Development of a Real-time PCR Assay for Trypanosoma Cruzi

8/20/2019 Development of a Real-time PCR Assay for Trypanosoma Cruzi

http://slidepdf.com/reader/full/development-of-a-real-time-pcr-assay-for-trypanosoma-cruzi 1/6

Acta Tropica 103 (2007) 195–200

Development of a real-time PCR assay for Trypanosoma cruzi

detection in blood samples

Maria Piron a,∗, Roser Fisa b, Natalia Casamitjana a, Paulo Lopez-Chejade b,Lluıs Puig a, Mireia Verges b, Joaquim Gascon c, Jordi Gomez i Prat d,

Montserrat Portus b, Sılvia Sauleda a

a Transfusion Safety Lab., Banc de Sang i Teixits, Barcelona, Spainb Department of Parasitology, Faculty of Pharmacy, Universitat de Barcelona, Av. Joan XXIII s/n, 08028 Barcelona, Spain

c Department of Tropical Medicine, Hospital Clınic i Provincial de Barcelona, C/Rossell´ o 132, 2-2, 08026 Barcelona, Spain

d Unitat de Medicina Tropical i Salut Internacional Drassanes, Av. Drassanes, 19, 08001 Barcelona, Spain

Received 8 February 2007; received in revised form 4 May 2007; accepted 29 May 2007

Available online 23 June 2007

Abstract

The aim of this study was to develop a real-time PCR technique to detect Trypanosoma cruzi DNA in blood of chagasic patients.

Analytical sensitivity of the real-time PCR was assessed by two-fold serial dilutions of T. cruzi epimastigotes in seronegative blood

(7.8 down to 0.06 epimastigotes/mL). Clinical sensitivity was tested in 38 blood samples from adult chronic chagasic patients and 1

blood sample from a child with an acute congenital infection. Specificity was assessed with 100 seronegative subjects from endemic

areas, 24 seronegative subjects from non-endemic area and 20 patients with Leishmania infantum-visceral leishmaniosis. Real-time

PCR was designed to amplify a fragment of 166 bp in the satellite DNA of T. cruzi. As internal control of amplification humanRNase P gene was coamplified, and uracil- N -glycosylase (UNG) was added to the reaction to avoid false positives due to PCR

contamination. Samples were also analysed by a previously described nested PCR (N-PCR) that amplifies the same DNA region as

the real-time PCR. Sensitivity of the real-time PCR was 0.8 parasites/mL (50% positive hit rate) and 2 parasites/mL (95% positive

hit rate). None of the seronegative samples was positive by real-time PCR, resulting in 100% specificity. Sixteen out of 39 patients

were positive by real-time PCR (41%). Concordance of results with the N-PCR was 90%. In conclusion, real-time PCR provides

an optimal alternative to N-PCR, with similar sensitivity and higher throughput, and could help determine ongoing parasitaemia in

chagasic patients.

© 2007 Elsevier B.V. All rights reserved.

Keywords: Trypanosoma cruzi; Real-time PCR; Chagas disease

1. Introduction

Chagas disease is a protozoan infection caused by

Trypanosoma cruzi. The disease is widespread in Central

∗ Corresponding author at: Transfusion Safety Laboratory, Banc

de Sang i Teixits, Passeig Vall d’Hebron 119-129, 08035 Barcelona,

Spain. Tel.: +34 93 2749025; fax: +34 93 2749027.

E-mail address: [email protected] (M. Piron).

and South America and the number of infected people is

estimated at 12–14 million. Transmission of T. cruzi to

humans occurs after the bite of the reduviid bug, when

the excreta containing the parasites contaminate the bite

wound and mucosa, usually after scratching. The par-

asite can also be transmitted from infected mothers to

their children, through blood transfusion or organ trans-

plantation, and in secondary ways, by oral transmission

or laboratory accidents (WHO, 2002). Due to migration

0001-706X/$ – see front matter © 2007 Elsevier B.V. All rights reserved.

doi:10.1016/j.actatropica.2007.05.019

mailto:[email protected]

http://localhost/var/www/apps/conversion/tmp/scratch_4/dx.doi.org/10.1016/j.actatropica.2007.05.019

http://localhost/var/www/apps/conversion/tmp/scratch_4/dx.doi.org/10.1016/j.actatropica.2007.05.019

mailto:[email protected]



196 M. Piron et al. / Acta Tropica 103 (2007) 195–200

movements from rural to urban areas and from endemic

countries to North America and Europe, chagas disease

is now found in non-endemic areas where, even in the

absence of the vector, the infection can still be trans-

mitted congenitally, by blood transfusion and by organ

transplantation.

Chagas disease passes through two successive stages,the acute and the chronic phase. After the acute clin-

ical manifestations disappear, the infection rests with

a long period of clinical latency, called the indetermi-

nate form period, which may last throughout life or

evolve to a chronic phase with cardiac or gastrointesti-

nal involvement. The chronic phase is characterised by

high specific IgG antibody production and low, intermit-

tent parasitaemia, which results in the low sensitivity of

the classic parasitological techniques. Diagnosis in this

stage mainly relies on serological techniques, despite

their lack of specificity when crude T. cruzi antigensare used (Luquetti and Rassi, 2000). Also false–negative

serological results have been reported, which may be

related to the antigen used, the parasite strain involved

in the infection, or poor immune response of the patient

(Luquetti and Rassi, 2000). In addition, serology is not

accurate enough in the evaluation of treatment effi-

cacy, as it remains positive from 6 months to some

years after successful treatment, particularly in adults,

and has low positive predictive value in the diagno-

sis of congenital Chagas disease in the first months

of life due to transfer of antibodies from mother tochild.

Molecular-based assays, in particular amplification

by the polymerase chain reaction (PCR), provide a

more sensitive alternative to traditional parasitological

techniques. Some PCR protocols have been described,

leading to unequal results, probably due to differences

in the volume of blood processed, the DNA extrac-

tion procedure, or the DNA region of T. cruzi amplified

(Junqueira et al., 1996; Virreira et al., 2003).

Nested PCR (N-PCR) provides higher sensitivity than

single-run PCR assay and has already been reported for

supplementary diagnosis of Chagas disease (Marcon etal., 2002). This technique is highly sensitive, but time

consuming and entails a high risk of false positive results

due to contaminating amplicons.

In contrast, real-time PCR technology uses fluores-

cent labels for continuous monitoring of amplification

throughout the reaction. The main advantages are the

rapid throughput of results (amplification and detection

in one step) and reduced risk of carry-over contamina-

tion (minimal manipulation of samples and use of UNG).

Real-time PCRcan be optimised both as a qualitative and

quantitative assay.

The aim of this study was to develop and evaluate the

efficacy of a real-timePCR assay to detectandeventually

quantify T. cruzi in blood of chagasic patients.

2. Patients and methods

2.1. Positive controls

Epimastigotes from T. cruzi (Maracay strain) cultured

in LIT medium with 10% heat-inactivated foetal calf

serum were used to prepare the positive controls. The

number of parasites was assessed by microscopic exam-

ination and was adjusted to 7.8 epimastigotes/mL in

human EDTA whole blood from pooled healthy individ-

uals (Control 1) and frozen at−20 ◦C. For the sensitivity

analysis (qualitative assay), two-fold serial dilutions of

Control 1 in human EDTA whole blood were performed

down to 0.06 epimastigotes/mL. To assess the dynamic

range of the real-time PCR technique, 10-fold serial

dilutions of blood spiked with T. cruzi epimastigotes

were obtained (106–10−1 epimastigotes/mL). DNA was

extracted as described below andthe real-time PCR reac-

tions were performed as triplicates for each sample.

2.2. Patients and samples

Thirty-eight blood samples from patients with

chronic Chagas disease, who were native to endemic

areas (33 Bolivians, 3 Argentines, 1 Brazilian, 1 Hon-

duran) and living in Barcelona, Spain were included.One millilitre serum sample and 1 mL of EDTA–blood

were frozenat−20 ◦C untilanalysis. Allof these patients

arrived at Spain between 2000 and 2004. The patients

included in our study were alladults, diagnosed as chron-

ically infected by T. cruzi, and had not received any prior

specific treatment. All provided signed informed con-

sent for inclusion in the study. Patients were diagnosed

by two serological techniques, the Bioelisa Chagas assay

(Biokit, Barcelona, Spain), whichuses recombinant anti-

gens, and a conventional in-house ELISA with whole T.

cruzi antigens. Blood from a newborn with congenital

Chagas disease (Riera et al., 2006) was also included

in the study. Blood samples from 100 healthy individu-

als from endemic areas, and 24 healthy individuals from

non-endemic areas were used as negative controls for

the specificity study. Peripheral blood buffy coat and

bone marrow from 20 patients with Leishmania infantum

visceral leishmaniasis (VL) were also studied.

2.3. DNA extraction

DNA was extracted from 100 L of 1mL thawed

EDTA–blood, 200L buffy coat and 200L bone



M. Piron et al. / Acta Tropica 103 (2007) 195–200 197

Table 1

Primers and probe selected for the T. cruzi nested PCR and for the real-time PCR

PCR Primer or probe Sequencea (5–3) Nucleotide positionb

Nested TCZ 1 (forward) CGAGCTCTTGCCCACACGGG 1–20

TCZ 2 (reverse) CCTCCAAGCAGCGGATAGTTCAGG 165–188

TCZ 3 (forward) TGCTGCASTCGGCTGATCGTTTTCGA 21–46

TCZ 4 (reverse) CARGSTTGTTTGGTGTCCAGTGTGTGA 142–168

Real-time Cruzi 1 (forward) ASTCGGCTGATCGTTTTCGA 27–46

Cruzi 2 (reverse) AATTCCTCCAAGCAGCGGATA 172–192

Cruzi 3 (probe) CACACACTGGACACCAA 143–159

a R, A/G; S, C/G.b Nucleotide position in the DNA satellite sequence (GenBank accession no. AY520036).

marrow with the High Pure PCR Template Prepara-

tion kit (Roche, Basel, Switzerland), and eluted in

200L of elution buffer according to the manufac-

turer’s instructions. Five microliters of extracted DNA

was amplified in triplicate in both the real-time PCR andN-PCR.

2.4. Nested PCR assay

The N-PCR assay is based on a previously described

procedure (Marcon et al., 2002) using primers TCZ

1 and TCZ 2 for the first reaction and TCZ 3 and

TCZ 4 for the nested amplification, with some mod-

ifications (Table 1). PCR was carried out in 20L

reaction mixture containing 1.5 mM MgCl2 and 1U of

RedTaq polymerase (Sigma), with annealing tempera-tures of 63 ◦C (40 cycles) and 57 ◦C (25 cycles) in the

first and second amplification runs, respectively. The

PCR programs were run on an MJ Research thermo-

cycler (PTC-200), and the 149-nucleotide amplicon was

separated by electrophoresis on 3% agarose gel and visu-

alised by ultraviolet transillumination after staining with

ethidium bromide.

2.5. Real-time PCR assay

Primers and probe were selected from the same repet-itive sequences of satellite DNA amplified in the N-PCR

protocol and designed according to the Primer Express

Software (Applied Biosystems). The primers Cruzi 1

and Cruzi 2 amplify a 166-bp segment. The probe Cruzi

3 was labelled with 5FAM (6-carboxyfluorescein) and

3MGB (minor groove binder). Table 1 describes the

position of primers and probe for both the N-PCR and

real-time PCR. The pre-developed reagent for the RNase

P human gene (TaqMan Human RNase P detection

reagent, Applied Biosystems) was included in the PCR

reaction as internal control of amplification. The final

conditions in the PCR mixture were 1× Universal Mas-

ter Mix with UNG (Applied Biosystems), 0.1× RNase

P detection reagent, 750 nM each T. cruzi primer and

250 nM for the T. cruzi probe in a 20L reaction. The

samples were amplified in a thermocycler ABI Prism7700 (Applied Biosystems) with the following PCR con-

ditions: first step (2min at 50◦C), second step (10 min at

95 ◦C)and45 cycles (15 s at 95◦Cand1minat58 ◦C). A

sample was considered valid when the internal control

was efficiently amplified, and was considered positive

for T. cruzi when the threshold cycle (Ct) for the T. cruzi

target was <45. The Ct for a given sample is the first

cycle of the PCR reaction where fluorescence is detected

above the baseline. A non-template control was included

in each run as the real-time PCR negative control.

2.5.1. Statistical analysis

The sensitivity of the real-time PCR assay was cal-

culated by PROBIT analysis (SPSS v13, Chicago, IL),

and the 95% and 50% positive hit rates are reported. The

Ct values are expressed as the mean and standard devi-

ation. The coefficient of variation was calculated as the

percentage of the Ct standard deviation divided by its

mean.

3. Results

3.1. Analytical sensitivity and specificity

The sensitivity of the real-time PCR was assessed

by analysing 24 aliquots of each two-fold serial dilu-

tion of parasite-spiked whole blood (Table 2). The 24

PCR results for each dilution were obtained from two

independent runs. After PROBIT analysis, the 95%

detection limit was found at 2.07 parasites/mL (95%

CI 1.68–2.80) and the 50% detection limit at 0.80 par-

asites/mL (95% CI 0.62–1.03). Therefore, a negative

result in the real-time PCR assay should be reported




Table 2

Results for the sensitivity assay for the real-time PCR using two-fold

dilutions of blood sample spiked with a known T. cruzi concentration

Parasites/mL Positive/tested

7.81 24/24

3.91 24/24

1.95 21/240.98 17/24

0.49 10/24

0.24 6/24

0.12 4/24

0.06 2/24

inferior to 2.8 parasites/mL. The sensitivity of the real-

time PCR was similar to that obtained with the N-PCR

assay, which in our hands yields a clear band down to 2

parasites/mL.

As forthe quantitative results, thereal-time PCRreac-tions performed in triplicate with 10-fold serial dilutions

of DNA from blood spiked with T. cruzi epimastig-

otes(106–10−1 epimastigotes/mL) showed a linear curve

from 105 down to 10 parasites/mL of blood, with a four-

log dynamic range (Fig. 1).

As for the reproducibility of the assay, single-use

aliquots of Control 1 were extracted and amplified in 28

independent runs. Mean Ct values were 33.73± 1.68 for

the T. cruzi target and 28.91± 1.36 for the human RNase

P gene, for a resulting coefficient of variation of 4.97%

and 4.87%, respectively. We observed no contaminationof the negative controls or non-template controls of the

assay due to carry-over during either the DNA extraction

or the real-time PCR set-up.

3.2. Clinical sensitivity and specificity

Negative samples have been tested to determine the

specificity of the real-time PCR and the new primers

described here. None of the 124 T. cruzi seronegative

Fig. 1. Dynamic range of the real-time PCR. DNA of 10-fold serial

dilutions of blood spiked with T. cruzi epimastigotes were amplified as

triplicates (106–10−1 epimastigotes/mL). The linear regression curve

and regression coefficient are indicated.

Table 3

Description of the positiveand discrepant samples in the real-time PCR

and nested PCR in blood from patients with Chagas disease

Sample Origin Real-time PCR (mean Ct) N-PCR

1 Argentina 34.63 Positive

2 Bolivia 28.73 Positive

3 Bolivia 32.92 Positive4 Bolivia 35.48 Positive







11 Honduras 30.60 Positive

12 Bolivia 39.35 Negative


14 Bolivia 39.22 Negative


16 Bolivia Negative Positive17 Bolivia Negative Positive

18 Spaina 14.74b Positive

a Congenital case, mother from Bolivia.b From buffy-coat sample.

samples or 20 samples from VL patients tested positive

by real-time PCR. In our study, the specificity of the

real-time PCR was, therefore, 100%. When the chagasic

patients were analysed, we found that 23 out of 39 sam-

ples were negative by real-time PCR. All these samples

had an acceptable signal for RNase P gene amplification

(mean Ct 28.94± 2.65), thus indicating that no false neg-

ative results were generated by PCR inhibitors, nor were

there errors in sample dispensing into the PCR reaction.

Conversely, 16 samples out of the 39 chagasic patients

(41%) were positive by the real-time PCR for T. cruzi.

The mean Ct value for the T. cruzi target in positive sam-

ples from chronic patients was 35.54± 3.29, being all

of them near or below the lower limit of the dynamic

range (Fig. 1). When compared to the N-PCR, agree-

ment between the techniques was 90%. Four samples

had discrepant results, two positives by N-PCR and two

positives by real-time PCR (Table 3).Finally, the sample from the newborn with congenital

infection was positive with a mean Ct equal to 14.74,

which is over the dynamic range.

4. Discussion

Herein, we describe the development of a new real-

time PCR method based on TaqMan technology for the

diagnosis of T. cruzi infection in blood samples. Pre-

viously described PCR methods for the diagnosis of

Chagas disease were based on one-step PCR, with or



M. Piron et al. / Acta Tropica 103 (2007) 195–200 199

without hybridisation, or N-PCR followed by gel elec-

trophoresis. Consequently, they were time-consuming

and produced false positive results due to contamination

of the samples by carry-over, or false negative results due

to inhibition in the amplification process, when PCRs

were performed in the absence of parallel amplification

of a human gene as a control.More recently, some works have described real-time

PCR methods using SybrGreen technology which is

based on incorporation of a fluorescent dye into the

double-strand DNA (Cummings and Tarleton, 2003;

Virreira et al., 2006). We chose to use a TaqMan probe

that better guaranties the specificity of the measured sig-

nal.

Our real-time PCR method is based on amplification

of a genomic DNA sequence which had been previously

described as specific for all T. cruzi lineages (Moser et

al., 1989; Virreira et al., 2003). It has been designedto include a decontamination step and an internal con-

trol for the quality of amplification, and results can be

interpreted both qualitatively and, with the appropriate

standard curve, quantitatively. As is shown in our study,

the real-time PCR has a sensitivity similar to that of the

N-PCR, with a concordance in theclinicalsamples tested

of 90%. Discrepant results between real-time PCR and

N-PCR can be explained by low parasitaemia, probably

below the limit of detection of both PCR techniques.

Indeed, we noted that both samples with a positive real-

time PCR but negative N-PCR result presented relativelylate Ct for the real-time technique (39.35 and 39.22,

Table 3), which actually correspond to low parasitaemia

according to our standard curve (Fig. 1). Therefore, sen-

sitivity could be further improved if a larger volume of

blood were processed for DNA extraction. The samples

included in this study are representative of the T. cruzi-

infected population in a non-endemic area, that is, young

adults in an indeterminate phase of the disease with low

or absent parasitaemia. We must mention that all the

selected patients were diagnosed on serological findings

and had not received any treatment before enrolment

in the study. All patients with Chagas chronic diseasearrived at Spain between 2000 and 2004 and there was

no significant difference in the time spent outside the

endemic area between patients who presented a posi-

tive result by PCR (real-time or N-PCR) and those who

presented a negative result. Use of the real-time PCR

in this context will be as a qualitative assay to accom-

pany the serological diagnosis. Although the quantitative

assay is of limited value in the indeterminate phase of

the disease, the true potential of the real-time PCR will

eventually be better recognised in other situations for

which PCR-based techniques have been promoted, such

as congenital infections (Mora et al., 2005; Schijman et

al., 2003; Virreira et al., 2003), monitoring parasitaemia

during and after treatment (Apt et al., 2005; Britto et al.,

2001; Russomando et al., 1998; Sanchez et al., 2005;

Schijman et al., 2003), early detection of relapses after

heart transplantation (Maldonado et al., 2004), and other

immunosuppressive circumstances. As expected, a lowCt value (Ct = 14.74), even over the dynamic range of the

technique, was found in the sample from the newborn

with acute congenital infection included in this study.

To be quantifiable, this sample should be diluted before

the extraction step in order to enter the dynamic range

of the technique. However, for more accurate results

in any PCR assay, an international reagent with prop-

erly quantified T. cruzi DNA load would be necessary

for each experiment. International standards for various

infectious agents (human immunodeficiency virus, hep-

atitis C virus) (Saldanha et al., 1999) are available formolecular biology assays, in order to standardise and

compare methods and laboratory performance. Agen-

cies providing such materials should be encouraged to

make properly characterised T. cruzi reagents available

for this purpose.

In summary, this new real-time PCR system is sim-

pler, faster and more reliable than conventional PCR

techniques. Moreover, the possibility of quantification

and the reduced risk of contamination are added values

to this method.

Acknowledgements

This study has been partially supported by grant

024/13/2004 from the Agencia d’Avaluacio de Tecnolo-

gies I Recerca Mediques (AATRM, Catalunya, Spain).

The T. cruzi Maracay strain was kindly provided by

Prof. A. Osuna (Granada, Spain). We are grateful to

Celine Cavallo for the English revision of the manuscript

and to Marta Espelt for technical assistance.

References

Apt, W., Arribada, A., Zulantay, I., Solari, A., Sanchez, G., Mun-

dana, K., Coronado, X., Rodrıguez, J., Gil, L.C., Osuna, A., 2005.

Itraconazole or allopurinol in the treatment of chronic American

trypanosomiasis: the results of clinical and parasitological exam-

inations 11 years post-treatment. Ann. Trop. Med. Parasitol. 99,

733–741.

Britto, C., Silveira, C., Cardoso, M.A., Marques, P., Luquetti, A.,

Macedo, V., Fernandes, O., 2001. Parasite persistence in treated

chagasic patients revealed by xenodiagnosis and polymerase chain

reaction. Mem. Inst. Oswaldo Cruz 96, 823–826.

Cummings, K.L., Tarleton, R.L., 2003. Rapid quantitation of Try-

panosoma cruzi in host tissue by real-time PCR. Mol. Biochem.

Parasitol. 129, 53–59.




Junqueira, A.C., Chiari, E., Wincker, P., 1996. Comparison of the

polymerase chain reaction with two classical parasitological meth-

ods for the diagnosis of Chagas disease in an endemic region of

north-eastern Brazil. Trans. R. Soc. Trop. Med. Hyg. 90, 129–132.

Luquetti, A.O., Rassi, A., 2000. Diagnostico Laboratorial da Infeccao

pelo Trypanosoma cruzi. In: Brener, Z., Andrade, A.A., Barral-

Netto, M. (Eds.), Trypanosoma cruzi e Doenca de Chagas, second

ed. Guanabara Loogan, Rio de Janeiro, pp. 344–378.Maldonado, C., Albano, S., Vettorazzi, L., Salomone, O., Zlocowski,

J.C., Abiega, C., Amuchastegui, M., Cordoba, R., Alvarellos, T.,

2004. Using polymerase chain reaction in early diagnosis of re-

activated Trypanosoma cruzi infection after heart transplantation.

J. Heart Lung Transplant. 23, 1345–1348.

Marcon, G.E.B., Andrade, P.D., de Albuquerque, D.M., Wanderley, J.,

da, S., de Almeida, E.A., Guariento, M.E., Costa, S.C.B., 2002.

Use of a nested polymerase chain reaction (N-PCR) to detect Try-

panosoma cruzi in blood samples from chronic chagasic patients

and patients with doubtful serologies. Diagn. Microbiol. Infect.

Dis. 43, 39–43.

Mora, M.C., Sanchez Negrette, O., Marco, D., Barrio, A., Ciaccio,

M., Segura, M.A., Basombrio, M.A., 2005. Early diagnosis of

congenital Trypanosoma cruzi infection using PCR, hemoculture,

and capillary concentration, as compared with delayed serology. J.

Parasitol. 91, 1468–1473.

Moser, D.R., Kirchhoff, L.V., Donelson, J.E., 1989. Detection of Try-

panosoma cruzi by DNA amplification using polymerase chain

reaction. J. Clin. Microbiol. 27, 1477–1482.

Riera, C., Guarro, A., El Kassab, H., Jorba, J., Castro, M., Angrill, R.,

Gallego, M., Fisa, R., Martin, C., Lobato, A., Portus, M., 2006.

Congenital transmission of Trypanosoma cruzi in Europe (Spain):

a case report. Am. J. Trop. Med. Hyg. 75, 1078–1081.

Russomando, G., de Tomassone, M.M.C., de Guillen, I., Acosta, N.,

Vera, N., Almiron, M., Candia, N., Calcena, M.F., Figueredo, A.,

1998. Treatment of congenital Chagas’ disease diagnosed and fol-

lowed up by the polymerase chain reaction. Am. J. Trop. Med.

Hyg. 59, 487–491.

Saldanha, J., Lelie, N., Heath, A., WHO Collaborative Study Group,1999. Establishment of the first international standard for nucleic

acid amplification technology (NAT) assays for HCV RNA. Vox

Sang 76, 149–158.

Sanchez, G., Coronado, X., Zulantay, I., Apt, W., Gajardo, M., Solar,

S., Venegas, J., 2005. Monitoring the efficacy of specific treatment

in chronic Chagas disease by polymerase chain reaction and flow

cytometry analysis. Parasite 12, 353–357.

Schijman, A.G., Altcheh, J., Buergos, J.M., Biancardi, M., Bisio, M.,

Levin, M.J., Freilij, H., 2003. Aetiological treatment of congenital

Chagas’ disease diagnosedand monitored by thepolymerase chain

reaction. J. Antimicrob. Chemother. 52, 441–449.

Virreira, M., Martınez, S., Alonso-Vega, C., Torrico, F., Solano, M.,

Torrico, M.C., Parrado, R., Truyens, C., Carlier, Y., Svoboda, M.,

2006. Amniotic fluid is not useful for diagnosis of congenital Try-

panosoma cruzi infection. Am.J. Trop. Med. Hyg. 75, 1082–1084.

Virreira, M., Torrico, F., Truyens, C., Alonso-Vega, C., Solano, M.,

Carlier, Y., Svoboda, M., 2003. Comparison of polymerase chain

reaction methods for reliable and easy detection of congenital Try-

panosoma cruzi infection. Am. J. Trop. Med. Hyg. 68, 574–582.

WHO, 2002. Control of Chagas disease. WHO-Technical Report

Series, 905.

Development of a Real-time PCR Assay for Trypanosoma Cruzi

Documents

Transcript of Development of a Real-time PCR Assay for Trypanosoma Cruzi