SHORT COMMUNICATION

Development of IRAP-SCAR marker for strain identificationin Lentinula edodes

Yang Xiao • Yaohong Dai • Yingying Lu •

Wei Liu • Zhuoren Wang • Yinbing Bian

Received: 24 September 2010 / Accepted: 28 November 2010 / Published online: 5 December 2010

� Springer Science+Business Media B.V. 2010

Abstract Rapid and correct authentication of commercial

strains is still important in today’s mushroom industry.

Here for the first time we reported the using of sequence

characterized amplified region (SCAR) marker developed

from inter-retrotransposon amplified polymorphism

(IRAP) marker to identify Lentinula edodes strain. Geno-

mic polymorphism among 44 shiitake cultivars in China

were surveyed by 24 IRAP primer combinations, from

which primer combination LTR1L/MarY1R could generate

a unique and reproducible 1712 bp fragment to distinguish

strain No. 4 from other 43 strains. Based on this strain-

specific fragment, a SCAR primer pair was designed and its

validity was verified by correctly amplifying a single

strain-specific fragment from DNA samples of 100 L. ed-

odes strains. Our study lays the foundation for developing

strain-specific SCAR marker by retrotransposon-based

marker technique in fungi.

Keywords Shiitake � IRAP marker � SCAR marker �Strain identification

Introduction

Lentinula edodes, Xianggu or shiitake mushroom, well

known for its delicious taste and valuable medical func-

tions (Ooi 2000), is the second most important mushroom

in the world. It was first cultivated in China more than

800 years ago and is very popular in East Asia. Today

China accounts for roughly 70% of the world total pro-

duction (Chang and Miles 1987).

Currently there are more than 100 commercial strains of

shiitake mushroom cultivated across different areas of

China on a commercial scale (Li et al. 2008). However, due

to lack of strict quality control system for the sale of

mushroom spawn, confusion may be caused such as iden-

tical strains have different names or different strains share a

same name. Incorrect naming of shiitake cultivars may

bring a great economic loss to the farmers, thus stunting the

sustained and sound development of Lentinula industry in

China. It is extremely urgent to exploit suitable methods to

rapidly and precisely distinguish different commercial

strains. Conventional phenotypic analysis of fruit body is

time-consuming and greatly influenced by environmental

factors. By comparison, DNA molecular markers are more

stable and accurate, which are becoming useful and

effective tools for study on fungal genetic diversity and

strain authentication.

PCR-based molecular markers were well-established in

edible mushroom, including random amplified polymor-

phic DNA (RAPD) (Zhang and Molina 1995), amplified

fragment length polymorphism (AFLP) (Terashima et al.

2002), inter-simple sequence repeats (ISSR) (Zhang et al.

2007) and sequence-related amplified polymorphism

(SRAP) (Yu et al. 2008). In 1999, Kalendar et al. devel-

oped inter-retrotransposon amplified polymorphism

(IRAP) (Kalendar et al. 1999), a marker system based on

transposable elements in barley. In contrast to other

markers, IRAP aims to genomic polymorphism between

two nearby retrotransposons in the genome (Kalendar and

Schulman 2006). But application of IRAP marker in

mushroom is still limited to several ectomycorrhizal

basidiomycetes like Laccaria bicolor and Tricholoma

matsutake (Dıez et al. 2003; Murata et al. 2005), due to the

Y. Xiao � Y. Dai � Y. Lu � W. Liu � Z. Wang � Y. Bian (&)

Institute of Applied Mycology, Huazhong Agricultural

University, 430070 Wuhan, China

e-mail: bybpaper@gmail.com; bianyinbing@mail.hzau.edu.cn

123

World J Microbiol Biotechnol (2011) 27:1731–1734

DOI 10.1007/s11274-010-0626-x

absence of sequence information of retrotransponson in

other species.

Further, based on above-mentioned molecular markers,

special DNA fragment could be converted into SCAR

marker (Paran and Michelmore 1993), which introduced

the possibility of distinguishing different strains rapidly

and precisely. The SCAR markers have been successfully

used for authentication of important economic fungal

species such as L. edodes (Qin et al. 2006; Li et al. 2008;

Wu et al. 2010), Flammulina velutipes (Su et al. 2008a)

and Ganoderma lucidum (Su et al. 2008b).

In our previous IRAP genetic diversity analysis of

shiitake cultivars in China (Our unpublished data), a strain-

unique DNA fragment was attained. The objective of this

investigation was to develop a SCAR marker for rapid and

effective identification of L. edodes strain. As far as we

known, this was the first report on the conversion of strain-

specific IRAP marker into reliable SCAR marker in fungi.

Materials and methods

Fungal strains

Forty four main shiitake cultivars in China were used to

develop SCAR markers. Additional 55 wild strains in

mainland and one Taiwan commercial strains of L. edodes

were used to test the validity of developed SCAR marker

(Xiao et al. 2010). All the tested strains were stored in

Spawn Test Center of Huazhong Agricultural University.

DNA extraction

The mycelia of all the tested strains of L. edodes were

grown in liquid potato dextrose (PD) broth at 25�C for

2 weeks. Genomic DNA was extracted from mycelia frozen

in liquid nitrogen following Zhang and Molina’s (1995)

protocol. DNA concentration and purity were determined

with the UV-1700 spectrophotometer (Shimadzu, Japan).

Qualified samples were diluted to 50 ng/ll for PCR

amplification.

IRAP procedure

IRAP primers design

IRAP primers were designed based on the following three

nucleotide sequences (Table 1): (1) 50and 30 LTRs (the

long terminal repeat) of retrotransposon in L. edodes; (2)

highly conserved sequence of MarY retrotransposon in

homobasidiomycetes; (3) a cDNA sequence of L. edodes

with homology (E = 1e-29) to reverse transcriptase-

RNase H-integrase encoded by retrotransposon. All the

IRAP primers were designed by the online software ‘‘Pri-

mer 3’’ (http://frodo.wi.mit.edu/primer3/). Combinations of

two primers among different primer types were employed

in IRAP amplification.

IRAP amplification

IRAP amplification was carried out in a MyCycler thermal

cycler (Bio-Rad, USA) with every 20 ll reaction volume

containing 19 PCR buffer, 30 ng template DNA, 0.75 U

Taq DNA polymerase, 0.30 mM dNTPs, 2.0 mM MgCl2.

The PCR reaction program consisted of: 1 cycle at 94�C,

4 min; 32 cycles of 94�C for 40 s, 56.1�C for 40 s, and

72�C for 2 min; followed by a final extension for 7 min at

72�C. Products were analyzed by electrophoresis in 2% (w/

v) agarose/TAE gels and detected by ethidium bromide

staining using GL200 image analysis system (Kodak,

USA).

Cloning and sequencing of IRAP fragment

The DNA fragment unique to certain strain was excised

from the agarose gels and purified using DNA gel extrac-

tion kit (Doupson, China). The purified fragment was then

ligated to pMD18-T Vector (TaKaRa, Japan) and

sequenced using ABI 373 DNA sequencer.

Table 1 IRAP primers used in this study

Primer code GenBank accession no. Primer type Tm (�C) Primer sequence

LTR1L AB291605 A 59.7 AAAGTACGCAGCCCCTATCA

LTR1R AB291605 A 60.1 GAAGTGGCGGAACCAATAGA

LTR2L AB291605 B 60.1 TATAGCCAACCCTCCACAGC

LTR2R AB291605 B 60.2 AACTGGACAAGGCAACAAGG

MarY1L AB056683 C 60.0 GTGCCCTGTGTGTTTTTCCT

MarY1R AB056683 C 60.1 AAGGGGTACTCCGCCTCTAA

RTE-L EB012660 D 60.3 CACCGTTGCCTTTTCTGTCT

RTE-R EB012660 D 60.0 AGTAAACGAGGGTGGTCACG

1732 World J Microbiol Biotechnol (2011) 27:1731–1734

123

SCAR design and analysis

A pair of SCAR primers was designed from the sequenced

IRAP fragment using ‘‘Primer 3’’. Sequences of the SCAR

primers were: SCLM2-F (50CCCTTATCTTGACCTCTC

TGTCAT 30); SCLM2-R (50CAAGAAAGGTGTCAG

TAGCAAAGA 30). Genomic DNA of all the 100 shiitake

strains were then used to confirm the validity of the SCAR

primer. SCAR-PCR reaction components were identical to

those of IRAP-PCR except IRAP primer pair were replaced

by the SCAR primer pair. Thermal cycling condition of

SCAR-PCR was the same as that of IRAP-PCR, with the

only exception of anneal at 60�C.

The DNA sequence was submitted to GenBank with the

Accession No. GU075817. Homology searches were per-

formed by online program BLAST (http://www.ncbi.nlm.

nih.gov/BLAST/).

Results

Identification of strain-specific DNA fragment

via IRAP-PCR

A total of 24 IRAP primer combinations were initially

screened using DNA sample from six shiitake strains, six

of which produced clear and polymorphic profiles. Then

these six primer combinations were used to analyze genetic

diversity among 44 shiitake cultivars. Finally primer

combination LTR1L/MarY1R generated a bright and

reproducible fragment of approximately 1800 bp, specific

to strain No. 4 (strain name: 9608) (Fig. 1a). The charac-

teristic DNA fragment was purified, cloned and sequenced.

Sequencing results revealed that the fragment was actual

1712 bp in length with fairly high [G?C] content (46%)

and ended with sequence LTR1L at both ends. BLASTX

search showed it is homology with transposase of Phak-

opsora pachyrhizi (E = 2.9; Accession No. CAK26784),

which confirmed that the characteristic fragment was

related to retrotransposon of L. edodes.

Development of strain-specific SCAR marker

To better authenticate the shiitake strain, the IRAP marker

was converted into strain-specific SCAR marker. Accord-

ing to the nucleotide sequence of the unique strain-specific

fragment, a primer pair (SCLM2-F and SCLM2-R) was

designed by Primer 3 software. The SCAR primer pair was

then used to amplify the genomic DNA from all the 100

shiitake strains. PCR results indicated that a single and

distinct DNA fragment of 1159 bp in length was observed

only in strain No. 4, with no amplification in other strains

(Fig. 1b).

Discussion

As a traditional tasty and healthy food, L. edodes is widely

cultivated in China. It is well known that different strains

adapt to their own favorite climatic conditions. Incorrect

cultivation of L. edodes strains could cause serious loss in

yield and quality of fruit body. Therefore, it is very

important to accurately identify right strains before culti-

vation. Strain-specific SCAR marker was proven to be a

simple, reliable and effective method for strain identifica-

tion and it can be derived from any PCR-based markers,

such as RAPD (Li et al. 2008), ISSR (Qin et al. 2006; Su

et al. 2008a, b), SRAP (Wu et al. 2010) and AFLP (Liu

et al. 2009).

IRAP’s particular advantages over other marker systems

could be summarized as following aspects. Firstly, in

contrast to RAPD and ISSR markers, IRAP is more

reproducible and reliable by using higher annealing tem-

perature and longer primer in PCR amplification. Secondly,

IRAP is high in polymorphism. The high degree of poly-

morphism produced by retrotransposon-based marker

A

B

1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43

2000

1000750

500

250

MFig. 1 PCR results of tested

strains amplified by primer

combinations LTR1L/MarY1R

(a) and SCLM2-F/SCLM2-R

(b). Numbers on top of the gel

are strain serial numbers. a The

arrow indicates the specific

fragment that is converted into

SCAR marker in strain No. 4

(lane 4). b The arrow indicates

the distinct and reproducible

SCAR marker unique to strain

No. 4 (lane 4)

World J Microbiol Biotechnol (2011) 27:1731–1734 1733

123

could be due to the past or recent actions of the retro-

transposon (Chadha and Gopalakrishna 2005). Thirdly,

compared with AFLP marker, IRAP is simple and easy-to-

handle. In addition, transposable elements act as agents of

genome restructuring and mutagenesis by promoting a

wide range of mutations (Riccioni et al. 2008). Therefore,

as a retrotransposon-based marker, IRAP can detect large

changes in the genome (Kalendar and Schulman 2006).

In principle, retrotransposons may integrate into the

genome with either orientation. Hence any two members of

a retrotransposon family may be found head-to-head, tail-

to-tail, or head-to-tail. For the first two orientations, a

single IRAP primer suffices to generate PCR products from

elements sufficiently close to one another (Kalendar et al.

1999). So, it is reasonable that the specific IRAP fragment

unique to strain No. 4 was generated only using primer

LTR1L.

In the present study, after the strain-specific SCAR

marker was developed among the 44 shiitake cultivars,

another 55 wild strains and one Taiwan commercial strain

of L. edodes were further utilized to validate the unique-

ness and stability of the SCAR marker. Thus the reliability

and accuracy of the SCAR marker in strain identification

was confirmed, eliminating non-strain-specific case when

employed in a large strain population.

In summary, this was the first report on development of

strain-specific SCAR marker via IRAP assay in fungi and

the first application of IRAP marker in L. edodes. Our

study provides an effective and precise PCR-based diag-

nostic method to identify shiitake strain and lays the basis

for further utilization of IRAP marker in L. edodes, an

important economic mushroom.

Acknowledgments This work was financially supported by the

National Key Technology R&D Program in the 11th Five-year Plan

of China (Grant No. 2008BADA1B02), and the Industry (Agricul-

ture), Science and Technology Plans of China (Grant No. nyhyzx07-

008).

References

Chadha S, Gopalakrishna T (2005) Retrotransposon-microsatellite

amplified polymorphism (REMAP) markers for genetic diversity

assessment of the rice blast pathogen (Magnaporthe grisea).

Genome 48:943–945

Chang ST, Mile PG (1987) Historical record of the early cultivation

of Lentinus in China. Mushroom J Trop 7:31–37

Dıez J, Beguiristain T, Tacon FL, Casacuberta JM, Tagu D (2003)

Identification of Ty1-copia retrotransposons in three ectomycor-

rhizal basidiomycetes: evolutionary relationships and use as

molecular markers. Curr Genet 43:34–44

Kalendar R, Schulman AH (2006) IRAP and REMAP for retrotrans-

poson-based genotyping and fingerprinting. Nat Protoc

1:2478–2484

Kalendar R, Grob T, Regina M, Suoniemi A, Schulman A (1999)

IRAP and REMAP: two new retrotransposon-based DNA

fingerprinting techniques. Theor Appl Genet 98:704–711

Li HB, Wu XQ, Peng HZ, Fu LZ, Wei HL, Wu QQ, Jin QY, Li N

(2008) New available SCAR markers: potentially useful in

distinguishing a commercial strain of the superior type from

other strains of Lentinula edodes. Appl Microbiol Biotechnol

81:303–309

Liu JH, Gao L, Liu TG, Chen WQ (2009) Development of a

sequence-characterized amplified region marker for diagnosis of

dwarf bunt of wheat and detection of Tilletia controversa Kuhn.

Lett Appl Microbiol 49:235–240

Murata H, Babasaki K, Yamada A (2005) Highly polymorphic DNA

markers to specify strains of the ectomycorrhizal basidiomycete

Tricholoma matsutake based on rmarY1, the long terminal repeat

of gypsy-type retroelement marY1. Mycorrhiza 15:179–186

Ooi VEC (2000) Medicinally important fungi. Mushroom Sci

15:41–51

Paran I, Michelmore RW (1993) Development of reliable PCR-based

markers linked to downy mildew resistance genes in lettuce.

Theor Appl Genet 85:985–993

Wu X, Li H, Zhao W, Fu L, Peng H, He L, Cheng J, Wei H, Wu Q

(2010) SCAR markers and multiplex PCR-based molecular

typing of Lentinula edodes. Curr Microbiol. doi:10.1007/s00284-

010-9623-4

Qin LH, Tang Q, Chen MJ, Pan YJ (2006) Use of intersimple

sequence repeats markers to develop strain-specific SCAR

markers for Lentinula edodes. FEMS Microbiol Lett

257:112–116

Riccioni C, Rubini A, Belfiori B, Passeri V, Paolocci F, Arcioni S

(2008) Tmt1: the first LTR-retrotransposon from a Tuber spp.

Curr Genet 53:23–34

Su H, Wang L, Liu L, Chi X, Zhang Y (2008a) Use of inter-simple

sequence repeat markers to developstrain-specific SCAR mark-

ers for Flammulina velutipes. J Appl Genet 49:233–235

Su H, Wang L, Ge Y, Feng E, Sun J, Liu L (2008b) Development of

strain-specific SCAR markers for authentication of Ganodermalucidum. World J Microbiol Biotechnol 24:1223–1226

Terashima K, Matsumoto T, Hasebe K, Fukumasa-Nakai Y (2002)

Genetic diversity and strain-typing in cultivated strains of

Lentinula edodes (the shii-take mushroom) in Japan by AFLP

analysis. Mycol Res 106:34–39

Xiao Y, Liu W, Dai Y, Fu C, Bian Y (2010) Using SSR markers to

evaluate the genetic diversity of Lentinula edodes’ natural

germplasm in China. World J Microbiol Biotechonol

26:527–536

Yu M, Ma B, Luo X, Zheng L, Xu X, Yang Z (2008) Molecular

diversity of Auricularia polytricha revealed by inter-simple

sequence repeat and sequence-related amplified polymorphism

markers. Curr Microbiol 56:240–245

Zhang Y, Molina F (1995) Strain typing of Lentinula edodes by

random amplified polymorphic DNA assay. FEMS Microbiol

Lett 131:17–20

Zhang R, Huang C, Zheng S, Zhang J, Ng TB, Jiang R, Zuo X, Wang

H (2007) Strain-typing of Lentinula edodes in China with inter

simple sequence repeat markers. Appl Microbiol Biotechnol

74:140–145

1734 World J Microbiol Biotechnol (2011) 27:1731–1734

123