Conformational Epitope
ConA - Concanavalin A
cpm - Counts per minute
dbEST - Database of EST sequences
dsRNA - double stranded RNA
DEPC - Diethyl Pyrocarbonate
DMSO - Dimethyl Sulphoxide
DNA - Deoxyribonucleic acid
dNTP - Deoxynucleotide triphosphate
DTT - Dithiothreitol
EDTA - Ethylene Diamine Tetra Acetic Acid
ELISA - Enzyme linked immunosorbent assay
EM - Electron Microscopy
EST - Expressed Sequence Tag
FCS - Fetal Calf Serum
FITC - Fluorescein Isothiocyanate
GAPDH - Glyceraldehydes-3-phospate dehydrogenase
h - Hours
HEPES - (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid)
HRP - Horse Radish Peroxidase
IBD - Infectious Bursal Disease
IBDV - Infectious Bursal Disease Virsus
ICT - Immunochromatographic Test
Ig - Immunoglobulin
IgG - Gamma Immunoglobulin
IL - Interleukin
IMAC - Immobilized Metal Affinity Chromatography
IMDM - Iscove’s modified Dulbecco’s medium
IP - Identified Positive
IPTG - Iso-propyl -thiogalactopyranoside
![Page 24: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/24.jpg)
xxii
IFN - Interferon
Kb - Kilobase
kDa - Kilodaltons
LB - Luria-Bertani Broth
LPS - Lipopolysaccharide
mAb - Monoclonal Antibody
MDA - Maternally Derived Antibodies
min - Minutes
mg - milligram
mL - millilitre
mm - millimetre
mM - millimolar
MilliQ - Triple distilled water
mRNA - messenger RNA
MTT - Tetrazolium (3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyl
tetrazolium bromide
NBT - Nitroblue tetrazolium
NC - Nitrocellulose membrane
ng - nanogram
NK - Natural Killer cells
OD - Optical Density
ORF - Open Reading Frame
PABA - Para Amino Benzoic Acid
PBMC - Peripheral Blood Mononuclear Cell
PBS - Phosphate Buffered Saline
PBST - PBS with 0.05% Tween-20
PC - Peptide Conjugate
PCR - Polymerase Chain Reaction
PDB - Protein Data Bank
PEG - Polyethylene Glycol
![Page 25: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/25.jpg)
xxiii
PI - Post Inoculation
pm - picomole
PMSF - Phenyl Methyl-Sulfonyl Fluosride
pNPP - p-Nitrophenyl Phosphate, disodium salt
RdRp - RNA-dependent RNA polymerase
RNA - Ribonucleic Acid
RNAP - RNA Polymerase
rpm - Rotations per minute
RPMI - Rosewell Park Memorial Institute
RT-PCR - Reverse Transcriptase Polymerase Chain Reaction
SAN - Specific Antibody Negative
SDS-PAGE - Sodium-dodecyl-sulphate polyacrylamide gel
SEM - Standard Error Mean
SI - Stimulation Index
SPF - Specific Pathogen Free
SSB - Sample Solubilization Buffer
Taq - Thermus aquaticus
TBE - Tris Borate EDTA
TE - Tris EDTA
TEMED - N,N,N ,N - Tetramethylethylene diamine
TGF- - Transforming Growth Factor
Th - T helper cells
TLR - Toll Like Receptor
TMB - Tetramethyl benzidine
T reg/ Tr - T regulatory cells
Tris - Tris (hydroxymethyl) aminoethanes
VN - Viral Neutralization
VP2 - Viral Protein
v IBDV - Variant IBDV
vv IBDV - Very Virulent IBDV
![Page 26: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/26.jpg)
1
CHAPTER 1
INTRODUCTION
1.1 INTRODUCTION
Poultry industry comprises one of the most rapidly growing food-
producing sectors in the world and keeps expanding with an increase in
population. The production and consumption of eggs and poultry meat has
been increasing worldwide over the last three decades as the consumption of
eggs has doubled and that of chicken meat has tripled (Jordan and Pattison
2001). Indian poultry industry is booming and emerging as the world's 2nd
largest market, growing at a phenomenal rate of 12 to 15% every year. The
poultry industry in India is constantly on the rise with increasing ease of
modern techniques and changing from live bird to fresh chilled and frozen
product market. However, such a marked growth in poultry production has
created a situation where the birds have become more susceptible to disease
causing agents of diverse origin. These disease conditions have caused
considerable economic downfall to poultry industry and have repeatedly
threatened the progress made in recent years. Several viral diseases have
plagued the industry in the past two decades resulting in serious losses. There
are about twenty known viruses infecting chickens, out of which some are
highly virulent and responsible for huge economic losses.
Infectious bursal disease (IBD) also known as Gumboro disease
after the geographical location of the first outbreak in 1962 (Cosgrove et al
1962) is an acute, highly contagious disease of young chickens caused by
![Page 27: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/27.jpg)
2
Infectious Bursal Disease Virus (IBDV), characterized by immunosuppression
and mortality generally at 3-6 weeks of age. It has contributed significantly in
overall loss to poultry industry because of increased mortality due to IBD and
other diseases occurring because of vaccination failures due to
immunosuppressive effect of the disease. IBDV replicates in the lymphocytes
of the bursa of Fabricius, which is responsible for an immunosuppressive
disease that may cause death or impaired growth in young chicken. IBDV is a
member of the Birnaviridae family (Brown et al 1986), the genome of which
consists of two segments of double stranded RNA designated A and B (Dobos
et al 1979). IBDV consists of four structural proteins, among which VP2 has
been identified as the main host-protective antigen that carries major
neutralizing epitopes, have serotype, and strain specificity (Azad et al 1987;
Becht et al 1988; Fahey et al 1989; Reddy et al 1992).
To date, two antigenically distinct serotypes (I and II) and several
antigenic subtype of serotype I of IBDV have been identified by cross
neutralization assays using polyclonal sera (Jackwood et al 1982). The
protection of chicks from IBD is complicated by the presence of several
antigenic subtypes. Hence, vaccination with one antigenic subtype will not
ensure protection against a heterologous subtype. Therefore, it is important to
identify not only the virus but also the antigenic subtypes of IBDV.
Since its emergence in 1962 in United States, this virus continues
to have the greatest impact on poultry industry even today (Lukert and Saif
1991). In United States, all pathogenic viruses produce classical Gumboro
disease lesion such as enlargement of bursae, hemorrhage or transudation in
bursae and mortality. Instead, the variant viruses cause an extremely rapid
atrophy of bursae and are immunosuppressive. Immunosuppression enhances
the susceptibility of chicks to other infection and interferes with vaccination
against other diseases of chicken (Okoye et al 1984). Until 1984, IBDV
![Page 28: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/28.jpg)
3
strains were of low virulence causing less than two per cent specific mortality
(Van den Berg et al 2000) and the disease was controlled satisfactorily by
vaccination. But, from 1986 onwards, vaccination failures were described in
different parts of the world. In 1987/1988, vvIBDV (very virulent) strains
capable of causing 30 to 70 percent mortalities in broilers and layers were
isolated in Holland, Belgium and UK (Van den Berg and Meulemans 1991).
Since then, outbreaks of vvIBDV have occurred in most European countries
as well as Africa, Japan, China and South East Asia. vvIBDV were able to
break through the maternal as well as active immunity induced mainly by
classical or mild IBDV vaccines.
Poultry chicks are the only bird species known to develop clinical
disease and distinct lesions when exposed to IBDV. However, Mcfrran et al
(1980) have also isolated a number of strains of IBDV from fowl, turkey and
duck. Greenfield et al (1986) stated that Japanese quails were refractory to
IBD infection. They showed no bursal change and did not form precipitating
antibodies.
IBDV is not vertically transmitted i.e. no transmission from parent
to one day old chick through the egg. Horizontal transmission through
infected feces, contaminated equipment (especially footwear) or other organic
material is the most likely route of spread. It has been demonstrated that the
Lesser Mealworm (Alphitobius diaperinus) could act as a vector carrying
IBDV from one cycle to the next. The symptoms of IBDV infected chicks are
nonspecific which includes depression, whitish diarrhoea, anorexia,
prostration, and death (Chettle et al 1989). Older chickens may show milder
disease symptoms, but all age groups subsequently experience a transient
immunosuppression (Sharma et al 2000).
![Page 29: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/29.jpg)
4
In India, the first IBD outbreak was in Uttar Pradesh in 1971
(Mohanty et al 1971). Jayaramiah and Mallick et al (1974) followed it with
the virus isolation. Ever since its appearance in India, IBD has remained a
major threat to poultry industry in almost all the states. However, the severity
of IBD was realized only when severe outbreaks occurred in Maharashtra
(Ajinkya et al 1980), Bihar (Chauhan et al 1980), Andhra Pradesh
(Verma et al 1981) and in Tamil Nadu (Purushothaman et al 1988) with high
mortality range of 20 – 90%.
Due to a sharp decline in poultry production all over the world by
repeated IBDV outbreaks, much emphasis has been given to early detection of
IBDV. Already established methods of observation like clinical symptoms and
histopathology have long been replaced by number of molecular technologies
that include PCR and immunological detection methods. Some commercial
detection kits, based on in-situ hybridization, PCR (PrimerDesign™ genesig
Kit) and immunodetection are also available (SBIO IBD+ELISA test,
FlockChek* IBD-XR IDEXX ELISA kit, Anigen Rapid IBDV Ag test kit,).
Viral antigens can be demonstrated by the agar-gel precipitin assay or by the
antigen-capture enzyme-linked immunosorbent assay (AC-ELISA). With
some restrictions, AC-ELISA allows the identification of vvIBDV
(Eterradossi et al 1998, Islam et al 2001). RT-PCR in combination with
restriction enzyme analysis allows the rapid identification of vvIBDV
(Lin et al 1993, Jackwood and Jackwood 1994, Zierenberg et al 2001).
Nucleotide sequencing of RT-PCR products is widely used for further
characterization of IBDV strains (Sapats and Ignjatovic 2000, Zierenberg et al
2000, Islam et al 2001, Liu et al 2002, Viswas et al 2002). Most RT-PCR
protocols are based on VP2 nucleotide sequences.
Previous studies have shown that the IBDV virion is an effective
immunogen, though such antiserum has the limitation of involving a labor-
![Page 30: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/30.jpg)
5
intensive process for virus propagation and purification. The bacterial
expression system overcomes these obstacles and the protein is readily
purified through simple purification processes. Thus, it can be utilized for
over-expression of viral proteins for raising antibody that can be used in
immunodetection methods.
Although good management practices, meticulous sanitation, use
of non-specific immune-stimulants and early detection are currently used to
counter the disease, these methods are not sufficient to eradicate the disease.
One of the important prophylactic measures against viral diseases is the use of
vaccines. Viral vaccines prevent or modify the severity of infection in the
individual host and interrupt or reduce the transmission of the pathogens to
other susceptible hosts. Therefore, vaccination is inevitable and mandatory
under high infection pressure. In the light of this, an effective vaccine against
IBDV would be highly desirable. Thus, there is a strong demand for a cost
effective and simple vaccine giving sufficient protection against IBDV
outbreaks, an approach that has been so useful in controlling viral and
bacterial diseases in other animals including man. At present, the disease is
controlled by the combined use of live virus and inactivated oil emulsion
vaccines. However, these vaccines are not always safe, as they may not
contain the required immunogens present in the variant strains prevailing in
that area. The study of virus at molecular level is therefore an essential
prerequisite for formulating a suitable vaccine, particularly with local isolates
recovered from field cases.
Most of the successful viral vaccines make use of the prominent
envelope proteins or major nucleocapsid proteins. Proteins playing important
role in initial steps of infection represent the major targets for effective
vaccine development. A number of experimental recombinant IBD vaccines
have been developed which used fowl poxvirus (Bayliss et al 1991, Shaw and
![Page 31: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/31.jpg)
6
Davison 2000), herpesvirus of turkey (Darteil et al 1995), fowl adenovirus
(Sheppard et al 1998, Francois et al 2001), Marek’s disease virus (Tsukamoto
et al 2002) and Semliki forest virus (Phenix et al 2001) as the vector. In-vitro
expressed VP2 (Vakharia et al 1993, Vakharia et al 1994, Pitcovski et al 1996,
Dybing and Jackwood 1998, Wang et al 2000, Yehuda et al 2000) or in-vitro
generated virus-like particles (VLP) of IBDV (Hu et al 1999, Kibenge et al
1999) have been found to be immunogenic. DNA vaccines also have been
developed for IBDV (Fodor et al 1999, Chang et al 2001, Chang et al 2003).
However, none of these vaccines has so far been commercialized.
1.2 OBJECTIVES
In view of the above considerations, the present study was
conceived with the goal of developing, therefore, carried out with following
objectives, towards the goal of developing simple and reliable methods of
diagnosis and prevention of IBDV infection. Towards achieving this goal, the
following objectives were formulated,
i. Cloning, characterization and assessment of
immunoprophylactic efficacy of the N-terminal region of
capsid protein of IBDV in chickens.
ii. Cloning, characterization and assessment of
immunoprophylactic efficacy of the N-terminal region of
capsid protein of IBDV as DNA vaccine in chickens.
iii. Generation and characterization of monoclonal antibodies
against recombinant IBDV capsid protein fragment and
development of a sandwich ELISA based method for detection
of IBDV.
![Page 32: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/32.jpg)
7
1.3 OVERVIEW OF THE THESIS
The first part of the dissertation attempted to develop an enhanced
vaccine suitable for field application against IBDV in chickens by
incorporating regions specific from indigenous field isolates.
In India, only live attenuated vaccines, either imported (Nobilis
strain (live vaccine) by Intervet International Ltd, Netherlands) or locally
made (Live intermediate strain of IBDV by Ventri biological Ltd, Pune and
Indovax Pvt. Ltd, Hissar, India) are mainly in use and appear to be efficient in
protecting the chickens as there are not many reports of outbreak in the
vaccinated chickens from India. However, there is always a possibility of
reversion to virulence in case of live vaccines and accidental wrong
inactivation poses a threat of disease incidence in the field. Both these
drawbacks can be overcome by the use of highly immunogenic recombinant
protein. VP2 of IBDV is a well-known major host protective virus antigen,
and contains at least three neutralizing epitopes, which determine the virus
virulence (Eterradossi et al 1998, Pitcovski et al 1998, Chai et al 2001).
Although there are attenuated IBDV vaccines available
commercially, there are no recombinant vaccines till date in market. Hence
the first objective of the current study attempts to develop an efficient
recombinant protein/DNA subunit vaccine for IBDV strains endemic in India.
An epitopic fragment of 366 bp from the VP2 N-terminal region of IBDV was
amplified, cloned in T7 promoter based pRSET-B vector and expressed as a
21 kDa fusion protein with N-terminal six-histidine residues. The
immunoreactivity of the recombinant capsid protein with the sera from
infected and vaccinated chickens in the western blotting showed that N-
terminal region is immunodominant. The recombinant VP2 fragment was
then compared with commercial vaccine for immunoprophylactic efficacy.
All vaccination experiments presented here with purified recombinant
proteins and commercial vaccines were administered through intramuscular
![Page 33: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/33.jpg)
8
route in chickens. The subsequent challenge with IBDV was carried out
through oral and intraocular route.
Further, the VP2 fragment was cloned in CMV promoter based
pVAX DNA vaccine vector and was studied for protection efficacy, which
was the second objective of the dissertation. The DNA was purified using
endotoxin free plasmid purification kit. Prior to immunization, the in vitro and
in vivo expression of the DNA vaccines in CHO cell lines and chicken muscle
tissue respectively were confirmed by RT-PCR and western blot analysis.
Subsequently, the chickens were immunized with the DNA vaccines via
intramuscular injection. Protective response was studied following IBDV
challenge as described earlier.
The third objective of the dissertation deals with development of
diagnostics for IBDV. Currently a limited number of diagnostic tests exist
worldwide for the diagnosis of IBDV infection in chickens like indirect
immunofluorescence assay, virus isolation, serum neutralization test,
polymerase chain reaction and ELISA. However, there are no sero-specific
indigenous kits for IBDV susceptible endemic areas in India. The serological
assay in which virus-specific IgY is measured in serum samples, is critical to
identify the acute stage of the infection in chickens. Hence, there is a need to
develop a more sero-specific assay that will detect IBDV strains in local areas
with high sensitivity. Also, the serological assay must use a well defined and
characterized viral protein for reproducibility and accuracy in detection.
ELISAs based on even the truncated recombinant proteins are reported to be
efficient in the diagnosis of diseases (Hirata et al 2002, Fukumoto et al 2003,
Boonchit et al 2004). Therefore in the present study, an ELISA based antigen
detection assay in bursal infection caused by IBDV was developed using
monoclonal and polyclonal antibody raised against rVP252-417. The assay was
standardized using rVP252-417 and purified IBDV with different combination
of antibodies. Monoclonal antibodies were used to develop dipstick method
for rapid detection of antigen.
![Page 34: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/34.jpg)
9
The present study demonstrated the consistency of
immunodetection in field samples, which can be improved by carrying out
antigen based detection methods. Furthermore, vaccination with recombinant
viral proteins can induce protection against IBDV infection and further this
protection can be extended to a longer period by DNA immunization.
1.4 REVIEW OF LITERATURE
1.4.1 Etiology
Infectious bursal disease virus (IBDV) is the etiological agent of an
immuno-suppressive disease of young chickens of 3 to 6 weeks of age. IBDV
is a member of the family Birnaviridae (Muller et al 1979) and is a type-III
virus in the Baltimore classification. This family has three designated genera
namely – Aquabirnavirus which includes infectious pancreatic necrosis virus
that infects fish, molluscs, crustaceans; Infectious bursal disease virus that
infects birds belongs to Avibirnavirus; and lastely Entomobirnavirus which
includes Drosophila X virus that infects birds and insects (Leong et al 2000).
Viruses in this family have genome that consists of two segments of double
stranded RNA (dsRNA), hence the name Birnaviridae (Muller et al 1979,
Macdonald et al 1980). Before the reorganisation of Birnaviridae family and
before there was adequate information on its morphology and physiochemical
characteristics, IBDV was placed at times in the Picornaviridae (Cho et al
1969, Lunger et al 1972) or Reoviridae families (Koester et al 1972, Pattison
et al 1975). IBDV is highly contagious and is transmitted by fecal-oral route,
especially from feces-contaminated fomites, feed and water.
1.4.2 Structure and Molecular Biology of IBD Virus
Infectious bursal disease virus is single-shelled nonenveloped
viron with icosahedral dsRNA genome (segments A and B) that is packaged
into a single virus particle, approximately 70 nm in diameter, exhibiting levo
symmetry with triangulation number of T = 13 (Caston et al 2001, Coulibaly
![Page 35: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/35.jpg)
10
et al 2005). The viron composed of 32 capsomeres. The genomic packing
density of IBDV is approximately 10 bp/100 nm3
(Luque et al 2009). Buoyant
density of complete IBDV particles in the cesium chloride gradient ranges
from 1.31 – 1.34 g/mL (Todd and McNulty 1979). IBDV can package more
than one complete genome copy. Moreover, multiploid IBDV particles
propagate with higher efficiency than haploid virions. Five viral particles
designated VP1, VP2, VP3, VP4 and VP5 are recognized in IBDV.
1.4.3 Physical and Chemical Properties of the Virus
Infectious bursal disease virus is resistance to ether and
chloroform and is unaffected at pH 2, but gets inactivated at pH 12. The
infectivity of the virus markedly reduced by exposure to 0.5% formalin for 6
h (Benton et al 1967). The exposure to 1% phenol for one hr inactivated the
virus and the infectivity was reduced by exposure to 1% formalin for one hour
(Cho and Edgar 1969). It is also resistant to heat, UV irradiation and
photodynamic in-activation, whereas it’s naked RNA makes it sensitive to
Actinomycin D (Petek et al 1973). Landgraf et al (1967) found that virus
sustained 60oC but not 70
oC for 30 mins, and 0.5% chloramines killed the
virus after 10 mins. Alexander and Chettle (1998) detected a biphasic drop in
infectivity of the virus in bursal homogenates at 70o, 75
o, and 80
oC with initial
rapid drop followed in the second phase with a gradual decline. IBD virus is
very stable and therefore, persisted in poultry houses after cleaning and
disinfection (Kibenge et al 1988)
1.4.4 Genome Organization
Infectious bursal disease virus is a bi-segmented double-stranded
(ds) RNA virus belonging to the family of Birnaviridae (Dobos et al 1979,
MacDonald and Gower 1981). Muller et al (1979) stated that double stranded
RNA has sedimentation coefficient of 14S and a buoyant density of
1.62 g/mL. The larger segment A contains two partially overlapping open
reading frames (ORFs). The first, smaller ORF encodes a nonstructural
![Page 36: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/36.jpg)
11
protein VP5, whereas the second ORF encodes a 108-kDa precursor
polyprotein, that is self-cleaved to produce VPX (48 kDa), VP3 (32 kDa), and
VP4 (28 kDa) (Lukert et al 1991). Chevalier et al (2002) showed that in the
mature virions, VPX is processed into VP2 (41 kDa). VP2 and VP3 are the
major structural proteins of the IBDV virion. The smaller segment B encodes
VP1, a 90 kDa RNA-dependent RNA polymerase (Lukert et al 1991).
Figure 1.1 Structure and Genome Organization of Infectious Bursal
Disease Virus (a) Structure of infectious bursal disease virus
(adapted from www.expasy.org) (b) Genome organization of
Infectious bursal disease virus (Courtesy: www.expasy.org)
![Page 37: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/37.jpg)
12
1.4.5 Viral Proteins
IBDV’s bisegmented double-stranded RNA genome encodes an
RNA dependent RNA polymerase, VP1; two major structural proteins,
namely VP2 and VP3; a viral protease, VP4; and a nonstructural protein, VP5
(Xiaojuan et al 2008).
Segment B encodes a 90 kDa protein designated VP1 (Lukert et al
1991). This represents the RNA-dependent RNA polymerase (RdRp) as it
contains motifs that are typical for the RdRp of plus-strand RNA viruses.
Ursula et al (2004) demonstrated that, unlike Hepatitis C Virus and many
other RNA viruses, the polymerase activity of VP1 in IBDV appeared to be
strictly dependent on the 3’ terminal sequences of genomic segments A and B
and like other polymerases, metal ion co-ordination is important in the
polymerization reaction. VP1 forms complexes with the capsid protein VP3,
leading to efficient encapsidation into Virus-Like Particles (Eleuterio et al
1999)
VP2 and VP3 are two major structural proteins of IBDV,
constituting 51 and 40% of the viral proteins, respectively (Lukert et al 1991).
Segment A encodes a 110 kDa polyprotein, which is cleaved autocatalytically
to give pVP2, VP3 and VP4. The 48 kDa VP2 precursor matured to yield the
structural protein VP2 (40 kDa). Kibenge et al (1997) showed that the
cellular proteases are not required for this maturation process. Since VP2 does
not accumulate intracellularly, as the other viral proteins do, post-translational
modification of pVP2 into VP2 probably occurs during or after virus
assembly (Muller and Becht 1982). Both constituents of the proteinaceous
capsid of IBDV. It has been suggested that the external surface might be built
of trimeric subunits formed by VP2 and that the inner surface might be built
of trimeric subunits formed by VP3. The VP2 protein has been identified as
the major host-protective immunogen of IBDV and contains major epitopes
![Page 38: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/38.jpg)
13
responsible for eliciting neutralizing antibodies (Becht et al 1988, Azad et al
1991, Heine and Boyle 1993).
VP3, a 32 kDa size protein and the second most abundant protein in
IBDV consists of 257 amino acids (aa). It was shown that the protein’s
carboxy terminus exhibits several functions. A domain causing self-
interaction is located between aa 224 and 247 (Luque et al 2009). Moreover,
VP3 was found to interact with VP1 via its 10 C-terminal amino acids
(Tacken et al 2002) and to bind to the viral dsRNA, forming
ribonucleoprotein complexes (Luque et al 2009). During heterologous
expression in insect cells, VP3 was found to colocalize with pVP2 but not
with the mature form of VP2. VP3-pVP2 binding was observed to result in
the formation of virus-like particles (Ona et al 2004). VP3 is believed to act as
a scaffolding protein for pVP2, and the protein is thought to be a key
organizer in birnavirus morphogenesis (Maraver et al 2003).
The viral protease, VP4, is responsible for this self-processing of
the polyprotein, but the exact locations of the cleavage sites are unknown
(Azad et al 1987, Jagadish et al 1988). VP4 has often been described as a
minor virion component because it was detected in purified virions prepared
by a variety of methods (Kibenge et al 1988). However, Granzow et al (1997)
showed that VP4 is not a constituent of mature virions but that its presence in
virion preparations was due to contaminating VP4-containing type II tubules.
In addition to the large ORF, segment A also contains a second
ORF, preceding and partially overlapping the polyprotein gene, which
encodes VP5 (17 kDa). This non-structural protein has only been detected in
IBDV-infected cells (Mundt et al 1995). VP5 proved to be non-essential for
IBDV replication (Mundt et al 1997) but plays a role in virus pathogenesis
(Yao et al 1998), although its exact function is still unknown.
![Page 39: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/39.jpg)
14
1.4.6 Virus Replication and Transcription
The replication cycle of IBDV has not been completely elucidated.
The entire process consists of several steps. Attachment to the host cells is the
first step, followed by entry into the host cell. Once inside the cell, virion
particles are disassembled and the nucleic acids are released. Subsequent
steps include replication, transcription and translation. Finally, viral particles
are assembled, and the matured virions are released from the host cell (Marsh
and Helenius 1989).
IBDV field isolates mainly infect and destroy actively dividing
IgM-bearing B cells in the bursa of Fabricius (BF) and other locations (Hirai
et al 1981, Rodenberg et al 1994). Glycoprotein VP2 trimers from IBDV
constitute the external surface of the mature virus capsid, containing the
antigenic regions responsible for elicitation of neutralizing antibodies (Fahey
et al 1989, Birghan et al 2000). Based on the atomic structure of the viral
particles the external domain of the VP2 trimers exists as ‘protrusions’ on the
capsid surface and is believed to be responsible for receptor binding
(Coulibaly et al 2005). That glycoprotein VP2, responsible for the recognition
of corresponding receptor, has been certificated in Vero cells on the molecular
level (Yip et al 2007). Like other non-enveloped animal viruses, IBDV seems
to be internalized by receptor-mediated endocytosis. After cell entry,
birnavirus may directly proceed to initiate transcription and replication
without uncoating, since the RdRp remains transcriptionally active without
any proteolytic pre-treatment or degradation of the capsid of the virus
particles (Spies et al 1987). It was demonstrated that baculovirus-expressed
wild-type VP1 acts as an RdRp on IBDV-specific RNA templates as it
contains motifs that are typical for the RdRp of plus-strand RNA viruses and
depends on the 3’ non-coding region of plus-strand RNAs transcribed from
IBDV segments A and B for its polymerase activity (Ursula et al 2004).
![Page 40: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/40.jpg)
15
During capsid assembly, VP2 is synthesized as a protein precursor,
called pVP2, whose 71-residue C-terminal end is proteolytically processed.
The conformational flexibility of pVP2 is due to an amphipathic -helix
located at its C-terminal end. VP3, the other IBDV major structural protein
that accomplishes numerous roles during the viral cycle, acts as a scaffolding
protein required for assembly control. The progressive trimming of VP2 C-
terminal domain controls the oligomerization of capsid protein. The
coordination of these molecular events leads to the assembly of the viral
capsid (Daniel et al 2007). The VP5 protein reported to be involved in the
cytopathogenicity of IBDV and promotes virion release from infected cells
(Yongping et al 2009).
1.4.7 Persistence of Virus in Chicken Tissues
IBDV was reported to persist in the chicken for a few days but the
lesions could be seen for at least 10 weeks, the longest interval evaluated in
that study (Winterfield et al 1972). Chickens were inoculated with an
attenuated cell culture adapted virus at one day of age, the virus could be
detected in the homogenate of BF, spleen, thymus, liver, kidney and the lungs
for up to 14 days after post-inoculation (Skeeles et al 1979a, Skeeles et al
1979b). In an another study it was documented that variant IBDV was
detected in virus-inoculated commercial broilers for up to 6 weeks and
infectious virus was recovered from all organs at 4 weeks post inoculation
(PI) (Elankumaran et al 2002). This was the first report that mentions that
IBDV can be detected up to six weeks in the bursa.
1.4.8 Target Organ
The target organ for pathogenic serotype 1 is the bursa of fabricius
(BF). The BF reaches the maximum development between 3-6 weeks of age
and at this time chickens are most susceptible to the disease. The IBDV
![Page 41: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/41.jpg)
16
infection results in high mortality during the acute stage of the disease or in B
cell deficiency after recovery from infection (Becht 1980, Kaufer and Weiss
1980). Chickens infected with IBDV when older than 12 weeks do not show
clinical signs (Becht 1980). The bursectomized chickens survive the IBDV
infections which is lethal for normal chicken (Kaufer and Weiss 1980). High
concentrations of antigens and high infectivity titers were found in BF of
infected chickens, whereas only traces of antigen and low virus titers were
detected in the thymus, spleen (Kaufer and Weiss 1980) and peripheral blood
(Burkhardt and Muller 1987, Mundt et al 2003). In vitro infection studies
have shown that IBDV replicates in the population of proliferating B cells
(Muller 1986, Skeeles et al 1979b) but not in very immature lymphobalsts or
competent B cells (Becht 1980).
1.4.9 Pathogenesis
Pathogenesis is defined as the method used by the virus to cause
injury to the host with mortality, disease or immuno-suppression as a
consequence (van den Berg et al 2000). The injuries can be evaluated at the
level of whole animal, the organ and the cell. IBDV usually infects young
chickens between 3-6 weeks of age and causes a clinical disease, while sub-
clinically infecting older birds. The outcome of IBDV infection is dependent
on the strain and amount of the infecting virus, the age and breed of the birds,
route of inoculation and presence or absence of neutralizing antibodies
(Muller et al 2003).
Sequential studies of tissues from orally infected chickens using
immuno-fluorescence detected the viral antigen in macrophages and lymphoid
cells in the cecum at 4 h post-inoculation (PI) and in the lymphoid cells of
duodenum and jejunum at 5 h PI (Muller et al 1979). The virus reaches the
liver at 5 h PI and enters the bloodstream from where it is distributed to other
organs; the bursal infection is followed by viremia. The virus persists in the
![Page 42: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/42.jpg)
17
bursa of experimentally inoculated SPF chickens up to 3 weeks of age but the
presence of maternal antibodies in the commercial chicken decreases the
duration of its existence in bursa (Abdel-Alim and Saif 2001a).
Various studies have shown that the variant and classic viruses
exhibit similar pathology but differ from each other with respect to their
pathogenicity and immunogenicity (Hassan et al 1996). Variant viruses were
reported to induce bursal atrophy with minimal or no immune response in
contrast to the classic viruses which induce a severe inflammatory response
(Sharma et al 1989). However, it was noticed subsequently that variant
viruses are not homogenous as a group as thought previously (Hassan et al
1996).
Host systems used to propagate the virus have a profound effect on
the pathogenicity of the virus isolates. Significant differences occurred in the
pathogenicity and immunogenicity of the virus propagated in BF or in the
blue grates monkey-70 (BGM-70) cells. However, the antigenicity of the
viruses propagated in BF or the BGM-70 cells were not significantly different
(Hassan et al 1996, Hassan and Saif 1996). Some strains of IBDV can adapt
to CEF while others are refractory to grow in it. The SAL strain was adapted
and passaged successfully in CEF cells while IN strain was unable to grow in
CEF (Hassan et al 1996, Hassan and Saif 1996). The back passage of either
IN or SAL in SPF chickens maintained or increased the virulence of both
viruses (Hassan et al 1996, Hassan and Saif, 1996). Wild type viruses from B
lymphocytes of BF were reported to be different than those grown in chicken
embryo fibroblast (CEF). Differentiating B lymphocytes in the BF provide the
optimal micro-environment for highly efficient virus replication; CEF and
other cells seem to lack that environment (Lange et al 1987).
![Page 43: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/43.jpg)
18
1.4.10 Immunology
The IBDV is ubiquitous in commercial chickens environment and
chickens acquire the infection orally or by inhalation. The virus is transferred
from the gut to other tissues by phagocytic cells like macrophages. In
macrophages of the gut associated tissues it could be detected as early as 4
hours after oral inoculation using immunofluorescence (Muller et al 1979).
The virus then reaches the bursa via the blood where the most extensive virus
replication occurs. By 13 hours post-inoculation most follicles are positive for
virus and by 16 hours post-inoculation a second and pronounced viremia
occurs accompanied by secondary replication in other organs resulting in
disease and death (Van den Berg et al 2000).
The target organs for the virus are the IgM+ bearing B cells. During
the acute phase of the disease the bursa undergoes atrophy as the bursal
follicles get depleted of B cells. Virus replication causes extensive damage to
lymphoid cells in medullary and cortical regions of the follicle. Apoptosis of
the neighboring B cells augments the destruction of the bursal morphology.
By this time an ample amount of viral antigen can be detected in other organs
(Granzow et al 1997, Kim et al 1999). Maternally derived antibodies (MDA)
protect chickens against subclinical disease and immunosuppression
(Giambrone and Clay 1986). The MDA is known to protect the chickens for 3
weeks of age (Lasher and Davis 1997).
T cells are resistant to infection by IBDV (Hirai et al 1979). During
the acute phase of the disease lesions appear in the thymus which is quickly
overcome within a few days (Sharma et al 2000). A profound influx of T cells
is reported in and around the site of virus replication. The infiltrated T cells
could be detected from one to twelfth weeks post-inoculation, although the
viral antigen disappears by the third weeks. The IBDV induced cytotoxic T
cell limit the spread of the virus by destroying the cells expressing the viral
![Page 44: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/44.jpg)
19
antigen and thus can initiate the recovery process. At the same time IBDV-
induced T cells might enhance the viral lesions by producing inflammatory
cytokines. T helper cells produce inflammatory cytokines like IFN- which
activates the macrophages to produce nitric oxide (NO) (Sharma et al 2000).
Both humoral and cellular arms of the immune system are compromised
during the IBDV infection due to lysis of the B cells and altered antigen-
presenting cells. The IBDV causes a transient inhibition of in vitro
proliferative activity of T cells to mitogens. The virus stimulates the
macrophages to produce T cell cytokine like IFN- to produce nitric oxide
(NO) and other cytokines with anti-proliferative activity. IBD did not affect
natural killer cells levels in chickens (Sharma et al 2000).The NO production
after IBD virus infection exerts antiviral effect since the immune-suppressed
chickens that failed to induce NO had more severe disease and higher degree
of virus replication. But it does not seem to correlate with the hemorrhagic
lesions which result from the reaction of host-factors and the determinants
responsible for virus virulence and virus clearance (Poonia and Charan 2005).
The IBDV induced damage to humoral immunity is reversible.
Antibody production correlates with the morphologic restoration of the bursal
follicles. Mitogenic response of T cells returned to the normal levels. During
the course of mitogenic inhibition, T cells of infected chicken also failed to
secrete IL-2 upon in vitro stimulation (Sharma and Fredericksen 1987). Intra
bursal T cells and T-cell-mediated responses play significant role in viral
clearance and promoting recovery from infection. They defend the host cell
by reducing the viral burden but at the same time produce inflammatory
cytokines and nitric oxide inducing factor that enhance tissues destruction and
also delay the recovery process (Rautenschlein et al 2002). Intrabursal T cells
were activated by in vitro stimulation with IBDV. The activated cells had
increased surface expression of chicken MHC class II molecule, Ia and IL-2
receptor CD25. In addition, these cells have an up regulated IFN- gene
![Page 45: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/45.jpg)
20
expression (Kim et al 2000). Splenocytes exposed to IBDV produced nitric
oxide inducing factor (IFN- ) (Rautenschlein et al 2002). Intrabursal T cells
inhibited the mitogenic response of normal splenocytes by 90%. This bursal T
cell-induced mitogen inhibition was found to be dose-dependent and not
MHC-restricted (Kim and Sharma 2000). In contrast to the bursal T cells, the
splenocytes from IBDV exposed chickens did not have suppressive activity.
Mitogenic inhibition by bursal T cells is mediated by soluble factors, the
nature of which is still unknown (Rautenschlein et al 2002). Chickens that
survive the disease, clear the virus and recover from its pathologic effects
(Sharma et al 2000). It has been shown that the more virulent the virus the
stronger is the suppression of the humoral and cell mediated immunity.
Virulent virus also produced a detectable NO production in serum.
Humoral immunity is the primary mechanism of the protective
immune response. Infection with IBDV results in the formation of antibodies
to the group and serotype specific antigens (Jackwood et al 1985). Field
exposure or vaccination results in VN titers higher than 1:1000. But weak
responses are obtained in chickens immunized with purified viral
polypeptides (Fahey et al 1985), since viral protein conformation is important
in eliciting a high VN antibody response (Azad et al 1987). Antibody
production is stimulated at the primary site of viral replication in gut
associated tissue and they can be detected as soon as 3 days PI. These
antibodies prevent the spread of the virus to other tissues. Due to the rapid
onset of antibodies, the necrotic foci that form in the bursa of fabricius stop
expanding and are completely eliminated (Becht, 1980).
1.4.11 IBDV Detection Methods
Because of the severe impact of IBDV on the poultry industry and
also the environment, much effort has been directed towards disease
management and control. A basic requirement to prevent outbreaks is
![Page 46: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/46.jpg)
21
detection at an early stage. In addition to the traditional observation of gross-
and clinical signs and morphological pathology using light and electron
microscopy, histopathology and histochemistry, a whole array of molecular
technologies has been developed for the detection of IBDV. Besides, the use
of in situ hybridization techniques, polymerase chain reaction (PCR) and
immunological detection methods have been developed for the detection of
IBDV. A large number of commercial detection kits based on in situ
hybridization, PCR and immune-detection, are also available.
The IBDV diagnosis can be broadly classified into two types,
antigen based and antibody based, which utilize antigen-antibody reaction or
nucleic acid detection. To date a lot of DNA and protein based diagnostic
techniques are available that can detect the virus at early stage of infection.
Some of these diagnostic tests for the detection of IBDV infection are
discussed in detail under each section.
1.4.11.1 In situ Hybridization
In situ hybridization methods have been developed for almost all
the viral diseases of poultry. A molecular clone representing 445 base pairs at
the 3' end of genome segment B was used as radio labeled probe to detect
viral RNA from cell culture and from chicken bursa and spleen tissue
specimens (Jackwood et al 1989). Following this, series of 32P-labeled
randomly primed cDNA probes were tested against the vaccine strains, as
well as field-origin strain of IBDV (Davis and Boyel 1990). Henderson and
Jackwood (1990) demonstrated that the hybridization assay is more sensitive
than the agar-gel precipitin (AGP) and immunofluorescence (IF) assay which
can detect IBDV for a longer period of time, post-infection. Jackwood (1990)
prepared a radiolabeled cDNA probe using both the segments of double-
stranded genomic infectious bursal disease virus (IBDV) RNA as template,
which was specific for viral RNA and detected approximately 10 ng of IBDV
RNA.
![Page 47: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/47.jpg)
22
The cDNA clones STC-243, located on genome segment A, and
STC-119, located on genome segment B, were used to prepare non-
radioactive probes. Probes were labeled with digoxigenin and detected the
homologous STC virus and also heterologous viruses in bursal tissue sections
(Jackwood et al 1992). The digoxigenin labeled cDNA probe synthesized
from the VP4 region of a virulent field isolate of IBDV could detect four
serologic subtypes of IBDV and the test was rapid, reproducible, and sensitive
(Hathcock and Giambrone 1992). Liu et al (2000) developed an in situ
hybridization (ISH) test with a 491 bp cDNA fragment derived from the VP2
gene of IBDV. The digoxigenin-labeled 491 bp nested PCR product was used
as probe for ISH to detect and localize IBDV RNA in bursae of Fabricius
from chickens both experimentally infected as well as commercially reared.
The cDNA of 448 base pairs in length located near the VP2/VP4
junction in IBDV STC strain was used as a biotin labelled probe in a dot-blot
hybridization assay to detect IBDV. The probe detected four subtypes of
IBDV serotype 1 and a serotype 2 IBDV isolate (Jackwood et al 1990). Lee
(1992) developed four biotin-labeled probes which detected both serotype l
and serotype 2 IBDV, with one probe was highly sensitive detected as little as
0.04 ng of IBDV RNA. However the probes were specific and did not cross-
react with nucleic acids extracted from mockinfected cells or from seven
unrelated avian viruses. Xue and Lim (2001) established biotin-streptavidin
system to directly visualize IBDV-binding cells in cell culture or in fresh
tissues. This method can be employed for the expressional cloning of IBDV
receptor and can be applied to studies on other avian viruses.
Apart from the bursa the IBDV RNA positive cells were observed
in tissues of thymus, spleen, proventriculus, and cecal tonsil. One drawback is
that it requires trained personnel to prepare the sections and to identify the
positive hybridization signals.
![Page 48: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/48.jpg)
23
1.4.11.2 Reverse Transcription and Polymerase Chain Reaction
The advent of Polymerase Chain Reaction (PCR) has made the
diagnosis of almost all the diseases very easy. Due to its high specificity,
sensitivity and the time taken to perform this test, PCR has been the most
preferred test to detect the poultry diseases. PCR is the amplification of a
fragment of DNA that lies between two regions of a known sequence by the
use of two oligonucleotides as primers for a series of synthetic reactions that
are catalyzed by DNA polymerase enzyme (Mullis and Faloona 1987).
Wu et al (1992) developed the first PCR test for the detection
IBDV. A set of primers that specify a 150-base-pair segment of IBDV genome
were used to distinguish the IBDV from other infections in chicks. The PCR
could detect 2 femtograms of IBDV RNA. Denatured double stranded (ds)
RNA for reverse transcription produce high yield of cDNA. As part of the
analysis, the nature of cDNA produced in two preparations was examined by
PCR amplification, which showed that heat denaturation at 65oC of dsRNA in
the presence of DMSO is superior to denaturation without DMSO (Biao and
Frederick, 1994). Akin et al (1998) demonstrated that dsRNA extracted by the
proteinase K digestion method is more suitable than that by acid-guanidium-
phenol-chloroform (AGPC) method for the amplification of longer fragments
of IBDV cDNA by PCR.
Lee et al (1994) developed a protocol based on single-tube, non-
interrupted RT-PCR for the detection of IBDV using a primer set framing a
region within the gene coding for IBDV VP2 protein to amplify a 318 bp
fragment of the IBDV genome. The amplified product was detected with three
strains of IBDV and even detected the bursal-tissue specimens from
commercially reared chickens. RT-PCR with two pairs of primers amplifying
virus specific sequences from the VP2 and VP3 genes yielding products of
365 bp and 320 bp respectively was used for identification of Israeli isolates
![Page 49: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/49.jpg)
24
of IBDV. The system was applied to tissue culture and to long frozen bursa of
Fabricius from infected chickens (Stram et al 1994). Two pairs of primers
were designed to amplify 309 and 520 bp of segment A genes that partially
code for the IBDV proteins VP2 and VP3, respectively. Thus, an
amplification assay was developed to detect IBDV gene sequences in clinical
samples, infected cell cultures and chicken embryo (Tham et al 1995).
Wu et al (1997) performed quantitative competitive PCR (QC-PCR)
amplification to measure complementary DNA (cDNA) and RNA levels of
IBDV, using a competitor, a deletion mutant of the wild type IBDV cDNA.
The assay could measure IBDV cDNA levels ranging from l g to 45 fg and
RNA levels ranging from 9 g to 45 fg.
A rapid and sensitive protocol for the detection of IBDV RNA in
the bursa of Fabricius was developed by Liu et al (1998), where four primers
from the sequence of a hypervariable region in VP2 genes were selected to
amplify a 643 bp product from IBDV RNA by RT-PCR and was reamplified
and double checked by a nested PCR amplifying a 491-bp cDNA. The
sensitivity of nested PCR was at least 100 times greater than RT-PCR as
determined by dilution of the bursal homogenate. Moody et al (1999)
demonstrated that the course of IBDV infection in chickens can be monitored
by Measuring the IBDV RNA in blood by multiplex real-time quantitative
RT-PCR. Cardoso et al (2000) confirmed the passage of classical IBDV on
chicken embryo related (CER) cell monolayers by RT-PCR. They concluded
that it was possible to detect the viral RNA in infected cell culture from 6 h
post inoculation. Abdel-Alim and Saif (2001) investigated persistence of
IBDV or its RNA in BF of infected and vaccinated SPF chicks and of infected
and vaccinated commercial broiler chicks that had maternally derived
antibodies. They found positive results with RT-PCR from day 7 to 28 days PI
with the amplified product size 743 bp. A sensitive and specific based
multiplex polymerase chain reaction (mPCR) was developed and optimized
![Page 50: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/50.jpg)
25
for the simultaneous detection and differentiation of avian reovirus (ARV),
avian adenovirus group I (AAV-I), infectious bursal disease virus (IBDV), and
chicken anemia virus (CAV) (Caterina et al 2004).
Rapid identification of viral strain with quantification of virus
genome was carried out with a real-time RT-PCR assay utilizing dual-labeled
fluorescent probes binding to VP4 sequence that are specific to the classical
(Cl), variant (V) and very virulent (vv) strains of IBDV. The assay was highly
sensitive and could detect as little as 3 × 102 to 3 × 10
3 copies of viral
template (Peters et al 2005). Kusk et al (2005) developed a strain-specific
multiplex RT-PCR technique, which can detect and differentiate between field
strains of IBDV and vaccine virus strains. Vaccination effects failed, when the
vaccinated flocks were exposed to a different antigenic subtype, which
reinforces the importance of identification of new IBDV variants. The
presence of one or more nucleotide mutations were able to detect by real-time
RT-PCR using probes designed for two epitope regions of VP2, so that it can
be a useful tool to assist in the development of more effective vaccination
strategies (Mickael and Jackwood 2005).
Li et al (2007) used specific set of primers for IBDV virulent strain
DK01 and vaccine strain D78 to quantify and detect IBDV in infected bursa
of Fabricius (BF) and cloacal swabs simultaneously in dually infected
chickens using quantitative real time RT-PCR with SYBR green dye.
Aini et al (2008) compared the SYBR Green I real-time PCR, enzyme-linked
immunosorbent assay ELISA and conventional agarose detection methods in
detecting specific IBDV PCR, found that real-time PCR was the most
sensitive method for IBDV detection.
Wang et al (2009) developed a real-time RT-PCR with VP5 gene of
IBDV as the target binding region detected and quantified IBDV in cell lines
and concluded that DF-1 cell line may be a more suitable continuous cell line
![Page 51: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/51.jpg)
26
for the propagation of IBDV compared to CEF. Xu et al (2009) established a
reverse-transcription loop-mediated isothermal amplification (RT-LAMP)
method rapid detection of IBDV using four primers specific to the conserved
region of VP3 gene. Ghorashi et al (2011) combined real-time RT-PCR and
high resolution melt (HRM) curve analysis to differentiate between classical
vaccines/isolates and variants IBDV strains, which developed into a robust
technique for genotyping IBDV isolates/strains.
1.4.11.3 Immunofluroscence
Fluorescent antibody detection of IBDV in fresh bursal tissue
impression smears is also a reliable method of detection (Meulemans et al
1977, Muller 1979). The viral antigen was detected in chickens inoculated
with the Sk-1 strain until post-inoculation days 5 or 6 by the fluorescent
antibody test (Ide 1975). Cells infected with double-stranded RNA (dsRNA)
containing viruses i.e. reovirus, infectious pancreatic necrosis virus, and
IBDV showed bright fluorescence with anti-dsRNA (Macdonald 1980). In
the field surveys, immunofluorescence was a more sensitive method of
demonstrating infection than direct electron microscopy and virus isolation
and gave a good correlation with histopathological diagnosis of IBD
(Allan et al 1984). The fluorescence observed in the normal tissue sample is
compared with the fluorescence observed in the infected tissue sample. This
assay method is rapid, requires less than 3 hours to detect the infection.
However, the final specimen has a limited life span, since fluorescence fades
relatively quickly. The only disadvantages are that it requires a fluorescent
microscope and adequately trained personnel to distinguish the fluorescing
IBDV infected cells.
![Page 52: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/52.jpg)
27
1.4.11.4 Agar Gel Immuno-Diffusion (AGID)
Precipitation of antigen-antibody complexes from solution has been
used since the 1920s for the quantification of antigens and antibodies.
Reactions in gels were first utilized for immunochemical studies in the mid-
1940s, when Oudin introduced one-dimensional, simple immunodiffusion in
tubes containing agar gel. Gel methods have significantly higher sensitivity
and greater resolving power than techniques with no support medium. In
addition, the actual gels may be photographed and stored, since the insoluble
immunoprecipitates formed at equivalence become trapped in the gel matrix
(Johnson 1986).
Agar gel diffusion test (AGDT) or Agar gel immunodiffusion
(AGID) or Agar gel precipitation test (AGPT) is the most common,
economical and simple test for detection of IBDV specific antibodies in
serum, or viral antigen in bursal tissue. The test has been widely used over a
long period of time throughout the world as it is easily adaptable to any
laboratory condition.
Kosters and Geissler (1971) performed AGDT using bursal
homogenates from the infected chicken to detect IBDV. Ulbrich and Zureck
(1977) followed the same technique and could detect precipitation antigen in
bursal tissue between 32 hours and five days after experimental infection in
four-week-old chicks. Kosters (1971) reported precipitating bursal antigen by
immunodiffusion at one to five days after infecting chickens of one to four
weeks of age. Faragher (1972) determined optimal conditions of
immunodiffusion reactants associated with IBD and found them similar to
those required by other avian systems. He found that precipitating antigen was
organ specific, being detected only in the bursa of the infected chickens.
![Page 53: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/53.jpg)
28
Many scientists detecting IBDV in the IBD suspects chicken’s
bursal samples using standard IBD antibodies by AGPT, AGID or AGDT
(Ajinkya et al 1980, Okoye and Uzoukwu 1984, Ganesan et al 1990,
Nachimuthu et al. 1993, Thevathasan and Jaywardana 1997, Saif 2000).
Beside bursal suspension IBDV infected chorio-allantoic membrane
suspensions, chicken embryo fibroblast cell cultures and liver homogenates
were also showed IBDV presence by AGID (Kulkarni et al 1983, Joshi and
Shakya 1996, Kumar et al 2000). Monoclonal antibody (mAbs) based AGDT
was used for detection of IBDV antigen (Snyder et al 1992, Umapathi et al
2002)
1.4.11.5 Dot Blot Assay
The dot blot assay is based on antigen antibody interaction where,
the protein samples are dotted onto the Nitrocellulose membrane directly
without processing them like in Western blot assay. The extent of viral
infection can be determined from the intensity of the dot. The dot blot assay is
a good alternative to the ELISA and the IFAT in the serodiagnosis. Cruz-Coy
et al (1993) used monoclonal antibody (mAb) developed against a variant
subtype of IBDV, to recognize all six serologic subtypes of IBDV and three
untyped IBDV by dot blot method. Zhang Chunjie (1994) established a
sandwich Dot-blot method for detecting IBDV, which showed 100 times
higher sensitivity than that of AGP. Later, kumar et al (1996) also showed that
dot blot is rapid and more sensitive than AGPT in detecting IBDV. Gowri et
al (1996) standardized the Avidin-biotin dot blot method to detect IBDV
antigen in bursal sample. Moreover Anil et al (2002) reported that dot blot
was as equally sensitive as 1 step PCR. Chances of false-positive results are
less with the immunodot method, which detects the available protein copies
actually present in the sample. The test is very simple and may be used by
![Page 54: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/54.jpg)
29
farmers without any sophisticated equipments. If the antiserum is very
specific, dot blot can be a practical alternative to PCR.
1.4.11.6 Enzyme Linked Immunosorbent Assay (ELISA)
ELISAs are in use for the detection of antibodies to IBD. It
describes the demonstration of class specific immunglobulin responses during
IBD infection. Howie and Thorsen (1981) showed ELISA as a precise,
sensitive and reproducible means of measuring IBDV antibodies in chicken
and turkey sera. Viral antigen preparation was crucial to the precision of the
ELISA test. Purified virus prepared from high titer seed virus was less non
specific than that from low titer of seed virus in an ELISA (Tsukamoto et al
1990). Immunologic studies involving IBDV have suggested that VP2
contains a conformationally dependent neutralizing epitope which could be
used to distinguish serotypes. A 944-bp portion of the VP2 gene of IBDV
expressed in baculovirus was used as an antigen in an ELISA, could detect
IBDV neutralizing antibodies from specific-pathogen-free chickens sera
infected with IBDV strains (Jackwood et al 1996). Deng et al (2007) found
out that VP3 consists of antigenic epitopes which could react with IBDV
antibodies. Wang et al (2008) showed that recombinant VP3 expressed in
E.coli used as antigen in detecting the field chicken sera was comparable to
the ELISA based commercial kit. Singh et al (2010) made a comparison of
four indirect ELISA viz., a commercial IDEXX-ELISA kit, VP2 and or VP3
antigen based ELISAs and a whole virus ELISA and concluded that
IDEXX-ELISA, VP3-ELISA and VP2-ELISA had similar and relatively
better performance when compared to whole virus antigen-ELISA.
Peptides prepared for the predicted antigenic determinants on the
VP2 and VP3 protein were used as antigens in ELISA, an alternative to whole
viral antigen to detect anti-IBDV antibodies in the chicken sera. Saravanan
et al (2004) synthesized two Multiple antigenic peptides (MAPs) for the
![Page 55: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/55.jpg)
30
predicted antigenic determinants on the VP2 protein, which could specifically
detect anti-IBDV antibodies in the chicken sera when coated with 5 ng/ml on
the ELISA plate, whereas the coating amount of purified IBDV whole viral
antigen was 500 ng/ml, indicating the high efficiency of MAPs.
ELISA is the most widely used assay to detect viruses in humans
and other animals. Different protocols have been described for the detection
of IBDV using an antigen-capture enzyme-linked immunosorbent assay
(AC-ELISA). Kwang et al (1987) detected IBDV antigen prepared from the
cloacal bursa using AC-ELISA. Two neutralizing monoclonal antibodies
(MCAs), R63 and B69, were used in AC-ELISA to verify the presence of
IBDV in infected bursal tissues (Snyder et al 1988). AC-ELISA based on
different neutralizing mouse monoclonal antibodies (Mabs) was used to study
Polish IBDVs isolated from two epidemics on the turn of 70/80s (early IBDV)
and in the 90s (recent IBDV) and were compared to the Faragher 52/70
(F52/70) reference strain of European classical serotype 1 IBDV and to the
89/163 (typical) and 91/168 (atypical) French very virulent (vv) IBDV
isolates (Eterradossi et al 1997). Antibodies raised and purified against the
VP3 antigenic determinant MAPs were used to detect native virus in ELISA
(Saravanan et al 2004).
The assay is rapid and can be used to determine the total amount of
antigen by comparing the readings with a standard curve obtained with known
amounts of pure antigen. This assay is very simple as it does not require
antigen purification and is highly specific.
1.4.11.7 Latex Agglutination Test
Latex agglutination test have been routinely used for clinical
diagnosis of various pathogens like Corynebacterium diphtheriae (Toma et al
1997), Clostridium difficile (Staneck et al 1996), Streptococcus pnemoniae
![Page 56: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/56.jpg)
31
(Garcia et al 1999). The latex agglutination is a simple, rapid and
cost-effective test and thus quite applicable in developing countries. It can be
conveniently used in a hatchery for screening a large number of chicken
samples, as it does not require trained personnel or instruments like the
radioactive detectors and microscopes. The test can be performed in
30 minutes and spot detection can be done with naked eye.
A monoclonal antibody (mAb) to infectious bursal disease virus
(IBDV) bound polystyrene latex microspheres agglutinated with extracts of
bursae and sera from chickens infected with all strains or isolates of IBDV
tested. (Nakamura et al 1993a). Later Nakamura et al (1993b) performed a
competitive agglutination test using the polystyrene latex bound monoclonal
antibody to detect the serum antibody titer against IBDV. The titer of antibody
specific to IBDV was measured by latex agglutination-inhibition (LI) test was
rapid and an easy technique for measuring IBDV VP2-specific antibody,
which titer level eventually used to correlated with protection of chicken from
IBDV (Nakamura et al 1994). Nachimuthu et al (1995) reported that there was
no statistically significant difference in detecting IBDV antigen from different
organs by reverse passive haemagglutination test (RPHA), latex agglutination
(LAT) and agar gel immunodiffusion (AGID). However LAT was
recommended because of cost and speed of obtaining results.
1.4.11.8 Immunohistochemical Staining
For immunohistochemical staining field samples need to be fixed in
Davidson’s fixative and stored till assay. The immunochemical tests with
monoclonal antibodies are easy and rapid to perform with necessary
equipments or a laboratory designed for histopathological analysis. Reading
the reactions requires only the use of a light microscope and minimal training
for the determination of positive reaction.
![Page 57: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/57.jpg)
32
A monoclonal antibody that binds with all the strains of IBDV was
used for immunohistochemical detection and localization of IBDV in
formalin-fixed paraffin-embedded sections of the bursa of Fabricius of
experimentally and naturally infected chickens (Cruz-Coy et al 1993). Dolz
et al (2005) carried out immunohistochemical studies of those bursal tissues
to determine possible emergence of IBDV isolates with modified antigenic or
virulent properties. Hamoud et al (2007) fount out the optimal fixation
conditions for immunohistochemical detection of IBDV, which were 10%
formalin concentration, pH 7.0, and temperature of 4 degrees C, where
maximum intensity of immunostaining was observed. The major limitation of
this technique is that it requires the use of skilled technicians to prepare and
process the samples for immunohistology.
1.4.11.9 Immunochromatographic Assay
The immunochromatographic assay is an alternative rapid-detection
method for easy visualization of antigen–antibody reactions. The results can
be directly observed with the naked eye and is, thus, more convenient when
performing bioassays in the field.
Zhang et al (2005) developed a rapid diagnostic strip for chicken
infectious bursal disease (IBD) based on membrane chromatography using
high-affinity monoclonal antibodies directed to chicken IBDV. The diagnostic
strip had high specificity for detection of chicken IBDV antigen and
recognized a variety of the virus isolates, including virulent and attenuated
strains, with no cross-reactivity to other viruses. Wang et al (2008) used
disperse dyes (DADISPERSE NAVY BLUE SP) as an immunoassay
chromogenic marker, in analyzing antibody against IBDV (anti-IBDV).
Recently Nurulfiza et al (2011) developed an immunochromatographic assay
using colloidal gold-antibody conjugate to detect IBDV in chickens. The
results showed that the test strip was more sensitive than the commercial
![Page 58: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/58.jpg)
33
enzyme-linked immunosorbent assay because it could detect a dilution factor
up to 120,000 (250 ELISA units) for positive samples.
1.4.12 IBDV Control Methods
IBDV is highly infectious and very resistant to inactivation.
Therefore, despite strict hygienic measures, vaccination is inevitable under
high infection pressure and mandatory to protect chickens against infection
during the first weeks after hatch. Mostly two types of vaccine are available
for the control of IBD. These are live attenuated vaccines, or inactivated oil-
emulsion adjuvanted vaccines.
The most popular strategy for IBD vaccination is hen hyper-
immunization (Sharma and Rosenberger 1987). Poultry integrators use live
IBDV vaccines and two or more inactivated vaccines in replacement pullets
and hens in order to hyper-immunize hens. Passive immunity to IBDV is then
transferred to broiler progeny providing some level of early protection against
field challenge. Some companies rely on passive immunity only for broiler
protection and do not use any live vaccines in progeny (Fussell 1995). In
addition to passive immunity, live IBDV vaccines are also given in an effort
to gain active immunity against IBDV (Giambrone 1995, McMurray 1995,
Putnam 1995). Live IBDV vaccines are administered either in ovo or at
hatching, and in the field through booster vaccinations. Live Delaware variant
and classic combinations are often recommended (Miller Heins 1995). The
timing of live IBD vaccine administration in broiler progeny, usually
depending upon antibody titer levels as measured by ELISA or other
techniques (Ather 1993).
Day-old chicks with maternally derived IBD antibodies were
inoculated with IBD oil emulsion, showed 90 per cent survival when
challenged at seven weeks of age (Wyeth and Chettle 1990). Age of
![Page 59: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/59.jpg)
34
vaccination is an important aspect of protection against IBDV infection.
Chicks administered with inactivated IBD oil emulsion vaccine at seven days
old were fully protected compare to the chicks administered at 10, 14 or 28
days old, with a partial protection (Wyeth et al 1992). Chicks of 3 to 6 weeks
age groups are mostly susceptible to IBDV. Considering the age factor in the
susceptibility of chicks to IBDV, Kembi et al (1995) recommend the ocular
route as the most effective for vaccination compared to the oral and
intramuscular route, as the Post-intra ocular vaccination seroconversion was
observed at the age of 6 weeks in 70% of the birds which increased to 80%
during the two following weeks. Tsukamoto et al (1995) suggested that
serological determination of the optimum vaccination time for each flock is
required to effectively control highly virulent IBDV in the field. The optimum
vaccination timing could be approximated by titrating the maternal IBDV
antibodies of 1-day-old chicks by an enzyme-linked immunosorbent assay or
by an agar gel precipitin test.
The immune system in birds begins to develop early during
embryogenesis and various immune reactions have been induced in the late
stage chicken embryos. Therefore attempts on ovo vaccination as an
alternative approach to post-hatch vaccination of chickens, were explored.
Negash et al (2004) reported that compared to post-hatch vaccination, in ovo
vaccination stimulates both the innate and adaptive immune responses with
the advantage that because of the prenatal immunization, in ovo vaccinated
chicks have developed an appreciable degree of protection by the time of
hatch.
Vaccines along with many immunomodulators are used for
enhancement of immunity in humans and animals for a long time. Hung et al
(2009) reported that Gingyo-san (GGS), a traditional Chinese medical
formula enhanced cell-mediated immunity and augmented the effects of IBD
![Page 60: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/60.jpg)
35
vaccination in strengthening subsequent anti-viral responses. Similarily,
polysaccharide-containing extracellular fractions (EFs) of the edible
mushroom Pleurotus ostreatus increased the level of IBD antibodies when
used in combination with BIAVAC and BIAROMVAC vaccine (Selegean et al
2009). There was significant increase in mitogenic stimulated lymphocyte
proliferation and antibody levels of chicks immunized with IBD vaccine
emulsified with an extract from Momordica cochinchinensis seed (Selegean
et al 2009).
Amakye-Anim et al (2000) reported that IBDV vaccine immunized
chicks supplementated with ascorbic acid (AA) to their diet did not show any
clinical signs or mortality when challenged with IBDV. Hung et al (2010)
revealed that the dietary supplementation with recombinant porcine
lactoferrin (rPLF) led to significant increase in serum IgG and IBD-specific
antibody titers, and also enhanced the expression of IFN-gamma and IL-12 in
chicken T lymphocytes. Passive hyperimmune therapy (PHT) is another
alternative to standard vaccination. Passive immunization with antibodies
derived from blood is widely used to prevent or treat infections like measles,
hepatitis A, hepatitis B, tetanus, varicella, rabies, and vaccinia etc.
Eterradossi et al (1997) showed that SPF chicks are passively protected from
IBDV when hatched from the eggs injected with semi purified egg-yolk anti
IBDV immunoglobulins. Malik et al (2006) recovered 92% IBD virus
infected birds, when injected with purified anti IBDV antibodies.
In recent years, because of the advances in recombinant technology,
different innovative strategies have been reported for IBDV vaccines.
Recombinant protein and DNA based vaccines have been developed (Shaw
and Davison 2000, Wang et al 2000, Chang et al 2003). These vaccines are
free of the disadvantages associated with currently used live attenuated
vaccines. The recombinant vaccines are made by inserting the genes for
![Page 61: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/61.jpg)
36
IBDV capsid proteins in the genome of a suitable vector. Specifically VP2
gene is used, as it is the host protective antigen of IBDV. It contains epitopes
responsible for the induction of neutralizing antibody. Recombinant VP2
expressed in systems such as Escherichia coli, Pichia pastoris, baculo virus,
fowl pox virus etc. were used as sub unit vaccine, showed protection when
challenged with IBDV.
The entire sequence of Segment A encoding VP2, VP4, and VP3 in
that order cloned into the Escherichia coli expression vector pET21a under
the T7 promoter. Chicks immunized with purified recombinant IBDV by intra
muscular injection induced anti-IBDV antibodies and were protected when
challenged with the Gep 5 isolate of IBDV (Rogel et al 2003). Recombinant
VP2 as subunit vaccine and live induced bacteria expressing VP2 as vaccine
conferred protection of 90-100% and 85.7% respectively for chicks
challenged with virulent IBDV (Rong et al 2005). Wang et al (2007) explored
the mimotope vaccine approach against IBDV, by synthesizing an artificial
gene designated as 5epis consisting of the five mimotopes arranged in tandem
(F1-F7-B34-2B1-2G8) with four GGGS spacers, and cloned into a
prokaryotic expression plasmid pET28b. The multi-mimotope protein r5EPIS
gave 100% protection and promised to be a novel subunit vaccine candidate
for IBDV.
VP2 was produced in a highly immunogenic form by expression in
the yeast Saccharomyces cerevisiae. The recombinant protein, formulated as
an oil-emulsion vaccine, induced antibodies and protected the immunized
chicks against a challenge infection with virulent IBDV (Fahey et al 1991).
Another yeast expression system is the facultative methylotropic yeast Pichia
pastoris which utilizes methanol. Large scale production of VP2 was achieved
with the cloning of VP2 gene into a Pichia pastoris expression system, which
gave protection against IBDV as an efficient and cost effective sub unit
![Page 62: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/62.jpg)
37
vaccine (Pitcovski et al 2003). Pichia pastoris expressed VP2 and
hypervariable region of the VP2 gene gave fully and partial protection
respectively (Villegas et al 2008). VP2 protein fused with interleukin - 2
expressed in Pichia pastoris elicited the secretion of both IgG1 and IgG2a and
showed a protection of 85% in the challenge experiments (Wang et al 2010).
IBDV structural proteins (VP2, VP3 and VP4) were introduced into
the baculovirus expression system, which inoculated into susceptible chickens
induced virus-neutralizing antibodies and conferred up to 79% protection
aginst IBDV challenge. Specific-pathogen-free hens vaccinated with a single
dose of the same subunit vaccine produced virus-neutralizing antibodies that
were capable of passively protecting the progeny from infection with variant
IBDV (Vakharia et al 1993, Vakharia et al 1994). Pitcovski et al (1996)
showed recombinant VP2 expressed in insect cells as a high potential subunit
vaccine, protecting chicks from high pathogen IBDV. This was further
confirmed by Yehuda et al (2000), when baculovirus expressed VP2 induced
antibodies similar to commercial vaccine and the antibodies were also
transferred to their offspring and were detected in the blood of the progeny for
at least 20 days after hatching. Booster dose with recombinant baculovirus
VP2 increased the survival to 100% when challenged with IBDV (Ouyang
et al 2010).
The development of recombinant vaccinia viruses for the
expression and delivery of vaccine antigens to mammalian species soon led to
the realization that other host-specific viruses would also be suitable vectors
for vaccine delivery. A number of viruses of poultry are being developed as
potential vaccine vectors. Poxviruses, herpesviruses and adenoviruses appear
to be the most attractive candidate vector viruses.
![Page 63: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/63.jpg)
38
rFPV-VP2, a fowlpox virus recombinant expressing VP2
vaccinated in chicks provided protection against mortality induced by the
homologous IBDV strain or a highly virulent strain (Heine and Boyle 1993).
Replication-competent herpesvirus vectors are prospective vaccine vehicles
having a potential for long-term induction of both humoral and cellular
protective immunity against pathogens in animals. Tsukamoto et al (2002)
demonstrate that the amount of VP2 antigen expressed in the herpesvirus
(HVT) vector was correlated with the vaccine efficacy against lethal IBDV
challenge. rHVT-pecVP2, which expressed the VP2 antigen approximately
four times more than did rHVT-cmvVP2 in vitro, induced complete protection
against a lethal IBDV challenge in chickens, whereas rHVT-cmvVP2 induced
58% protection. Huang et al (2004) devised a recombinant Newcastle disease
virus (NDV) vector using reverse genetics approach to express the host
protective immunogen VP2, which on vaccinated generated antibody
responses against both NDV and IBDV and provided 90% protection against
NDV and IBDV. Cao et al (2005) developed a fusion protein of VP2 and T4
phage surface capsid protein using T4 bacteriophage surface protein display
system which gave a 100% protection against vvIBDV strain when
immunized to SPF chickens. The adeno-associated virus (AAV) is a
replication-defective virus member of the family Parvoviridae that has been
successfully used for gene delivery in humans and other species. Perozo et al
(2008) evaluated the protection efficacy of an avian adeno-associated virus
(AAAV) expressing the VP2 protein (rAAAV-VP2) against IBDV-virulent
challenge, which induced protective immunity in 80% of the challenged birds.
Since the introduction of edible plant-based vaccines by Mason et al (1992),
several laboratories have used transgenic plants for expression of viral and
bacterial antigens. Transgenic lines of Arabidopsis thaliana expressing
recombinant VP2 were developed and could able to induced antibody
response against IBDV in orally-fed chickens (Wu et al 2010). Similarly SPF
chicks orally vaccinated with transgenic rice seeds expressing VP2 protein
![Page 64: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/64.jpg)
39
produced neutralizing antibodies against IBDV and were protected when
challenged with a highly virulent IBDV strain (Wu et al 2007).
DNA vaccination, the delivery of plasmid DNA encoding
immunogens by direct inoculation, offers the potential for further
advancements in the production of effective vaccines. A plasmid DNA
carrying VP2, VP4, and VP3 genes of IBDV Immunized twice or three times
could conferred protection for 50–100 or 80–100% of chicks, respectively
(Chang et al 2001). Cytokines are natural modulators of the immune system
that offer the potential for further improving the protective immune response
of conventional vaccines against avian pathogens of economic importance.
Immune cytokines, such as the chicken IL-2 (chiIL-2) gene incorporated into
vaccination regimens currently being used by the poultry industry, could,
potentially, act as natural vaccine enhancing molecules. VP2 gene cloned in a
bicistronic vector along with chicken interleukin-2 (chiIL-2) as an adjuvant.
An in vivo challenge study of bicistronic DNA vaccine expressing IBDV-VP2
and chicken IL-2 together showed effective protection compared to IBDV-
VP2 and chiIL-2 injected separately against a lethal IBD infection in chickens
(Kumar et al 2009).
Good health management and excellent farm management are still
required to prevent diseases in the chicks. Unfortunately, many of these
management techniques can only be adopted by the intensive and some of the
semi-intensive farms having enough trained personnel. Excluding meticulous
sanitation and first-rate management practices, sufficient control measures
against IBDV are required. Therefore, a cheap and simple vaccine giving
sufficient protection against IBDV outbreaks would be highly desirable for
poultry farming.
![Page 65: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/65.jpg)
40
CHAPTER 2
MATERIALS AND METHODS
2.1 MATERIALS
2.1.1 Reagents and Chemicals
Chemicals of analytical grade were purchased from Sigma
Chemical Company, St. Louis, USA and the components required for
preparing the bacterial growth media were bought from HiMedia, Mumbai,
India. Antibiotics like ampicillin were purchased from Ranbaxy, Delhi, India
and kanamycin from HiMedia, Mumbai, India. Reverse transcriptase enzyme,
ribonuclease inhibitor, restriction enzymes, vent DNA polymerase and T4
DNA ligase were obtained from New England Biolabs, Beverly, MA, USA
and taq polymerase was from Genecraft, Lüdinghausen, Germay and Genei,
Bangalore, India. Oligonucleotide primers for PCR were synthesized from
Microsynth, Balgach, Switzerland. DNA molecular weight markers and
protein molecular weight markers were obtained from Fermentas (Fermentas,
MD, USA). Trizol reagent for RNA extraction was obtained from Gibco BRL,
Life Technologies, Carlsbad, CA, USA. For large-scale purification of
plasmids Gigaprep kits were purchased from Qiagen, Germany. For endotoxin
assay, E-toxate kit (Limulus amebocyte lysate assay, Sigma, USA) was used.
The chelating sepharose for purification of histidine tagged recombinant
protein, Q sepharose and Hibond nitrocellulose membranes for Western
blotting were procured from Amersham Pharmacia Biotech, Piscataway, NJ,
USA.
![Page 66: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/66.jpg)
41
The Maxisorp microtitre plates for carrying out Enzyme Linked
Immunosorbent Assay were purchased from NUNC, Roskilde, Denmark. The
immunological reagents and secondary conjugates were also procured from
Sigma, St.Louis, USA and Bangalore Genei, India. Rabbit anti-chicken IgY
ALP conjugate was obtained from Chromous Biotech, Bangalore, India.
Mouse anti-histidine monoclonal antibody was obtained from Sigma,
St.Louis, USA. For cell culture and splenocyte proliferation assay, 96-well
flat bottom sterile tissue culture plates and tissue culture flasks from NUNC,
Roskilde, Denmark were used. RPMI, IMDM and fetal calf bovine sera were
obtained from Gibco BRL, USA. For hybridoma HT and HAT were procured
from Invitrogen, USA. Polyethylene glycol (PEG), for fusion was obtained
from Sigma, St.Louis, USA
Live, tissue culture adapted (intermediate strain) IBD vaccine
manufactured by BAIF Laboratories, Pune, India and live intermediate strain
(Georgia) of IBD vaccine manufactured by Indovax, Hissar, India were used
for molecular studies.
2.1.2 Culture Media
Luria Bertani (LB) broth was used for the propagation of DH5
and BL21 (DE3) strains. The LB broth was prepared by dissolving 10 g of
tryptone, 3 g of yeast extract and 5 g of sodium chloride in 1 litre of distilled
water and the pH was adjusted to 7.2–7.4 with 1 N NaOH. In the above
composition, sodium chloride was left for LBON broth (LB omitted sodium
chloride) for GJ1158 strain. To prepare solid medium, 2% agar was added to
the LB or LBON broth. Media was supplemented with 100 µg mL-1
of
ampicillin or 50 mg mL-1
of kanamycin wherever required.
![Page 67: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/67.jpg)
42
2.1.3 Bacterial Strains and Plasmids
DH5 and BL21 (DE3) strains of E. coli were obtained from
Invitrogen, CA, USA. GJ1158 strain of E. coli was obtained from Genei,
Bangalore, India. Genotypes of the E. coli strains that were used in this study
are given in Appendix 1. T7 expression vector pRSET B and DNA vaccine
vector pVAX1 was purchased from Invitrogen, CA, USA. The map and the
restriction sites present in the MCS of pRSET B and pVAX1 are shown in
Appendix 2 and Appendix 3 respectively.
2.1.4 Expression System Used in this Study
The recombinant clones were expressed in pRSET plasmid system
based on T7 RNA polymerase (Studier and Moffat 1986). T7 promoter is
highly specific for T7 RNA Polymerase and the transcription by T7
polymerase is selective and 5 times faster than E. coli RNA polymerase thus
leading to higher expression of genes cloned under T7 promoter. The metal-
binding domain (six-tagged histidine moieties) at the N-terminal end forms a
fusion peptide and has a high affinity for the divalent ions (nickel, copper and
cobalt) and facilitates purification of the protein using immobilized metal
affinity columns (IMAC) (Crowe et al 1995).
The pRSETB vector used for cloning in this study offers
T7 promoter for high-level expression
T7 gene-10 sequence to provide protein stability
N-terminal 6-histidine tag for rapid purification with nickel
resin and detection with an anti-histidine antibody
N-terminal X-press epitope for protein detection with the Anti
X-press antibody
Enterokinase cleavage site for removal of fusion tag.
![Page 68: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/68.jpg)
43
The T7 expression hosts used in this study are BL21 (DE3), BL21
(pLysS) and GJ1158. BL21 strain contains a chromosomal copy of T7 RNA
polymerase gene under the control of lac UV5 (DE3 lysogen) promoter which
can be induced by isopropyl-thio-galactoside (IPTG). T7 RNAP is expressed
upon induction and transcribes the gene of interest, hence expression of genes
under the control of T7 promoter in the plasmid can be induced with the
gratuitous inducer IPTG (Calbiochem, Merck, Germany) at 1 mM final
concentration. Further, BL21 (DE3) being a lon protease deficient strain
protects the expressed heterologous proteins from proteolytic cleavage.
Another genetically engineered strain of BL21 (DE3) was
developed called GJ1158 (Bhandari et al 1997). This strain (GJ1158) carries a
single chromosomally integrated copy of the gene for phage T7 RNA
polymerase under transcriptional control of the cis-regulatory elements of the
osmoresponsive proU operon. Plasmids that have been constructed to obtain
overproduction of individual target gene products in strain BL21 (DE3) (by
addition of IPTG as an inducer) can directly be transformed into GJ1158.
Induction of Pro-U by NaCl drives the transcription of the T7 RNA
polymerase gene, which in turn switches on the expression of the genes under
the control of T7 promoter in the recombinant plasmid.
The NaCl induction regimen was also shown to be associated with
a decreased propensity for sequestration of overexpressed target proteins
within insoluble inclusion bodies The use of NaCl as an inexpensive inducer
in large-scale expression cultures and increased stability makes GJ1158 a very
suitable expression host. BL21 (DE3) host was induced with 1mM IPTG for 3
hours, while GJ1158 host was induced with sterile NaCl to a final
concentration of 0.3M.
In case of BL21(pLysS) strains, the native plasmid contains a
chloramphenicol resistance marker and it produces small amounts of
![Page 69: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/69.jpg)
44
lysozyme which prevents leaky expression of genes under the control of T7
promoter in the uninduced condition and this is especially important in case of
certain toxic proteins.
2.1.5 Primers Used for the Amplification and Cloning of Capsid
Gene Fragment
Two sets of primers flanked with different restriction sites were
used to clone in pRSETB and pVAX vectors. T7 promoter forward and
reverse primers were also used along with the insert specific primers to find
out the orientation of the capsid gene fragment in the recombinant vector,
pRBVP252-417 and to sequence the pRBVP252-417. The sequences of the
primers and the corresponding annealing temperatures used in PCR are given
in Table 2.1.
Table 2.1 Primers Used for Cloning the Capsid Gene Fragment
Primer Sequence (5’ – 3’) Length Annealing
Temperature
pRBVP252-417
(Forward)
GGAAGATCTAGCCTTCTG
ATG CCA ACA ACC GG
32 54oC
pRBVP252-417
(Reverse)
CCCAAGCTTATCTGTCAG
TTCACTCAGGC
29 54oC
pVAXVP252-417
(Forward)
CCCAAGCTTAATATGGTC
CTTCTGATGCCAACAACC
36 54oC
pVAXVP252-417
(Reverse)
CCGGAATTCCTA(ATG)6
TTACCTCCTTATGGCCCG
48 54oC
T7 Promoter
(Forward)
TAATACGACTCACTATAGG 19 54oC
T7 Promoter
(Terminal)
TGCTAGTTATTGCTCAGCGG 20 54oC
![Page 70: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/70.jpg)
45
2.1.6 Animals
One day old specific-antibody negative (SAN) Leghorn chickens
were procured from Poultry Research Centre, Tamilnadu Veterinary and
Animal Science University, Chennai. Six weeks old inbred BALB/c mice and
four months old albino female rabbits were purchased from Kings Institute,
Chennai. Animals were moved to the laboratory on the day of the experiment
and maintained under standard conditions with food and water at the animal
house facilities of Centre for Biotechnology, Anna University, Chennai, India.
Animals were handled in accordance with institutional guidelines, and the
Institutional Animal Ethics Committee (IAEC) approved the use of animals
for this study.
2.1.7 Virus
IBDV - infected bursal samples were obtained from Department of
Microbiology, Madras Veterinary College, Chennai, India. All the procedures
followed were in accordance with the guidelines issued by Department of
Public Health, Government of TamilNadu, India, for dealing with animal
subjects. The Institutional Review Board at the Centre for Biotechnology,
Anna University, Chennai, India also approved the protocols.
2.2 BURSAL PROCESSING
Bursal sample was made into a 50% (W/V) suspension with sterile
PBS and homogenized using mortar and pestle. The bursal suspension was
followed with three cycles of slow freezing and rapid thawing. After
centrifugation at 5000 rpm for 20 min at 4oC, the supernatant fluid was added
with equal volume of ice cold chloroform and then re-centrifuged at
12000 rpm for 20 min at 4oC. The clear aqueous phase was collected and
filtered through a 0.4 µm filter. The filtrate was then treated with ampicillin
![Page 71: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/71.jpg)
46
and kanamycin (amount of antibiotics depended on the volume of the
supernatant) and incubated at 37oC for 1 h. The prepared sample was then
stored at -80oC for infectivity studies.
2.3 IN VIVO TITRATION FOR IBDV CHALLENGE
In order to ensure a constant and reproducible challenge pressure,
chickens were challenged by intra-ocular and anal route. To determine the
amount of virus required for the desired challenge pressure of approximately
90% mortality, a virus stock was prepared and titrated in vivo. SAN chickens
aged 3-4 weeks were challenged with different dilutions of IBDV made in
sterile saline. Mortality was recorded and dead chickens were tested for the
presence of IBDV. IBDV challenge after vaccination was performed
identically.
2.4 EXPERIMENTAL INFECTION IN CHICKENS
Chickens were infected with IBDV infected bursal homogenate by
intraocular or anal route. Control animals were administrated with phosphate
buffer saline. Three days after inoculation, the animals from experimental and
control groups are sacrificed. The target tissues were removed and stored
separately at –80oC for further studies.
2.5 PURIFICATION OF IBDV
IBDV was purified from the homogenate of bursae. The pooled
suspension of homogenised bursae samples were mechanically lysed by three
freeze-thaw cycles and centrifuged at 8000 g for 30 min at 4oC. The
supernatant was collected and ultracentrifuge at 100000 g at 4oC for 1 h. The
supernatant was discarded and the pellet resuspended in 500 µL of NTE
buffer (0.2 M NaCl, 0.02 m Tris-HCl and 0.02 M EDTA, pH 8) supplemented
![Page 72: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/72.jpg)
47
with 1mM phenyl methyl sulfonyl fluoride (PMSF). This suspension was
layered over the top of a 20-60% (w/v) continuous sucrose gradient and
centrifuged at 100000 g for 1 h. After centrifugation, the viral band was
removed with a pipette. The fraction was diluted in NTE buffer and
centrifuged at 100,000 g for 1h. The final pellet was then resuspended in 200
µL of NTE buffer and stored at -80oC.
2.6 PARTIAL PURIFICATION OF IBDV
The pooled bursal samples homogenised in NTE buffer, were
frozen and thawed 3 times and the resultant lysate was centrifuged at 5000 g
for 10 min. The pellet was discarded and the supernatant was filtered through
0.4 µm filter and the filtrate was centrifuged at 8000 g for 10 min. The
resulting supernatant was again centrifuged at 70000 g for 1 h and used as the
partially purified viral sample. All the centrifugation steps were carried out at
4oC.
2.7 PRODUCTION OF ANTISERUM AGAINST WHOLE VIRUS
Purified IBDV was used to produce antibodies in mice. Three
Swiss albino inbred mice were immunized with IBDV by intra-peritoneal
injection once every two weeks over a six-week period. Antigen (20 µg) was
mixed with equal volume of Freund’s complete adjuvant (Sigma, USA) for
the first injection. Subsequent injections were done with 20 µg antigen in
Freund’s incomplete adjuvant (Sigma, USA). Eight days after the final dose,
mice were exsanguinated and antisera collected.
2.8 RECOMBINANT CLONES USED IN THE PRESENT STUDY
A gene fragment between 52-417 base pairs of VP2, the IBDV
structural genes encoding the capsid protein was chosen for cloning into T7
![Page 73: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/73.jpg)
48
expression vector pRSET B and for the mammalian expression vector pVAX.
The pRSET B containing the fragment of VP2 gene for expressing the
recombinant protein is designated as pRBVP252-417. Similarly DNA vaccine
construct encoding the VP2 fragment is designated as pVAXVP252-417.
2.9 BIO-INFORMATIC ANALYSIS OF CAPSID GENE
The antigenic determinants or epitopes present on the partial
fragment of VP2 protein were analyzed using the bioinformatics tools
BcePRED (Saha et al 2004) and IEDB (Peters et al 2005) which utilized the
physiochemical properties of protein like hydrophilicity, flexibility and
surface probability to locate these antigenic determinants.
2.10 CLONING OF VP2 GENE FRAGMENT
Total RNA was extracted from infected bursa according to the
manufacturer protocols as described in common methods. The cDNA was
used for the amplification of 366 bp capsid gene fragment. The amplified 366
bp fragment was cloned into pRSET B, a T7 expression vector in between
Bgl II and Hind III site. The restricted vector and the PCR product were
ligated using T4 DNA Ligase. The recombinant product (named as
pRBVP252-417) was transformed into DH5 strain of E. coli. The
transformants were screened for the presence of the insert by PCR using insert
specific primers. Plasmid was extracted from the positive transformants and
was double digested using the flanking restriction enzymes (Bgl II and
Hind III) to confirm the insert. The orientation of the insert was analyzed by
PCR using different combinations of T7 primers and insert specific primers
and was further confirmed by nucleotide sequencing. Similarly the amplified
366 bp fragment was cloned into a mammalian expression vector, pVAX in
between Hind III and Eco RI site.
![Page 74: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/74.jpg)
49
2.10.1 Confirming the Orientation of the Insert
The orientation of the capsid gene insert in the recombinant
plasmid, pRBVP252-417 was analyzed by PCR using different combinations of
T7 primers and insert specific primers. The sizes of the PCR products
obtained were compared with pRSET B map to find out the orientation of the
insert and it was further confirmed by sequencing the pRBVP252-417 using T7
forward and terminal primers according to the procedure recommended by
Applied Biosystems (ABI PRISM) in Microsynth, Balgach, Switzerland. The
pVAXVP252-417 was also sequenced for orientation confirmation. The
nucleotide sequence of the 366 bp was deposited into GenBank under the
accession no. FJ848772.
2.10.2 Sequence Analysis
The nucleotide sequence of 366 bp and its deduced
amino acid sequence were analyzed by BLAST (Altschul et al 1990), which is
available on the worldwide website of NCBI, MD, USA
(http://www.ncbi.nlm.nih.gov/BLAST). The percentage homology of the 366
bp and its deduced amino acid sequence with the other isolates of IBDV was
calculated.
2.11 EXPRESSION OF THE RECOMBINANT PROTEIN
Briefly the following protocol was used for expression of the
recombinant protein (LBON was supplemented with 100 µg/mL of
ampicillin).
i. E. coli strain of GJ1158 was transformed with pRBVP252-417
construct.
![Page 75: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/75.jpg)
50
ii. A single colony of fresh transformant was inoculated into
3 mL LBON and grown overnight at 37oC in water bath
shaker.
iii. 200 µL of the overnight culture was inoculated into 200 mL
LBON in 1000 mL conical flask and grown at 37oC with
150 rpm shaking, till OD600 of the culture reached 0.6.
iv. NaCl was added to a final concentration of 0.3 M and the
culture was grown for 3 h at 37oC with 150 rpm shaking.
The culture was centrifuged at 10000 g for 5 min. The supernatant
was discarded and the bacterial pellet containing the recombinant protein was
stored at -20oC until further use.
2.12 PURIFICATION OF RECOMBINANT PROTEINS USING
IMMOBILIZED METAL AFFINITY CHROMATOGRAPHY
(IMAC)
Each recombinant protein was expressed with 6 histidine residues
as an N-terminal fusion peptide. The metal binding domain in the fusion
peptide allows simple one step purification of recombinant protein by IMAC.
The recombinant proteins was expressed as inclusion bodies, hence the
proteins were purified under denaturing conditions (8 M urea).
Briefly the following protocol was adopted for purification:
i. Cells were harvested by centrifugation at 10,000 g after
induction with NaCl for 3 h.
ii. The cell pellet was solubilised with binding buffer (0.1M
Phosphate buffer pH 8.0, 0.01 M Tris pH 7.5 and 8 M urea)
overnight at 4oC on a rocker.
![Page 76: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/76.jpg)
51
iii. The column was equilibrated with 3 column volumes binding
buffer (pH 8.0). Samples were applied to the column (5 mg
protein /ml of Ni-NTA column), allowed to bind to the NiCl2
charged Ni-NTA column (Pharmacia, USA).
iv. Column was washed with solubilisation buffer (pH 7.5),
followed by elution with increasing concentrations of
imidazole (10-150 mM) to remove all contaminating proteins.
v. The protein was eluted at 500 mM imidazole concentration.
The purity of the protein was checked on SDS-PAGE. After
purification the sample was dialysed against 0.1X PBS and
then concentrated by vacuum concentrator. The concentration
of each purified recombinant protein was estimated by Lowry
method and stored at –80oC in aliquots till further use.
2.13 LARGE-SCALE PRODUCTION OF THE DNA VACCINES
The recombinant E. coli containing the DNA vaccine plasmid
pVAXVP252-417 was grown in LB broth media supplemented with 50 µg/mL
of kanamycin. A single colony of the recombinant E. coli was grown in 50 mL
at 37oC with shaking for 8 h. This growing culture was used to inoculate the
2.5 liters medium. The cells were grown at 37°C for 12–16 h with vigorous
shaking for 16 h.
Subsequently, cells were harvested and used for extraction of the
plasmid using QIAGEN EndoFree plasmid purification Giga kit as per
manufacturers’ instructions. Briefly the following protocol was used for large-
scale isolation of plasmid DNA as per the instructions manual (QIAGEN,
Germany).
![Page 77: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/77.jpg)
52
i. Harvesting of bacteria: E.coli cells from 2.5 litre culture were
pelleted by centrifugation at 6000 g for 15 min at 4°C. All the
media was removed carefully.
ii. Cell resuspension: 125 mL of Buffer P1 (50 mM Tris·Cl,
10 mM EDTA, 100 g/mL RNase A) was added to the pellet
and resuspended until the suspension was homogeneous and
no cell clumps were visible.
iii. Cell lysis: The bacterial cells were lysed by adding 125 mL of
Buffer P2 (200 mM NaOH, 1% SDS (w/v)). The solution was
mixed gently but thoroughly until a homogeneous lysate was
obtained and incubated at 25oC for 5 min.
iv. Neutralisation: The above lysis mix was neutralised by adding
125 mL chilled Buffer P3 (3.0 M potassium acetate), mixed
gently but thoroughly until white, fluffy material was formed
and the lysate was no longer viscous.
v. Filtration: This lysate was poured into the QIAfilter
Mega-Giga Cartridge and incubated at 25oC for 10 min and
filtered by vacuum pump. 50 mL of Buffer FWB2 (1 M
potassium acetate) was loaded to the QIAfilter Cartridge and
gently stirred and filtered again.
vi. Endotoxin removal: QIAGEN Endotoxin Removal Buffer was
added to the filtered lysate, mixed by inverting the bottle
approximately 10 times, and incubated on ice for 30 min to
remove endotoxin.
vii. Equilibration: QIAGEN-tip 10,000 was equilibrated by
applying Buffer QBT (750 mM NaCl; 50 mM MOPS, 15%
isopropanol 0.15% Triton X-100) and column was allowed to
empty by gravity flow.
![Page 78: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/78.jpg)
53
viii. Loading the lysate: The incubated filtrate obtained from step 6
was poured over the resin and allowed to enter the resin by
gravity flow.
ix. Wash: QIAGEN-tip was washed with a total of 600 mL Buffer
QC (1.0 M NaCl, 50 mM MOPS, 15% isopropanol).
x. Plasmid elution: Plasmid DNA was eluted with 100 mL Buffer
QN (1.25 M NaCl, 50 mM Tris·Cl, 15% isopropanol).
xi. Plasmid precipitation: DNA was precipitated by adding 70
mL (0.7 volumes) at 25oC isopropanol to the eluted DNA,
mixed and centrifuged immediately at 15000 g for 30 min at
4°C. Supernatant was carefully decanted.
xii. Washing precipitate: The precipitated DNA was washed with
10 mL of endotoxin-free 70% ethanol to remove the salt
contamination and centrifuged at 15,000 g for 10 min.
Supernatant was carefully decanted without disturbing the
pellet. The pellet was air-dried for 20 min. The dried pellet
was resuspended in endotoxin-free buffer TE.
The DNA was checked by restriction digestion and PCR using
gene specific primers for the presence of insert. The concentration and purity
of DNA was assessed by checking the ratio of absorption at 260 and 280 nm.
The plasmid DNA was stored in -20o
C till the vaccination study.
2.14 TRANSIENT TRANSFECTION OF CHINESE HAMSTER
OVARY (CHO) CELL LINE BY DNA VACCINE
CONSTRUCTS
The CHO cell line cryopreserved and maintained by the Tissue
Culture Laboratory, Centre for Biotechnology, Anna University, was used for
![Page 79: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/79.jpg)
54
the transient transfection of DNA vaccine constructs (pVAXVP252-417) to
check for expression. CHO cells were transiently transfected using
Lipofectamine reagent (GibcoBRL/Life Technologies, Gaithersberg, MD) as
described by the manufacturer.
i. In a six-well or 35 mm tissue culture plate, ~ 2x 105 cells
were seeded per well in 2 mL of DMEM medium containing
10% FBS and supplemented with 50 µg/mL gentamicin.
ii. The cells were incubated at 37oC in a CO2 incubator until
they were 70-80% confluent. This usually took around 18-24
h.
iii. The following solutions were prepared in sterile 2 mL
eppendorfs.
iv. Solution A: For each transfection, 2 µg DNA (plasmid)
was diluted in 375 µL serum-free DMEM medium without
gentamicin Solution B: For each transfection, 12 µL
LIPOFECTAMINE reagent was diluted in 375 µL serum-
free medium.
v. The above two solutions were mixed gently and incubated at
25oC for 15-45 min.
vi. The cells were washed once with 2 mL serum-free medium.
vii. For each transfection, 750 µL serum-free medium was added
to each tube containing the lipid-DNA complexes, mixed
gently and overlaid on the washed cells.
viii. The cells were incubated for 6 h at 37oC in a CO2 incubator.
ix. 1.5 mL medium with 20% FBS was added after removing
the transfection mixture.
![Page 80: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/80.jpg)
55
x. Medium was replaced every 18-24 h following start of
transfection.
xi. The cell extracts were assayed for gene expression by
RT-PCR, 48 h after the start of transfection.
The transfected cells were harvested after 48 h time point. Total
RNA and protein was extracted from cells by using TRIzol and the RNA was
converted into cDNA using MMLV Reverse Transcriptase (Genei, Bangalore)
by standard protocols. The cDNA was checked for the presence of message
level of each gene in the transfected CHO cell by doing PCR with gene
specific forward and reverse primers. The protein was subjected to western
blot analysis with anti-IBDV and anti-VP252-417 antibodies.
2.15 GENERAL MOLECULAR BIOLOGY TECHNIQUES
Molecular biology methods such as plasmid DNA preparation,
agarose gel electrophoresis and SDS-PAGE, transformation, PCR, RT-PCR
and western blotting used in this study are described in the following pages.
2.15.1 Reverse Transcription and Polymerase Chain Reaction
(RT-PCR)
2.15.1.1 RNA extraction
Isolation of RNA was carried out with adequate precautions to
eliminate RNase activity. All glasswares and plasticwares were treated with
DEPC (diethyl pyrocarbonate), which inactivates RNase by covalent
modification. All the glasswares, plasticwares and solutions were autoclaved
at 121oC for 20 mins and baked at 80
oC for three hours. Gloves were used for
performing all the experiments. RNA was isolated by using TRIzol Reagent
as per manufacturer’s protocol. Briefly,
![Page 81: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/81.jpg)
56
i. The media was removed from the culture plate wells and cells
were washed with 1 mL of PBS.
ii. To each well of 6 well culture plate, 1 mL of TRIzol reagent
was added. Cell lysate was incubated for 5 min at room
temperature. For bursal samples, 50 mg of bursal tissue was
homogenised in 1 mL TRIzol with a glass homogeniser. All
the centrifugation steps mentioned here were carried out at
12000 g.
iii. 200 µL of chloroform was added to this and kept at 4oC for 20
min. The content was centrifuged at 4oC for 20 min.
iv. The RNA in the aqueous phase was precipitated by 0.7
volume of isopropanol for 30 min at -20oC and centrifuged for
30 min at 4oC.
v. The pellet was washed with 0.5 mL of 70% ethanol and it was
dried till the ethanol evaporates.
vi. The dried pellet was resuspended in 10 µL of DEPC treated
H2O.
vii. The concentration was estimated by taking the absorbance at
260 nm.
2.15.1.2 Reverse transcription reaction
Reverse transcription reaction was carried out as follows: Synthetic
oligonucleotides (Synergy Scientific, Switzerland) corresponding to the 5’ and
3’ conserved ends of the VP252-417 were used for cDNA synthesis. dsRNA was
boiled for 5 min and immediately transferred to ice, 40 pmol of each primer
was added and incubated at 25°C for 15 min. The reverse transcription was
performed at 42°C for 60 min using 200 units of Murine Malonyl Reverse
Transcriptase (MMLV-RT) lacking RNase-H activity (New England Biolab);
![Page 82: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/82.jpg)
57
40 units of RNAsine, and 10 mM dNTPs in a 20 µL reaction. The reverse
transcriptase was inactivated by heating the reaction for 5 min at 95°C. The
cDNA synthesized was further used for PCR.
2.15.1.3 Polymerase chain reaction of cDNA
For PCR reaction, 10 µL of cDNA mixture prepared as described
earlier was added to a PCR reaction mixture consisting of 5 units of Taq
polymerase (New England Biolabs, Ipswich, US), 10 µL of 10X Taq Buffer,
and 25 pmol of each primers and 10 µL 2.0 mM dNTPs in a final volume of
100 µL. The reaction mixture was placed in a PCR thermal cycler for cyclic
reactions. The PCR reaction was set up as per the nature of primer (Table 2.1)
and size of amplified product. The PCR products were run on 1.2% agarose
gels stained with ethidium bromide and photographed by gel documentation
system.
PCR conditions used for amplification:
Step 1 - Initial denaturation: 95°C, 5 min
Step 2 - Denaturation : 95°C, 1 min
Step 3 - Annealing: 54°C, 1 min
Step 4 - Extension: 72°C, 1 min
Step 5 - Cycling from step 2 to 4 for 30 more times.
Step 6 - Final extension: 72°C, 10 min
Step 7 - End
2.15.2 Agarose Gel Electrophoresis
Horizontal submerged gels were used to separate the DNA
fragments (Sambrook et al 1989). 0.5X Tris-Borate EDTA buffer of pH 8.3
![Page 83: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/83.jpg)
58
(44.5 mM Tris, 44.5 mM Boric acid and 1 mM EDTA) was used. The
electrophoresis was performed at constant 100 volts at room temperature. The
gel loading buffer contained 0.2% Orange-G in 50% glycerol and TBE.
1% agarose gels were employed for checking plasmids and their
restriction digestion products, whereas for checking the PCR product 1.2%
gels were used. Gels were stained with 0.5 µg/mL of ethidium bromide,
viewed under UV transilluminator (Fotodyne, Hartland, WI, USA). 100 bp
ladder and 1Kb ladder (Fermentas, MD, USA) were used as molecular weight
markers. Photographs were taken with gel documentation unit, (Bio-Rad, CA,
USA) using UV light filter to visualise ethidium bromide stained bands.
2.15.3 Purification of DNA from Agarose Gel
Amplified gene products from various geographical locations were
gel purified individually using Qiaquick gel extraction kit (Qiagen, Hilden,
Germany) as described below:
i. The expected amplified gene product was excised using a
sterile scalpel blade from the agarose gel.
ii. Binding buffer, thrice the weight of the excised gel piece, was
added and incubated at 50°C until the gel melts completely.
iii. Equal volume of isopropanol of the gel weight was added and
mixed well.
iv. The contents were then transferred to the column and
centrifuged at 13000 rpm for 1 min and the filtrate was
discarded.
v. Column was washed with the wash buffer in the ratio 1:4
(wash buffer : ethanol) and centrifuged at 13000 rpm for
1 min and the filtrate was discarded.
![Page 84: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/84.jpg)
59
vi. The empty column was centrifuged again at 13000 rpm for
1 min to remove the excess alcohol.
vii. The column was then placed in a new collecting tube and
30 L of sterile water was added and incubated for 1 min and
centrifuged at
viii. 13000 rpm for 1 min.
ix. The filtrate containing the purified PCR gene product was
analyzed in 1.2% agarose gel and quantified.
2.15.4 Restriction Digestion
The restriction digestions were performed using enzymes from
New England Biolabs, USA, and in the manufacturer-recommended buffers.
i. Restriction enzyme digestions were carried out as follows:
DNA (3-4 µg) 2 µL
Buffer (10 X) 2 µL
Enzyme (2-3 units/ g of DNA) 1 µL
BSA (10 X) 2 µL
ii. Total volume was made upto 20 L with triple distilled water
and incubated for 3–4 h at 37°C.
iii. The completion of digestion was monitored by agarose gel
(1%) electrophoresis.
iv. When double digestions were performed, the most appropriate
buffer as recommended by the manufacturer was used.
Simultaneously the efficiency of each enzyme was verified
separately in the selected buffer using control DNA. For
![Page 85: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/85.jpg)
60
cloning pRBVP252-417 restriction enzyme Bgl II and Hind III
were used, while cloning pVAXVP252-417 restriction enzyme
Hind III and Eco RI were used.
2.15.5 Ligation
Ligation of digested vector and insert DNA was performed as
follows. The ligation mixture consisted of
10X Ligation buffer 2 µL
Vector (~50 ng) 2 µL
Insert (20-50 ng) 6 µL
T4 DNA ligase (10 Weiss units) 1 µL
The total reaction volume was made up to 20 L with distilled
water and ligation was performed for 16 h at 16°C and after completion stored
at -20°C till use. The ligation mixture was transformed into E. coli host
DH5 . The positive clones were further confirmed by restriction digestion
and lysate PCR using gene-specific primers to check for the presence of
insert.
2.15.6 Screening the Clones by Lysate PCR
For screening the recombinant clones, a small portion of freshly
grown transformant-positive colony was picked using a sterile toothpick and
resuspended in 100 L of 0.1X TE (1 mM Tris and 1 mM EDTA). The cells
were lysed by boiling for 10 min, snap-chilled on ice, centrifuged at 12,000 g
for 10 min and 1 L of the supernatant was used as template for PCR
(Sambrook et al 1989). VP252-417 specific primers were used in lysate PCR. A
direct analysis of the lysate PCR will reveal the possible presence of the gene
![Page 86: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/86.jpg)
61
insert. The clones were selected based upon the insert site and archived for
further analysis.
2.15.7 Plasmid DNA Extraction
i. Plasmid DNA extraction from recombinant E. coli was based
on the method of Birnboim and Doly (1979). All the
centrifugation steps in this procedure were performed in a
microfuge at 12000 g.
ii. A 3 mL overnight grown culture of plasmid bearing E.coli was
centrifuged for 5 min and the supernatant was discarded. The
residual medium was removed by brief centrifugation
followed by aspiration.
iii. The cell pellet was resuspended in 200 µL of TE buffer
(50 mM Tris-HCl, pH 8.0 and 10 mM EDTA) by vigorous
vortexing and incubated at 25oC for 5 min.
iv. RNase was added to a final concentration of 0.5 µg/mL to the
200 µL cell suspension and mixed by pipetting and incubated
at 37oC for 30 min.
v. Freshly prepared 200 µL of alkaline-SDS (1% SDS in 0.2 N
NaOH) was added, the tube was gently inverted 3-4 times and
placed on ice. After 5 min, 200 µL of potassium acetate
solution (3.2 M pH 5.2) was added, mixed by gentle inversion,
and centrifuged for 15 min at 4oC.
vi. The supernatant was carefully transferred into a fresh tube.
The sample was extracted once with equal volume of Tris
buffered phenol: chloroform: isoamyl alcohol (25:24:1) and
once with equal volume of chloroform: isoamyl alcohol
(24:1).
![Page 87: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/87.jpg)
62
vii. The plasmid DNA in the aqueous phase was precipitated by
adding 2.5 volumes of ethanol or equal volume of
isopropanol for 30 min at -20oC and pelleted by centrifugation
for 30 min at 4oC.
viii. The supernatant was discarded and the pellet was washed
using 0.5 mL of 70% ethanol by centrifugation at 4oC for 10
min. The pellet was dried under a light source and
resuspended in 30 µL of double distilled water or TE (10 mM
Tris-Cl, pH 8.0, 1 mM EDTA) and stored at -20oC.
2.15.8 Transformation of E. coli
Transformation of E. coli with plasmid DNA was done by utilizing
CaCl2 for the preparation of competent cells. Briefly the following procedure
was used.
i. A single colony of freshly revived E. coli culture was
inoculated in 3 mL of LB and grown at 37oC overnight.
ii. 100 µL of overnight culture was inoculated into 50 mL LB
medium in conical flask and allowed to grow at 37oC till 0.6
OD600.
iii. Culture was chilled on ice for 30 min and centrifuged at
4500 g for 10 min at 4oC.
iv. The cell pellet was resuspended in 10 mL of 100 mM ice-cold
MgCl2 and incubated on ice for 20 min.
v. Cells were pelleted as in step 3 and the pellet was resuspended
in 25 mL of 100 mM ice-cold CaCl2 and incubated on ice for
30 min.
![Page 88: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/88.jpg)
63
vi. Cells were again pelleted as in step 3 and resuspended in 2 mL
of 100 mM CaCl2. Approximately 10-20 ng of DNA was
added to 100 µL of above cells and further incubated for 30
min on ice.
vii. A heat shock at 42oC was given for 90 seconds and chilled on
ice for 5 min.
viii. To this tube 400 µL of LB medium was added, allowed to
grow for 1 h at 37oC and 100 µL was plated onto LB agar
plates supplemented with appropriate antibiotics.
ix. A positive control plasmid was used in all the experiments to
verify the transformation efficiency. Cells with no DNA
added served as negative controls.
For transformation in E. coli (GJ1158) LB medium without NaCl
was used in all steps.
2.15.9 SDS-Polyacrylamide Gel Electrophoresis
Proteins extracted from recombinant E. coli or tissue samples were
analysed by the method of Laemmli (1970) with minor modifications. The
various buffers used are as follows.
i. Monomer solution: 29.2% acrylamide and 0.8% N, N’-
methylene bis acrylamide in distilled water. The solution was
filtered through whatman filter paper and stored in amber
color bottles at 4oC.
ii. Separating gel buffer: 1.5 M Tris-Cl, pH 8.3
iii. Stacking gel buffer: 1 M Tris-Cl, pH 6.8
![Page 89: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/89.jpg)
64
iv. Electrophoresis buffer: 0.025 M Tris-Cl, 0.192 M glycine,
0.1% SDS, pH 8.3.
v. Ammonium persulphate (APS): 120 mg/mL (12%).
vi. SDS: 10% solution.
vii. Tetramethylethylenediamine (TEMED)
viii. Sample solubilizing buffer (SSB) (5X): 10% SDS, 10% (v/v)
-mercaptoethanol, 50% sucrose, 0.025% bromophenol blue
in stacking gel buffer. 1X SSB was added to the cell pellet
and resuspended with appropriate volume of 1X PBS and
kept in boiling water bath for 10 min.
Depending on the proteins to be separated, 10–15% separating gel
and 5% stacking gels were used. Stacking gel was approximately 1/5 of the
separating gel. Protein estimations were performed (Bradford 1976) and equal
amounts (20-25 µg) of total protein were loaded in each well. Electrophoresis
was performed at room temperature with constant current of 20 mA for
stacking gel and 30 mA for separating gel. Gels were stained with staining
solution (0.25 g of Coomassie Brilliant Blue R-250 in 45% methanol, 10%
acetic acid) overnight and destained with 45% methanol, 10% acetic acid
solution until a clear background was obtained. Photographs were taken with
ChemiImager Gel Documentation system (Bio-Rad, CA, USA).
2.15.10 Western Blotting
After electrophoresis, the SDS–PAGE gel was transferred for
Western blotting as described by Towbin et al (1979). The separating SDS–
PAGE gel and nitrocellulose membrane (NC) (HyBond, Amersham
Pharmacia, U.K) cut to the exact size of separating gel was incubated in
transfer buffer (25 mM Tris, 192 mM glycine, 20% methanol, 0.1% SDS) for
![Page 90: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/90.jpg)
65
10 min. The nylon mask was laid in the apparatus to block the extra area of
transfer. Without trapping air bubbles, the NC was overlaid on the gel and
sandwiched between filter papers and scotch brite pads. Electrophoretic
transfer was carried out at 120 mA for 90 min using Hoefer TE 70 semi-dry
electroblotting apparatus (Amersham Pharmacia Biotech, U.K). After transfer,
the molecular weight marker lane was cut and stained with amido black (100
mg amido black in 45% methanol, 10% acetic acid). The rest of the NC was
stained with Ponceau S (0.2% Ponceau S [Sigma, St Louis, USA] in 0.3%
trichloroacetic acid and 0.3% sulfosalicylic acid) to ensure the transfer of the
proteins. Membrane was washed in PBS and blocked overnight at 4°C with
5% non-fat milk powder in PBS. The NC was washed in wash buffer (PBS
with 0.05% Tween-20) thrice for 5 min, followed by washing in 1X PBS
thrice and then incubated with appropriately diluted primary antibody at room
temperature for 1 h. The membrane was washed again as described above and
was incubated in recommended dilution of secondary antibody conjugated
with alkaline phosphatase for 1 h. After extensive washing, the blot was
incubated in detection buffer (100 mM Tris–Cl, pH 9.5, 100 mM NaCl, 5 mM
MgCl2) for 10 min. The colour development was achieved using 33 L of 5-
bromo-4-chloro-3-indolyl phosphate (50 mg/mL in dimethyl formamide;
USB, Amersham Pharmacia) and 66 L of nitroblue tetrazolium (50 mg/mL
in 70% dimethyl formamide; USB, Amersham Pharmacia) in 10 mL of
detection buffer. The reaction was stopped after 15 min by adding 10 mM
EDTA.
Primary antibodies, mouse monoclonal anti-His (Sigma, St Louis,
USA), diluted at 1:20000 in 1X PBS was used in detecting the expressed
recombinant fusion protein. Various field samples were used at 1:100 dilution
for immunoblot analyses. Mouse, chicken and rabbit anti-VP252-417 were used
in 1:5000 dilution. The secondary antibodies anti-chicken (Chromous
![Page 91: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/91.jpg)
66
Biotech, Bangalore, India), anti-rabbit and anti-mouse (Sigma, St.Louis,
USA) IgG-ALP conjugate were used at 1:1000 dilution.
2.16 IMMUNOLOGICAL STUDIES
2.16.1 Chicken Sera Samples
All serum samples used in this study were obtained from different
chicken farms located at Namakal district of Tamil Nadu. All the procedures
followed were in accordance with the guidelines issued by Department of
Public Health, Government of TamilNadu, India, for dealing with animal
subjects. The Institutional review board at the Center for Biotechnology, Anna
University, India also approved the protocols.
2.16.2 Immunoreactivity with Field Sera
The optimum dilutions for assay reagents were determined by
titration, and the blocking/assay conditions were determined by a series of
comparative trials. VP252-417 and purified IBDV antigens were (100 ng/well)
diluted in coating buffer (0.1M carbonate/bicarbonate, pH 9.6). The antigens
were then coated in 96-well plates (Nunc Maxisorp, Nalge Nunc
International, Denmark) and incubated o/n at 4°C. After washing three times
with PBS-T, the plates were blocked with 5% skimmed milk powder at 37°C
for 1 h. Chicken field sera were diluted in PBS (1:100), added to the wells
(100 L/well) and incubated at 37°C for 1 h. After washing with PBS-T,
chicken anti-IgG alkaline phosphatase conjugate (Sigma, St Louis, USA),
(1:2000 dilution in PBS-T) was added (100 L/well) and incubated for 1 h at
37°C. Plates were washed three times with PBS-T and the substarte pNPP (p-
nitrophenyl phosphate, disodium salt) was added to the wells (Sigma, St
Louis, USA) at 1mg/mL in substrate buffer (NaHCO3 - 0.84 g/L; Na2CO3 -
1.25 g/L; MgCl2 - 0.2 g/L). The absorbance was measured 405 nm after 30
min using a micro plate ELISA reader (BioTek Instruments, Inc., USA).
![Page 92: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/92.jpg)
67
2.16.3 Animals, Immunization and Sera Collection
One day old specific-antibody negative (SAN) Leghorn chickens
were procured from Poultry Research Centre, Tamilnadu Veterinary and
Animal Science University, Chennai and were grouped according to the
experiment requirement. All the experiments were performed in accordance
with ‘Institutional Animal Ethics Committee’ regulations. Their maternal
antibody was determined by ELISA on the day before vaccination. The
chickens that had no detectable anti-IBDV antibody were used as
experimental chickens.
For protein immunization, chickens were injected via
intramuscular route with 50 µg of the rVP252-417 or commercial whole viral
vaccines (IV 95 vaccine strain and Georgia vaccine strain) suspended in 100
µL of Phosphate Buffer Saline (PBS) and mixed with alum at 1:1 ratio. The
control group of chickens received alum alone in 100 µL PBS. Same dose of
booster was given on days 7, 14, and 21. Blood was collected every two
weeks from 0th
day to till 84th
day. The blood was allowed to clot and
centrifuged at 2500 rpm for 10 min. The sera were separated and stored at -
20oC. Similarly for DNA immunization, chickens were injected via
intramuscular route with 100 µg of pVAXVP252-417 was suspended in 100 µL
of water for injection. The control group of chickens received pVAX vector in
100 µL water for injection.
2.16.4 Measurement of Total IgY
Protein specific IgY levels in the chickens sera were determined by
ELISA as described above. 96-well microtiter plates were coated with 100 L
of protein (100 ng/well). After washing and blocking with 5% skimmed milk
powder, a serial two-fold dilution (1:500-128000) of antisera was used.
Antibody titers were assessed as the highest serum dilution giving an
![Page 93: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/93.jpg)
68
absorbance (0.15) higher than that of preimmune sera. The color was
developed using p-nitrophenyl phosphate substrate (1 mg/mL) in substrate
buffer and absorbance was read at 405nm.
2.16.5 Direct Binding Assay
ELISA plates were coated with rVP252-417 protein and incubated o/n
at 4ºC. The plates were washed with PBS-T followed by PBS and blocked in
5% skimmed milk powder as described above. The anti-sera raised against
corresponding IBDV vaccines were diluted in 1% skimmed milk powder
(1:1000) and incubated at 37ºC for 2 h. After washing as described above,
rabbit anti-chicken IgY (1:1000) (Sigma, St Louis, USA) was added and kept
at 37ºC for 1 h, washed and reacted with pNPP (p-nitrophenyl phosphate,
disodium salt) substrate system (Sigma, St Louis, USA). The optical density
of the reaction product was read at 405 nm after 30 min (Tripathi et al 2006).
Alternatively, reactivity of rVP252-417 antisera with different commercial
vaccines was also performed, wherein, ELISA plates were coated with
commercial vaccines and incubated with rVP252-417 antisera at 1:1000
dilution. Binding of rVP252-417 with antisera raised against it was considered
as the reference binding in both the assays.
2.16.6 Splenocyte Proliferation Assay
All the procedures were performed in aseptic conditions under a
laminar hood. The DNA and protein immunized chickens were sacrificed on
day 42 and the spleens were removed aseptically. Splenocytes were separated
and washed twice with fresh culture medium (RPMI 1640). Lysis buffer
(0.1% ammonium chloride) was added to the pellet to remove the RBC’s and
the cell suspensions were overlaid onto Histopaque® 1077 density gradient
medium and centrifuged at 1800 rpm for 20 min at room temperature.
Lymphocytes at the interface were collected and cells were counted by the
![Page 94: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/94.jpg)
69
trypan blue dye exclusion assay. The single cell suspension was cultured in
triplicates in 96 well plates (Nunc, Denmark) at 2 x 105 cells/mL in RPMI
1640 medium (100 µL/well) supplemented with gentamycin ( 80 µg/mL)
(Ranbaxy Laboratories, India), 25 mM HEPES (USB, Amersham Pharmacia,
UK), 2 mM glutamine (USB, Amersham Pharmacia, UK) and 10% fetal
bovine serum. The cells were then stimulated in vitro with different
concentration of antigens (0.1, 1, 5, 10, 50 µg/well), along with Con A
(1µg/well, positive control). Wells with medium alone were used as
unstimulated controls. The plates were incubated for 72 h at 37oC in a CO2
incubator (Forma Scientific Inc., Marietta, USA) with 5% CO2. After 72 h cell
proliferation was measured by MTT assay (Promega, USA). The proliferative
response was expressed as stimulative index. (SI = geometric mean (GM) of
absorbance in experimentally stimulated cells divided by absorbance of
unstimulated cells). All cultures were taken in triplicates and the results
expressed as mean SI ± SEM.
2.16.7 Tissue Distribution
Plasmid DNA (pVAXVP252-417) at a dose of 100 g/ individual was
administered to separate groups of five for DNA distribution analysis at
various time points. At various time points (2, 15, 45 and 60 days) following
the administration of the recombinant plasmid, samples of different organs
and cell types like muscle, spleen, kidney, liver, and bursa cells were
obtained. Around 100 mg of tissues were taken for isolating the DNA as
described below. The DNA from different tissues at different time points were
subjected to PCR amplification with VP252-417 gene specific primers for
studying the distribution
![Page 95: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/95.jpg)
70
2.16.8 DNA Isolation from Different Tissues
A piece of tissue (100 mg) was homogenized with 200 µL low salt
buffer (10mM Tris HCl, pH 7.6; 10mM KCl, 10mM MgCl2 and 2mM EDTA
– TKM1) and transferred to a 1.5 mL eppendorf tube. To this 10µL of Nonidet
P-40 (NP-40, Sigma) was added to lyses the cells and mixed well by inversion
several times. The mixture was then centrifuged at 10000 rpm for 10 min at
room temperature. The supernatant was discarded and pellet was washed with
TKM1 buffer and centrifuged as before. The pellet was resuspended in 200
µL of high salt buffer (10mM Tris HCl, pH 7.6; 10mM KCl, 10mM MgCl2
and 2mM EDTA, 0.4 M NaCl – TKM2). To the mixture 15 µL of 10% SDS
was added. Then mixed the whole suspension thoroughly by pipetting back
and forth several times, and incubated for 10 min at 55oC, after which 125 µL
of 5mM NaCl was added and mixed well. Then the mixture was centrifuged
at 12000 rpm for 5 min and the supernatant containing DNA was collected.
The DNA was recovered by ethanol precipitation and dried. The dried DNA
was resuspended in 20 µL TE buffer.
2.16.9 RT-PCR for Expression of the DNA Vaccines in Immunized
Chicken Muscle
100 mg of chicken muscle tissue was taken and treated with Trizol
reagent (Invitrogen, USA).Total RNA (from muscle tissue on days 2, 15, 45
and 60 days after vaccination) isolated was converted to cDNA by reverse
transcriptase enzyme by using Retroscript kit as per the manufacturer
instructions (ProtoScript, New England Biolabs). The contaminating plasmid
DNA was removed by treatment with DNAse I, amplification grade
(Boehringer Mannheim), according to the manufacturer protocol. The cDNA
(1 g) was amplified for 35 cycles at 94°C for 60 seconds, 54°C for
60 seconds and 72°C for 1 minute, using the primer pairs for the genes
encoding VP252-417. The products were visualized by electrophoresis on 1.2%
agarose gels containing ethidium bromide.
![Page 96: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/96.jpg)
71
2.17 IMMUNOPROPHYLACTIC STUDIES
2.17.1 Animals for Protection Study and Immunization
One day old specific-antibody negative (SAN) Leghorn chickens
were procured from Poultry Research Centre, Tamilnadu Veterinary and
Animal Science University, Chennai and were grouped so that each group
consisted of 20 chickens. All the experiments were performed in accordance
with ‘Institutional Animal Ethics Committee’ regulations. Their maternal
antibody was determined by ELISA on the day before vaccination. The
chickens that had no detectable anti-IBDV antibody were used as
experimental chicks.
The animals were immunized with 50 g of protein in alum or
100 g of DNA suspended in water for injection. Four doses at weekly
intervals were administered intramuscularly. The control group for protein
received PBS alone in alum, while the DNA group control received pVAX
vector in water for injection. Sera collected periodically after immunization
was used to check the antibody titre by ELISA. Chickens were challenged
with 2×104 embryo infective dose (EID50)/mL of standard challenge strain
IBDV (characterized vIBDV strain from TANUVAS, Chennai, India) by the
oral route, observed clinically for 10 days.
Protection against challenge was evaluated by the following
methods:
Three days post-challenge, the presence of viral particles in
the Bursa of Fabricius was tested by AGP.
Chickens were inspected for mortality, bursal gross lesions
and bursa to body weight ratio (bursa/body weight (%)).
![Page 97: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/97.jpg)
72
Reduced bursa to body weight ratio is indicative of bursal
atrophy caused by IBD.
Chickens were weighted and their blood and bursa of Fabricius
were collected at the termination of the study. Bursa of Fabricius were
weighed and the ratio of bursa of Fabricius (BF) and body weight (BW) was
calculated using the formula: (BF weight (in g)/BW (in g))×1000 (Chang et al
2003). Histological examination was performed to confirm the status of
protection. The samples of bursal tissue were taken and fixed in formalin
acetic acid alcohol (FAA) fixative. Bursa of Fabricius were sectioned and
stained with hematoxylin and eosin. Bursal damage measured by
microscopical examination, all sections were randomised and read blind by
two people to reduce bias. The lesions on bursa of Fabricius were scored
using the system developed by Shaw and the protection was defined by the
number of chickens with histopathological BF lesion score 0 and 1
(Shaw and Davison 2000).
2.18 MONOCLONAL ANTIBODY PRODUCTION
2.18.1 Immunization of Mice with rVP252-417 for Hybridoma
Six-eight week old female BALB/c mice were immunized
subcutaneously with 100 µL of emulsion containing 50 g of purified
rVP252-417 protein in PBS emulsified with equal volume of Freund’s complete
adjuvant. The first booster was given 3 weeks later, by subcutaneous route in
incomplete Freund’s adjuvant. The Second booster was given 3 weeks from
the first, and the blood sample was collected 10 days later. Antibody titer was
determined by ELISA. When antibody titre reached approximately greater
than 1/30,000 the mice were rested. After resting for 1 month, 4 days prior to
fusion, the mice were injected intraperitoneally with 200 µg of the antigen in
saline.
![Page 98: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/98.jpg)
73
2.18.2 Preparation of Myeloma Cells and Splenocytes
The cell-line used for fusion was Sp2/0-Ag-14, originally derived
from a fusion between spleen cells from BALB/c mice with X63-Ag8. Sp2/0
myeloma cells were maintained in IMDM supplemented with 36 mM sodium
bicarbonate, penicillin (100 U mL-1
), streptomycin (100 µg mL-1
), gentamycin
(50 µg mL-1
), nystatin (5 U mL-1
), 10 % (v v-1
) FBS and -mercaptoethanol
(5 10-5
M). Prior to fusion with splenocytes, Sp2/0 cells in the log phase
were harvested, pelleted down by centrifugation at 1500 rpm at 4oC and
washed twice with IMDM to remove serum. After excision of spleen from the
immunized mice under aseptic conditions, the splenocytes were recovered
using needle and piston assembly, washed twice and resuspended in 10 mL of
IMDM. An aliquot of the cells suspension was counted. About 80 - 100 106
splenocytes could be recovered from one mouse.
2.18.3 Preparation of Macrophage Feeder Layer
Mice were sacrificed and macrophages collected by flushing the
peritoneal cavity with 10 mL of ice cold IMDM. About 5-7 106
cells could
be obtained from a normal mouse.
2.18.4 Fusion of Cells
A suspension of the SP2/O cells and splenocytes in a 1:5 ratio was
centrifuged to obtain a tight pellet. To the dry pellet, 0.5 mL of the PEG-4000
solution (1 g in 0.8 mL of IMDM and 0.2 mL of DMSO Merck, Rahway, NJ)
was added drop wise over 1 min, with gentle tapping of the tube throughout
the course of addition and exposed to PEG for another 1 min. PEG was
diluted with 5 mL of IMDM (with 20% fetal bovine serum) over 5 min, first 1
mL being added drop wise over one minute. The cells were incubated at
37°C for 20-60 min. After centrifugation, the cell pellet was resuspended
gently in HAT supplemented IMDM.The cells were then aliquoted in 96-well
plates.
![Page 99: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/99.jpg)
74
2.18.5 Cell Viability Test
To determine the number of viable cells in the cell culture, trypan
blue staining was performed just before observing under microscope. One
part of trypan blue solution (0.4% trypan blue in phosphate buffered saline
(PBS) and one part cell suspension was mixed together and applied to a
Heamocytometer chamber. The viable cells have clear cytoplasm whereas the
dead cells have blue cytoplasm. The viable cells present in all four corner
squares were counted (including those that lie on the bottom and left-hand
perimeters but not those that lie on the top and right-hand perimeters). Any
clump present was counted as one cell. The mean number of cells per
0.1 mm3 volumes was calculated and multiplied by 10
4 to obtain the number
of cells/mL (ie. cells/cm3/mL). The dilution factor used for trypan blue (2x)
was applied to obtain the number of cells per mL of culture.
Number of viable cells 100
Viable cells (%) =
Total number of cells (Dead and viable)
2.18.6 Selection of Hybridoma
The HAT selection medium consisted of IMDM supplemented with
20% FBS, hypoxanthine (1 10-4
M), aminopterin (4 10-7
M) and
thymidine (1.6 10-5
M). After resuspending in HAT medium, 0.2 mL
aliquots containing 0.2 106 splenocytes and 3-5 10
3 macrophages were
distributed in the wells of a 96 well micro titer plate. The plates were kept in a
humidified incubator containing 5% CO2 in the air at 37°C. Medium from
individual wells was replaced with fresh medium as above but without
aminopterin after 7 days. The unfused Sp2/0 cells are killed within 72-96 h
during selection in HAT medium. After 10-12 days following fusion,
supernatants from wells containing hybrids that were 50% confluent were
tested for their ability to secrete specific antibody by ELISA using rVP252-417
as antigen.
![Page 100: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/100.jpg)
75
Single cluster clones secreting antibodies specific to rVP252-417 was
selected, expanded and subsequently subcloned to monoclonality by
the method of limiting dilution on feeder cells. Monoclonality was confirmed
by subclass isotyping using mAb isotyping kit II (ImmunoPure, PIERCE).
2.18.7 Analysis of Serum Samples and Monoclones by rVP252-417
Antigen Based ELISA
The ELISA method for the detection of antibodies to rVP252-417 was
standardized in the laboratory.
i. The rVP252-417 antigen (1 µg well-1
) in PBS, pH 7.2, was
placed in the wells of a polystyrene plate for overnight
incubation followed by blocking of the unoccupied sites
with a 1% solution of gelatin in PBS. Followed by
incubation with monoclonal or polyclonal antibodies for 2 h.
ii. The unbound antibodies were removed by three washes (3
min each) with PBS containing 0.1% Tween (PBST)
followed by three washes with PBS.
iii. This was followed by incubation for 1 h with goat anti-
mouse IgG conjugated to alkaline phosphatase (ALP) at the
dilution of 1:2,000 in PBS containing 0.2% of BSA (RIA
buffer).
iv. After washing with PBST and PBS, the immunoreactivity of
the MAbs was visualized by addition of the substrate pNPP
(p-nitrophenyl phosphate, disodium salt) to the wells
(Sigma, St Louis, USA) at 1mg/mL in substrate buffer
(NaHCO3 - 0.84 g/L; Na2CO3 - 1.25 g/L; MgCl2 - 0.2 g/L).
The absorbance was measured at 405 nm after 30 min using
![Page 101: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/101.jpg)
76
a micro plate ELISA reader (BioTek Instruments, Inc.,
USA).
v. For the serum antibodies in positive and control group was
based on the titer criteria, Mean ± 3 SD. The cutoff for a
positive response was considered when the ELISA OD value
was at least 3 times higher than the mean control value.
2.18.8 Expansion of Secretor Clones
Antibody secreting clones were expanded by transferring them
from 0.2 mL culture wells to 1 mL culture wells of 24 well culture plates in
the presence of 3-5 103 macrophages. During subsequent subcloning or
expansion, the cells were weaned off HT medium, by replacement with
serially diluted concentrations of HT (hypoxanthine and thymidine). Before
transferring to plastic culture flasks (25 cm3), cells with more than 75%
confluency in the 1 mL wells were confirmed for stable antibody secretion, by
ELISA.
2.18.9 Cloning under Limited Dilution (Subcloning)
Subcloning was carried out after cell-lines were well established.
The cells in the log phase of growth were diluted ten-fold so as to obtain one
cell in 0.2 mL of IMDM containing 20% FBS and 3-5 103
macrophages.
Three to four days after plating in the 96 culture plate, wells were examined
microscopically to determine the number of clones in the well. Wells
containing single hybridoma were replenished with 0.2 mL of fresh medium
and when the clones reached 50% confluency, the supernatants were assayed
for the presence of antibody. Antibody producing clones (monoclonals) were
expanded as described above.
![Page 102: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/102.jpg)
77
2.18.10 Subclass Isotyping of Monoclonal Antibodies
Subclass isotyping was done with Rapidot Kit (mouse
Immunoglobulin isotyping) Department of Aquaculture, College of Fisheries,
Mangalore, India to check the isotypes of all five monoclonal antibodies.
2.18.11 Maintenance of Cell-Lines
Hybridoma cell lines were maintained in IMDM, supplemented
with 36 mM sodium bicarbonate, penicillin (100 U mL-1
), streptomycin
(100 µg mL-1
), gentamycin (50 µg mL-1
), nystatin (5 U mL-1
), 8-10% (v v-1
)
FBS and -mercaptoethanol (5 10-5
M). All the cultures were grown at
37 °C incubator with 5% CO2.
2.18.12 Cryopreservation of Cells
Myeloma, hybridoma cells were stored frozen (in liquid nitrogen)
at various stages during the course of the experiment, so as to be able to
revive them when required. The composition of freezing mixture includes
50% IMDM/DMEM, 40% FBS and 10% DMSO. For freezing, cells in the log
phase of the growth were centrifuged and the cell pellet was re-suspended in
the chilled freezing mixture by drop wise addition and transferred to –80°C in
the freezing vials and subsequently to liquid nitrogen. For reviving the cells,
the vials were removed from liquid nitrogen and warmed rapidly to
37°C. Freezing mixture was removed by centrifugation and the cells were
transferred to culture flasks containing 5 mL culture medium.
2.18.13 Affinity Measurement of Monoclonal Antibodies
The affinity of antibodies raised against rVP252-417 was measured by
estimating the disassociation constant (Kd). For the measurement of the Kd in
solution, the method of Friguet et al. (1985) was used.
![Page 103: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/103.jpg)
78
i. The rVP252-417 antigen (1 µg well-1
) in PBS, pH 7.2, was
placed in the wells of a polystyrene plate for overnight
incubation followed by blocking of the unoccupied sites with
a 5% solution of non-fat milk in PBS.
ii. The monoclonal antibodies were incubated with gradient of
rVP252-417 antigen concentration for 16 h at 25°C so as to
attain antigen-antibody equilibrium. The starting
concentration of inhibiting antigen was 50µg mL-1
and was
carried out at twofold serial dilutions.
iii. These complexes were transferred onto the wells of the
microtitre plates previously coated with the respective antigen
and blocked and were incubated for 2 h at 37°C.
iv. After three washes with PBS containing 0.1% Tween (PBST)
followed by three washes with PBS, goat anti-mouse IgG
conjugated to alkaline phosphatase (ALP) at the dilution of
1:2000 in PBS containing 0.2% of BSA was added and
incubated for 1 h at 37 °C.
v. After washing with PBST and PBS, the immunoreactivity of
the MAbs was visualized by addition of the substrate pNPP
(p-nitrophenyl phosphate, disodium salt) to the wells (Sigma,
St Louis, USA) at 1mg/mL in substrate buffer (NaHCO3 - 0.84
g/L; Na2CO3 - 1.25 g/L; MgCl2 - 0.2 g/L). The absorbance was
measured at 405 nm after 30 min using a micro plate ELISA
reader (BioTek Instruments, Inc., USA).
vi. Dissociation constant (Kd) was calculated using the following
equation derived from Scatchard and Klotz (Friguet et al
1985):
0 D
0 0
A K1
A A a
![Page 104: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/104.jpg)
79
Wherein A0 and A: absorbance measured for antibody in
absence and presence of antigen respectively; KD:
disassociation constant; a0: total antigen concentration.
2.18.14 Avidity Measurement of Monoclonal Antibodies
The ELISA for monoclonal antibodies reactivity with rVP252-417 and
purified IBDV antigen were performed as previously. The protocol followed
in the present assay has been previously described by Binley et al (1997) and
used with modification.
i. The 1 µg well-1
of rVP252-417 antigen and 2 µg well-1
of
purified IBDV antigen in PBS, pH 7.2, was placed in the wells
of a polystyrene plate for overnight incubation followed by
blocking of the unoccupied sites with a 5% non-fat milk
solution in PBS. This was followed by incubation wit
two fold dilution of monoclonal or polyclonal antibodies in
PBS containing 0.5% non-fat milk for 1 h.
ii. For avidity measurement, plate was divided in such a way that
rows A, B, and C are coated with antigen (PBS wash) and
rows F, G, and H are coated with antigen for avidity (8M Urea
treatment) rows D and E are blank.
iii. For avidity, each plate was washed three times, 5 min each,
with 200 mL well-1
as follows:
a. Rows A, B, and C with PBS
b. Rows D, E, and F with 8 M urea in PBS
iv. This was followed by incubation for 1 h with goat anti-mouse
Ig conjugated to alkaline phosphatase (ALP) at the dilution of
![Page 105: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/105.jpg)
80
1:2,000 in PBS containing 0.5% of non-fat milk solution in
PBS.
v. The unbound antibodies were removed by three washes (3 min
each) with PBS containing 0.1% Tween (PBST) followed by
three washes with PBS.
vi. The immunoreactivity of the MAbs was visualized by addition
of the substrate pNPP (p-nitrophenyl phosphate, disodium salt)
to the wells (Sigma, St Louis, USA) at 1mg/ml in substrate
buffer (NaHCO3 - 0.84 g/L; Na2CO3 - 1.25 g/L; MgCl2 - 0.2
g/L). The absorbance was measured at 405 nm after 30 min
using a micro plate ELISA reader (BioTek Instruments, Inc.,
USA).
Data presentation: Midpoint titers are defined as the antibody
dilutions giving half-maximal binding (after background subtraction). The
avidity index is defined here as (A/B 100%), where A is the absorbance
value with urea treatment and B is the absorbance value without urea
treatment at a given dilution/concentration of antibody. The value of B in
every avidity index calculation was derived from titration curves, where the
absorbance value A was then read at the same antibody dilution, correcting for
background for both values. Avidity indices calculated are the average of two
replicates. Antibodies with avidity indices of < 30% are designated low-
avidity antibodies, those with values of 30-50% are designated intermediate-
avidity antibodies, and those with values > 50% are designated high-avidity
antibodies.
When a urea wash was used in ELISAs, we define the binding
property of monoclonal or polyclonal antibodies as its avidity, although it
should be noted that monoclonal antibodies, owing to their clonal nature,
![Page 106: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/106.jpg)
81
cannot have avidity per se. We use this term here to conveniently distinguish
binding observed after a urea wash step from that without the urea wash.
2.18.15 Production of Polyclonal Antibody against rVP252-417
Laboratory bred rabbits were immunized with the purified
recombinant protein rVP252-417 to produce polyclonal antibodies, as per
protocol described (Harlow et al 1988).
Briefly, the rabbit was immunized subcutaneously with 250 µg of
purified rVP252-417 protein emulsified in Freund’s complete adjuvant, followed
by administration of 125 µg of the antigen in Freund’s incomplete adjuvant.
Animals were pre-bled before immunization to be used as control. Serum
samples were collected 2 weeks after the final immunization and tested for
immunoreactivity against the rVP252-417 antigen by Western blotting and the
antibody titers by ELISA. The antibody titre in immunized animals was
estimated by serial dilution and compared with control or pre immune serum.
The criteria for serum titre were Mean ± 3 SD against the control. The cutoff
for a positive response was fixed atleast 3 times higher than the mean control
value.
2.18.16 Purification of Monoclonal Antibody
Culture supernatants of murine mAb IgG2b (3A11A2 + 1C7F12)
were equilibrated against 50 mM glycine-NaOH buffer, pH 8.5 containing 2M
NaCl and loaded onto a protein A-Sepharose column (Amersham, USA).
After washing, the bound mAbs were eluted with 0.1M glycine-HCl, pH 3.0,
and neutralized with 1 M Tris-HCl, pH 8.0.
![Page 107: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/107.jpg)
82
2.18.17 Enrichment of mAbs and Polyclonal Antibodies
Monoclonal and polyclonal antibodies raised against rVP252-417
were precipitated with 50% and rinsed twice with 40% ammonium sulphate to
remove albumin fraction. Concentrated antibodies were dissolved and
dialyzed against 50 mM PBS and estimated.
2.18.18 Standardization of IBDV Antigen Capture ELISA
Sandwich ELISA was standardized for antigen detection with
monoclonal and polyclonal antibodies in combination as capture antibody and
detection antibody to detect antigens. The methods previously described by
Rao et al (2000) and Lalitha et al (2002) and used with modification.
i. Flat bottom 96-well microtitre plates (Immunolon 4,
Dynatech Laboratories, Inc., Alexandria, VA) were coated
with 1µg/well of anti- rVP252-417 MAb (500 ng of 3A11A2
and 1C7F12) diluted in 50 mM PBS pH 7.2 and kept
overnight at 4°C.
ii. The plates were washed in phosphate buffered saline (PBS)
containing 0.05% Tween 20 (Sigma) and blocked with
blocking buffer, PBS containing 5% skimmed milk for
two h at 37°C.
iii. After six washes, rVP252-417 or purified IBDV sample was
mixed with equal volumes of glycine (0.15 M; pH 2.0/Tris
(0.1 M; pH 9.0) and added to the wells in duplicates and the
plates were incubated at 37°C for 2 h.
iv. The plates were washed as before and incubated with either
rabbit anti- IBDV antibody or rabbit anti-rVP252-417 (dilution
of 1:2000) at 37°C for 1 h. After washing the plate, goat anti
rabbit IgG ALP conjugate was added and incubated at 37°C
for 1 h.
![Page 108: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/108.jpg)
83
v. The capturing activity of the MAbs was visualised by
addition of the substrate pNPP (p-nitrophenyl phosphate,
disodium salt) to the wells (Sigma, St Louis, USA) at
1mg/mL in substrate buffer (NaHCO3 - 0.84 g/L; Na2CO3 -
1.25 g/L; MgCl2 - 0.2 g/L). The absorbance was measured at
405 nm after 30 min using a micro plate ELISA reader
(BioTek Instruments, Inc., USA).
2.19 DEVELOPMENT OF RAPID DIPSTICK DIAGNOSTIC
ASSAY FOR DETECTION
Prototype of dipstick device was developed and assayed as
described below:
i. Briefly, the prototype contains a test line of capture rabbit
anti-rVP252-417 polyclonal and a control line with goat-anti
mouse IgG on nitro cellulose membrane.
ii. The sample adsorbent pad contains detection reagent with
colloidal gold conjugated monoclonal anti-rVP252-417
antibody (3A11A2).
iii. The processed infected bursal sample will be drawn in the
adsorbent pad and any native antigen present will bind with
the colloidal gold conjugated monoclonal and will be carried
further across the test and control line.
iv. The indication of positive reaction will be seen as two
magenta coloured lines in test and control regions
respectively.
v. The negative reaction will be represented as a single magenta
coloured line in the control region.
![Page 109: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/109.jpg)
84
2.19.1 Preparation of Colloidal Gold
Gold chloride (AuCl4) was procured from Amresco, OH, USA.
Colloidal gold with an average diameter of 25-30 nm (validated by electron
microscopy, Amresco) was prepared by controlled reduction of a boiling
solution of 0.02 % chloroauric acid with 1 % sodium citrate according to the
method of Frens (1973).
The solution was stored in refrigeration 4°C away from light until
use. Criteria for the colloidal gold solution batch having maxima between
525–530 nm and A1cm 527 nm = 2.0 + 0.05 was used for preparing the
conjugate with antibody (Basker et al 2004).
2.19.2 Preparation of Gold – Antibody Conjugate
i. Added 30 mL of colloidal gold (40nm) with 15 ml of 10mM
sodium phosphate buffer and add 150 µg purified antibody.
ii. Mixed the reaction for 30 mins using magnetic stirrer and
added 5 mL of blocking agent (0.2% Casein, 0.1% Azide in
100 mM Borate pH 7.5).
iii. Mixed again for 30 mins using magnetic stirrer and
centrifuged at 7000 rpm for 30 mins at 4oC.
iv. Collected the pellet and resuspended in 1 mL of blocking
agent
v. The absorbance was measured at 520 nm.
![Page 110: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/110.jpg)
85
2.20 STATISTICAL ANALYSIS
All statistical analyses were done using Graphpad prism software
version 5.0. The difference in two means was compared using non-
parametrical analysis of Student‘s t-test. For multiple comparisons, non-
parametric Kruskal-Wallis test was used along with the Bonferroni's post test.
For T cell proliferation studies two ways ANOVA was used. A probability (p)
value < = 0.05 was considered statistically significant.
![Page 111: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/111.jpg)
86
CHAPTER 3
RESULTS
3.1 CLONING, EXPRESSION, PURIFICATION AND
IMMUNOPROPHYLACTIC EFFICACY OF
RECOMBINANT VP2 FRAGMENT
In order to make a recombinant protein of the immunodominant
region, a 366 bp from the N-terminal end of VP2 protein was amplified based
on the prediction of antigenic determinants using the bioinformatic tools
BcePRED (Saha et al 2004) and IEDB (Peters et al 2005). The amplified
immunodominant region was cloned in to a prokaryotic expression vector,
pRSET B. The authenticity of the clone was checked by PCR using different
combinations of T7 or insert-specific primers and was further confirmed by
nucleotide sequencing. The expression of recombinant VP252-417 was obtained
in BL21 (DE3) and GJ1158 strains of E.coli. The large-scale expression was
optimized in GJ1158 strain of E. coli, since the induction can be achieved
with NaCl. The recombinant VP252-417 expressed as a histidine tagged fusion
protein was purified by gel-elution as well as by IMAC.
The IMAC purified recombinant VP252-417 was assessed for
humoral and cellular immune response. The hyper immune serum raised
against the purified recombinant VP252-417 was used as the positive control in
all the western blotting experiments carried out with the infected and
vaccinated sera. The reactivity of the purified recombinant VP252-417 with the
sera raised against field isolates and commercial vaccine strains confirmed
that the immunodominant N-terminal region is immunoreactive to IBDV and
confers humoral immune response. Further, the rVP252-417 was evaluated as
![Page 112: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/112.jpg)
87
vaccine by viral challenge studies in immunized chickens which confirmed
protection.
3.1.1 Amplification and Analysis of VP252-417 Gene
The antigenic determinants in the amino acid sequence encoded by
the 366 bp region from 52 to 417 bp of VP2 gene was examined by semi-
empirical method and showed the presence of three immunogenic regions
with 20-29 amino acids that could be linear epitopes. The bioinformatics tools
BcePRED (Saha et al 2004) and IEDB (Peters et al 2005) showed a length of
25-29 amino acids that is hydrophilic, surface accessible, flexible and thus
possibly antigenic. The sequences of the antigenic determinants obtained by
both the methods are given in Table 3.1. The 366 bp fragment of VP2 gene
was amplified from the infected bursal samples by RT-PCR (Figure 3.1a).
The specificity of the 366 bp amplicon was tested by digestion with Bsa I and
Bfa I restriction enzymes. The Bsa I digestion released 67 and 299 bp
fragments and Bfa I digestion released 253 and 113 bp fragments
(Figure 3.1b).
3.1.2 Cloning of VP252-417 Gene
The ORFs of the VP252-417 sequence was amplified by PCR using
VP252-417 sequence specific primers with Bgl II and Hind III sites. The PCR
products were purified and digested with Bgl II and Hind III restriction
enzymes. The digested PCR and the predigested vector, pRSET B were
ligated using T4 DNA ligase. To select the recombinants, the ligation mixture
was transformed into DH5 strain of E. coli and selected on LB agar plates
containing ampicillin. Screening for positive clones was carried out by colony
lysate PCR with insert specific primers (Figure 3.1c). The positive
transformants were used for further characterization.
![Page 113: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/113.jpg)
88
Figure 3.1 Amplification and Cloning of VP2 Gene Fragment
10 L of the PCR or restriction digestion products were loaded on 1.2% agarose gel, stained with ethidium bromide (0.5
g/mL) and observed in the gel documentation unit.
(a) RT- PCR amplification of VP2 gene fragment from IBDV infected bursal samples
Lanes: 1 – 100 bp DNA molecular weight marker, 2 – Negative control, 3 and 4- Infected bursal samples. The 366 bp
amplified product is indicated by an arrow on the right side.
(b) Specificity of the RT-PCR product by Restriction enzyme analysis
Lanes: 1 –100 bp DNA molecular weight marker, 2 – Undigested 366 bp PCR product, 3 and 4 – Bsa I and Bfa I digested
366 bp PCR product respectively.
(c) Screening of transformants by colony PCR
The 366 bp insert in the pRBVP252-417 was amplified by PCR using insert specific primers. Lanes: 1- 100 bp DNA molecular
weight marker, 2 to 8 – Positive transformants, 9 – Positive control (cDNA from infected bursa), 10 - Negative control. The
amplified product is indicated by an arrow.
(a) (b) (c)
![Page 114: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/114.jpg)
89
Table 3.1 The Antigenic Determinants Identified in 122 aa Region by
BcePRED and IEDB
Sl.
No
Start
Position
End
Position
Length
(aa)
Antigenic determinants (Sequence)
1 5 29 25 PTTGPASIPDDTLEKHTLRSETSTY
2 39 58 20 GLIVFFPGFPGSIVGAHYTL
3 67 95 29 DQMLLTAQNLPASYNYCRLVSRSLTVRSS
The amino acid sequence of antigenic determinants with the
starting and end positions are given along with the length of the antigenic
determinants. Single letter code for the amino acids is used.
3.1.3 Restriction Profile Analysis
Plasmids were prepared from the transformants for each clone and
digested with Bgl II and Hind III for confirmation of cloning. Single digestion
with the enzymes linearized the pRBVP252-417 to the size of approximately 3.3
kb, whereas the pRSET B linearized to 2.9 kb. When the pRBVP252-417
plasmid was subjected to double digestion with Bgl II and Hind III, the 366
bp insert was observed (Figure 3.2a), which confirmed the presence of the
gene fragment in the vector.
3.1.4 Confirming the Orientation of the Insert in pRBVP252-417
The orientation of the insert in the recombinant plasmid designated
as pRBVP252-417, was analyzed by PCR using different combinations of T7
promoter and insert specific primers. The size of the amplicons, 550 bp and
433 bp for pRBVP252-417 was obtained in the PCR showing the correct
orientation of the insert (Figure 3.2b) which was further confirmed by
sequencing the clone using T7 primers. The nucleotide sequence of the 366
![Page 115: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/115.jpg)
90
bp region obtained from pRBVP252-417 was deposited in the Genbank database
(Accession No. FJ848772). The nucleotide and the deduced amino acid
sequence of 366 bp are given in Figure 3.3. BLAST analysis of the nucleotide
sequence of the 366 bp showed 98–99% homology with the other VP2 gene
fragment sequences (Table 3.2) whereas, the amino acid sequence showed
100% homology with the VP2 fragment of IBDV isolates across the globe
(Table 3.3).
Figure 3.2 Confirmation of the Insert and its Orientation in the
Recombinant Plasmid, pRBVP252-417
(a) Restriction digestion analysis
2 g of the recombinant plasmid (pRBVP252-417) and pRSET B were
digested with Bgl II and Hind III and resolved on 1.2 % agarose gel.
Lanes: 1 - 100 bp DNA molecular weight marker, 2 - Undigested
pRSET B, 3 – Double digested pRSET B, 4 – Undigested pRBVP252-
417, 5 & 6 - Double digested pRBVP252-417.
(b) Confirmation of orientation of the insert
The orientation of 366 bp insert was confirmed by PCR using
different combination of T7 promoter and insert specific primers. The
PCR products were resolved on 1.2 % agarose gel. Lanes: 1 - 100 bp
DNA molecular weight marker, 2 - Insert specific primers, 3 - T7
promoter forward and insert reverse primers, 4 - Insert forward and
T7 promoter reverse primers, 5 - T7 promoter forward and reverse
primers, 6 - Negative control.
![Page 116: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/116.jpg)
91
Figure 3.3 Nucleotide and the Deduced Amino Acid Sequence of 366 bp
N-terminal Region of VP2 Protein
The 366 bp region is shown in the upper case with amino acid
sequence below the corresponding codon. Single letter code for
amino acids is used.
![Page 117: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/117.jpg)
92
Table 3.2 BLASTN Analysis of 366 bp of VP2 Gene Fragment
SEQUENCES PRODUCING SIGNIFICANT ALIGNMENTSScore
(Bits)E-Value
Percentage
of Identity
gb|HQ224883.1| Infectious bursal disease virus strain KNU08010
gbI| FJ848772.1 Infectious bursal disease virus isolate TNcbt1 VP2
dbj|AB368970.1 Infectious bursal disease virVP5, pVP2-VP4-VP3
dbj|AB368968.1|Infectious bursal disease vir VP5, pVP2-VP4-VP3
gb|EU328334.1| Infectious bursal disease virus isolate VP2 mRNA,
gb|EU328331.1| Infectious bursal disease virus isolate QD-h VP2
gb|EU328329.1| Infectious bursal disease virus isolate JS-h VP2
gb|EU328327.1| Infectious bursal disease virus isolate HeN-h VP2
gb|EU184685.1| Infectious bursal....Cro-Ig/02 VP5 and structural
polyprotein genes,
gb|EU042143.1| Infectious bursal virus isolate HLJ-7 VP2 mRNA
gb|DQ286035.1| Infectious bursal disease virus isolate MG7
nonfunctional VP5 gene, partial seq; polyprotein gene, partial cds
gb|DQ927042.1| Infectious bursal strain ks segment A mRNA,
gb|DQ927040.1| Infectious bursal strain mb segment A mRNA
gb|DQ450988.1| Infectious bursal disease virus polyprotein gene,
partial cds
gb|AY780423.1| IBDV isolate JNeto-BR segment A partial cds
gb|AY780418.1| IBDV isolate SM-BR segment partial cds
gb|AF533670.1|IBD strain SH/92 polyprotein mRNA,complete cds
gb|AF322444.1|IBDV segment A VP5 protein and polyprotein
genes, complete cds
gb|AY323952.1| IBDV seg A VP5 and polyprotein genes, cds
gb|AF508177.1| IBDV VP2 gene, complete cds
676
676
676
676
676
676
676
676
676
676
676
676
676
676
676
676
676
676
676
676
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
The BLAST N analysis showing the first 20 hits from Infectious
bursal disease virus isolates. The homology between the 366 bp sequenced in
the present study and other IBDV isolates were 99-100%.
![Page 118: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/118.jpg)
93
Table 3.3 BLASTP Analysis of the Deduced Amino Acid of 366 bp
SEQUENCES PRODUCING SIGNIFICANT
ALIGNMENTS
Score
(Bits)
E-
Value
%
Identity
gb|ACO59489.1| VP2 [Infectious bursal disease virus]
gb|ABY57305.1| VP2 [Infectious bursal disease virus]
gb|ABS87226.1| VP2 [Infectious bursal disease virus]
gb|ABY57307.1| VP2 [Infectious bursal disease virus]
gb|ABS87227.1| VP2 [Infectious bursal disease virus]
gb|ABS87228.1| VP2 [Infectious bursal disease virus]
gb|ACP30643.1| polyprotein [Infectious bursal disease virus]
gb|ABS87230.1| VP2 [Infectious bursal disease virus]
gb|ABE02188.1| polyprotein [Infectious bursal disease virus]
dbj|BAA87931.1| VP2-4-3 polyprotein [Infectious bursal
disease virus]
gb|AAK27323.1|AF248612_1 VP2 protein IBDV
gb|ABC86599.1| VP2 [Infectious bursal disease virus]
gb|AAK50615.1| polyprotein [Infectious bursal disease virus]
gb|ABY57302.1| VP2 [Infectious bursal disease virus]
gb|AAU05319.1| VP2 [Infectious bursal disease virus]
gb|AAW29102.1| VP2 [Infectious bursal disease virus]
gb|AAS87050.1| VP2 [Infectious bursal disease virus]
gb|ACP30640.1| polyprotein [Infectious bursal disease virus]
gb|AAM28900.1| VP2 [Infectious bursal disease virus]
gb|ABC86600.1| VP2 [Infectious bursal disease virus]
246
249
249
249
249
249
249
248
248
249
249
249
249
248
249
248
249
249
249
249
1e-83
2e-80
2e-80
2e-80
2e-80
3e-80
3e-80
3e-80
3e-80
3e-80
3e-80
3e-80
3e-80
3e-80
3e-80
3e-80
3e-80
3e-80
3e-80
3e-80
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
The BLASTP analysis showed 100% homology with the VP2
fragment protein of Infectious bursal disease virus isolates across the globe.
3.1.5 Expression of rVP252-417 Fragment Protein
The plasmid pRBVP252-417 was transformed into GJ1158 cells in
order to obtain high-level expression of the proteins using salt induction. The
![Page 119: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/119.jpg)
94
transformants were selected on LB agar plates without NaCl (LBON),
containing ampicillin (100 g/ mL of LB agar). Transformants were randomly
selected to screen the expression of protein. One of the transformants, giving
highest level of expression was selected for further expression studies.
Initially, the expression was tested in 3 mL medium by induction with
different concentrations of NaCl. The expression was analyzed on a 12%
SDS-PAGE (Figure 3.4a). The recombinant construct showed expression of a
protein of 21 kDa molecular mass as expected. The expression was confirmed
using anti-His monoclonal antibody as the primary antibody by western
blotting (Figure 3.4b). The induced pRSET B vector alone was used as
negative control. Leaky expression was observed in the uninduced culture.
Expression parameters like concentration of the inducer (NaCl),
OD of induction and time period were optimized before large scale
expression. About 2.5% of the pre-inoculum was transferred into flasks
containing 200 mL LB with ampicillin and grown till OD600 reached 0.6. The
cultures were induced with the optimized concentration of 0.3 M NaCl for 3
hours. In addition to using a cheaper and non-toxic inducer, the expression of
the recombinant VP252-417 in GJ1158 strain was stable at least for a month
which is convenient for large-scale expression.
![Page 120: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/120.jpg)
95
Figure 3.4 Expression of Recombinant VP2 Fragment Protein and its
Confirmation by Western Blotting
(a) Expression of recombinant VP2 fragment protein
Total protein extracts from pRBVP252-417 and pRSET B vector
were solubilized in 1X SSB, resolved on 12% SDS-PAGE gel and
stained with CBB dye. Lanes: 1 - protein molecular weight marker,
2 – pRBVP252-417 uninduced, 3 to 6 - pRBVP252-417 induced with
different NaCl concentration (0.15, 0.3, 0.45 and 0.6 M
respectively), 7 - pRSET B induced.
(b) Confirming the expression of recombinant VP2 fragment protein
Total protein extracts from pRBVP252-417 and pRSET B were
solubilized in 1X SSB, resolved on 12% SDS-PAGE gel and were
transferred on to a nitrocellulose membrane and were probed with
anti-his monoclonal antibody. Lanes: 1 - protein molecular weight
marker, 2 – pRBVP252-417 uninduced, 3 to 6 - pRBVP252-417 induced
with different NaCl concentration (0.15, 0.3, 0.45 and 0.6 M
respectively), 7 - pRSET B induced.
![Page 121: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/121.jpg)
96
3.1.6 Purification of Recombinant VP252-417 Protein
The expression of proteins in the T7 expression system facilitates
an easy one step purification on Ni2+
immobilized columns. The rVP252-417
protein was expressed in GJ1158 in soluble form without inclusion bodies.
After centrifuging the culture, the cells were resuspended in binding buffer
and sonicated for cell lysis. Soluble fractions or clarified lysates obtained after
sonication were used for the purification on IMAC columns. The binding and
elution buffer conditions were optimized and the combination of 50 mM Tris-
Sodium phosphate, 10 mM Imidazole and 0.4 M NaCl at pH 6.5 was used.
The pure fraction of rVP252-417 was eluted at 200-300 mM Imidazole.
In addition to IMAC, gel elution was also used to purify the protein
based on the formation of the insoluble potassium salt of lauryl sulfate bound
to the protein. Precipitates thus formed are visible within minutes down to the
level of 0.06 pg of protein/mm2 of gel cross-sectional surface area. Thus the
protein band of interest was cut and eluted in PBS incubating at 95oC for 10
mins. This method was rapid and sensitive technique for protein purification.
Both the IMAC purified protein and the gel-eluted protein were analyzed on
12% SDS-PAGE (Figures 3.5a and 3.5b). The proteins were confirmed by
western blotting with anti-His antibody (Figures 3.6a and 3.6b).
![Page 122: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/122.jpg)
97
Figure 3.5 Purification of Recombinant VP252-417 Protein by IMAC and
Gel- Elution
(a) Purification of recombinant VP252-417 by IMAC
The recombinant VP252-417 was eluted at 200-300 mM imidazole
concentration from Ni2+
bound sepharose column. The wells were
loaded with 25 L volume of the following on 12% SDS-PAGE.
Lanes: 1 – protein molecular weight marker, 2, 3 & 4 – 50, 100, 150
mM imidazole eluent respectively, 5, 6 & 7 - 200, 250, 300 mM
imidazole eluent respectively, 8 - total protein extract from
pRBVP252-417.
(b) Purification of recombinant VP252-417 by Gel elution
pRBVP252-417 total protein extract was resolved on 12% SDS-PAGE
gels, stained with CBB R-250 and the recombinant VP252-417 band
alone was cut and eluted from the gel pieces. Lanes: 1- protein
molecular weight marker, 2 & 3 – gel eluted protein, 4 - total protein
extract from pRBVP252-417.
![Page 123: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/123.jpg)
98
Figure 3.6 Immunoblot Analysis of Purified Recombinant VP252-417
Protein
(a) Analysis of IMAC purified recombinant VP252-417
25 L of each elution was resolved on 12% SDS-PAGE, transferred
onto a nitrocellulose membrane and were probed with anti-his
monoclonal antibody. Lanes: 1 – protein molecular weight marker, 2,
3 & 4 – 50, 100, 150 mM imidazole eluent respectively, 5, 6 & 7 -
200, 250, 300 mM imidazole eluent respectively, 8 - total protein
extract from pRBVP252-417.
(b) Analysis of gel eluted purified recombinant VP252-417
10 L of gel-purified recombinant VP252-41 was resolved on 12%
SDS-PAGE, transferred onto a nitrocellulose membrane and was
probed with anti-His monoclonal antibody as follows. Lanes: 1-
protein molecular weight marker, 2 & 3 – gel eluted protein, 4 - total
protein extract from pRBVP252-417.
![Page 124: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/124.jpg)
99
3.1.7 Antibody Titre of rVP252-417 Protein in Mice
The purified rVP252-417 was used for the production of polyclonal
immune serum in female BALB/c (H-2d) mice. After each immunization, the
mice were bled and the sera were separated. The immunoreactivity of the
antibodies in the immune sera was assessed by western blotting and the
antibody titre was determined by ELISA. After final immunization, the
collected sera were pooled and the antibody titre of the rVP252-417 immunized
sera was determined by ELISA using the preimmune sera (Figure 3.7a). The
polyclonal immune serum and the preimmune serum were serially diluted
from 1:100 to 1:64,000. The rVP252-417 protein was found to be highly
immunogenic inducing a titer of 64, 000. In the western blotting (Figure
3.7b), the immune sera showed reactivity up to 1:10,000 dilution, whereas the
pre immune sera did not show any reactivity.
3.1.8 Characterization of rVP252-417 Protein
Mice polyclonal serum raised against purified IBDV whole
antigens and serum from IBDV infected chicken were tested with rVP252-417
protein. The reactivity of the rVP252-417 with these sera as a 21 kDa protein in
western blotting (Figure 3.7c) confirmed the origin of the recombinant
VP252-417. The reactivity of the recombinant protein with anti-His monoclonal
antibody was used as positive control.
![Page 125: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/125.jpg)
100
Figure 3.7 Determination of Antibody Titre and the Specificity of Mouse
Anti-rVP252-417 Sera
(a) Determination of antibody titre by ELISA
The ELISA plate was coated with 100 ng/well of purified rVP252-417
and the assay was performed with serial dilution of mouse pre and
pooled post immune rVP252-417 sera. The anti- rVP252-417 antibody
titre was found to be 1:64,000.
(b) Western blot analysis of mouse anti- rVP252-417 sera
10 g of purified rVP252-417 was resolved on 12% SDS-PAGE,
transferred to nitrocellulose membrane and probed with different
dilution of post immune sera. The immunoreactivity of the sera with
the rVP252-417 was indicated by the appearance of 21-kDa protein
band. Lanes: 1 - protein molecular weight marker, 2 – anti-His
monoclonal antibody, 3 – preimmune sera (1: 100), 4, 5, and 6 – anti-
rVP252-417 sera at 1:1,000, 1:5,000 and 1:10,000, respectively.
(c) Characterization of rVP252-417 by Western blot analysis
Lanes: 1 - protein molecular weight marker, 2 - Anti-his monoclonal
antibody (1:20,000), 3 - Hyper immune serum against purified IBDV
whole antigens raised in mice (1:2000), 4 - Polyclonal serum from
IBDV infected chicken (1:2000).
![Page 126: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/126.jpg)
101
3.1.9 Humoral Responses of rVP252-417 in Chickens
3.1.9.1 Antibody titer in chicken
The antibody response in chicken was measured in terms of peak
IgY titers. The total IgY raised against recombinant VP252-417 and
commercially available IBDV whole virus vaccine strains in chickens were
measured by ELISA and was represented as antibody titer. The recombinant
VP252-417 elicited potent humoral responses with peak titers of 25,000 in
chicks at 42nd
day after immunization (Figure 3.8a) while the IBDV vaccines,
IV 95 strain and Georgia strain showed peak titers of 16,000 and 18,000,
respectively. The rVP252-417 specific IgY level was high compared to both the
commercial whole viral vaccines (Figure 3.8b).
3.1.9.2 Reactivity with commercial IBDV strains
The ability of the antisera raised against rVP252-417 to bind the
IBDV IV 95 and Georgia vaccine strains was tested by ELISA. The rVP252-417
antisera showed significantly high reactivity (P < 0.0001) against IBDV
vaccine strains compared to the control sera even at a very high dilution
(1:1000) (Figure 3.9a). Since the IBDV vaccine strains contain the whole
virus, this indicates that the antibodies raised against the rVP252-417 binds the
IBD virus and shows the similar antigenicity.
![Page 127: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/127.jpg)
102
Figure 3.8 Humoral Responses of rVP252-417 in Chickens
(a) Measurement of antibody titer for recombinant protein and
commercial IBDV vaccines in chickens
The total IgY induced by the rVP252-417 and IBDV whole virus
vaccine strains, at different intervals post immunization in chicken
(n=5 per group) was assessed by ELISA. Chickens were immunized
with 50 g of recombinant protein in alum or 50 g of commercial
IBDV vaccine and blood was collected at different intervals. Serum
from the chickens immunized with alum alone was taken as
negative control
(b) Peak titers induced by the recombinant protein and commercial
IBDV vaccines in chickensThe peak antibody titers were induced on the 42
nd day by all the
immunized chickens. Comparison of peak titers shows that the
recombinant protein is highly immunogenic. Data represents mean
titer of five chickens ± SEM.
![Page 128: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/128.jpg)
103
Conversely, the reactivity of antisera raised against IBDV vaccine
strains with rVP252-417 was also assessed by ELISA. The antisera raised
against IBDV vaccine strains showed significantly high reactivity (P < 0.05)
with rVP252-417 compared to preimmune sera (Figure 3.9b). This demonstrates
that the polyclonal sera of IBDV vaccine carry antibodies against the rVP252-
417 confirming the presence of the dominant epitopes in VP252-417.
3.1.9.3 Reactivity with field isolates
To further analyze the reactivity of the antibodies raised against the
rVP252-417 with the IBDV antigens, western blotting was carried out with
IBDV field isolate antigens prepared from infected chicken using anti-VP2 52-
417 sera. It was interesting to observe that the rVP252-417 antisera showed
reactivity with VP2 precursor protein, VPX at 54 kDa, indicating that the
antibodies recognized the epitopes of native antigen in field isolate (Figure
3.10a). Also, antisera against the IBDV vaccine strains showed reactivity with
rVP252-417 showing the 21 kDa band (Figure 3.10b).
![Page 129: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/129.jpg)
104
Figure 3.9 Reactivity with Commercial IBDV Strains
(a) Reactivity of rVP252-417 protein and IBDV vaccine strains with
antisera raised against rVP252-417 protein in chicken and (b) Reactivity of
rVP252-417 protein with antisera raised against rVP252-417, IV 95 vaccine
strain and Georgia vaccine strain in chicken. Absorbance of the
recombinant protein with its antisera was taken as positive control.
Reactivity of alum control serum was taken as negative control. Data is
represented as mean absorbance ± SEM.
![Page 130: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/130.jpg)
105
Figure 3.10 Reactivity with Field Isolates and Commercial
Strains
(a) Reactivity of the IBDV strain isolated from infected chickens and
commercial IBDV vaccine- IV 95 vaccine, Georgia vaccine, with
polyclonal sera raised against rVP252-417 protein in chickens. After
transfer, the blots were incubated with appropriate primary antibody
followed by rabbit anti-chicken IgY ALP (1:10,000) and developed
with NBT and BCIP. Lanes: 1 - protein molecular weight marker, 2
- IV 95 vaccine strain, 3 - Georgia vaccine strain, 4 - Field isolate
IBDV strain.
(b) Reactivity of the rVP252-417 with polyclonal sera raised against
commercial IBDV vaccines- IV 95 vaccine, Georgia vaccine.
Reactivity of the rVP252-417 against its antisera was considered as
the positive control. After transfer, the blots were incubated with
appropriate corresponding primary antibodies, followed by rabbit
anti-chicken IgY ALP (1:10,000) and developed with NBT and BCIP.
Lanes: 1 - protein molecular weight marker, 2 - IV 95 vaccine strain
antisera, 3 - Georgia vaccine strain antisera , 4 - rVP252-417
antisera.
![Page 131: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/131.jpg)
106
3.1.10 Cellular Response of rVP252-417
To evaluate the presence of possible T cell epitopes recognized in
the SAN chickens, splenocyte proliferation assay was carried out. The cellular
response of rVP252-417 to stimulate the spleen lymphocytes of chickens
immunized with either rVP252-417 or the commercial IBDV vaccine was
studied.
Chicks were primed with rVP252-417 or with IBDV vaccines and
spleen cells stimulated in vitro, with rVP252-417 antigen and respective IBDV
vaccines. rVP252-417 showed significantly (P < 0.01) high proliferation (mean
S.I = 7.21 – 9.45) with concentrations as low as 10 µg/mL in groups
immunized with rVP252-417 and IBDV commercial vaccines compared to
control (Figure 3.11b and 3.11c). When rVP252-417 primed spleen cells were
stimulated with the commercial vaccines, the cells showed significantly
(P < 0.01) high proliferation (mean S.I = 6.45 – 7.55) with a concentration of
50 µg/mL in rVP252-417 immunized group compared to control (Figure 3.11a).
The study suggests the presence of T cell epitopes in rVP252-417 and
thus is capable of inducing a potent cellular response in chicken. The positive
control ConA showed proliferation in both control and rVP252-417 immunized
chickens.
![Page 132: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/132.jpg)
107
Figure 3.11 Splenocyte Proliferation Assay in Chickens
Splenocyte proliferation of (a) rVP252-417 (b) IV 95 vaccine strain (c)
Georgia vaccine strain immunized chickens stimulated with the
recombinant protein, vaccines and ConA compared to that of the
alum control chickens. The data is represented as mean stimulation
index (S.I) of five chicken’s ± SEM.
3.1.11 Protection against Virulent IBDV Challenge
The BF/BW ratios of chickens vaccinated with rVP252-417 protein
were not different from those of the unvaccinated and unchallenged normal
control (group 5) (P>0.05) but significantly higher than challenged control
group (group 4) (P<0.05). The chickens vaccinated with commercial IBDV
strains IV 95 (group 2) and Georgia vaccine (group 3) showed higher BF/BW
ratios compared to challenge control group, though the difference was not
significant (P>0.05) (Table 3.4)
Protection of chicken from all the experimental groups against
vIBDV challenge was measured by the histological bursal damage scoring
![Page 133: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/133.jpg)
108
system described in Table 3.4 (Rong et al 2005). It shows the bursal damage
score for five different groups 10 day after challenge with vIBDV. No
chicken in unvaccinated and challenged control group (group 4) was free of
infection while the protection of rVP252-417 protein group (group 1) was 100%.
The chickens of group 3 and 4, vaccinated with commercial IBDV IV 95 and
Georgia vaccines showed ~55% and 60% protection respectively from bursal
damage. 75% from group 1 were valued 0 while scoring the histological
section. But in groups 3 and 4 only 20% and 25% of chickens respectively
showed score 0.
![Page 134: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/134.jpg)
109
Table 3.4 Protection Efficacy of rVP252-417 Protein Vaccine after Virus Challenge in Immunized Chickens
Histopathological BF lesion scoresd
Scores 0
ratiose
Protectionf(%)Group Vaccine
aBF/BW ratio
b Mortality
c
0 1 2 3 4 5 Avg
1 rVP252-417 1.145±0.15 0/20 15 5 0 0 0 0 0.25 15/20 20/20 = 100
2 IV 95 vaccine
strain
0.773±0.32 3/20 4 7 5 3 1 0 1.5 4/20 11/20 = 55
3 Georgia
vaccine strain
0.698±0.28 2/20 5 7 7 3 0 0 1.5 5/20 12/20 = 60
4 CC†
0.531±0.18 10/10 0 0 0 1 2 7 4.6 0/10 0/10 = 0
5 NC‡
1.253±0.17 0/10 10 0 0 0 0 0 0 10/10 NA
†CC: Challenge control,
‡ NC: Normal control
a All groups, except NC (group 5), were challenged with 2×104 embryo infective dose (EID50)/ml of standard challenge strain IBDV (vIBDV strain
from TANUVAS) by the oral route.b BF/BW ratio was calculated by bursal weight ×1000 then divided by body weight and presented as the mean ± SD from each group.
c Mortality was recorded during 10-day-period after virus challenge and presented as number of dead chickens/total number of chickens in each
group.
d Bursal gross lesions were scored from 0 to 5 based on the severity of bursal involvement at time of euthanasia (0: no lesion, 1: slight change, 2:scattered or partial bursal damage, 3: 50% or less follicle damage, 4: 51–75% follicle damage, 5: 76–100% bursal damage).
e Score 0 ratio was calculated by the number of chickens with histopathlogical BF lesion score 0/the number of chickens in the group.
f Protection was defined by the number of chickens with histopathlogical BF lesion score 0 and 1/the number of chickens in the group.
![Page 135: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/135.jpg)
110
3.2 CLONING, IN VIVO EXPRESSION AND
IMMUNOPROPHYLACTIC EFFICACY OF VP2
FRAGMENT (VP252-417) AS DNA VACCINE
The 366 bp from the N-terminal end of VP2 protein was
subcloned in pVAX1, eukaryotic expression vector. The pVAX-VP252-417
clone was transformed into the high-efficiency plasmid propagation host
DH5 strain of E .coli. The large-scale plasmid extraction was carried out
using QIAGEN endo-toxin free plasmid purification giga kit as per
manufacturer’s instructions. Prior to immunization, the in vitro and in vivo
expression of the DNA vaccines in CHO cell lines and chicken muscle tissue
respectively were confirmed by RT-PCR and western blot analysis. The
protective efficacy as DNA vaccine pVAX-VP252-417 was evaluated by viral
challenge studies in chickens, which showed high protection against IBD.
3.2.1 Sub Cloning of VP252-417 in pVAX1 Vector
The VP252-417 was sub cloned in DNA vaccine mammalian
expression vector pVAX1. The VP2 fragment was amplified from pRBVP252-
417 clone by PCR using gene-specific primers incorporating the restriction
sites for Eco RI in the forward primer and Hind III in the reverse primer. The
purified PCR product was digested with the same enzymes and then ligated
into the multiple cloning site of pVAX1 vector digested with the same
enzymes. The ligation mixture was transformed in to TOP10 strains of E. coli.
The positive clones were selected by lysate PCR using gene specific forward
and reverse primers. All the positive clones showed amplification of 366 bp
size VP252-417 insert DNA (Figure 3.12a).
![Page 136: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/136.jpg)
111
3.2.2 Restriction Digestion Analysis
Plasmid DNA was prepared from the transformants containing
positive clones and restriction digestion was carried out for further
confirmation of the clones. Double digestion with Eco RI and Hind III
showed the products 366 bp insert and the 2.9 kb vector back bone,
confirming the presence of Insert (Figure 3.12b). The DNA vaccine vector
containing VP252-417 was designated as pVAX-VP252-417, and was sequenced.
3.2.3 In Vitro Expression of the DNA Vaccine Construct in CHO
Cell Line
The CHO cell line was used for the transient transfection of DNA
vaccine construct of VP252-417 to check the expression. CHO Cells were
transiently transfected with pVAX - VP252-417 using lipofectamine reagent.
The transfected cells were harvested after 72 hours and the cells were
transfected with a positive control plasmid pEGFPN3 which contains green
fluorescent protein under CMV promoter (Figure 3.13b). Total RNA was
extracted from cells Trizol and converted into cDNA. The cDNA was tested
for the presence of pVAX - VP252-417 gene in the transfected CHO cell by
PCR with VP252-417 gene specific primers. Figure 3.13a shows the
amplification of cDNA from transfected cells with a PCR product of 366 bp
with VP252-417 gene-specific primers. The level of GAPDH mRNA (house
keeping gene) was used as positive control (Figure 3.13c).
Further, to confirm the expression of the encoded antigens, western
blot analysis was done with the transfected cell lysate. IBDV-antibody was
used to probe the proteins after transfer from polyacrylamide gel to
nitrocellulose membrane. The reactivity of protein at the corresponding
molecular size confirmed the authenticity of the expressed antigen (Figure
3.13d).
![Page 137: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/137.jpg)
112
Figure 3.12 Cloning of VP252-417 in pVAX1 Plasmid
10 L of the PCR or restriction digestion products were loaded on
1.2% agarose gel, stained with ethidium bromide (0.5 g/mL) and
observed in the Gel documentation unit.
(a) Screening of transformants by Lysate PCR
The 366 bp insert in the pVAX-VP252-417was amplified by PCR
using insert specific primers. Lanes: 1- 100 bp DNA molecular
weight marker, 2 - Negative control, 3 to 5 – Positive
Transformant, 6 – Positive control (pRBVP252-417) for the PCR.
The amplified product is indicated by an arrow.
(b) Restriction digestion analysis
2 g of the recombinant plasmid (pVAX-VP252-417) was digested
with Hind III and Eco RI and resolved on 1.2% agarose gel. Lanes: 1
- 100 bp DNA molecular weight marker, 2 - Undigested pVAX-
VP252-417, 3 to 5 – Double digested pVAX-VP252-417.
![Page 138: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/138.jpg)
113
Figure 3.13 In Vitro Expression of pVAXVP252-417 Construct in CHO
Cell Line
(a) RT-PCR of transfected cells with pVAX-VP252-417 primers.
The 366 bp VP252-417was amplified by PCR using insert specific primers.
Lanes: 1- 100 bp DNA marker, 2 - cDNA from untransfected cells, 3 - cDNA
from pVAX-transfected (vector control), 4 -cDNA from pVAX-VP252-417
transfected cells showing PCR product (~366 bp), 5 - PCR positive control
(pVAX- VP252-417 plasmid), 6 - Negative control.
(b) CHO cells transfected with positive control plasmid pEGFP showing Green
Fluorescence
(c) RT-PCR of pVAX-VP252-417 transfected cells with control primers (GAPDH)
Lanes: 1- 100 bp DNA molecular weight marker, 2 - Negative control for
GAPDH primers, 3 - cDNA with GAPDH primers (positive control), 4 -
Negative control for VP252-417 primers, 5 - cDNA with VP252-417 primers
showing PCR product (366 bp). The amplified products are indicated by
arrows.
(d) Western blot analysis for in vitro synthesis of DNA encoded VP252-417 in CHO
cells
Total protein was extracted from the transfected cells after 48 h. Lanes: 1-
Molecular weight marker, 2 - Total protein from cells transfected with DNA
encoding VP252-417, 3 - E.coli expressed rVP252-417, 4 - un-treated cell lysate.
Samples were probed with VP252-417 - antibodies.
![Page 139: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/139.jpg)
114
3.2.4 In Vivo Expression of the DNA Vaccine Constructs in Chicken
Muscle Tissue
The expression of the antigens at the transcriptional level was also
studied in vivo. Intramuscular injection of 100 g of pVAX-VP252-417 was
given at the right pectoral muscle of chicken. RNA was extracted from the
injected muscle tissue at three different time points (1d, 14d, 28d and 42d).
RT-PCR showed the amplified product at the expected size (366 bp) (Figure
3.14). For 42d post immunization samples, the RT-PCR product was very less
compared to other time-points.
Figure 3.14 Expression of the DNA vaccine Constructs in Muscle Tissue
The RNA was extracted from the immunized muscle tissue after 1d,
14d, 28d and 42d and RT-PCR was performed, following treatment
with DNAse, using gene specific primers. PCR products were
electrophoresed on 1.2% agarose gel. Lane M, 100 bp ladder; Lane 1,
negative control (injected with empty vector); Lanes 2, 3 & 4-RT-
PCR products for 1d, 14d, 28d and 42d time points respectively.
.
![Page 140: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/140.jpg)
115
3.2.5 Tissue Distribution and Persistence of DNA Vaccine in
Immunized Chickens
To determine the fate of the injected plasmid DNA in chicken, a
tissue distribution study employing PCR analysis was conducted following a
single intramuscular injection (Figure 3.15). In this study two experimental
groups were evaluated: one group vaccinated with pVAXVP252-417 and the
other, an unvaccinated negative control group. An equal number of tissues
from both the groups were processed and analyzed at the same time. Post-
immunization, the chickens were sacrificed by administering anesthesia at
different time points viz 1 day, 14 days 28 days and 42 days. Different organs
like muscle, spleen, kidney, liver, and bursa were isolated and DNA was
extracted from these tissues. The DNA from different tissues at different time
points was subjected to PCR amplification using VP252-417 primers for
studying the distribution of the pVAXVP252-417. The level of expression at
different time points were evaluated based on the band intensity of the PCR
amplified product
Shortly after intramuscular injection (1 day), pVAXVP252-417
plasmid DNA was detected in all tissues analyzed, suggesting that the DNA
vaccine has quick absorption. Majority of the plasmid DNA exists in the
injected local muscles for all vaccinated chickens. On post inoculation day
(PID) 14, plasmid DNA was detectable in muscle, spleen, kidney, liver, and
bursa, but the opposite muscle and kidney samples displayed much weaker
positive bands compared to earlier time-points and the other samples.
However PID 28, Plasmid DNA was detected only in injected site muscle,
spleen, liver, and bursa. The long-term existence of the plasmid DNA in
spleen and bursa implies the production of effective immune response in
chickens. By PID 42, the DNA was still detected at the site of injection of the
birds while all other samples were negative (Table 3.5). All tissues analyzed
![Page 141: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/141.jpg)
116
from the unvaccinated group were found to be free of plasmid as determined
by the absence of any amplification products, thereby validating that the
tissue collection and PCR analysis was free of contamination.
Table 3.5 In Vivo Tissue Distribution of pVAXVP252-417
Days after intramuscular inoculationTissue types
1 14 28 42
Muscle
Opposite muscle
Spleen
Kidney
Liver
Bursa
+ + + +
+ + - -
+ + + -
+ + - -
+ + + -
+ + + -
Figure 3.15 Tissue Distribution Analyses for pVAXVP252-417 DNA in
Immunized Chickens
Tissue distribution of the pVAXVP252-417 DNA in the immunized
chicken at different time-points by PCR analysis with VP252-417
primers on days 1 (A), 14 (B), 28 (C) and 42 (D) after vaccination.
Lane 1 to 6: DNA template from muscle tissue, opposite muscle
tissue, spleen, kidney, liver, and bursa respectively. Lane 7: negative
control
![Page 142: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/142.jpg)
117
3.2.6 Immune Response Studies of DNA Vaccine (pVAXVP252-417) in
Chickens
3.2.6.1 Antibody titer in chicken
Groups of one day old SAN white leghorns were immunized with
100 µg of DNA vaccine (pVAXVP252-417 and pVAX) intramuscularly. Four
immunizations with one week interval were administered. Blood was
collected every two weeks from 0th
day till 84th
day. Unimmunized chickens
were used as control group. The antibody titer was determined by ELISA to
determine the level of anti- rVP252-417 IgY in the serum.
As shown in Figure 3.16, there were no rVP252-417 specific
antibodies generated by the chickens immunized with pVAX vector, while
pVAXVP252-417 vaccinated chickens produced specific antibodies against
rVP252-417. The antibody titers of the DNA vaccinated chickens were
significantly lower than those immunized with recombinant protein (rVP252-
417). Antigen specific antibodies in chickens immunized with pVAXVP252-417
DNA vaccine constructs were detectable only after the second immunization.
The level of antigen specific antibodies was observed to increase during the
course of immunization. The pVAXVP252-417 elicited potent humoral
responses with peak titers of 12,000 in chickens at 42nd
day after
immunization. There was no significant difference in the titer of pVAX
immunized chickens and unimmunized chickens.
3.2.6.2 Cellular response of pVAXVP252-417
To evaluate cellular response of pVAXVP252-417 in the SAN
chickens, splenocyte proliferation assay was carried out. The cellular response
of pVAXVP252-417 immunized chicken’s spleen lymphocytes, when
stimulated with either rVP252-417 or the commercial IBDV vaccine was
![Page 143: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/143.jpg)
118
studied. Chickens primed with pVAXVP252-417 and stimulated in vitro, with
rVP252-417 antigen and IBDV vaccines showed significantly (P < 0.01) high
proliferation (mean S.I = 11 – 12.5) with concentrations as low as 10 µg/mL
compared to chickens primed with pVAX vector (Figure 3.17). There was no
significant difference in the splenocyte proliferation of pVAX immunized
chickens and unimmunized chickens, when stimulated with different antigens.
3.2.7 Protection Studies of pVAXVP252-417 against Virulent IBDV
Challenge
The BF/BW ratios of chickens vaccinated with pVAXVP252-417
plasmid were not different from those of the unvaccinated and unchallenged
normal control (group 4) (P>0.05) but significantly higher than challenged
group which was vaccinated with pVAX plasmid and unvaccinated control
groups. There was no significant difference in the BF/BW ratios of pVAX
immunized chickens and unimmunized chickens (Table 3.6)
Protection of chicken from all the experimental groups against
vIBDV challenge was measured by the histological bursal damage scoring
system described in Table 3.6 (Rong et al 2005). It shows the bursal damage
score for five different groups 10 day after challenge with vIBDV. No
chicken in groups of pVAX vaccinated and unvaccinated but yet challenged
(group 2 and 3 respectively) were free of infection while the protection of
pVAXVP252-417 vaccinated (group 1) was 75%. 60% of bursal samples from
group 1 were valued 0 while scoring the histological section. But in group 2
and 3 none of the bursal samples showed score 0.
![Page 144: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/144.jpg)
119
Figure 3.16 Measurement of Antibody Titer for Recombinant DNA
Vaccine in Chickens
Mean ELISA antibody titer from different groups of birds vaccinated
with recombinant DNA vaccine at different time intervals post-
challenge.
Figure 3.17 Splenocyte Proliferation Assay in Chicken Immunized with
DNA Vaccine
Splenocyte proliferation of pVAXVP252-417 immunized chickens
stimulated with the recombinant protein, vaccines and ConA
compared to that of the pVAX control chickens. The data is
represented as mean stimulation index (S.I) of five chicken’s ± SEM.
![Page 145: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/145.jpg)
120
Table 3.6 Protection Efficacy of rVP252-417 DNA Vaccine after Virus Challenge in Immunized Chickens
Histopathological BF lesion scoresd Scores 0
ratiose Protection
f(%)
Group Vaccinea BF/BW
ratiob Mortality
c
0 1 2 3 4 5 Avg
1 pVAXVP252-417 1.056±0.15 2/20 12 3 3 2 0 0 0.75 12/20 15/20 =75
2 pVAX 0.445±0.14 20/20 0 0 0 2 2 16 4.7 0/20 0/20 = 0
4 CC†
0..432±0.12 10/10 0 0 0 1 2 7 4.6 0/10 0/10 = 0
5 NC‡
1.153±0.17 0/10 10 0 0 0 0 0 0 10/10 NA
†CC: Challenge control,
‡ NC: Normal control
a All groups, except NC (group 4), were challenged with 2×104 embryo infective dose (EID50)/ml of standard challenge strain IBDV
(vIBDV strain from TANUVAS) by the oral route.
b BF/BW ratio was calculated by bursal weight ×1000 then divided by body weight and presented as the mean ± SD from each group.
c Mortality was recorded during 10-day-period after virus challenge and presented as number of dead chickens/total number of chickens
in each group.
d Bursal gross lesions were scored from 0 to 5 based on the severity of bursal involvement at time of euthanasia (0: no lesion, 1: slight
change, 2: scattered or partial bursal damage, 3: 50% or less follicle damage, 4: 51–75% follicle damage, 5: 76–100% bursal damage).
e Score 0 ratio was calculated by the number of chickens with histopathlogical BF lesion score 0/the number of chickens in the group.
f Protection was defined by the number of chickens with histopathlogical BF lesion score 0 and 1/the number of chickens in the group.
![Page 146: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/146.jpg)
121
3.3 DEVELOPMENT OF MONOCLONAL ANTIBODIES TO
RECOMBINANT VP2 FRAGMENT (rVP252-417)
The recombinant VP252-417 was expressed in E. coli GJ1158. The
purified VP252-417 protein was used for immunizing homozygous Balb/c
female mice and establishment of hybridomas. Hybridomas developed by
fusion of mouse myeloma cells, Sp2/o with spleen cells of immunized mice
resulted in several antibody secreting clones. The clones were screened for
monoclonal antibodies against rVP252-417 by ELISA and those showing high
reactivity were selected for diagnostic assays.
3.3.1 Immunization and Antibody Titre
For immunization, 50 g of purified recombinant VP252-417 antigen
(per mouse) in Freund’s complete adjuvant was injected subcutaneously as a
primary dose followed by two booster doses in Freund’s incomplete adjuvant
at a regular interval of 21 days. ELISA was performed to determine the
antibody titre every 10th day after booster. The animals were rested for 2
months to ensure that the antibody titer levels, particularly the IgM level
drops, shifting the immune system to secrete IgG. A final booster of 250 g in
0.4 ml PBS was injected intraperitoneally 3-4 days prior to fusion. A final
serum titer of 30,000 was achieved after the immunization.
3.3.2 Harvest of Myeloma Cells
A seeding cell density of 5 × 104 cells/mL worked was used for
Sp2/0 cells. Sp2/0 cells grew to a maximum density of 9 × 105 cells/mL, with
a doubling time of approx. 20 hrs. A total of 1 × 107 Sp2/0 cells (i.e. 1:5 ratio
to immune spleen cells) was used for fusion.
![Page 147: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/147.jpg)
122
3.3.3 Harvest of Mouse Feeder Cells
To maximize the yield of hybrids from the fusion and cloning
procedures, feeder cells were co-cultured with the hybrids. Mouse peritoneal
cells, most of which were macrophages, have been found to be effective
feeder cells, providing soluble growth factors for hybridoma cells.
Approximately 5-7 106 peritoneal feeder cells were harvested from one
mouse and the above concentration was enough to seed 100 wells (96 well
plate) (i.e. 3000-5000 cells/well) for conditioning and for removal of dead
cells.
3.3.4 Cell Fusion and Hybrid Yield
The fused cells were screened for the hybridomas in HAT
selection medium. The plates were observed and screened for clones secreting
immunoglobulins. Around 50% of the hybrids were growing to confluency
and secreted immunoglobulins (either IgM or IgG). Every such well had at
least two hybrid clones. The supernatant from those clones were used for
ELISA on plate coated with recombinant VP252-417 (1 g/well). The results
showed that 61 clones secreted specific antibodies to recombinant VP252-417.
These clones showed an absorbance of more than 0.8 in ELISA (Figure 3.18).
![Page 148: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/148.jpg)
123
Figure 3.18 Primary screening of Hybrids
Primary screening of hybrids from 96 well plates to select the
clones for further analysis and scale up.
3.3.5 Scale-Up of the Clones
The clones secreting antibodies with positive reactivity to
recombinant VP252-417 were scaled-up to 1mL culture in 24 well plate at 1X
HT and tested again by ELISA after 3-5 days of growth. The results showed
that 35 clones secreted specific antibodies to recombinant VP252-417 and the
selected clones were further screened with rVP252-417 and partially purified
IBDV antigen for reactivity (Figure 3.19). Of these, 10 clones secreted
specific antibodies to recombinant and IBDV antigen which were selected for
further expansion. The selected hybrids were expanded to 5 ml in culture
flasks at 0.5X HT and tested again by ELISA after 3-5 days of growth. The
cells were slowly weaned off HT. After 3-4 passages 5 hybrid cells were
cloned to monoclonality by the limiting dilution method.
![Page 149: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/149.jpg)
124
Figure 3.19 Secondary Screening of Hybrids from 24 Well Plates
Screening of hybrids from 24 well plates to select the clones for
further analysis and scale up.
3.3.6 Sub-Cloning: Cloning by Limiting Dilution and Derivation of
Stable Clones
Cloning by limiting dilution was a standard method based on the
Poisson distribution. Dilution of cells to an appropriate number per well
maximized the proportion of wells that could contain a single clone.
Hybridomas to be cloned were diluted to 1 cell/well. This kind of dilution
provides ~ 30-40 % of wells with 1 cell/well as per the poisson statistics. As a
standard procedure, hybridoma that yielded > 90 % antibody positive cultures
upon recloning was considered to be stable. At the end of this cloning
process, the clones were selected and cryopreserved.
![Page 150: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/150.jpg)
125
3.3.7 Selection of Monoclones
We screened for stable, high antibody secreting clones which
showed good affinity to IBDV antigen and VP252-417 in ELISA which was
scaled-up to 1 mL and subsequently to 5 mL culture. Finally, five clones
namely 1C7F12, 2C6H2, 3A11A2, 6E6B12 and 8G5C6 were selected
(Figure 3.20) and cryopreserved.
Figure 3.20 Screening of the Clones Secreting Monoclonal Antibody for
rVP252-417, Partially Purified and Purified IBDV
3.3.8 Characterization of the mAbs
To determine the titers and sensitivity of the antibodies, the mAb’s
were again tested for binding to rVP252-417 antigen in ELISA by varying
dilution. The five clones selected were tested in ELISA by varying the
dilution of supernatant (Figure 3.21) and for different concentrations of
rVP252-417 (Figure 3.22).
![Page 151: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/151.jpg)
126
Figure 3.21 Reactivity of mAbs against rVP252-417 in ELISA
The assay data plotted are mean value of triplicates +/- deviations.
As per the procedure, the ELISA was performed. The two fold dilution of
mAbs supernatant was used as primary antibody.
Figure 3.22 Reactivity of Monoclonal Antibodies against rVP252-417
using ELISA
![Page 152: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/152.jpg)
127
The assay performed with varying concentration of rVP252-417 from
1000 ng to 31.25 ng. The mAbs supernatant was used as primary.
3.3.9 Confirmation of mAbs against rVP252-417 in Western Blot
The selected mAbs (1C7F12, 2C6H2, 3A11A2, 6E6B12 and
8G5C6) were further characterized by western blot. The affinity and
sensitivity of the clones were again confirmed using the mAbs supernatant as
primary antibody against rVP252-417 and rVP2 (Full length VP2) (Figure
3.23).
Figure 3.23 Western Blot Analysis of Hybridoma Culture Supernatant
against (a) rVP252-417 and (b) rVP2 (Full length VP2)
Lanes 1: Molecular weight marker, 2: 1C7F12 clone, 3: 2C6H2
clone, 4: 6E6B12 clone, 5: 3A11A2 clone, 6: 8G5C6 clone.
After sub-cloning, the selected clones (1C7F12, 2C6H2, 3A11A2,
6E6B12 and 8G5C6) were scaled up and found to produce mAb continuously
against rVP252-417. Thus it was confirmed that the mAb’s 1C7F12, 2C6H2,
3A11A2, 6E6B12 and 8G5C6 were stable and these can be further used for
developing suitable kits for detection of IBDV.
![Page 153: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/153.jpg)
128
3.3.10 Isotyping of Monoclones
The Isotyping of all five mAbs was carried out by the Rapidot-
mouse immunoglobulin isotyping kit. All the clones belonged to IgG2b
isotype class except clone 6E6B12 which belonged to IgM class isotype.
3.3.11 Affinity of Anti-VP252-417 Monoclonal Antibodies
Hybridomas were screened by the differential ELISA to identify
wells with high-affinity mAbs, and the selected hybridoma cells were cloned.
Affinities of selected mAb clones to VP252-417 protein were measured. The Kd
of each mAb was determined by measuring the rate of binding to the antigen
at different protein concentrations and was calculated using the equation
derived from Scatchard and Klotz (Friguet et al 1985). The result revealed
high affinity of 3A11A2 monoclonal antibody to the VP252-417 antigen. The
Kd value of the 3A11A2 monoclonal antibody for VP252-417 was threefold
lower than 1C7F12 and 2C6H2, monoclonal antibodies (Table 3.7). The
6E6B12 and 8G5C6 monoclonal antibodies showed high Kd values and low
affinity to VP252-417 antigen.
Table 3.7 Affinity of Anti-VP252-417 Monoclonal Antibodies
mAb Isotype Kd (molL-1
)
1C7F12 IgG2b 6.32 10-9
2C6H2 IgG2b 6.12 10-9
3A11A2 IgG2b 2.3 10-9
6E6B12 IgM 2.95 10-7
8G5C6 IgG2b 3.4 10-8
![Page 154: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/154.jpg)
129
3.3.12 Avidity of Anti-VP252-417 Monoclonal Antibodies
Urea wash was given in ELISA to measure the specificity and
binding strength of mAbs to their corresponding epitope. Effect of urea
treatment was previously described by Binley et al (1997) on the binding of
gp120 of HIV type1 with panel of monoclonal antibodies. Result of urea
elution showed high avidity index for 3A11A2 with recombinant VP252-417
and moderately high with purified IBDV antigen. Both 1C7F12 and 2C6H2
clones showed intermediate avidity index with recombinant as well as
purified IBDV antigen, while other clones showed low avidity index with
recombinant as well as purified IBDV whole virus antigen (Table 3.8). VP252-
417 polyclonal antibodies showed high avidity index for both recombinant and
purified IBDV antigen. Low avidity index of high reactive monoclonal
antibodies with recombinant and IBDV antigen may explain the cross
reactivity of monoclonal and low affinity immune complexes was eluted with
the treatment of mild denaturant (8M Urea).
Table 3.8 Avidity Index of mAbs with rVP252-417 and Purified IBDV
Antigen
Avidity Index percentage (%)mAbs Isotype
rVP252-417 Purified IBDV
1C7F12 IgG2b 45.4 31.9
2C6H2 IgG2b 34.8 28,5
3A11A2 IgG2b 69.8 48
6E6B12 IgM 10.5 12
8G5C6 IgG2b 28.9 10
Mouse Anti- rVP252-417 polyclonal 74.8 56.6
![Page 155: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/155.jpg)
130
3.4 DEVELOPMENT OF SANDWICH ELISA (ANTIGEN
DETECTION) FOR IBDV DETECTION
Sandwich ELISA was standardized for antigen detection with
mAbs and polyclonal antibodies in combination as capture antibody and
detection antibody for detecting viral antigens. The results showed
significantly high detection of rVP252-417compared to control when mAbs
were used as capture antibody. Sandwich ELISA prototype for detecting
IBDV was developed for field trial.
3.4.1 Optimization of Various Parameters for the Development of
Sandwich ELISA
Criss cross serial dilution analysis was carried out to determine
optimal reagent concentration to be used in the ELISA. All the three
reactants in this ELISA namely - a primary solid phase coating reagent, a
secondary reagent (rVP252-417, and purified IBDV antigen) that binds to the
primary reagent and the second antibody which binds to the secondary reagent
were serially diluted and analyzed by criss cross matrix. Sandwich ELISA
was standardized for rVP252-417 with mAbs and polyclonal antibodies in
combinations using either one as capture antibody and the other as
detection antibody to detect antigens. Results showed that mAb can be
the better option as capture antibody than rabbit anti VP252-417 polyclonal
antibody. Sandwich ELISA was carried out for five mAbs as capture
antibody and rabbit anti VP252-417 polyclonal as detection antibody, while
50 ng of rVP252-417 and 1 µg of purified IBDV antigen were used as
standard and 1 µg E.coli protein was used as control. Two mAbs,
3A11A2 and 1C7F12 showed the detection of recombinant and native
antigen in sandwich assay and were consequently selected for further
standardization, while detection was not significant enough with
monoclonal antibodies 2C6H2, 6E6B12 and 8G5C6 (Figure 3.24). Both of
![Page 156: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/156.jpg)
131
mAbs (namely 3A11A2 and 1C7F12) were used in combination to
develop the assay which showed promising results for antigen detection
than when either mAbs were used as single capture antibody. Purified
IBDV antigen showed the same pattern of absorbance in sandwich assay
as recombinant antigen (Figure 3.24).
Figure 3.24 Sandwich ELISA with rVP252-417 and Purified IBDV
1 µg of VP252-417 mAbs were used as capture antibody and
1:1000 dilution of rabbit anti VP252-417 polyclonal as detection antibody,
while 50 ng of rVP252-417 and 1 µg of purified IBDV antigen used as
standard test antigen. 1 µg of E.coli host protein was used as control.
Two mAbs 3A11A2 and 1C7F12 showed the detection of recombinant
and native antigen in sandwich assay, while other mAbs did not show
significant detection.
3.4.2 Sensitivity of the Sandwich ELISA Using Recombinant
VP252-417 and Purified IBDV Antigen
ELISA was carried out to find out the minimum detectable
concentration of purified rVP252-417 and IBDV antigen. A known amount
![Page 157: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/157.jpg)
132
of the purified rVP252-417 antigen starting from 100 ng to 6.25 ng
(Figure 3.25) and purified IBDV antigen from 1 µg to 62.5 ng was added
to normal sera (Figure 3.26). The serum was added to the microtitre
plate, which was coated with anti rVP252-417 monoclonal antibody and the
assay performed as mentioned above. The E. coli antigen was used as
control. It was found that the minimum amount of rVP252-417 antigen that
could be detected was 10 ng by ELISA and no reactivity to E. coli
antigen was observed even at a higher concentration. IBDV antigen was
detected significantly at 125 ng level in capture assay.
Figure 3.25 Capture Assay with Different Amounts of rVP252-417 Antigen
The monoclonal antibodies, mAbs 3A11A2 and 1C7F12, were
selected for validating capture assay at 1 µg as single and in combinations.
The rabbit anti VP252-417 polyclonal antibody was used at the dilution of
1:1000 for detection. The cocktail monoclonal (3A11A2 + 1C7F12) showed
better sensitivity compared to the individual
![Page 158: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/158.jpg)
133
Figure 3.26 Capture Assay with Different Amounts of Purified IBDV
Antigen
The cocktail monoclonal (3A11A2 + 1C7F12) showed better
sensitivity compared to the individual purified IBDV antigen.
3.4.3 Determination of the Titers of Anti-VP252-417 Polyclonal
Antibodies
ELISA plates (96 wells) were coated with 100 ng /well of
purified rVP252-417 antigen and 1 µg of purified IBDV antigen and direct
ELISA was performed. The pre and post immune sera were serially
diluted starting from 1:100 to 1:16000. Rabbit anti rVP252-417 sera showed
reactivity with the rVP252-417 antigen and purified IBDV antigen. Pre-
immune control sera showed no reactivity with recombinant antigen as
well as purified IBDV (Figure 3.27).
![Page 159: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/159.jpg)
134
Figure 3.27 Reactivity of Rabbit rVP252-417 Polyclonal Antibody
100 ng of rVP252-417 and 1µg of purified IBDV antigens were
coated on 96 well microtiter plates. The two fold dilution of
rabbit anti-rVP252-417 polyclonal serum was used as primary.
The assay data plotted are mean value of duplicate + deviations.
3.5 DEVELOPMENT OF RAPID DIPSTICK DIAGNOSTIC
ASSAY FOR DETECTION
Prototype of dipstick device was developed (Figure 3.28) and
assayed. Briefly, the prototype contains a test line of capture rabbit anti-
VP252-417 polyclonal and a control line with goat-anti mouse IgG on nitro
cellulose membrane. The sample adsorbent pad contains detection reagent
with colloidal gold conjugated monoclonal anti-VP252-417 antibody
(3A11A2).The IBDV infected processed bursal sample will be drawn in the
adsorbent pad and any native antigen present will bind with the colloidal gold
conjugated monoclonal and will be carried further across the test and control
line. The indication of positive reaction will be seen as two dark magenta
coloured lines in test and control regions respectively. The negative reaction
![Page 160: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/160.jpg)
135
will be represented as a single magenta colored line in the control region.
Rapid dipstick diagnostic assay for IBDV detection was optimized using
rabbit anti-VP252-417 polyclonal and 3A11A2 monoclonal as capture and
detection antibody respectively. Purified rVP252-417 and IBDV was used as
standard test antigen.
Figure 3.28 Dipstick Prototype Device
It contains test and control line with capture rabbit anti-VP252-
417 polyclonal and goat-anti mouse IgG respectively on nitro
cellulose membrane. The sample adsorbent pad contains
colloidal gold conjugated monoclonal anti-VP252-417 antibody
(3A11A2) for detection. The test is confirmed positive with two
dark magenta coloured lines in test and control regions
respectively and negative reaction with a single magenta
coloured line in the control region. (a). Dipstick device
assembly; (b). Dipstick prototype
![Page 161: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/161.jpg)
136
The minimal detection limit of the dipstick assay, based on the
reactivity of dipsticks in samples containing various concentrations of the
purified rVP252-417 and IBDV antigen, was 50 ng/mL and 250 ng/mL of
sample respectively. Finally IBDV infected bursal samples were tested as a
means to develop field-mode-rapid diagnostic prototype as the same with
recombinant antigens gave promising sensitivity and specificity. The samples
tested in this fashion showed a sensitivity of (60%) and high levels of
specificity (100%).
![Page 162: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/162.jpg)
137
CHAPTER 4
DISCUSSION
During the last decade, the proportion of chicken meat in the
overall meat market has increased phenomenally because of lower price and a
positive health consciousness among consumers. Consumer demand in the
area of food safety appears to be for a product without “chemicals” and
without pathogens. Consumers also expect chicken meat to be produced from
flocks in which the needs of animal health and welfare have been fulfilled. In
this regard, much interest in research has been given to chicken health,
focusing on diagnosis and characterization of the infectious pathogens
(mainly viruses) and more recently on ‘vaccination’ strategies. The efficacy
of vaccination can be significantly hampered by virus infections affecting the
chicken’s immune system. Among these, IBDV is one of the most important
infectious virus. Although first observed about 40 years ago, “Gumboro
disease” continues to pose an important threat to the commercial poultry
industry. The control of the disease has unfortunately not been successful till
now.
The virus causes an acute disease in chickens which leads to high
morbidity and mortality in susceptible chickens. In addition, the virus induces
immunosuppression which increases the susceptibility of chickens to other
pathogens and decreases vaccination efficacy, which is a major disease
control measure in this industry. Despite all efforts with improved bio-safety
practices and vaccination, the virus is still pandemic. Currently, live
attenuated or inactivated whole virus vaccines are widely used in the field.
![Page 163: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/163.jpg)
138
However, there is always a possibility of reversion to virulence in case of live
vaccines and accidental wrong inactivation poses a threat of disease incidence
in the field. Both these drawbacks can be overcome by the use of highly
immunogenic recombinant vaccine, which is safer and more efficacious to
control IBD. Selecting appropriate antigens is vital in the design of an
effective IBDV vaccine. The complete genome sequence of IBDV and the
characterization of most of the structural proteins were helpful in selection of
putative vaccine candidates. VP2 protein, containing most of the
neutralization sites, is the primary host-protective immunogen of IBDV and
has been the target protein for recombinant vaccine studies using a variety of
different expression systems (Darteil et al 1995, Tsukamoto et al 1999, Butter
et al 2003, Huang et al 2004). In this dissertation the major antigenic protein
VP2, has been exploited to develop subunit protein and DNA vaccines for
IBDV and also to develop an efficient diagnostic tool to detect IBDV
infection in chickens.
4.1 SUBUNIT PROTEIN VACCINE (VP252-417)
Recent advances in immunomics have led to the identification of
antigenic regions that can be used as subunit vaccines. The present study
attempts to circumvent the dual difficulty in culturing virus isolated from
clinical samples and amplifying full length VP2 gene with the single plausible
option of using immunogenic regions of VP2 for subunit vaccine
development.
In this study, attempts were made to develop a VP2 subunit
vaccine encoding immunodominant regions and study its efficacy in chicken
models against viral challenge. Restriction digestion of 366 bp RT-PCR
amplicons of capsid gene obtained from IBDV infected bursal samples were
subjected to digestion with Bsa I and Bfa I restriction enzymes to confirm the
VP2 fragment. The sizes of the restriction fragments, 299 and 67 bp produced
![Page 164: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/164.jpg)
139
by Bsa I digestion and 253 and 113 bp released by Bfa I digestion confirmed
the specificity of the RT-PCR reaction. Liu et al (2000) also confirmed the
specificity of the IBDV amplicons using digoxigenin-labeled 491bp nested
PCR product as probe for in situ hybridization (ISH) to detect and localize
IBDV RNA in formalin-fixed, paraffin-embedded Bursae of Fabricius from
both experimentally infected as well as commercially reared chickens.
The orientation of the 366 bp insert was examined by PCR. The
sizes of the amplicons obtained by the combination of T7 forward and insert
reverse primers – 550 bp and insert forward and T7 reverse primers – 433 bp
confirmed the orientation. In this way, both orientation and the correct size of
the cloned fragment are determined simultaneously (Dooley et al 1993).
The BLAST analysis of the 366 bp nucleotide sequence of VP2
gene obtained from IBDV in the present study revealed 98–99% homology
with other isolates of IBDV reported earlier in the GenBank. Cent percent
similarity of the deduced amino acid sequence of 366 bp with other global
isolates indicated that the changes at the nucleotide level resulted only in
silent mutations. Earlier, Kataria et al (1999) reported a 552 bp RT-PCR
amplified product, comprising the complete variable region of the VP2 gene,
to be similar to very virulent viruses from European and other Asian
countries.
The VP2 fragment clone (VP252-417) was further expressed,
purified and characterized using T7 expression system. The recombinant
VP252-417 was expressed as a fusion protein of 21 kDa with N-terminal
histidine tag which was confirmed using anti-his monoclonal antibody as the
primary antibody in the western blotting. The expression of proteins in the T7
expression system facilitates an easy one step purification on Ni2+
immobilized columns. Thus the rVP252-417 was purified using Immobilized
Metal Affinity Chromatography. SDS-PAGE gel electro-elution method of
![Page 165: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/165.jpg)
140
protein purification could obtain high concentration of purified recombinant
protein (Nanni et al 2005). Electro-eluted recombinant 3AB1, a non-structural
protein of foot-and mouth disease virus was used to develop an indirect
ELISA for differentiating animals infected with foot-and-mouth disease virus
(FMDV) from vaccinated animals (Nanni et al 2005). The sensitivity and
specificity of the assay was 97.5 and 100 % respectively. Moreover electro-
eluted method yielded more purified protein than the IMAC. Therefore,
purification of rVP252-417 was also carried out using SDS-PAGE gel electro-
elution. Both the methods yielded high quality purified rVP252-417, which was
confirmed through western blot analysis.
`The antigenic sites on a protein are fundamental to elicit humoral
immune response and can be used as antigens for developing sub unit vaccine
(He et al 2004). In the present study, analysis of the deduced amino acid
sequence of 366 bp by different epitope prediction softwares revealed four
probable epitopes carrying both B and T epitopes involved in eliciting
immune response. The reactivity of the recombinant VP252-417 with sera from
IBDV infected and vaccinated chickens further suggested that the conserved
N-terminal region is immunodominant and gets exposed to the immune
system of chickens. A similar strategy has been widely applied for epitope-
based vaccines in various viral, bacterial and parasitic diseases which showed
potent responses compared to whole protein (Srinivasan et al 2004,
Madhumathi et al 2010). The high antibody titre induced by the 122 amino
acid of VP2 protein in chickens in our study confirmed its immunogenicity.
Mundt et al (2003) has shown that recombinant VP2 protein has protective
efficacy on par with the cell cultured attenuated strains and similarly the
subunit recombinant VP2 fragment used in our experiments have shown high
anti-IBDV titres against commercial vaccine strains.
![Page 166: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/166.jpg)
141
Earlier studies have shown that passive antibodies to VP2
neutralise the IBDV, protecting the chicks from active infection (Fahey et al
1989, Lukert et al 1991, Vakharia et al 1993). An interesting observation by
Maw et al (2008) shows that chicks free from IBDV vaccination carried
antibodies to neutralise virulent infectious strains through natural harbouring
of IBD like virus. Thus the presence of antibodies against VP2 or IBD whole
virus could indicate protective response against IBDV infection. In the current
study, immunization with recombinant VP252-417 elicited higher antibody titre
in SAN chicks compared to whole attenuated viral vaccines and hence could
be effective in protection.
Since, reactivity of antibodies raised against rVP2 epitope subunit
to the field isolate is a requisite for protective humoral response, we analyzed
the cross-reactivity of the anti-VP252-417 sera with the whole virus antigens
isolated from the infected bursa which showed binding to a 54 kDa protein,
representing the VPX- the precursor of full length VP2.
Further, the recognition of anti-VP252-417 with the whole virus in
the commercially available vaccine strains was analyzed, which showed
significantly high reactivity with the IBDV vaccines and vice versa. Similarly,
a reverse verification of sera from IBDV virus vaccinated chicks against
recombinant VP252-417 also showed significant cross reactivity. Additionally,
the observation from splenocyte assays has shown high levels of T cell
proliferation confirming the presence of T epitope in rVP252-417 recognized in
chicken. This indicates the augmentation of the immune function through cell
mediated response, suggesting the multi-epitope nature of the selected VP2
region.
![Page 167: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/167.jpg)
142
Elaborate immune responses have not been studied for IBD virus
vaccination in the light of protective epitope search. The present study with
the putative VP2 epitope region confirms its immunogenic potential in
eliciting active humoral and cell mediated immune responses. Further, the
reactivity of anti-VP252-417 sera with whole IBD virus from various sources in
addition to high antibody titer shows the presence of immunodominant B cell
epitopes encompassing VP252-417 region that confirms the epitope prediction
result (Srinivasan et al 2004, Van Regenmortel 2006).
The challenge study against vIBDV infection in the immunized
chickens showed that the recombinant VP252-417 conferred 100% protection
confirming its efficacy as subunit vaccine for IBDV. Surprisingly, the
commercial “intermediate” vaccine strains showed only ~55-60% protection
which was significantly lesser than that of recombinant protein. Moreover,
only 20-25% of chickens immunized with these vaccines showed score 0 in
the histopathological analysis of bursa with an average of 1.5 BF lesion score.
This could be explained since the live attenuated IBD vaccine can itself result
in bursal damages (Mazariegos et al 1990).
Presently, the whole attenuated IBDV is used for field vaccination,
which involves strenuous maintenance of virus through passages in selected
cultures. Besides, this conventional method carries the possible risk of bursal
atrophy and immunosuppression, augmenting the need for better and safer
IBD vaccines. A recombinant method of vaccination is more economical,
considering the growing demands of poultry consumption in the world. Here,
we have shown that the rVP52-417 carrying dominant epitopes is effective in
protecting against IBDV infection and thus could be a promising subunit
vaccine.
![Page 168: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/168.jpg)
143
4.2 VP2 SUBUNIT DNA VACCINE (VP252-417)
The administration of naked nucleic acids into animals is
increasingly being used as a research tool to elucidate mechanisms of gene
expression and the role of genes and their cognate proteins in the pathogenesis
of disease in animal models. Naked DNA is an attractive non-viral vector
because of its inherent simplicity. It can be easily produced in bacteria and
manipulated using standard recombinant DNA techniques. It shows very little
dissemination and transfection at distant sites following delivery and can be
re-administered multiple times into mammals (including primates) without
inducing an antibody response against itself (i.e., no anti-DNA antibodies
generated). Also, long-term foreign gene expression from naked plasmid
DNA (pDNA) is possible even without chromosome integration if the target
cell is post-mitotic (as in muscle) or slowly mitotic (as in hepatocytes) and if
an immune reaction against the foreign protein is not generated (Wolff et al
1990). Direct injection of plasmid DNA expressing a protein of a pathogen
has been observed to be a novel and an effective modality of vaccination
(Wolff et al 1990). Immunization with DNA vaccines leads to the uptake of
plasmids by host cells and expression of the protein (Wolff et al 1990).
The expressed protein has been observed to enter the antigen
presenting pathways, resulting in strong and persistent cellular and humoral
immune responses. Sometimes the isolation of enough pure protein for
vaccination is time-consuming and in such instances, genetic immunization
may be both time and labour-saving in producing antibodies and may offer a
unique method for vaccination (Tang et al 1992). DNA based vaccines that
induce antigen expression in vivo may ameliorate pitfalls associated with
subunit, live and attenuated vaccines.
![Page 169: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/169.jpg)
144
DNA vaccines have been successfully administered to confer
protection against bacterial (Cornell et al 1999), viral (Hooper et al 2000)
and parasitic diseases such as Schistosomiasis (Dupre et al 1999) in various
animal models. In chickens DNA vaccines have conferred protection against
several viral disease like Marek’s disease (Tischer et al 2002), Infectious
bronchitis (Yang et al 2009) and H5N1 Avian influenza (Rao et al 2008) etc.
Direct administration of plasmid DNA encoding an antigen represents an
attractive approach to vaccination against infectious diseases, particularly in
developing countries where easy-to-handle and cost-effective vaccines are
needed. The strong and long-lasting antigen-specific humoral (antibodies) and
cell-mediated (T help, other cytokine functions and cytotoxic T cells) immune
responses induced by DNA vaccines appear to be due to the sustained in vivo
expression of antigen, efficient antigen presentation and the presence of
stimulatory CpG motifs. These features are desirable for the development of
prophylactic vaccines against numerous infectious agents.
Hence, VP52-417 was also cloned into the DNA vaccine vector
pVAX1, as described earlier. The recombinant construct pVAX- VP52-417 was
purified in large-scale and the transient expression was confirmed in CHO
cell lines
In order to assess the fate of the injected DNA in the immunized
chickens, tissue distribution analysis was performed. The results of this study
revealed that immediately after injection, plasmid DNA was distributed
throughout multiple tissues of chicken, whereas at later time points DNA
persisted mainly within muscle tissue. The finding that plasmid DNA was
rapidly detected systemically and later found primarily at the injection site is
consistent with other reports of direct introduction of DNA by intramuscular
injection of fish (Garver et al 2005) mice (Parker et al 1999) and sheep (Mena
et al 2001). Therefore it is likely that the mechanism of plasmid dispersal is
![Page 170: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/170.jpg)
145
similar for chickens and these animals. Studies with vertebrates have
indicated that the circulatory system is a possible route for the dispersal of
plasmid DNA after intramuscular vaccination (Parker et al 1999; Mena et al
2001). Likewise, the dispersal of DNA plasmids in chickens may well occur
via the circulatory system. In our study, plasmid DNA was detected in the
various distal tissues, which after injection would have been distributed via
the circulatory system. Plasmid DNA persisted in the muscle tissue as long as
42 days; however, no plasmid DNA was detected beyond 28 days after
vaccination in all other tissues analyzed with a 10 g of vaccine dose,
suggesting that the plasmid was either absent or below the detection limit.
Hulse and Romero (2002) have shown expression of IBDV capsid
protein in muscle tissue by using an indirect immunofluorescence assay. The
present study indicated that DNA vaccine construct was intact in a wide range
of chicken tissues including thymus, spleen, and bursa of Fabricius up to 28
days post-injection. These results demonstrate that plasmid DNA injected
directly into the pectoral muscle of chickens is transcribed and translated at
the injection site and promptly distributed to primary and secondary lymphoid
tissues.
Expression of the DNA encoded antigens was confirmed in
chicken muscle near the site of injection at different time-points up to 42 days
by RT-PCR,. However it is not clear from these data whether protein is
readily accessible to antigen-presenting cells after synthesis and makes
transfected cells as targets for destruction by phagocytic cells. Further
immune-histochemical analyses are required to elucidate the mechanism
activated by the DNA encoded antigen. The plasmid DNA, was not only
immediately distributed to multiple tissues, but was persistent for a long
period. In contrast, in the case of DNA vaccination in fishes the injected DNA
usually gets rapidly cleared from the peripheral sites and is only retained in
![Page 171: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/171.jpg)
146
muscle tissue (Garver et al 2005). The absence of histopathologic changes at
the 42-day time point is a positive indication for the safety of this vaccine in
chickens.
The humoral and cellular responses elicited against the DNA
construct of pVAX- VP52-417 was carried out in the immunized chicken to
analyze the immunogenicity of the vaccine construct. Since DNA vaccines
are intracellular antigens known to elicit higher Th1 responses and poor Th2
responses, the antibody responses elicited by pVAX VP52-417 was lesser
compared to protein vaccine. However, the T cell responses were significantly
high as expected which is highly essential for viral infection.
In order to evaluate the prophylactic efficacy of the DNA vaccine,
viral challenge study was performed in immunized and unimmunized
chickens. The results showed a promising 75% protection for pVAX VP52-417
indicating a potential use for the DNA vaccine construct. In comparison, the
protein vaccine showed 100% protection which proves clearly that the protein
vaccine is more efficient than the DNA vaccine. However, DNA vaccine has
other advantages like ease and lower cost of production, ease in transport and
storage due to long term stability. Additionally, DNA vaccines elicit potent T
cell responses needed for memory response and viral clearance.
4.3 DEVELOPMENT OF VP2 MONOCLONAL ANTIBODIES
FOR ANTIGEN DETECTION
With the mutations of infectious bursal disease virus, the new
variant strains and subtypes come out ceaselessly. Hence an ongoing research
is required in the prevention and control of IBD. The laboratory diagnoses of
the suspected IBD specimens are very crucial to accurately grasp the
epidemic situation of IBDV and develop effective precautionary measures. As
for the diagnosis of IBDV, the infected bursa samples should be collected in
![Page 172: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/172.jpg)
147
the epidemic areas, and then transported to the specialized laboratories for
diagnosis. There is a wide lacuna for IBD diagnosis in developing countries
owing to ambiguity resulting from transportation of putrid specimens, false
negative tests from improper preservation of the specimens etc., However,
among the current diagnostic methods of IBDV, the methods such as virus
isolation, neutralization tests, indirect ELISA, RT-PCR, etc. must be
completed in the laboratories on certain conditions. Moreover, with a current
scenario of grass-roots inspection institutions devoid of advanced detecting
equipments and specialized technical personnel along with vast livestock and
poultry farms in India, creates a greater need for developing rapid and simple
diagnostic methods, which can be operated on the wild and field without
professionals and equipments.
Because binding of an antibody to an antigen is dependent on the
recognition of specific amino acid epitopes by the antibody, in this regard
mAbs technology has facilitated the development of sensitive and specific
tests for the detection of many microbial and viral antigens in clinical
specimens. Several immunological techniques that incorporate the use of
mAbs have been described, including ELISA (Czeruy and Eichhorn, 1989;
McNulty et al 1984), IFA, and fluorescent-antibody assay (Heckert et al
1990), immune-histochemical staining of fixed tissues (Unicom et al 1989),
and immune-blot assays (Herbrink et al 1982). In this study, an attempt was
made to develop a monoclonal antibody based diagnostic test for IBDV
detection. Monoclonal antibodies were developed for an immunodominant
region of IBDV capsid protein VP2 (VP252-417). A serological test (Sandwich
ELISA) was carried out using these mAbs which assessed the detection
sensitivities of purified IBDV and IBDV-infected bursal tissues.
![Page 173: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/173.jpg)
148
The results showed that the antigen preparations containing the
expressed VP252-417 of IBDV capsid protein could induce the production of
mAbs. After screening and sub-cloning, the five mAbs directed against VP252-
417 were isolated and characterized by analyzing the reactivity with
recombinant VP252-417 and purified IBDV, affinity and avidity to recombinant
antigen. All the five mAbs were able to react with recombinant VP252-417 and
purified IBDV in indirect ELISA under denaturing conditions. Further all of
them showed reactivity with recombinant VP252-417 in western blot indicating
that the recognized epitopes were not affected by the denatured protein. The
mAbs also bound the full length recombinant VP2 in western blot which
extend their capacity for detecting IBDV.
It is vital to detect IBDV antigen in the infected bursal at low
concentration to identify active IBDV infection, which needs high affinity of
the mAbs towards antigen. Indirect ELISA was used for studying the
association-dissociation equilibrium between a monoclonal antibody and the
corresponding antigen, and to measure the concentration of free antibody at
equilibrium, that gave reliable values of the real dissociation (or affinity)
constants of the system in solution. Because of the very high sensitivity of the
indirect ELISA, it was possible to measure very small concentrations of free
antibodies. This gave easy access to dissociation constants as low as about 10-
9M. Three of the mAbs 3A11A2, 1C7F12 and 2C6H2 showed high affinity
towards the rVP252-417 with dissociation constants about 10-9
M, thus specific
to IBDV with minimal cross-reactivity. While affinity is an absolute
thermodynamic measure of the strength of interaction determined at
equilibrium, avidity can be defined as a more relative measure of the strength
of interaction which is a function of antigenic valence and structure, antibody
bivalence, the concentrations of antibody and antigen, and affinity. Affinity of
polyclonal antisera cannot be determined, but relative avidity of polyclonal
antisera can be estimated by using so-called avidity ELISAs in which the
![Page 174: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/174.jpg)
149
ability of chaotropic agents (such as urea) to disrupt antigen antibody
interactions is determined (Binley et al 1997 (a); Gray et al 1993; Richmond
et al 1998). Urea displacement ELISAs demonstrated that the avidity of the
mAbs towards the rVP252-417 and purified IBDV which showed mAb 3A11A2
with high avidity index of 69.8% and 48% respectively, while the mAbs
6E6B12 and 8G5C6 showed very less avidity index. It is possible that the
marked difference in antibody responses elicited by immunization of antigen
reflect fundamental differences in the epitopes present in them and their
interaction with the immune system. The lower avidity index of the two
monoclonal antibodies could be due to the difference in the binding sites.
Two of the monoclonal antibodies, namely 3A11A2 and 1C7F12
showed better reactivity with recombinant and purified IBDV antigen with
higher affinity and avidity to recombinant antigen. These mAbs were thus
used for validating capture assay as individual antibody and in combination.
The assay showed higher sensitivity when mAbs were used in combination.
The two mAbs recognize two different epitopes in rVP252-417 protein, leading
to synergistic binding that allows a more stable antigen-antibody interaction
and shows higher sensitivity in combination. Further these two mAbs were of
IgG2 class. As the affinity to the antigen of IgG is higher than that of the IgM
antibody, this suggests that these mAbs can be used widely for serological
tests.
4.4 DEVELOPMENT OF PROTOTYPE ANTIGEN BASED
IMMUNO-DIAGNOSTICS FOR INFECTIOUS BURSAL
DISEASE
Infectious bursal disease has been a great concern for the poultry
industry for a long time, but particularly for the past decade. Indeed, its
“reemergence” in variant or highly virulent forms has been the cause of
significant economic losses (Van den Berg et al 2000). Rapid diagnostic
![Page 175: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/175.jpg)
150
procedures are essential and emphasized for early detection, proper
surveillance and eradication of the disease. An immunological assay like
indirect ELISA has been used to detect IBDV specific antibodies in chicken
serum (Howie and Thorsen, 1982). Commercially available ELISA kits for
antibodies to IBDV strains detect antibodies to both serotypes 1 and 2 in
addition to all the known subtypes of serotype 1 viruses (Ismail and Saif,
1990). Identification of antibodies to different antigenic subtypes of IBDV is
currently possible only by the VN assay (Jackwood and Saif, 1987). Thus, an
immune response to antigenic variants of IBDV cannot be distinguished from
an immune response to other antigenic types of IBDV or serotype 2 viruses
with ELISA kits. Jackwood et al (1990) showed that recombinant VP2 based
ELISA appeared to be more sensitive than the commercial ELISA kits in
detecting antibodies to the IBDV. The antibody assays based on recombinant
VP2 have shown improved sensitivity and specificity, than that based on
purified IBDV antigen (Singh et al 1997). Antibody assays using recombinant
VP2, were evaluated in a multi-centre trial (Martínez-Torrecuadrada et al
2000, Dey et al 2009). However, the specificity of the tests has been reported
to be a great concern since they cannot distinguish current infection from past
infection or exposure to the IBDV.
Hence, there is a need to develop effective diagnostics for
detection of active infections by IBDV. In the present study, monoclonal
antibodies against the rVP252-417 have been used to develop a sandwich
ELISA to detect IBDV antigen in chicken. Capture assay was developed with
rVP252-417 monoclonal as capture antibody and rabbit anti-rVP252-417
polyclonal as detection antibody and validated against recombinant as well as
purified IBDV antigen. The assay showed high sensitivity. Rapid dipstick
diagnostic assay for the rapid detection of IBDV antigen was optimized using
3A11A2 and 1C7F12 monoclonal antibodies as capture and detection
antibody and pure rVP252-417 protein was used as standard test antigen. IBDV
![Page 176: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/176.jpg)
151
positive samples were tested as a means to develop field-mode-rapid
diagnostic prototype which showed the promising sensitivity and specificity.
The samples tested in this fashion showed a moderate sensitivity of 60% and
100% specificity. An extensive on-the-field trials (with samples procured and
tested immediately) in the future could enhance sensitivity and remedy
existing limitation when fresh samples are used.
![Page 177: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/177.jpg)
152
CHAPTER 5
CONCLUSION
5.1 CHARACTERIZATION OF RECOMBINANT VP252-417 AND
IMMUNE RESPONSE STUDIES IN CHICKEN
The fragment of IBDV capsid protein VP2 (VP252-417) carrying
putative immunodominant epitopes was cloned and expressed in
E. coli. The recombinant VP252-417 was purified using gel elution
and IMAC.
The immune responses of rVP252-417 were compared with two of
the attenuated IBDV commercial vaccines. The humoral
immune responses showed that immunization with recombinant
rVP252-417 elicited higher antibody titre in SAN chicks compared
to whole attenuated viral vaccines.
In the direct binding assay, anti-VP252-417 showed significantly
high reactivity with the whole virus in the commercially
available IBDV vaccine strains. Similarly, a reverse verification
of sera from IBDV virus vaccinated chicks against recombinant
VP252-417 also showed significant cross reactivity.
The cellular immune responses based on proliferation data
showed high levels of T cell proliferation confirming the
presence of T epitope in rVP252-417 recognized in chicken.
The challenge study against vIBDV infection in the immunized
chickens showed that the recombinant VP252-417 conferred 100%
protection confirming its efficacy as subunit vaccine for IBDV.
![Page 178: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/178.jpg)
153
5.2 CHARACTERIZATION OF RECOMBINANT VP252-417 AS
DNA VACCINE
The efficacy of VP252-417 as DNA vaccine was studied by sub
cloning the VP2 fragment in DNA vaccine vector pVAX1. The
recombinant construct pVAX- VP52-417 was purified in large-
scale and the transient expression was confirmed in CHO cell
lines.
Tissue distribution analysis was performed to assess the fate of
the injected DNA in the immunized chickens, which revealed
that immediately after injection, plasmid DNA was distributed
throughout multiple tissues of chicken, whereas at later time
points DNA persisted mainly within muscle tissue.
The humoral responses of pVAXVP252-417 immunized chickens
was significantly higher compared to the pVAX vector
immunized chickens but lesser compared to the rVP252-417
protein immunized chickens. The cellular immune response for
pVAXVP252-417 was significantly higher compared to the pVAX
immunized chickens.
In the viral challenging studies pVAXVP52-417 showed a
promising 75% protection indicating a potential use for the
DNA vaccine construct.
5.3 DEVELOPMENT OF MONOCLONAL ANTIBODY FOR
THE DETECTION OF IBDV
Monoclonal antibodies were developed for an immunodominant
region of IBDV capsid protein VP2 (VP252-417). All monoclonal
hybridoma clones were screened against rVP252-417 as well as
![Page 179: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/179.jpg)
154
purified IBDV. Five mAbs were selected for the
characterization.
In the isotyping ELISA it was found that all the sclones
belonged to IgG2b class except clone 6E6B12 which belonged
to IgM class isotype. Three of the mAbs 3A11A2, 1C7F12 and
2C6H2 showed high affinity towards the rVP252-417 with
dissociation constants of about 10-9
M, thus being specific to
IBDV with minimal cross-reactivity. Urea displacement
ELISAs demonstrated that the mAb 3A11A2 towards rVP252-417
and purified IBDV showed high avidity index of 69.8% and
48% respectively, while the mAbs 6E6B12 and 8G5C6 showed
very less avidity index.
Sandwich assay was developed with VP252-417 monoclonal as
capture antibody and anti-VP252-417 polyclonal as detection
antibody. The response of sandwich ELISA was tested with
rVP252-417 and purified IBDV. The minimal detection limit of
the sandwich assay, based on the reactivity of samples
containing various concentrations of the rVP252-417 and IBDV
antigen, was 50 ng/mL and 250 ng/mL respectively.
The dipstick was tested with IBDV positive samples and
showed 60% sensitivity and 100% specificity.
![Page 180: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/180.jpg)
155
5.4 FUTURE DIRECTIONS
5.4.1 Part I – Bimodal Vaccine (Combination of rVP252-417 and
pVAXVP252-417)
The current study has shown that rVP252-417 and pVAXVP252-417
are effective protein and DNA vaccines conferring protection of
100% and 75% respectively. Further, the protection efficacy of the
DNA vaccine can be enhanced by bimodal vaccine strategy with a
booster of protein vaccine rVP252-417 making it both long lasting
and efficacious. Also, dominant epitopes from other antigens like
VP3 can be combined with VP2 to make it multi-antigen targeted
approach.
5.4.2 Part II – Development of monoclonal antibody using
immunodominant region of VP3
The mAbs developed using rVP252-417 showed high efficiency in
detecting IBDV. Therefore developing monoclonal antibody using
immunodominant region of IBDV capsid protein VP3 can further
enhance the detection of IBDV.
![Page 181: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/181.jpg)
156
APPENDIX 1
GENOTYPES OF BACTERIAL STRAINS
S. No Strain Description Genotype Uses
1.E. coli
DH5
An Hoffman-Berling 1100strain derivative
(Meselson68) . Nalidixic
acid resistant
F- endA1 glnV44 thi-1
recA1 relA1 gyrA96 deoR
nupG 80dlacZ M15
(lacZYA-argF)U169,
hsdR17(rK- mK
+), –
Plasmid
maintenance
2.
E. coli
BL21
(DE3)
E. coli B strain with DE3, a prophage (lysogen)
carrying the T7 RNA
polymerase gene under
control of lacUV5
promoter and lacIq gene
F– ompT gal dcm lon
hsdSB(rB- mB
-) (DE3 [lacI
lacUV5-T7 gene 1 ind1
sam7 nin5])
IPTG-induced highlevel
expression
3.
E. coli
BL21(DE3)
plysS
Carries pLysS plasmidencoding T7 phagelysozyme, an inhibitor for
T7 polymerase which
reduces expression andprovides tighter control of
protein expression.
Chloramphenicol resistant
F- ompT gal dcm lon
hsdSB(rB- mB
-) (DE3)
pLysS(cmR)
IPTG-inducedcontrolled
expression
4.E. coli
GJ1158
T7 RNA polymerase geneunder salt inducible proU
promoter
ompT hsdS gal dcmmalAp510 malP::(proUp-
T7 RNAP) alQ::lacZhyb11
(zhf-900::Tn10dTet
Salt (NaCl)induced high
levelexpression of
soluble
proteins
![Page 182: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/182.jpg)
157
APPENDIX 2
VECTOR MAP OF pRSET
![Page 183: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/183.jpg)
158
APPENDIX 3
VECTOR MAP OF pVAX1
![Page 184: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/184.jpg)
159
REFERENCES
1. Abdel-Alim G.A. and Saif Y.M. “Detection and persistence of
infectious bursal disease virus in specific-pathogen-free andcommercial broiler chickens”, Avian Dis., Vol.45, pp.646-654, 2001.
2. Aini H. Hairul, Omar A.R., Hair-Bejo M. and Aini I Green I.
“Comparison of Sybr ELISA and conventional agarose gel-based PCR
in the detection of infectious bursal disease virus”, Vol. 163, No. 5,pp. 556-563, 2008.
3. Ajinkya S.M., Survashe B.D. and Sardeshpande P.D. “Breakdown in
immunity to Ranikhet disease (Newcastle disease) with infectious
bursal disease (Gumboro disease) in broiler chicks”. Indian Vet. J.,Vol.57, pp. 265-269, 1980.
4. Akin Aydemir, Wu Ching Ching and Lin Tsang Long “A comparison
of two RNA isolation methods for double-stranded RNA of infectious
bursal disease virus”, Journal of Virological Methods, Vol.74, No.2,pp.179-184, 1998.
5. Alexander, D.J., Chettle, N.J., “Heat inactivation of serotype 1
infectious bursal disease virus”. Avian Pathol., Vol.27, pp. 97-99,1998.
6. Allan G.M., McNulty M.S., Connor T.J., McCracken R.M. and
McFerran J.B. “Rapid diagnosis of infectious bursal disease infection
by immunofluorescence on clinical material”, Avian Pathol. Vol.13,No.3, pp.419-427, 1984.
7. Altschul S.F., Gish W., Miller W., Myers E.W. and Lipman D.J.
“Basic local alignment search tool”, Journal of Molecular Biology,
Vol. 215, pp. 403-410, 1990.
8. Amakye-Anim J., Lin T.L., Hester P.Y., Thiagarajan D., Watkins B.A.
and Wu C.C. “Ascorbic acid supplementation improved antibody
response to infectious bursal disease vaccination in chickens”, Poult
Sci., Vol.79, No.5, pp.680-688, 2000.
![Page 185: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/185.jpg)
160
9. Anil T.M., Shankar K.M. and Mohan C.V., ‘Monoclonal antibodies
developed for sensitive detection and comparison of white spot
syndrome virus isolates in India’, Diseases of Aquatic Organisms,Vol.51, pp. 67-75, 2002.
10. Ather M. A. “Infectious bursal disease in chicken”, Poult, Advisor.,Vol.26, No.12, pp.27-30, 1993.
11. Azad A. A., Jagadish M. N., Brown M. A. and Hudson P. J. “Deletion
mapping and expression in Escherichia coli of the large genomic
segment of a birnavirus”, Virology, Vol.161, pp. 145-152, 1987.
12. Azad A. A., McKern N. M., Macreadie I. G., Failla P., Heine H. G.,
Chapman A., Ward C. W. and Fahey K. J. “Physicochemical and
immunological characterization of recombinant host-protective antigen
(VP2) of infectious bursal disease virus”,. Vaccine, Vol.9, pp. 715-722,
1991.
13. Azad A.A., Jagadish M.N., Brown M.A. and Hudson P.J. “Deletion
mapping and expression in Escherichia coli of the large genomicsegment of a birnavirus”, Virology, Vol.161, No.1, pp. 145-152, 1987.
14. Baskar L. K., Srikanth T. R., Suba S., Mody H. C., Desai P. K. and
Kaliraj P. “Development and evaluation of a rapid flow through
immunofiltration test using recombinant filarial antigen for diagnosis
of brugian and bancroftian Filariasis”, Microbiol. Immunol., Vol. 48,No. 7, pp. 519-525, 2004.
15. Bayliss C.D., Peters R.W., Cook J.K., Reece R.L., Howes K., Binns
M.M. and Boursnell M.E., “A recombinant fowlpox virus that
expresses the VP2 antigen of infectious bursal disease virus induces
protection against mortality caused by the virus. Arch. Virol., Vol.120,pp. 193-205, 1991.
16. Becht H. “Infectious bursal disease virus”, Curr Top Microbiol
Immunol., Vol.90, pp.107-121, 1980.
17. Becht H., Muller H. and Muller H. K. “Comparative studies on
structural and antigenic properties of two serotypes of infectious bursaldisease virus”. J. Gen. Virol., Vol.69, pp. 631-640, 1988.
18. Benton W.J., Cover, M. S. and Rosenberger J. K. “ Studies on the
transmission of the infectious bursal agent (IBA) of chickens”. Avian
Dis., Vol.11, pp. 430-438, 1967.
![Page 186: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/186.jpg)
161
19. Bhandari P. and Gowrishankar J. “An Escherichia coli host strain
useful for efficient overproduction of cloned gene products with NaCl
as the inducer”, J. Bacteriol., Vol. 179, No.13, pp.4403-4406, 1997.
20. Biao Qian and Frederick S.B. Kibenge “Observations on polymerase
chain reaction amplification of infectious bursal disease virus dsRNA”,Journal of Virological Methods, Vol.47, No.1-2, pp.237-242, 1994.
21. Binley J.M., Arshad H., Fouts T.R. and Moore J.P. “An Investigation
of the High-Avidity Antibody Response to Glycoprotein 120 of
Human Immunodeficiency Virus Type 1”, AIDS Research and HumanRetroviruses, Vol. 13, No. 12, 1997.
22. Birghan C., Mundt E. and Gorbalenya A.E. “Anon-canonical lon
proteinase lacking the ATPase domain employs the ser-Lys catalytic
dyad to exercise broad control over the life cycle of a double stranded
RNA virus”. EMBO J. Vol.19, pp. 114-123, 2000.
23. Birnboim H.C. and Doly J. “A rapid alkaline extraction procedure for
screening recombinant plasmid DNA”, Nucleic Acids Research,Vol. 7, pp. 1513-1523, 1979.
24. Boonchit S., Xuan X., Yokoyama N., Goff W.L., Waghela S.D.,
Wagner G. and Igarashi I., “Improved enzyme-linked immunosorbent
assay using C-terminal truncated recombinant antigens of Babesia
bovis rhoptry-associated protein-1 for detection of specific antibodies”,Journal of Clinical Microbiology, Vol. 42, pp. 1601-1604, 2004.
25. Bradford M.M. “A rapid and sensitive method for the quantitation of
microgram quantities of protein utilizing the principle of protein-dyebinding”, Analytical Biochemistry, Vol. 72, pp. 248-254, 1976.
26. Brown F. “The classification and nomenclature of viruses”.Intervirology, Vol.25, pp. 141-143, 1986.
27. Burkhardt E. and Muller H. “Susceptibility of chicken blood
lymphoblasts and monocytes to infectious bursal disease virus
(IBDV)’, Arch Virol., Vol.94, No.3-4, pp. 297-303, 1987.
28. Butter C., Sturman T.D., Baaten B.J. and Davison T.F. “Protection
from infectious bursal disease virus (IBDV)-induced
immunosuppression by immunization with a fowlpox recombinantcontaining IBDVVP2”, Avian Pathol., Vol.32, pp. 597-604, 2003.
![Page 187: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/187.jpg)
162
29. Cao Y.C., Shi Q.C., Ma J.Y., Xie Q.M. and Bi Y.Z. “Vaccination
against very virulent infectious bursal disease virus using recombinant
T4 bacteriophage displaying viral protein VP2”, Acta BiochimBiophys Sin (Shanghai), Vol.37, No.10, pp.657-664, 2005.
30. Cardoso T.C., Rahal P., Pilz D., Teixeira M.C.B. and Arns C.W.
“Replication of classical infectious bursal disease virus in the chicken.embryo related cell line”, Avian Pathol., Vol.29, pp.213-217, 2000.
31. Caston J.R. “C terminus of infectious bursal disease virus major capsid
protein VP2 is involved in definition of the T number for capsidassembly”. J Virol., Vol.75, pp. 10815-10828, 2001.
32. Caterina Kristen M., Salvatore Frasca Jr, Girshick Theodore and
Khan Mazhar I. “Development of a multiplex PCR for detection of
avian adenovirus, avian reovirus, infectious bursal disease virus, and
chicken anemia virus”, Molecular and Cellular Probes, Vol.18, No.5,pp.293-298, 2004.
33. Chai Y.F., Christensen N.H., Wilks C.R. and Meers J.
“Characterisation of New Zealand isolates of infectious bursal disease
virus”. Arch. Virol., Vol.146, pp. 1571-1580, 2001.
34. Chang H.C., Lin T.L. and Wu C.C. “DNA vaccination with plasmids
containing various fragments of large segment genome of infectiousbursal disease virus”, Vaccine, Vol.21, pp. 507-513, 2003.
35. Chang H.C., Lin T.L. and Wu C.C. “DNA-mediated vaccination
against infectious bursal disease in chickens”. Vaccine, Vol.20,
No.3-4, pp.328-335, 2001.
36. Chauhan H.V.S., Jha G.J., Singh U.P. and Thakur N. “Outbreaks of
infectious bursal disease (Gumboro disease) in poultry (First report inBihar state)”, Indian J. Poult. Sci., Vol.15, pp. 253-258, 1980.
37. Chettle N., Stuart J.C. and Wyeth P.J. “Outbreak of virulent infectious
bursal disease in East Anglia”. Vet Rec., Vol.125, No.10, pp. 271-272,
1989.
38. Chevalier C., Lepault J., Erk I., Da Costa B. and Delmas B., “The
maturation process of pVP2 requires assembly of infectious bursaldisease virus capsids”, J. Virol., Vol.76, pp. 2384-2392, 2002.
![Page 188: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/188.jpg)
163
39. Cho Y. and Edgar S.A. “Characterization of the infectious bursalagent”. Poultry Science, Vol.48, pp.2102-2109, 1969.
40. Cornell K.A., Bouwer H. G., Hinrichs D. J. and Barry R. A., “Genetic
immunization of mice against Listeria monocytogenes using plasmid
DNA encoding listeriolysin O”, The Journal of Immunology,Vol. 163, pp. 322-329, 1999.
41. Cosgrove S. D., “An apparently new disease of chickens—aviannephrosis”, Avian Dis., Vol.6, pp. 385-389, 1962.
42. Coulibaly F., Chevalier C., Gutsche I., Pous J., Navaza J., Bressanelli
S., Delmas B. and Rey F.A. “The birnavirus crystal structure reveals
structural relationships among icosahedral viruses”, Cell, Vol.120, pp.761-772, 2005.
43. Crowe J., Masone B.S. and Ribbe J. “One-step purification of
recombinant proteins with the 6xHis tag and Ni-NTA resin”, Mol.
Biotechnol., Vol. 4, No. 3, pp. 247-258, 1995.
44. Cruz-Coy J.S., Giambrone J.J. and Hoerr F.J. “Immunohistochemical
detection of infectious bursal disease virus in formalin-fixed, paraffin-
embedded chicken tissues using monoclonal antibody”, Avian Dis.,Vol.37, No.2, pp.577-581, 1993.
45. Cruz-Coy J.S., Giambrone J.J. and Panangala V.S. “Production and
characterization of monoclonal antibodies against variant A infectiousbursal disease virus”, Avian Is., Vol. 37, No.2, pp.406-411, 1993.
46. Czeruy C. P. and Eichhorn W. “Characterization of monoclonal and
polyclonal antibodies to bovine enteric coronavirus: establishment of
an efficient ELISA for antigen detection in feces”, Vet. Microbiol.,Vol.20, pp. 111-122, 1989.
47. Daniel Luque, German Rivas, Carlos Alfonso, Jose L. Carrascosa,
Jose F. Rodríguez and Jose R. Caston. “Infectious bursal disease virus
is an icosahedral polyploid dsRNA virus”. PNAS, Vol. 106, No. 7, pp.
2148-2152, 2009.
![Page 189: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/189.jpg)
164
48. Daniel Luque, Irene Saugar, Jose F. Rodr guez, Nuria Verdaguer,
Damia Garriga, Carmen San Martin, Javier A. Velazquez-Muriel,
Benes L. Trus, Jose L. Carrascosa, and Jose R. Caston “Infectious
Bursal Disease Virus Capsid Assembly and Maturation by Structural
Rearrangements of a Transient Molecular Switch”, Journal ofVirology, pp. 6869-6878, 2007.
49. Darteil R., Bublot M., Laplace E., Bouquet J.F., Audonnet J.C. and
Riviere, M., “Herpesvirus of turkey recombinant viruses expressing
infectious bursal disease virus (IBDV) VP2 immunogen induce
protection against an IBDV virulent challenge in chickens”, Virology,
Vol.211, pp. 481-490, 1995.
50. Davis V.S. and Boyle J.A. “Random cDNA probes to infectious bursal
disease virus”, Avian Dis., Vol.34, No.2, pp.329-335, 1990.
51. Deng X.Y., Gao Y.L., Gao H.L., Qi X.L., Wang X.Y. and Wang X.M.
“Identification of VP3 antigenic epitopes of infectious bursal diseasevirus”, Bing Du Xue Bao., Vol.23, No.4, pp.305-311, 2007.
52. Dey S., Upadhyay C., Mohan C.M., Kataria J.M. and Vakharia, V.N.,
“Formation of sub-viral particles of the capsid protein VP2 of
infectious bursal disease virus and its application for serologicaldiagnosis”, J. Virol. Methods, Vol.157, pp. 84-89, 2009.
53. Dobos P., Hill B. J., Hallett R., Kells D. T. C., Becht H. and Teninges
D. “Biophysical and biochemical characterization of five animal
viruses with bisegmented double-stranded RNA genomes”. J. Virol.,Vol.32, pp. 593-605, 1979.
54. Dolz R., Majó N., Ordóñez G. and Porta R. “Viral genotyping of
infectious bursal disease viruses isolated from the 2002 acute outbreak
in Spain and comparison with previous isolates’, Avian Dis., Vol. 49,
No.3, pp.332-339, 2005.
55. Dooley S., Seib T., Engel M. and Welter C. “A rapid method to
determine the orientation of blunt end ligated polymerase chainreaction products”, Electrophoresis, Vol. 14, pp. 662-663, 1993.
56. Dupre Herv M., Schacht A. M., Capron A. and Riveau G., “Control of
schistosomiasis pathology by combination of Sm28GST DNA
immunization and praziquantel treatment”, The Journal of InfectiousDiseases, Vol.180, pp. 454-463, 1999.
![Page 190: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/190.jpg)
165
57. Dybing J.K. and Jackwood D.J., “Antigenic and immunogenic
properties of baculovirus-expressed infectious bursal disease viral
proteins”, Avian Dis., Vol.42, pp. 80-91, 1998.
58. Elankumaran S., Heckert R.A. and Moura L. “Pathogenesis and tissue
distribution of a variant strain of infectious bursal disease virus in
commercial broiler chickens”, Avian Dis., Vol.46, No.1, pp.169-176,2002.
59. Eleuterio Lombardo, Antonio Maraver, Jose R. Caston, Jose Rivera,
Armando Fernandez-Arias, Antonio Serrano, Jose L Carrascosa, and
Jose F Rodriguez, “VP1, the Putative RNA-Dependent RNA
polymerase of Infectious Bursal Disease Virus, Forms Complexes with
the Capsid Protein VP3, Leading to Efficient Encapsidation into Virus-
Like Particles. Journal of virology, pp. 6973-6983, 1999.
60. Eterradossi N., Arnauld C., Toquin D. and Rivallan G. “Critical amino
acid changes in VP2 variable domain are associated with typical and
atypical antigenicity in very virulent infectious bursal disease viruses”,
Arch. Virol. Vol.143, pp. 1627-1636, 1998.
61. Eterradossi N., Rivallan G., Toquin D. and Guittet M. “Limited
antigenic variation among recent infectious bursal disease virusisolates from France”, Arch. Virol., Vol.142, pp. 2079-2087, 1997.
62. Eterradossi N., Toquin D., Abbassi H., Rivallan G., Cotte J.P. and
Guittet M., “Passive protection of specific pathogen free chicks against
infectious bursal disease by in-ovo injection of semi-purified egg-yolk
antiviral immunoglobulins”, Zentralbl Veterinarmed B., Vol.44, No.6,pp. 371-383, 1997.
63. Fahey K. J., Erny K. and Crooks J. “A conformational immunogen on
VP-2 of infectious bursal disease virus that induces virus-neutralizing
antibodies that passively protect chickens”. J. Gen. Virol., Vol.70,pp. 1473-1481, 1989.
![Page 191: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/191.jpg)
166
64. Fahey K.J., Chapman A.J., Macreadie I.G., Vaughan P.R., McKern
N.M., Skicko J.I., Ward C.W. and Azad A.A. “A recombinant subunit
vaccine that protects progeny chickens from infectious bursal disease”,Avian Pathol., Vol.20, No.3, pp. 447-460, 1991.
65. Fahey K.J., O'Donnell I.J. and Bagust T.J. “Antibody to the 32K
structural protein of infectious bursal disease virus neutralizes viral
infectivity in vitro and confers protection on young chickens’, J Gen
Virol., Vol.66, No.Pt 12, pp. 2693-702, 1985.
66. Faragher J.T. “Infectious bursal disease in chickens”, Vet. Bull.,
Vol.42, pp.361- 369, 1972.
67. Fodor I., Horváth E., Fodor N., Nagy E., Rencendorsh A., Vakharia
V.N. and Dube S.K. “Induction of protective immunity in chickens
immunised with plasmid DNA encoding infectious bursal disease virusantigens”, Acta Vet Hung., Vol.47, No.4, pp.481-492, 1999.
68. Francois A., Eterradossi N., Delmas B., Payet V. and Langlois P.,
“Construction of avian adenovirus CELO recombinants in cosmids”, J.Virol., Vol.75, pp. 5288-5301, 2001.
69. Frens G. “Colloidal nucleation for the regulation of the particle size in
monodisperse gold suspension”, Nature Phys. Sci., Vol. 241, pp. 20-25,1973.
70. Friguet B., Chaffotte A.F., Djavadi-Ohaniance L. and Goldberg M.E.
“Measurements of the true affinity constant in solution of antigen-
antibody complexes by enzyme-linked immunosorbent assay”, J.Immunol. Methods, Vol. 77, pp. 305-319, 1985.
71. Fukumoto S., Xuan X., Kadota K., Igarashi I., Sugimoto C., Fujisaki
K., Nagasawa H., Mikami T. and Suzuki H., “High-level expression of
truncated surface antigen P50 of Babesia gibsoni in insect cells by
baculovirus and evaluation of its immunogenicity and antigenicity”,Clinical and Diagnostic Laboratory, Vol. 10, pp. 596-601, 2003.
72. Fussell L. W. “IBD vaccination strategies: Tyson Foods”, Inc., In:
International Poultry Symposium, Summit on IBD, Athens, GA.,pp.15-16, 1995.
73. Ganesan P.I., Appaji R.V.N., Karunakaran K., Elankumaran S. and
Ramkrishna J. “Diagnosis of infectious bursal disease by detection ofviral antigen”, Cheiron, Vol.19, pp.205-208, 1990.
![Page 192: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/192.jpg)
167
74. Garcia A., Roson B. and Perez J.L., “Usefulness of PCR and antigen
latex agglutination test with samples obtained by transthoracic needle
aspiration for diagnosis of pneumococcal pneumonia”, Journal ofClinical Microbiology, Vol. 37, pp. 709-714, 1999.
75. Garver K.A., Conway C.M., Elliott D.G. and Kurath G. “Analysis of
DNA-Vaccinated Fish Reveals Viral Antigen in Muscle, Kidney and
Thymus, and Transient Histopathologic Changes”, Marine
biotechnology, Vol. 7, pp. 540-553, 2005.
76. Ghorashi Seyed A., Rourke Denise O, Ignjatovic Jagoda and
Noormohammadi Amir H. “Differentiation of infectious bursal disease
virus strains using real-time RT-PCR and high resolution melt curve
analysis”, Journal of Virological Methods, Vol. 171, No. 1,
pp. 264-271, 2011.
77. Giambrone J. J. “Broiler vaccination-additional protection is often
needed”, In: International Poultry Symposium, Summit on IBD,Athens, GA., pp.17-20, 1995.
78. Giambrone J.J. and Clay R.P. “Evaluation of the immunogenicity,
stability, pathogenicity, and immunodepressive potential of four
commercial live infectious bursal disease vaccines’, Poult Sci., Vol.65,No.7, pp.1287-1290, 1986.
79. Gowri Mangala A., Jaykumar R., Kumaran K. and Nachimuthu K.
“Avidin - biotin dot ELISA for detection of infectious bursal disease
virus antigen”, Indian Vet. J., Vol.12, pp. 103-104, 1996.
80. Granzow H., Birghan C., Mettenleiter T. C., Beyer J., Kollner B.,
Mundt E. “A second form of infectious bursal disease virus associated
tubule contains VP4. Journal of Virology, Vol.71, pp. 8879-8885,1997.
81. Granzow H., Birghan C., Mettenleiter T.C., Beyer J., Kollner B. and
Mundt, E. “A second form of infectious bursal disease virus-associatedtubule contains VP4”,. J Virol., Vol.71, No.11, pp. 8879-8885, 1997.
82. Gray B. M. and Shaw D. R. “Artifacts with the thiocyanate elution
method for estimating relative antibody avidity”, J. Immunol. Methods,Vol.157, pp. 269-271, 1993.
![Page 193: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/193.jpg)
168
83. Greenfield C. L., Dohms J. E. and Dietert R. R. “Infectious Bursal
Disease Virus Infection in the Quail-Chicken Hybrid Infectious”,
Bursal Disease Virus Infection in the Quail-Chicken Hybrid, pp. 536-542, 1986.
84. Hamoud M.M., Villegas P. and Williams S .M. “Detection of
infectious bursal disease virus from formalin-fixed paraffin-embedded
tissue by immunohistochemistry and real-time reverse transcription-
polymerase chain reaction”, J Vet Diagn Invest.,Vol.19, No.1, pp.35-42, 2007.
85. Harlow E. and Lane D. “Antibodies: A Laboratory Manual”, Cold
Spring Harbour Laboratory Press, Cold Spring Harbour, New York,1988.
86. Hassan M.K. and Saif Y.M. “Influence of the host system on the
pathogenicity, immunogenicity, and antigenicity of infectious bursaldisease virus”, Avian Dis., Vol.40, No.3, pp. 553-561, 1996.
87. Hassan M.K., Al-Natour M.Q., Ward L.A. and Saif Y.M.
“Pathogenicity, attenuation, and immunogenicity of infectious bursal
disease virus”, Avian Dis., Vol.40, No.3, pp.567-571, 1996.
88. Hathcock T.L. and Giambrone J.J. “Digoxigenin-labeled nucleic acid
probe for the detection of infectious bursal disease virus in infectedcells”, Avian Diseases, Vol.36, No.2, pp.206-210, 1992.
89. Heckert R. A., Saif L. J., Hoblet K. H. and Agnes A. G. “Development
of protein A-gold immunoelectron microscopy for detection of bovine
corona virus in calves: comparison with ELISA and direct
immunofluorescence of nasal epithelial cells”, Vet. Microbiol., Vol.19,pp. 217-231, 1990.
90. Heine H. G. and Boyle D. B. “Infectious bursal disease virus structural
protein VP2 expressed by a fowlpox virus recombinant confers
protection against disease in chickens”, Arch. Virol., Vol.131, pp.277-292, 1993.
91. Henderson K.S. and Jackwood D.J. “Comparison of the dot blot
hybridization assay with antigen detection assays for the diagnosis of
infectious bursal disease virus infections”, Avian Dis., Vol.34, No.3,
pp.744-748, 1990.
![Page 194: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/194.jpg)
169
92. Herbrink P. F., Van Bussel J. and Warnaar S. O. “The antigen spot test
(AST): highly sensitive assay for the detection of antibodies”, J.
Immunol. Methods, Vol.48, pp. 293-298, 1982.
93. Hirai K., Funakoshi T., Nakai T. and Shimakura S. “Sequential
changes in the number of surface immunoglobulin-bearing B
lymphocytes in infectious bursal disease virus-infected chickens”,Avian Dis., Vol.25, No.2, pp. 484-496, 1981.
94. Hirai K., Kunihiro K. and Shimakura S. “Characterization of
Immunosuppression in chickens by infectious bursal disease virus”.Avian Dis., Vol.23, No.4, p. 950-965, 1979.
95. Hirata H., Ikadai H., Yokoyama N., Xuan X., Fujisaki K., Suzuki N.,
Mikami T. and Igarashi I., “Cloning of a truncated Babesia equi gene
encoding an 82-kilodalton protein and its potential use in an enzyme-
linked immunosorbent assay”, Journal of Clinical Microbiology, Vol.40, pp. 1470-1474, 2002.
96. Hooper J.W., Custer D.M., Schmaljohn C.S. and Schmaljohn A.L.,
“DNA vaccination with vaccinia virus L1R and A33R genes protects
mice against a lethal poxvirus challenge”, Virology, Vol. 266, pp. 329-339, 2000.
97. Howie R. and Thorsen J. “An Enzyme-linked Immunosorbent Assay
(ELISA) for Infectious Bursal Disease Virus”, Can. J. comp. Med.,Vol.45, pp. 51-55, 1981.
98. Hu Y.C., Bentley W.E., Edwards G.H. and Vakharia V.N. “Chimeric
infectious bursal disease virus-like particles expressed in insect cells
and purified by immobilized metal affinity chromatography”.Biotechnol Bioeng., Vol.63, No.6, pp.721-729, 1999.
99. Huang Z., Elankumaran S., Yunus A.S. and Samal S.K. “A
recombinant Newcastle disease virus (NDV) expressing VP2 protein of
infectious bursal disease virus (IBDV) protects against NDV andIBDV”, J Virol, Vol.78, No.18, pp.10054-10063, 2004.
100. Hulse D. J. and Romero C. H. “Fate of Plasmid DNA Encoding
Infectious Bursal Disease Virus VP2 Capsid Protein Gene after
Injection into the Pectoralis Muscle of the Chicken”, Poultry Science,
Vol.81, pp.213-216, 2002.
![Page 195: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/195.jpg)
170
101. Hung C.M., Yeh C.C., Chen H.L., Lai C.W., Kuo M.F., Yeh M.H., Lin
W., Tu M.Y., Cheng H.C. and Chen C.M. “Porcine lactoferrin
administration enhances peripheral lymphocyte proliferation and
assists infectious bursal disease vaccination in native chickens”,Vaccine, Vol.28, No.16, pp.2895-2902, 2010.
102. Hung C.M., Yeh C.C., Chong K.Y., Chen H.L., Chen J.Y., Kao S.T.,
Yen C.C., Yeh M.H., Lin M.S. and Chen C.M. “Gingyo-San Enhances
Immunity and Potentiates Infectious Bursal Disease Vaccination”,Evid Based Complement Alternat Med. Vol.22, 2009.
103. Ide P R. “A comparison of gel diffusion, fluorescent antibody and virus
isolation methods in experimental and natural cases of infectious bursaldisease”, Can J Comp Med., Vol.39, No.2, pp.183-190, 1975.
104. Islam M.R., Zierenberg K., Eterradossi N., Toquin D., Rivallan G. and
Müller H., “Molecular and antigenic characterization of Bangladeshi
isolates of infectious bursal disease virus demonstrate their similarities
with recent European, Asian and African very virulent strains”, J. Vet.
Med. B., Vol.48, pp. 211-221, 2001.
105. Ismail N.M. and Saif Y.M. “Differentiation between antibodies to
serotypes 1 and 2 infectious bursal disease viruses in chicken sera”,Avian Dis., Vol.34, pp. 1002-1004, 1990.
106. Jackwood D. H. and Saif Y. M. “Antigenic diversity of infectiousbursal disease virus”, Avian Dis., Vol.31, pp. 766-770, 1987.
107. Jackwood D. J. “Development and characterization of nucleic acid
probes to infectious bursal disease viruses”, Veterinary Microbiology.Vol. 24, No. 3-4, pp.253-260, 1990.
108. Jackwood D.J, Kibenge F.S.B. and Mercado C.C. “The Use of Biotin-
Labeled cDNA Probes for the Detection of Infectious Bursal DiseaseViruses”, pp. 129-136, 1990.
109. Jackwood D.J. and Jackwood R.J., “Infectious bursal disease viruses:
molecular differentiation of antigenic subtypes among serotype 1viruses”. Avian Dis., Vol.38, pp. 531-537, 1994.
110. Jackwood D.J., Henderson K.S. and Jackwood R. J. “Enzyme-Linked
Immunosorbent Assay-Based Detection of Antibodies to Antigenic
Subtypes of Infectious Bursal Disease Viruses of Chickens”, Clinical
![Page 196: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/196.jpg)
171
And Diagnostic Laboratory Immunology, Vol. 3, No. 4, pp. 456-463,1996.
111. Jackwood D.J., Henderson K.S. and Jackwood R.J. “Enzyme-linked
immunosorbent assay-based detection of antibodies to antigenic
subtypes of infectious bursal disease viruses of chickens”, Clin DiagnLab Immunol., Vol.3, No.4, pp.456-463, 1996.
112. Jackwood D.J., Kibenge F.S. and Mercado C.C. “Detection of
infectious bursal disease viruses by using cloned cDNA probes”, J
Clinical Microbiology. Vol.27, No.11, pp.2437-2443, 1989.
113. Jackwood D.J., Saif Y. M. and Hughes J. H. “Characteristics and
serologic studies of two serotypes of infectious bursal disease virus inturkeys”, Avian Dis., Vol.26, pp. 871-882, 1982.
114. Jackwood D.J., Saif Y.M. and Moorhead P.D. “Immunogenicity and
antigenicity of infectious bursal disease virus serotypes I and II in
chickens”, Avian Dis., Vol.29, No.4, pp.1184-1194, 1985.
115. Jackwood D.J., Swayne D.E. and Fisk R.J. “Detection of Infectious
Bursal Disease Viruses Using in situ Hybridization and Non-
Radioactive Probes”, Avian Diseases, Vol. 36, No. 1, pp. 154-157,1992.
116. Jagadish M. N., Staton V. J., Hudson P. J. and Azad A. A. “Birnavirus
precursor polyprotein is processed in Escherichia coli by its own virus-
encoded polypeptide”, Journal of Virology, Vol.62, pp. 1084-1087,1988.
117. Jayaramiah D.H. and Mallick B.B. “Identification of infectious bursal
disease in India”, Indian J. Anim. Hlth., Vol. 13, pp. 99-103, 1974.
118. Johnson A.M. “Immunoprecipitation in gels”, Chapter 4. In Manual of
Clinical Laboratory Immunology, 3rd Ed. By Rose, N.R.; Friedman, H.
and Fahey, J.L. American Society for Microbiology, Washington, D.C.pp. 14-24, 1986.
119. Jordan F.T.W. and Pattison M. “In Poultry Diseases”, 5th, WB
Saunders, 2001.
120. Joshi R.K. and Shakya S. “Studies on an infectious bursal disease
outbreak in a commercial poultry farm in Madhya Pradesh”, IndianVet. Med. J., Vol.20, pp. 41-42, 1996.
![Page 197: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/197.jpg)
172
121. Kataria R.S., Tiwari A.K., Butchaiah G. and Kataria J.M.
“Differentiation of infectious bursal disease virus strains by restriction
analysis of RT-PCR-amplified VP2 gene sequences”, Acta Virologica,Vol. 43, pp.245-249, 1999.
122. Kaufer I. and Weiss E. “Significance of bursa of Fabricius as target
organ in infectious bursal disease of chickens”, Infect Immun., Vol.27,No.2, pp.364-367, 1980.
123. Kembi F.A., Delano O.O. and Oyekunle M.A. “Effect of three
different routes of administration on the immunogenicity of infectious
bursal disease vaccine”, Rev Elev Med Vet Pays Trop., Vol.48, No.1,pp.33-35, 1995.
124. Kibenge F. S. B., Dhillon A. S. and Russell R. G. “Biochemistry and
immunology of infectious bursal disease virus”, Journal of General
Virology Vol.69, pp. 1757-1775, 1988.
125. Kibenge F. S., Qian B., Cleghorn J. R. and Martin C. K. “Infectious
bursal disease virus polyprotein processing does not involve cellularproteases”, Archives of Virology, Vol.142, pp. 2401-2419, 1997.
126. Kibenge F.S., Qian B., Nagy E., Cleghorn J.R. and Wadowska D.
“Formation of virus-like particles when the polyprotein gene (segment
A) of infectious bursal disease virus is expressed in insect cells”, Can JVet Res., Vol. 63, No.1, pp.49-55, 1999.
127. Kim I.J. and Sharma J.M. “IBDV-induced bursal T lymphocytes
inhibit mitogenic response of normal splenocytes”, Vet Immunol
Immunopathol Vol.74, No.1-2, pp.47-57, 2000.
128. Kim I.J., Gagic M. and Sharma J.M. “Recovery of antibody-producing
ability and lymphocyte repopulation of bursal follicles in chickens
exposed to infectious bursal disease virus”, Avian Dis., Vol.43, No.3,pp. 401-413, 1999.
129. Koester J., Becht H. and Rudolph R. “Properties of the infectious
bursal agent of chicken (IBA)”. Med. Microbiol. Immunol., Vol.157,pp. 291-298, 1972.
![Page 198: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/198.jpg)
173
130. Kosters J. “Der Nachweis von Antigen und prazipitierendea
Antikorpun nach experimentller Injektion mit dem Erreger der
Injektiosen Bursitis (Gumboro-Krankheit) bei verscheden alten
kuken”, Proc. 19th
World Vet. Congr., Mexico Vol.3, pp. 1180-1181,1971.
131. Kosters J. and Geissler H. “Serologische Untersuchungen uber die
verbreitung der infektiosen Bursitis der Junghennen (Gumboro
disease), tierarztl”, Umsch, Vol.26, pp.573-575, 1971.
132. Kulkarni D.D., Kulkarni M.N. and Gujar M.B. “Serological studies on
chicks infected with infectious bursal disease virus and vaccinated forRanikhet disease:, Indian J. Anim. Sci., Vol.53, pp.1281-1285, 1983.
133. Kumar R., Chandra R., Rao V.D.P. and Shukla S.K. “Isolation and
characterization of infectious bursal disease (IBD) virus”,. Indian Vet.
J., Vol.66, pp. 994-997, 1996.
134. Kumar S., Ahi Y.S., Salunkhe S.S., Koul M., Tiwari A.K., Gupta P.K.
and Rai A. “Effective protection by high efficiency bicistronic DNA
vaccine against infectious bursal disease virus expressing VP2 protein
and chicken IL-2”, Vaccine, Vol.27, No.6, pp.864-869, 2009.
135. Kumar, R., Chandra R., Rao V.D.P. and Shukla S.K. “Adaptation of
infectious bursal disease virus in chicken embryo fibroblast cell cultureand its fine structure”, Indian J. Anim. Sci., Vol.70, pp. 110-113, 2000.
136. Kusk Mette, Kabell Susanne, Jørgensen Poul H. and Handberg Kurt J.
“Differentiation of five strains of infectious bursal disease virus:
Development of a strain-specific multiplex PCR”, VeterinaryMicrobiology, Vol.109, No.3-4, pp. 159-167,2005.
137. Kwang M.J., Lu Y.S., Lee L.H., Lin D.F., Liao Y.K. Lee C. and Lee
Y.L. “Detection of infectious bursal disease viral antigen prepared
from the cloacal bursa by ELISA”, J. Chin. Soc. Vet. Sci., Vol.13, pp.
265-269, 1987.
138. Laemmli U.K. “Cleavage of structural proteins during the assembly ofthe head of bacteriophage T4”, Nature, Vol. 227, pp. 680-685, 1970.
![Page 199: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/199.jpg)
174
139. Lalitha P., Eswaran D., Gnanasekar M., Rao K.V., Narayanan R.B.,
Scott A., Nutman T. and Kaliraj P. “Development of antigen detection
ELISA for the diagnosis of brugian and bancroftian Filariasis using
antibodies to recombinant filarial antigens Bm-SXP-1 and Wb-SXP-1”, Microbiol. and Imm., Vol. 46, No. 5, pp. 327-332, 2002.
140. Landgraf H., Vielitz E. and Kirsch R. “Occurrence of an infectious
disease affecting the bursa of Fabricius (Gumboro disease)”, Dt.
Tierarztl. Wschr., Vol.74, pp. 6-10, 1967.
141. Lange H., Muller H., Kaufer I. and Becht H. “Pathogenic and structural
properties of wild type infectious bursal disease virus (IBDV) andvirus grown in vitro”, Arch Virol., Vol.92, No.3-4, pp.187-196, 1987.
142. Lasher H.N. and Davis V.S. “History of infectious bursal disease in the
U.S.A.--the first two decades”, Avian Dis., Vol.41, No.1, pp.11-19,
1997.
143. Lee L.H. “Characterization of nonradioactive hybridization probes for
detecting infectious bursal disease virus”, Journal of VirologicalMethods, Vol. 38, No.1, pp.81-92, 1992.
144. Lee L.H., Ting L.J., Shien J.H. and Shieh H.K. “Single-tube,
noninterrupted reverse transcription-PCR for detection of infectious
bursal disease virus”, J. Clin. Microbiol., Vol.32, pp. 1268-1272, 1994.
145. Leong J.C., Brown D., Dobos P., Kibenge F.S.B., Ludert J. E., Muller
H., Mundt E. and Nichsolson B. and Birnaviridae, “In the 7th Report of
the International Committee on the Taxonomy of Viruses. Academic
Press: San Diego, pp. 481-490, 2000.
146. Li Y.P., Handberg K.J., Kusk Kabell S., Zhang M.F. and Jorgensen
P.H. “Relative quantification and detection of different types of
infectious bursal disease virus in bursa of Fabricius and cloacal swabs
using real time RT-PCR SYBR green technology”, Research in
Veterinary Science, Vol. 82, No. 1, pp. 126-133, 2007.
147. Lin Z., Kato A., Otaki Y., Nakamura T., Sasmaz E. and Ueda S.,
“Sequence comparisons of highly virulent infectious bursal diseasevirus prevalent in Japan”. Avian Dis., Vol.37, pp. 315-323, 1993.
148. Liu J., Zhou J. and Kwang J., “Antigenic and molecular
characterization of recent infectious bursal disease virus isolates in
China”. Virus Genes, Vol.24, pp. 135-147, 2002.
![Page 200: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/200.jpg)
175
149. Liu X., Giambrone J. J. and Hoerr. F. J. “In situ Hybridization,
Immunohistochemistry, and in situ Reverse Transcription-Polymerase
Chain Reaction for Detection of Infectious Bursal Disease Virus”,Avian Diseases Vol. 44, pp.161-169, 2000.
150. Liu, X., Giambrone J.J. and Dormitorio T. “Simplified sample
processing combined with a sensitive nested polymerase chain reaction
assay for detection of infectious bursal disease virus in the bursa of
Fabricus”, Avian Dis., Vol.42, pp. 480-485, 1998.
151. Lukert P. D. and Saif Y. M. “Infectious bursal disease”, In B. W.
Calnek, H. J. Barnes, C. W. Beard, W. M. Reid, and H. W. Yoder, Jr.
(ed.), Diseases of poultry. Iowa State University Press, Ames,pp. 648-663. 1991.
152. Lunger P. D. and Maddux T. C. “Fine-structure studies of the avian
infectious bursal agent. I. In vivo viral morphogenesis”. Avian Dis.Vol.16, pp.874-893, 1972.
153. Luque D., Saugar I., Rejas M. T., Carrascosa J. L., Rodríguez J. F. and
Caston J. R. “Infectious bursal disease virus: ribonucleoprotein
complexes of a double-stranded RNA virus”, J. Mol. Biol., Vol.386,pp. 891-901, 2009.
154. MacDonald R. O. and Gower D. A. “Genomic and phenotypic
divergence among three serotypes of aquatic birnaviruses (infectiouspancreatic necrosis virus)”, Virology, Vol.l114, pp. 187-195, 1981.
155. Macdonald R.D. “Immunofluorescent detection of double-stranded
RNA in cells infected with reovirus, infectious pancreatic necrosis
virus, and infectious bursal disease virus”. Can J Microbiol., Vol.26,No.2, pp.256-261, 1980.
156. Madhumathi J., Prince P.R., Anugraha G., Kiran C., Rao D.N., Reddy
M.V.R. and Kaliraj, P. “Identification and characterization of
nematode specific protective epitopes of Brugia malayi TRX towards
development of synthetic vaccine construct for lymphatic filariasis”.Vaccine, Vol.28, pp. 5038-5048, 2010.
157. Malik M.W., Ayub N. and Qureshi I.Z. “Passive immunization using
purified IgYs against infectious bursal disease of chickens in
Pakistan”, J Vet Sci., Vol. 7, No.1, pp.43-46, 2006.
![Page 201: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/201.jpg)
176
158. Maraver A., Ona A., Abaitua F., Gonzalez D., Clemente R., Ruiz-Díaz
J. A., Caston J. R., Pazos F. and Rodriguez J. F. “The oligomerization
domain of VP3, the scaffolding protein of infectious bursal disease
virus, plays a critical role in capsid assembly”, J. Virol., Vol.77,pp. 6438-6449, 2003.
159. Marsh M. and Helenius A. “Virus entry into animal cells”, Adv. VirusRes. Vol.36, pp. 107-151, 1989.
160. Martínez-Torrecuadrada J.L., Caston J.R., Castro M., Carrascosa J.L.,
Rodríguez J.F. and Casal J.I., “Different architectures in the assembly
of infectious bursal disease virus capsid proteins expressed in insectcells”, Virology, Vol.278, pp. 322-331, 2000.
161. Mason H.S., Lam D.M.K. and Arntzen C.J. “Expression of hepatitis B
surface antigen in transgenic plants”, Proc. Natl. Acad. Sci. USA 89,
pp.11745-11749, 1992.
162. Maw M.T., Yamaguchi T., Ohya K. and Fukushi H. “Detection of
Vaccine-Like Infectious Bursal Disease (IBD) Virus in IBD Vaccine-Free Chickens in Japan”, J. Vet. Med. Sci., Vol.70, pp. 833-835, 2008.
163. Mazariegos L.A., Lukert P.D. and Brown J., “Pathogenicity and
immunosuppressive properties of infectious bursal disease
“intermediate” strain”, Avian Dis., Vol.34, pp. 203-208, 1990.
164. Mcferran J.B., Mcnulty M.S., Mccillop E., Corner T.J., Mccracken R.
M., Collins D. S. and Allan G. “Isolation and serological studies with
infectious bursal disease viruses from fowl, turkeys and ducks,
demonstration of a second serotype”. Avian Pathol., Vol.9,pp. 395-404, 1980.
165. McMurray B. “Vaccination strategies: Reflections from the field”,
Seaboard Farms. In: International Poultry Symposium, Summit onIBD, Athens, GA., pp.35-37, 1995.
166. McNulty M.S., Todd D., Allan G. M., McFerran J. B. and Green J. A.
“Epidemiology of rotavirus infection in broiler chicken: recognition offour sero groups”, Arch. Virol., Vol.81, pp. 113-121, 1984.
167. Mena A., Andrew M.E. and Coupar B.E. “Rapid dissemination of
intramuscularly inoculated DNA vaccines”, Immunology and CellBiology, Vol. 79, pp. 87-89, 2001.
![Page 202: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/202.jpg)
177
168. Meulemans G., Antoine O. and Halen P. “Application de
l’immunofluorescence au diagnostic de la Maladie de Gumboro”, OIE
Bull., Vol.88, pp. 225-229, 1977.
169. Mickael C.S. and Jackwood D.J. “Real-time RT-PCR analysis of two
epitope regions encoded by the VP2 gene of infectious bursal disease
viruses”, Journal of Virological Methods, Vol. 128, No. 1-2, pp. 37-46,2005.
170. Miller Heins S. “The emergence of the Delaware strain of IBD and its
control in the U.S”., In: International Poultry Symposium, Summit onIBD, Athens, GA., pp.99-101,1995.
171. Mohanty G.C., Pandey A.P. and Rajya B.S. “Infectious bursal diseasein chickens”. Curr. Sci., Vol.40, pp. 181-184, 1971.
172. Moody Adrian, Sellers Scott and Bumstead Nat “Measuring infectious
bursal disease virus RNA in blood by multiplex real-time quantitative
RT-PCR”, Journal of Virological Methods, Vol. 85, No.1-2, pp.55-64,2000.
173. Muller H. “Replication of infectious bursal disease virus in lymphoidcells’, Arch Virol., Vol.87, No.3-4, pp. 191-203, 1986.
174. Muller H. and Becht H. “Biosynthesis of virus-specific proteins in cells
Infected with infectious bursal disease virus and their significance as
structural elements for infectious virus and incomplete particles”.Journal of Virology, Vol.44, pp. 384-392, 1982.
175. Muller H., Islam M.R. and Raue R. “Research on infectious bursal
disease--the past, the present and the future”, Vet Microbiol., Vol.97,
No.1-2, pp.153-165, 2003.
176. Muller H., Scholtissek C. and Becht H., “The genome of infectious
bursal disease virus consists of two segments of double-strandedRNA”, J. Virol., Vol.31, pp. 584-589, 1979.
177. Muller R., Kaufer I., Reinacher M. and Weiss E. “Immunofluorescent
studies of early virus propagation after oral infection with infectious
bursal disease virus (IBDV)”, Zentralbl Veterinarmed B., Vol.26,No.5, pp. 345-352, 1979.
![Page 203: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/203.jpg)
178
178. Mullis K. and Faloona F. “Specific synthesis of DNA in vitro via a
polymerase-catalyzed chain reaction”, Methods Enzymol., Vol.155,
pp.335-350, 1987.
179. Mundt E., Beyer J. and Muller H. “Identification of a novel viral
protein in infectious bursal disease virus-infected cells”, Journal ofGeneral Virology Vol.76, pp. 437-443, 1995.
180. Mundt E., de Haas N. and van Loon A.A. “Development of a vaccine
for immunization against classical as well as variant strains of
infectious bursal disease virus using reverse genetics’, Vaccine,Vol.21, No.31, pp.4616-4624, 2003.
181. Mundt E., Kollner B. and Kretzschmar D. “VP5 of infectious bursal
disease virus is not essential for viral replication in cell culture”,Journal of Virology Vol.71, pp. 5647-5651, 1997.
182. Nachimuthu K., Raj G.D., Thangavelu A. and Venkatesan R.A.
“Reverse passive haemagglutination test in the diagnosis of infectious
bursal disease’, Trop Anim Health Prod., Vol. 27, No.1, pp.43-46,1995.
183. Nachimuthu K., Raj G.D., Thangavelu A., Koteeswaran A.,
Palaniswamy K.S. and Venugopalan A.T. “Seroprevalence of
infectious bursal disease in Tamil Nadu”, Indian Vet. J., Vol.70,pp. 100-103, 1993.
184. Nakamura T., Kato A., Lin Z., Hiraga M., Nunoya T., Otaki Y. and
Ueda S. “A rapid quantitative method for detecting infectious bursal
disease virus using polystyrene latex microspheres”, J Virol Methods.,Vol.43, No.1, pp. 123-129, 1993a.
185. Nakamura T., Otaki Y., Lin Z. and Kato A. “Rapid and quantitative
assay system for measuring anti-infectious bursal disease virus
antibody using monoclonal antibody bound to polystyrene latex
microspheres”, Avian Dis., Vol.37, No.3, pp.786-792, 1993b.
186. Nakamura T., Otaki Y., Lin Z., Nunoya T., Hoshi S. and Kato A.
“Direct correlation between the titer of infectious bursal disease virus
VP2-specific antibody and protection”, Avian Dis., Vol.38, No.2,pp.251-255, 1994.
![Page 204: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/204.jpg)
179
187. Nanni Mariana, Alegre Mariana, Compaired Diego, Taboga Oscar and
Fondevila Norberto, “Novel purification method for recombinant
3AB1 nonstructural protein of foot-and mouth disease virus for use in
differentiation between infected and vaccinated animals”, J Vet DiagnInvest., Vol.17, pp. 248-251, 2005.
188. Negash T., al-Garib S.O. and Gruys E. “Comparison of in ovo and
post-hatch vaccination with particular reference to infectious bursal
disease”, A review. Vet Q., Vol.26, No.2, pp. 76-87, 2004.
189. Nicosia G., Cutello V., Bentley P.J., Timis J., Saha S. and Raghava
G.P.S. “BcePRED: prediction of continuous B-Cell epitopes in
antigenic sequences using physico-chemical properties”, Eds. ICARIS,LNCS, Vol. 3239, pp.197-204, 2004.
190. Nurulfiza I., Hair-Bejo M., Omar A.R. and Aini I.
“Immunochromatographic gold-based test strip for rapid detection of
Infectious bursal disease virus antibodies”, J Vet Diagn Invest., Vol.23,No.2, pp.320-4, 2011.
191. Okoye J.O.A. and Uzoukwo M. “Histopathogenesis of infectious
bursal disease in the bursa of Fabricius. Persistence of infectious bursal
virus and the appearance of precipitins in infected chickens”, Tropicalveterinarian, Vol.2, pp. 91-102, 1984.
192. Ona A., Luque D., Abaitua F., Maraver A., Caston J. R. and Rodríguez
J. F. “The C-terminal domain of the pVP2 precursor is essential for the
interaction between VP2 and VP3, the capsid polypeptides ofinfectious bursal disease virus”, Virology, Vol.322, pp. 135-142, 2004.
193. Ouyang W., Wang Y., Zhou Y., Zhang H. and Tang Y. “Recombinant
VP2 protein of infectious bursal disease virus AH1 strain expressed in
insect cells: a vaccine candidate”, Sheng Wu Gong Cheng Xue Bao,
Vol.26, No.5, pp.595-603, 2010.
194. Parker S.E., Borellini F., Wenk M.L., Hobart P., Hoffman S.L.,
Hedstrom R., Le T. and Norman J.A. ‘Plasmid DNA malaria vaccine:
tissue distribution and safety studies in mice and rabbits’, Human Gene
Therapy, Vol. 10, pp. 741-758, 1999.
195. Pattison M., Alexander D. J. and Harkness J. W. “Purification and
preliminary characterization of a pathogenic strain of infectious bursaldis-ease virus”. Avian Pathol., Vol.4, pp. 175-187. 1975.
![Page 205: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/205.jpg)
180
196. Perozo F., Villegas P., Estevez C., Alvarado I.R., Purvis L.B. and
Williams S. “Protection against infectious bursal disease virulent
challenge conferred by a recombinant avian adeno-associated virusvaccine”, Avian Dis, Vol.52, No.2, pp.315-319, 2008.
197. Petek M., D'Aprile P.N. and Cancellotti F. “Biological and physico-
chemical properties of the infectious bursal disease virus (IBDV)”,Avian Pathol., Vol.2, No.2, pp. 135-152, 1973.
198. Peters B., Sidney J., Bourne P., Bui H.H., Buus S. and Doh G. “The
design and implementation of the immune epitope data base andanalysis resource”, Immunogenetics, Vol. 57, No.5, pp.326-336, 2005.
199. Peters Michelle A., Lin Tsang Long and Wu Ching Ching “Real-time
RT-PCR differentiation and quantitation of infectious bursal disease
virus strains using dual-labeled fluorescent probes”, Journal of
Virological Methods, Vol. 127, No.1, pp. 87-95, 2005.
200. Phenix K.V., Wark K., Luke C.J., Skinner M.A., Smyth J.A.,
Mawhinney K.A. and Todd D., “Recombinant Semliki Forest virus
vector exhibits potential for avian virus vaccine development”,
Vaccine, Vol.19, pp. 3116-3123, 2001.
201. Pitcovski J., Di-Castro D., Shaaltiel Y., Azriel A., Gutter B., Yarkoni
E., Michael A., Krispel S. and Levi B.Z. “Insect cell-derived VP2 of
infectious bursal disease virus confers protection against the disease inchickens”, Avian Dis., Vol.40, No.4, pp.753-761, 1996.
202. Pitcovski J., Goldberg D., Levi B.Z., Di-Castro D., Azriel A., Krispel
S., Maray T. and Shaaltiel Y. “Coding region of segment A sequence
of a very virulent isolate of IBDV - comparison with isolates from
different countries and virulence”, Avian Dis., Vol.42, pp. 497-506,1998.
203. Pitcovski J., Gutter B., Gallili G., Goldway M., Perelman B., Gross G.,
Krispel S., Barbakov M. and Michael A. “Development and large-scale
use of recombinant VP2 vaccine for the prevention of infectious bursaldisease of chickens”, Vaccine, Vol.21, No.32, pp.4736-4743, 2003.
204. Poonia B. and Charan S. “Early and transient induction of nitric oxide
(NO) in infectious bursal disease virus infection is T-cell dependent: a
study in cyclosporin-A treated chicken-model”, Indian J Exp Biol.,Vol.43, No.2, pp.192-196, 2005.
![Page 206: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/206.jpg)
181
205. Purushothaman V., Pannerselvam S., Venugopal K. and Thangaraj
T.M., “A report on the outbreak of infectious bursal disease in
chickens”. Cheiron, Vol.17, pp. 229-31, 1988.
206. Putnam M. “Reflections from the field: Wayne Poultry”, In:
International Poultry Symposium, Summit on IBD, Athens, GA., pp.40-41, 1995.
207. Rao K.V.N., Eswaran M., Ravi V., Gnanasekhar B., Narayanan R. B.,
Kaliraj, P., Kunthala J., Marson A., Nithyakalyani R. and Scott A.L.
“The Wuchereria bancrofti orthologue of Brugia malayi SXP-1 and the
diagnosis of bancroftian Filariasis”, Mol. Biochem. Parasitol., Vol.107, pp. 71-80, 2000.
208. Rao S., Kong W.P., Wei C.J., Yang Z.Y., Nason M., Styles D.,
DeTolla L.J., Panda A,, Sorrell E.M., Song H., Wan H., Ramirez-Nieto
G.C., Perez D. and Nabel G.J. “Multivalent HA DNA vaccination
protects against highly pathogenic H5N1 avian influenza infection inchickens and mice”, PLoS One. Vol.3, No.6, 2008.
209. Rautenschlein S., Yeh H.Y. and Sharma J.M. “The role of T cells in
protection by an inactivated infectious bursal disease virus vaccine”,Vet Immunol Immunopathol, Vol.89, No.3-4, pp. 159-167, 2002.
210. Reddy S. K., Silim A. and Ratcliffe M.J. “Biological roles of the
major capsid proteins and relationships between the two existing
serotypes of infectious bursal disease virus”, Arch. Virol., Vol.127,
pp. 209-222, 1992.
211. Richmond J.F., Lu S., Santoro J.C., Weng J., Hu S.L., Montefiori D.C.
and Robinson H.L. “Studies of the neutralizing activity and avidity of
anti-human immunodeficiency virus type 1 Env antibody elicited by
DNA priming and protein boosting”, J Virol., Voll.72, No.11, pp.9092-
9100, 1998.
212. Rodenberg J., Sharma J.M., Belzer S.W., Nordgren R.M. and Naqi S.
“Flow cytometric analysis of B cell and T cell subpopulations in
specific-pathogen-free chickens infected with infectious bursal disease
virus”,. Avian Dis., Vol.38, No.1, pp. 16-21, 1994.
![Page 207: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/207.jpg)
182
213. Rogel A., Benvenisti L., Sela I., Edelbaum O., Tanne E., Shachar Y.,
Zanberg Y., Gontmakher T., Khayat E. and Stram Y. “Vaccination
with E. coli recombinant empty viral particles of infectious bursal
disease virus (IBDV) confer protection”, Virus Genes, Vol.27, No.2,pp. 169-175, 2003.
214. Rong J., Cheng T., Liu X., Jiang T., Gu H. and Zou G. “Development
of recombinant VP2 vaccine for the prevention of infectious bursal
disease of chickens”, Vaccine, Vol.23, No.40, pp.4844-4851, 2005.
215. Saif E.M., Aly M., El, Aziz, A.M.A. and Mohamed, F.M.
“Epidemiological studies on Gumboro disease in upper Egypt. Assiut.Vet. Med. J., Vol.42, pp. 223-241, 2000.
216. Sambrook J., Fitsch E.F. and Maniatis T. “Molecular Cloning: A
Laboratory Manual”, Cold Spring Harbor Laboratory Press, Vol. I. 2nd
edition, 1989.
217. Sapats S.I. and Ignjatovic J., “Antigenic and sequence heterogeneity of
infectious bursal disease virus strains isolated in Australia”, Arch.Virol., Vol.145, pp. 773-785, 2000.
218. Saravanan P., Kumar S. and Kataria J.M. “Use of multiple antigenic
peptides related to antigenic determinants of infectious bursal disease
virus (IBDV) for detection of anti-IBDV-specific antibody in ELISA--
quantitative comparison with native antigen for their use inserodiagnosis”, J Immunol Methods, Vol.293, No.1-2, pp.:61-70, 2004.
219. Saravanan P., Satishkumar, Kataria J.M. and Rasool T J. “Detection of
Infectious bursal disease virus by ELISA using an antipeptide antibodyraised against VP3 region”, Acta Virol., Vol.48, No.1, pp.39-45, 2004.
220. Selegean M., Putz M.V. and Rugea T. “Effect of the polysaccharide
extract from the edible mushroom Pleurotus ostreatus against
infectious bursal disease virus”, Int J Mol Sci., Vol.10, No.8, pp.3616-
3634, 2009.
221. Sharma J. and Rosenberger J. K. “Infectious bursal disease and
reovirus infection of chickens: Immune responses and vaccinecontrol”, Avian Immun Basis Pract., Vol.2, pp.149-150, 1987.
222. Sharma J.M. and Fredericksen T.L. “Mechanism of T cell
immunosuppression by infectious bursal disease virus of chickens”,
Prog Clin Biol Res., Vol.238, pp.283-294, 1987.
![Page 208: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/208.jpg)
183
223. Sharma J.M., Dohms J.E. and Metz A.L. “Comparative pathogenesis
of serotype 1 and variant serotype 1 isolates of infectious bursal
disease virus and their effect on humoral and cellular immune
competence of specific-pathogen-free chickens”, Avian Dis., Vol.33,No.1, pp.112-124, 1989.
224. Sharma J.M., Kim I.J., Rautenschlein S. and Yeh H.Y. “Infectious
bursal disease virus of chickens: pathogenesis and
immunosuppression”, Dev Comp Immunol., Vol.24, No.2-3,pp. 223-235, 2000.
225. Shaw I. and Davison T.F. “Protection from IBDV-induced bursal
damage by a recombinant fowlpox vaccine, fpIBD1, is dependent on
the titre of challenge virus and chicken genotype”, Vaccine, Vol.18,
pp. 3230-3241, 2000.
226. Sheppard M., Werner W., Tsatas E., McCoy R., Prowse S. and
Johnson M., “Fowl adenovirus recombinant expressing VP2 of
infectious bursal disease virus induces protective immunity against
bursal disease”, Arch. Virol., Vol.143, pp. 915-930, 1998.
227. Singh N.K., Dey S., Madhan Mohan C., Mohan Kataria J. and
Vakharia V.N. “Evaluation of four enzyme linked immunosorbent
assays for the detection of antibodies to infectious bursal disease inchickens”, J Virol Methods., Vol.165, No.2, pp. 277-282, 2010.
228. Skeeles J.K., Lukert P.D., De Buysscher E.V., Fletcher O.J. and
Brown, J. “Infectious bursal disease viral infections. I. Complement
and virus-neutralizing antibody response following infection ofsusceptible chickens” Avian Dis., Vol.23, No.1, pp. 95-106, 1979a.
229. Skeeles J.K., Lukert P.D., De Buysscher E.V., Fletcher O.J. and Brown
J. “Infectious bursal disease viral infections. II. The relationship of
age, complement levels, virus-neutralizing antibody, clotting, andlesions”, Avian Dis., Vol.23, No.1, pp. 107-117, 1979b.
230. Snyder D.B., Lana D.P., Savage P.K., Yancey F.S., Mengel S.A. and
Marquardt W.W. “Differentiation of infectious bursal disease viruses
directly from infected tissues with neutralizing monoclonal antibodies:
Evidence for a major antigenic shift in recent field isolates”, AvianDis., Vol.32, pp. 535-539, 1988.
![Page 209: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/209.jpg)
184
231. Snyder D.B., Yancey F.S. and Savage P.K. “A monoclonal antibody
based agar gel precipitation test for antigenic assessment of infectious
bursal disease virus”, Avian Pathol., Vol.21, pp. 153-157, 1992.
232. Spies U., Muller H. and Becht H. “Properties of RNA polymerase
activity associated with infectious bursal disease virus and
characterization of its reaction products”, Virus Res., Vol.8, pp.127-140, 1987.
233. Srinivasan K.N., Brusic V. and August J.T. “New technologies for
vaccine development”, Drug Dev Res., Vol.62, pp. 383-392, 2004.
234. Staneck J.L., Weckbach L.S., Allen S.D., Siders J.A., Gilligan P.H.,
Coppitt G., Kraft J.A. and Willis D.H., “Multicenter evaluation of four
methods for Clostridium difficile, cytotoxin assay, culture, and latex
agglutination”, Journal of Clinical Microbiology, Vol. 34, pp. 2718-
2721, 1996.
235. Stram Y., Meir R., Molad T., Blumenkranz R., Malkinson M. and
Weisman Y. “Applications of the polymerase chain reaction to detect
infectious bursal disease virus in naturally infected chickens”, Avian
Dis., Vol.38, pp. 879-884, 1994.
236. Studier F.W. and Moffatt B. A. “Use of bacteriophage T7 RNA
polymerase to direct selective high-level expression of cloned genes”,J. Molecular Biology, Vol. 189, pp. 113-130, 1986.
237. Tacken M.G., Peeters B. P., Thomas A. A., Rottier P. J. and Boot H. J.
“Infectious bursal disease virus capsid protein VP3 interacts both with
VP1, the RNA-dependent RNA polymerase, and with viral double-stranded RNA”, J. Virol., Vol.76, pp. 11301-11311, 2002.
238. Tang D.C., De Vit M. and Johnston S.A. “Genetic immunization is a
simple method for eliciting an immune response”, Nature, Vol. 356,pp. 152-154, 1992.
239. Tham K.M., Young L.W. and Moon C. D. “Detection of infectious
bursal disease virus by reverse transcription-polymerase chain reaction
amplification of the virus segment A gene”, Journal of VirologicalMethods, Vol.53, No.2-3, pp.201-212, 1995.
240. Thevathasan C. and Jayawardana G.W.L. “Studies on infectious bursal
disease virus isolated from field outbreaks”, Trop. Agril. Res., Vol.9,
pp.372-377, 1997.
![Page 210: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/210.jpg)
185
241. Tischer B.K., Schumacher D., Beer M., Beyer J., Teifke J.P.,
Osterrieder K., Wink K., Zelnik V., Fehler F. and Osterrieder N. “A
DNA vaccine containing an infectious Marek's disease virus genome
can confer protection against tumorigenic Marek's disease inchickens”, J Gen Virol., Vol. 83, No. 10, pp.2367-2376, 2002.
242. Todd D. and McNulty M.S. “Biochemical studies with infectious
bursal disease virus: comparison of some of its properties with
infectious pancreatic necrosis virus”, Arch Virol., Vol.60, pp. 265-277,1979.
243. Toma C., Sisavath L. and Iwanaga M. “Reversed passive latex
agglutination assay for detection of toxigenic Corynebacterium
diphtheriae”, Journal of Clinical Microbiology, Vol. 35,
pp. 3147-3149, 1997.
244. Towbin H., Syaehelin T. and Gordon J. “Electrophoretic transfer of
proteins from polyacrylamide gels to nitrocellulose sheets: procedure
and some applications”, Proceedings of the National Academy of
Sciences of the United States of America, Vol. 76, pp. 4350-4354,1979.
245. Tripathi V., Chitralekha K.T., Bakshi A.R., Tomar D., Deshmukh
R.A., Baig M.A. and Rao D.N., “Inducing systemic and mucosal
immune responses to B-T construct of F1 antigen of Yersinia pestis in
microsphere delivery”, Vaccine, Vol. 24, No. 16, pp.3279-3289, 2006.
246. Tsukamoto K., Kojima C., Komori Y., Tanimura N., Mase M. and
Yamaguchi S., Protection of chickens against very virulent infectious
bursal disease virus (IBDV) and Marek’s disease virus (MDV) with a
recombinant MDV expressing IBDV VP2. Virology, Vol.257,
pp. 352-362, 1999.
247. Tsukamoto K., Obata H. and Hihara H. “Improved preparation of
ELISA antigen of infectious bursal disease virus”. Avian Dis., Vol.34,No.1, pp.209-213, 1990.
248. Tsukamoto K., Saito S., Saeki S., Sato T., Tanimura N., Isobe T., Mase
M., Imada T., Yuasa N. and Yamaguchi S., “Complete, long-lasting
protection against lethal infectious bursal disease virus challenge by a
single vaccination with an avian herpesvirus vector expressing VP2antigens”, J Virol., Vol.76, No.11, pp.5637-5645, 2002.
![Page 211: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/211.jpg)
186
249. Tsukamoto K., Tanimura N., Kakita S., Ota K., Mase M., Imai K. and
Hihara H. “Efficacy of three live vaccines against highly virulent
infectious bursal disease virus in chickens with or without maternalantibodies”, Avian Dis., Vol.39, No.2, pp.218-229, 1995.
250. Ulbrich F. and Zureck I. “Agar-gel precipitation test for diagnosis of
infectious bursitis in fowl (Gumboro disease)”, Mn. Vet. Med.,Vol.32, p.588, 1977.
251. Umapathi V., Parthiban M., Thiagarajan V. and Nachimuthu K.
“Preparation and characterization of immunogen for monoclonal
antibody production against infectious bursal disease virus serotype 1of poultry”, J. Immu. Immunopatho., Vol.4, pp. 113-116, 2002.
252. Unicom L. E., Coulson B. S. and Bishop R. F. “Experience with an
enzyme immunoassay for serotyping human group A rotaviruses”, J.
Clin. Microbiol., Vol.27, pp.586-588, 1989.
253. Ursula I von Einem, Alexander E Gorbalenya, Horst Schirrmeier,
Sven-Erik Behrens, Tobias Letzel and Egbert Mundt, “VP1 of
infectious bursal disease virus is an RNA-dependent RNA
polymerase”, Journal of General Virology, Vol.85, pp. 2221-2229,2004.
254. Vakharia V.N., Snyder D.B., He J., Edwards G.H., Savage P.K. and
Mengel-Whereat S.A. “Infectious bursal disease virus structural
proteins expressed in a baculovirus recombinant confer protection in
chickens”, J Gen Virol, Vol.74, No.6, pp.1201-1206, 1993.
255. Vakharia V.N., Snyder D.B., Lütticken D., Mengel-Whereat S.A.,
Savage P. K., Edwards G.H. and Goodwin M.A. “Active and passive
protection against variant and classic infectious bursal disease virus
strains induced by baculovirus-expressed structural proteins”, Vaccine,
Vol.12, No.5, pp.452-456, 1994.
256. Van den Berg T.P., “Acute infectious bursal disease in poultry: areview”, Avian Pathol., Vol.29, pp. 175-194, 2000.
257. Van den Berg T.P., Eterradossi N., Toquin D. and Meulemans G.
“Infectious bursal disease (Gumboro disease)”, Rev Sci Tech., Vol.19,No.2, pp. 509-543, 2000.
![Page 212: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/212.jpg)
187
258. Van den Berg T.P., Gonze M. and Meulemans G. “Acute infectious
bursal disease in poultry and characterization of a highly virulent
strain”. Avian Pathol., Vol.20, pp. 133-143, 1991.
259. Van Regenmortel M. H., (ed.) “Immunoinformatics may lead to a
reappraisal of the nature of B cell epitopes and of the feasibility of
synthetic peptide vaccines”, J. Mol. Recognit., Vol.19, pp. 183-187,2006.
260. Verma K.C., Panisup A.S., Mohanty G.C. and Reddy B.R. Infectious
bursal disease (Gumboro disease) and associated conditions in poultry
flocks of Andhra Pradesh. Indian J. Poult. Sci., Vol.16, pp. 385-392,1981.
261. Villegas P., Hamoud M., Purvis L.B. and Perozo F. “Infectious bursal
disease subunit vaccination”, Avian Dis, Vol.52, No.4, pp.670-674,
2008.
262. Viswas K.N., Muniyappa L., Suryanarayana V.V. and Byregowda
S.M., “Nucleotide sequence analysis of variable region of VP2 gene of
two infectious bursal disease virus isolates from commercial poultry
farms”. Acta Virol., Vol.46, pp. 95-101, 2002.
263. Wang C., Zhao Z., Zhang C., Liu Y., Ding K., Li Y., Cheng X. and
Chen P. “Influence of fusion protein of IBDV VP2 and chicken
interleukin-2 on immune response in chicken”, Sheng Wu Gong ChengXue Bao, Vol.26, No.4, pp.476-482, 2010.
264. Wang M.Y., Hu H.L., Suen S.Y., Chiu F.Y., Shien J.H. and Lai S.Y.
“Development of an enzyme-linked immunosorbent assay for detecting
infectious bursal disease virus (IBDV) infection based on the VP3
structural protein”, Vet Microbiology, Vol.131, No.3-4, pp.229-236,2008.
265. Wang M.Y., Kuo Y.Y., Lee M.S., Doong S.R., Ho J.Y. and Lee L.H.,
“Self-assembly of the infectious bursal disease virus capsid protein,
rVP2, expressed in insect cells and purification of immunogenic
chimeric rVP2H particles by immobilized metal-ion affinity
chromatography”, Biotechnol. Bioeng., Vol.67, pp. 104-111, 2000.
266. Wang S.J., Chang W.F., Wang M.Y., Hsiung K.P. and Liu Y.C.
“Development of a disperse dye immunochromatographic test for the
detection of antibodies against infectious bursal disease virus”, VetImmunol Immunopathol., Vol.125, No.3-4, pp.284-90, 2008.
![Page 213: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/213.jpg)
188
267. Wang Y.S., Fan H.J., Li Y., Shi Z.L., Pan Y. and Lu C.P.
“Development of a multi-mimotope peptide as a vaccine immunogen
for infectious bursal disease virus”, Vaccine, Voll.25, No.22, pp.4447-4455, 2007.
268. Wang Yongqiang, Qi Xiaole, Gao Honglei, Gao Yulong, Lin Huan,
Song Xiuqing, Pei Lei and Wang Xiaomei “Comparative study of the
replication of infectious bursal disease virus in DF-1 cell line and
chicken embryo fibroblasts evaluated by a new real-time RT-PCR”,Journal of Virological Methods, Vol. 157, No. 2, pp. 205-210, 2009.
269. Winterfield R.W., Fadly A.M. and Bickford A. “Infectivity and
distribution of infectious bursal disease virus in the chicken.
Persistence of the virus and lesions”, Avian Dis., Vol.16, No.3,
pp. 622-632, 1972.
270. Winterfield T. W., Hitchner S. B., Appleton G. S. and Cosgrove A. S.,
“Avian nephrosis, nephritis and Gumboro disease”, L & M NewsViews, Vol.3, p.103, 1962.
271. Wolff J.A., Malone R.W., Williams P., Chong W., Acsadi G., Jani A.
and Felgner P.L. “Direct gene transfer into mouse muscle in vivo”,Science, Vol. 247, pp. 1465-1468, 1990.
272. Wu C.C., Lin T.L., Zhang H.G., Davis V.S. and Boyle J.A. “Molecular
detection of infectious bursal disease virus by polymerase chainreaction”, Avian Dis., Vol.36, pp.221-226, 1992.
273. Wu Ching-Ching, Lin Tsang-Long and Akin.Aydemir “Quantitative
competitive polymerase chain reaction for detection and quantification
of infectious bursal disease virus cDNA and RNA”, Journal ofVirological Methods, Vol.66, No. 1, pp. 29-38, 1997.
274. Wu H., Singh N.K., Locy R.D., Scissum-Gunn K. and Giambrone J.J.
“Expression of immunogenic VP2 protein of infectious bursal disease
virus in Arabidopsis thaliana”, Biotechnol Lett., Vol.26, No.10,pp.:787-792, 2004.
275. Wu J., Yu L., Li L., Hu J., Zhou J. and Zhou X. “Oral immunization
with transgenic rice seeds expressing VP2 protein of infectious bursal
disease virus induces protective immune responses in chickens”, Plant
Biotechnol J, Vol.5, No.5, pp.570-578, 2007.
![Page 214: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/214.jpg)
189
276. Wyeth P. J. and Chettle N. J. “Use of infectious bursal disease vaccines
in chicks with maternally derived antibodies”, Vet Rec., Vol.126,
No.23, pp.577-578, 1990.
277. Wyeth P. J., Chettle N J. and Mohepat A.R. “Use of an inactivated
infectious bursal disease oil emulsion vaccine in commercial layerchicks”, Vet Rec., Vol.130, No.2, pp.30-32, 1992.
278. Xiaojuan Zheng, Lianlian Hong, Lixue Shi, Junqing Guo, Zhen Sun,
and Jiyong Zhou, “Proteomics Analysis of Host Cells Infected with
Infectious Bursal Disease Virus”, Molecular and Cellular Proteomics,Vol.7, pp. 612-625, 2008.
279. Xu Jiangtao, Zhenmei Zhang, Yanbo Yin, Shangjin Cui, Shouzhen Xu,
Yanyan Guo, Jida Li, Jianlin Wang, Xingcai Liu and Limin Han
“Development of reverse-transcription loop-mediated isothermal
amplification for the detection of infectious bursal disease virus”,
Journal of Virological Methods, Vol. 162, No. 1-2, pp. 267-271,2009.
280. Xue C.Y. and Lim B.L. “In situ Localization of Infectious Bursal
Disease Virus-Binding Cells by a Biotin-Streptavidin System”, AvianDiseases Vol.45, No. 2, pp. 504-511, 2001.
281. Yang T., Wang H.N., Wang X., Tang J.N., Gao R., Li J., Guo Z.C. and
Li Y.L. “Multivalent DNA vaccine enhanced protection efficacy
against infectious bronchitis virus in chickens”, J Vet Med Sci.,
Vol.71, No.12, pp.1585-1590, 2009.
282. Yao K., Goodwin M. A. and Vakharia V. N. “Generation of a mutant
infectious bursal disease virus that does not cause bursal lesions”,Journal of Virology, Vol.72, pp. 2647-2654, 1998.
283. Yehuda H., Goldway M., Gutter B., Michael A., Godfried Y., Shaaltiel
Y., Levi B.Z. and Pitcovski J. “Transfer of antibodies elicited by
baculovirus-derived VP2 of a very virulent bursal disease virus strain
to progeny of commercial breeder chickens”. Avian Pathol., Vol.29,No.1, pp.13-19, 2000.
284. Yip C.W., Yeung Y.S., Ma C.M., Lam P.Y., Hon C.C., Zeng F. and
Leung F.C. “Demonstration of receptor binding properties of VP2 of
very virulent strain infectious bursal disease virus on Vero cells’, VirusRes., Vol.123, No.1, pp. 50-56, 2007.
![Page 215: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/215.jpg)
190
285. Yongping Wu, Lianlian Hong, Juxiu Ye, Zhenyu Huang and Jiyong
Zhou “The VP5 protein of infectious bursal disease virus promotes
virion release from infected cells and is not involved in cell death”,Vol.154, No.12, pp. 1873-1882, 2009.
286. Zhang Chunjie “Establishment and Application of Sandwich Dof-
ELISA in Detection of Infection Bursai Disease Virus”, Journal ofLuoyang Agricultural College, Vol.01, pp. 33-38, 1994.
287. Zhang G.P., Li Q.M., Yang Y.Y., Guo J.Q., Li X.W., Deng R.G., Xiao
Z.J., Xing G.X., Yang J.F., Zhao D., Cai S.J. and Zang W.M.
“Development of a one-step strip test for the diagnosis of chickeninfectious bursal disease”, Avian Dis., Vol.49, No.2, pp.177-81, 2005.
288. Zierenberg K., Nieper H., van den Berg Th., Ezeokoli C.D., Voß M.
and Müller H., “The VP2 variable region of African and German
isolates of infectious bursal disease virus: comparison with very
virulent”, “classical” virulent, and attenuated tissue culture-adaptedstrains. Arch. Virol., Vol.145, pp. 113-125, 2000.
289. Zierenberg K., Raue R. and Müller H. “Rapid identification of “very
virulent” strains of infectious bursal disease virus by reverse
transcription-polymerase chain reaction combined with restrictionenzyme analysis”. Avian Pathol., Vol.30, pp. 55-62, 2001.
![Page 216: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/216.jpg)
191
LIST OF PUBLICATIONS
1. Chinnathambi Thangadurai, Pichaimuthu Suthakaran, Pankaj Barfal,
Balaiah Anandaraj, Satya Narayan Pradhan, Harith Kamil Boneya,
Subramanian Ramalingam, Vadivel Murugan. “Rare codon priority
and its position specificity at the 5’ of the gene modulates heterologous
protein expression in Escherichia coli”. Biochemical and Biophysical
Research Communications. 376, pp 647–652. 2008.
Submitted Genbank Sequences
1. Pradhan, S.N., Antony, U., Narayanan, R.B. and Roy,P., Evaluation
of immunoprophylactic efficacy of rVP2 subunit vaccine in Infectious
bursal disease virus of chicks. 2009, FJ848772 :
![Page 217: Development of Recombinant Subunit Vaccine and Monoclonal Antibody Based Diagnostic Test for Infectious Bursal Disease in Chickens.](https://reader034.fdocuments.us/reader034/viewer/2022042523/55cf993f550346d0339c5faf/html5/thumbnails/217.jpg)
192
CURRICULUM VITAE
Satya Narayan Pradhan was born in Berhampur, India. He obtained
his B.Pharm degree from College of Pharmaceutical Sciences, Berhampur
University. He also holds diploma in pharmaceutical production from IPER,
Pune and diploma in management from IGNOU, national university.
He qualified JNU national entrance and was awarded a fellowship
to pursue M.Tech (Biotech) from Anna University and completed with
distinction. His post-graduation dissertation titled “Hyper expression of
streptokinase in T7 Expression system” was graded excellent. He qualified
DBT-BET national entrance and was awarded Research Fellowship to pursue
Ph.D.
He has presented his work on viral vaccine and detection in various
national and international conferences and won prize. He has contributed to
one research publications and deposited one sequence in GenBank. He has
acquired rich experience during his research work on various techniques
related to - molecular biology, genetic engineering, immunology, cell culture,
monoclonal antibody development, and animal vaccination.