Proc. Nati. Acad. Sci. USAVol. 90, pp. 1154-1159, February 1993Colloquium Paper

This paper was presented at a colloquium entitled "Molecular Recognition," organized by Ronald Breslow, heldSeptember 10 and 11, 1992, at the National Academy of Sciences, Washington, DC.

Design of a metallo-bZIP protein that discriminates between CREand APi target sites: Selection against APi

(leucine zipper/coiled coil/DNA-protein interaction/specificity/self-assembly)

BERNARD CUENOUD AND ALANNA SCHEPARTZ*Department of Chemistry, Yale University, 225 Prospect Street, New Haven, CT 06511-8118

ABSTRACT The bZIP class of dimeric DNA binding pro-teins is characterized by a motif containing two discretedomains: a DNA contact domain defined by conserved basicand hydrophobic residues (basic domain), and a dimerizationdomain identified by a heptad repeat of leucine residues (zipperdomain). Molecules are constructed in which the GCN4 dimer-ization domain is replaced by a series of stereochemicallydefined metal ion complexes that alter systematically the rel-ative orientation of the basic domain peptides. Both the affinityand the specificity ofDNA binding are modulated by seeminglysmall changes in metal complex stereochemistry. AlthoughGCN4 binds CRE (ATGACGTCAT) and AP1 (ATGACTCAT)target sites with comparable affinity, one metallo-bZIP peptide([G29TshFe) prefers the CRE by 4 kcal mol'1 (1 cal = 4.184 J).Competition experiments performed with several DNAs dem-onstrate that discrimination between CRE and AP1 is domi-nated by selection against the AP1 site.

A fundamental challenge for the field of gene regulation is tounderstand the molecular mechanisms by which proteinsdiscriminate strikingly similar DNA sequences with highprecision. Structural, biochemical, and molecular geneticsstudies of DNA-protein interactions have established twounifying concepts to explain the origins of sequence speci-ficity (1). One involves direct hydrogen bonding and van derWaals interaction ofDNA base pairs with a matrix of proteinside chains oriented with complementarity to the correct, butnot the incorrect, sequences (1). Although some generaliza-tions may be made, these interactions have yet to be codified(2). The second involves the sequence-dependent ability ofDNA to distort upon protein binding. For the field of mo-lecular recognition, a challenge is to elaborate these conceptsand apply them to the design of molecules with tailoredsequence specificity. Sequence specificity may be defined asthe free energy of the correct complex relative to the freeenergies of all possible complexes, whether incorrect orpartially correct (3). Therefore, a complete understanding ofsequence specificity requires identification of not only thosefactors that enhance interaction with the correct site but alsothose factors that inhibit interaction with the incorrect (orpartially correct) site.The bZIP class of DNA binding proteins represents an

excellent system in which to study and apply those factorsthat control sequence specificity (4). The domain responsiblefor DNA recognition is small- 50 amino acids-and con-sists oftwo discrete domains: aDNA contact domain definedby conserved basic and hydrophobic residues (basic domain),and a dimerization domain identified by a heptad repeat of

leucine residues (zipper domain) (5). The two domains areseparated by exactly 6 amino acids, whose sequence is notconserved across bZIP families. Studies have shown that theactive dimeric DNA binding species is generated when thezipper domains of two protein monomers assemble into aparallel coiled coil (6, 7). The "scissors grip" (8) and "in-duced helical fork" (9) models for bZIP-DNA interactionspropose that the coiled coil, the natural dimerization domain,functions as a molecular scaffold to position the two basicdomain peptides in the dimer and present the correct con-stellation offunctional groups to the DNA. Although all bZIPproteins share a common domain architecture, they differ intheir ability to differentiate target sites with alternative half-site spacing. The Fos-Jun subfamily prefers the AP1 site(ATGACTCAT) and the CREB/ATF subfamily prefers theCRE site (ATGACGTCAT) (10, 11). Within a B-DNA con-text, the additional C&G base pair in the CRE site displaces thetwo ATGA contact surfaces by an axial translation of 3.4 Aand a twist angle of 360. Interestingly, the bZIP protein GCN4binds both sites with comparable affinity (12).

Recently, we described a series of synthetic peptides basedon GCN4, whose DNA binding preferences raise interestingquestions regarding the mechanism of sequence specificity inbZIP proteins (13). The molecules we constructed containtwo GCN4 basic domain peptides joined together by bis(ter-pyridyl)iron(II) complexes of well-defined geometry (Fig. 1).With these metal complexes we could assemble a series ofclosely related peptide dimers displaying alternative anddefined orientations ofthe basic domains (13-15). [G29Ts]2Feand [G29TLI2Fe are composed of two 29-residue peptidescontaining the GCN4 basic domain (G29) joined by disulfidebonds to the 4' positions of a bis(terpyridyl)iron(II) complex.In [G29Ts]2Fe, the disulfide and the terpyridyl are separatedby a methylene chain, while in [G29TLI2Fe they are separatedby a propylene chain. [G29TBI2Fe contains two G29 peptidesjoined by disulfide bonds to the 4 positions of a bis(ter-pyridyl)iron(II) complex. We find that these molecules dis-play dramatically different affinities for DNA containing ahigh-affinity GCN4 target site (13). [G29Tsb2Fe binds the CRE(ATGACGTCAT) with a dissociation constant (Kd) of 0.13nM, whereas no CRE interaction is detected with [G29TLI2Feor [G29TBI2Fe at a concentration of 0.2 ,uM. Although GCN4binds CRE and AP1 (ATGACTCAT) target sites with com-parable affinity, [G29Ts]2Fe shows a remarkable preferencefor the CRE site. Here we report the synthesis and charac-terization of [G29Tb2Fe complexes and further describe aseries of competition experiments designed to explore thethermodynamics of these interactions.

Abbreviations: FT, Fourier transform; FAB, fast atom bombard-ment; AAA, amino acid analysis; THF, tetrahydrofuran; HR, highresolution.*To whom reprint requests should be addressed.

1154

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Mar

ch 2

9, 2

020

Proc. Natl. Acad. Sci. USA 90 (1993) 1155

41.

At ^ ~~~~29

29

< L -Q3toSA.~~~~ A

!9.~~~~~~~

7-7-- E v ; S

-ark. . ^ .-- ..... - S\uv ,f'@ ..............

Xz .q>...e...,. 3:":.,,§>&,..,,/

3m.k: i.U:.'..i.'..3

A-. -,,.o....RSE:.SEvr '- A;a.: : :. I. iitf ......... -; My.... ..... .. j^_ C !._x., : JoUNIX,_. Jo..R;'s '.. Co£E_......'

,#e _ /./ I,.A\\..., i A.' 'v. '

,- A] Klzl *,,\a\ *\

1 z:Clii,=l.n:xs

C, \sA,as, Am ..=r-v

An.\ ...

FIG. 1. Schematic representation of [G29Ts]2Fe, [G29TL12Fe, and[G29TB12Fe and a cartoon illustrating DNA binding by metallo-bZIPcomplexes.

MATERIALS AND METHODSGeneral Details. All chemicals were reagent grade. All

synthetic reactions were carried out under a nitrogen atmo-sphere. Solvents were dried by standard methods and weredistilled immediately before use. Thin-layer chromatography(TLC) and flash chromatography (16) were performed withbasic alumina (Merck type T). 1H NMR spectra were re-corded at 250 MHz on a Bruker (Billerica, MA) WM 250spectrometer. Chemical shifts are reported in ppm downfieldfrom (CH3)4Si, and coupling constants are given in Hz. IRspectra were recorded with a Nicolet 5-SX Fourier transform(FT)-IR spectrometer. Mass spectra of organic moleculeswere recorded with a VG Instruments (Danvers, MA)ZAB-SE high-resolution (HR) spectrometer with fast atombombardment (FAB xenon) (Chemistry InstrumentationCenter, Yale University). Mass spectra of bis(terpyridyl)iron(II) complexes were recorded on a Hewlett-Packard 5988spectrometer equipped with an electrospray source (Analyt-ica, Branford, CT). Mass spectra of other peptide derivativeswere recorded with a VG Instruments ZAB-SE HR spec-trometer (W. M. Keck Foundation Biotechnology ResourceLaboratory, Yale University School of Medicine). Aminoacid analysis (AAA) was performed with a Beckman 73000analyzer with norleucine and homoserine as internal stan-dards. Cysteine was not determined. UV/visible (vis) spec-troscopy was carried out on a Perkin-Elmer Lambda 6instrument in 10mM potassium phosphate (pH 7.4). Am. andE are reported in nm and 104cm-' M-1, respectively.4-Ethylcarboylate-4'-methylthio-2,2' :6' ,2"-terpyridine

(Compound 3). To a solution of potassium tert-butoxide (88mg; 785 pumol) in 2.6 ml of dry tetrahydrofuran (THF) wasadded ethyl-2-acetylpyridine-4-carboxylate (compound 1)(17) (55.2 mg; 261 ,umol). The reaction mixture turned deeporange over a 10-min period, after which 3,3-bis(methylthio)-1-(2-pyridinyl)-2-propen-1-one (compound 2) (18) (58.8 mg;261 ,umol) was added. After 14 hr at room temperature (RT),NH4OAc (200 mg; 2.61 mmol) and 1.3 ml of CH3CO2H wereadded and the solvent was removed under reduced pressure.The residue was cooled at RT, treated with 2 g of ice and 2ml of H2O, and allowed to stand at 4°C for 4 hr. The resultingprecipitate was collected by filtration. The filtrate was con-centrated, chilled at 4°C, and filtered. The combined solidswere dried and dissolved in 10 ml of EtOH and 0.5 ml ofconcentrated H2SO4. The solution was refluxed for 17 hr,

cooled to RT, neutralized with NaHCO3, and concentrated.The residue was redissolved in 10 ml of H20 and extractedwith CH2Cl2 (3 X 10 ml). The organic fractions were dried(Na2SO4), filtered, concentrated under reduced pressure, andchromatographed (EtOAc/hexane, 1:9) to provide com-pound 3 as an oil (33.8 mg;% pZmol; 37%). 1HNMR (C2HCl3):8 9.10 (1H, bs, H3), 8.82 (1H, d, J = 5.1, H6), 8.69 (1H, dm,J = 4.7, H6), 8.65 (1H, d, J = 7.9, H3), 8.36 (1H, d, J = 1.8),8.33 (1H, d, J = 1.8), 7.89 (2H, m), 7.35 (1H, ddd, J = 1.1,4.8, 7.5, H5-), 4.48 (2H, q, J = 7.1, OCH2CH3), 2.66 (3H, s,SCH3), 1.46 (3H, t, J = 7.1, OCH2CH3). FT-IR (KBr, neat):2982, 2926, 1727, 1552, 1464, 1376, and 1282 cm-'. HR-MS(FAB, thioglycerol) calculated for C19H18N302S1 [M + H]:352.1119. Found: 352.1143.

4-(Hydroxymethyl)-4'-(methylthio)-2,2':6',2"-terpyridine(Compound 4). To a solution of compound 3 (22 mg; 62.7,umol) in 3 ml of dry THF was added 94,l of 1 M LiAlH4 inTHF (19). After 5 min, 2 ml of MeOH was added and thereaction mixture was stirred until the green color turnedyellow. The solvent was removed and the residue waschromatographed (MeOH/CH2C12, 3:97) to yield compound4 as an oil (17.8 mg; 57 Amol; 92%). 'HNMR (C2HC13): 88.66(1H, d, J = 4.2, H6"), 8.55 (1H, d, J = 5.0, H3-), 8.51 (1H, d,J = 8.0, H6), 8.48 (1H, s, H3), 8.24 (1H, s), 8.23 (1H, s), 7.82(1H, dt, J = 1.7,7.7, H4.), 7.31 (2H, m), 4.81 (2H, s, CH20H),2.62 (4H, s + bs, SCH3, and OH). FT-IR (KBr, neat): 3303,2924, 1575, 1562, 1543, 1463, 1376, 1052, and 785 cm-1.HR-MS (FAB, thioglycerol) calculated for C17H16N301S1 IM+ H]: 310.1014. Found: 310.1013.

4-(Methylthioacetate)-4'-(methylthio)-2,2':6',r2-terpyridine(Compound 5). Diisopropyl azodicarboxylate (34 I-l; 173,umol) was added to a stirred solution of triphenylphosphine(45.5 mg; 173 ,umol) in 600 ,ul ofTHF at 0°C (20). The mixturewas stirred at 0WC for 30 min before addition ofthioacetic acid(12.9 ,ul; 173 ,umol). A solution of compound 4 (17.8 mg; 57.2,umol) in 500 ,ul ofTHF was then added dropwise over 5 min.The reaction mixture was stirred for 1 hr at 0°C and 1 hr atRT. The solution was concentrated and chromatographed(EtOAc/hexane, 15:85) to give thioacetate (compound 5) asan oil (12.6 mg; 34 ,umol; 60%). 1H NMR (C2HC13): 8 8.70(1H, dapp, J = 0.7, H6.), 8.68 (1H, dapp, J = 3.4, H3Y), 8.62 (1H,s, H6), 8.59 (1H, s, H3), 8.31 (1H, s), 8.29 (1H, s), 7.85 (1H,dt, J = 1.6, 7.8, H4.), 7.33 (1H, dd, J = 4.8,7.6, Hs), 7.27 (1H,m, H5), 4.20 (2H, s, SCH2), 2.64 (3H, s, SCH3), 2.39 (3H, s,COCH3). FT-IR (KBr, neat): 3050, 2975, 2923, 1699, 1554,1450, 1370, 1254, 1121, 1098, 792, and 613 cm-'. HR-MS(FAB, thioglycerol) calculated for C19H17N3O1S2 [M + 141:368.0891. Found: 368.0919.

4-[(2-Pyridine)-methyl disulfldeJ-4'-(methylthio)-2,2':6',2r-terpyridine (Compound 6) (TB-SS-py). To a solution of com-pound 5 (12 mg; 32 ,umol) in 352 ,ul of a 100 mM solution of2,2'-dithiodipyridine in MeOH at0°C was added 40 ,ul of anaqueous 1 M LiOH solution (21). After 2 hr. the solvent wasremoved and the residue was chromatographed (EtOAc/hexane, 15:85) to afford TB-SS-PY (compound 6) as an oil (2.9mg; 6.7 ,umol; 21%). 1H NMR (C2HC13): 8 8.70 (1H, dpp, J= 3.9, H6.), 8.57 (1H, dapp, J = 0.8, H3.), 8.53 (1H, dappq J =4.8, H6), 8.51 (1H, s, H3), 8.34 (1H, m, pyH6), 8.32 (1H, d,J = 1.8), 8.24 (1H, d, J = 1.8), 7.88 (1H, dt, J = 1.7, 7.8, H4.'),7.40 (2H, m, pyH3,4), 7.35 (1H, tapp, J = 1.5, HY), 7.27 (1H,m, H5), 6.98 (1H, m, H, pyH4), 4.11 (2H, s, SCH2), 2.65 (3H,s, SCH3). FT-IR (KBr, neat): 3051, 2982, 2920, 2857, 1576,1559, 1416, 1377, 1109, and 784 cm-'. HR-MS (FAB, glyc-erol) calculated for C22Hj8N4S3 [M + H]: 435.0775. Found:435.0822.

4'-(Ethylcarboxylate)-2,2':6',2"-terpyridine (Compound10). A solution of compound 9 (22) (310 mg; 1.20 mmol) in37% HCl (10 ml) was heated to 800C for 2 hr. The reactionmixture was cooled to 40C and brought to pH 7 with 40%KOH (chelex treated). The resulting white precipitate was

Colloquium Paper: Cuenoud and Schepartz

*fG*s)2('

-)()- Si 'I f -.(.1-,

F I-

.185---1 Xf

Dow

nloa

ded

by g

uest

on

Mar

ch 2

9, 2

020

1156 Colloquium Paper: Cuenoud and Schepartz

filtered, dried, redissolved in 20 ml of EtOH and 1 ml ofconcentrated H2SO4, and refluxed for 20 hr. The solution wascooled on ice, neutralized with saturated NaHCO3, andextracted with CH2C12 (2 x 20 ml), and the organic extractswere dried (Na2SO4). After filtration, the solvent was re-moved in vacuo and the residue was chromatographed(EtOAc/hexane; 1:9) to yield ester (compound 10) as an oil(284 mg; 0.93 mmol; 78%) (23). 1HNMR (C2HCl3): 89.00 (2H,s, H3,5'), 8.80 (2H, dapp, J = 5.1, H6,6.), 8.69 (2H, dapp, J =7.8, H3,3), 7.97 (2H, tapp, J = 4.1, H4,4.), 7.42 (2H, tapp, J =5.7, H5,s), 4.48 (2H, q, J = 7.0, OCH2CH3), 1.45 (3H, t, J =7.1, OCH2CH3). FT-IR (KBr, neat): a 1723, 1718, 1557, 1395,1259, 1237, and 765 cm-'. HR-MS (FAB, thioglycerol) cal-culated for C,8H,6N302 [M + H]: 306.1242. Found: 306.1258.

4'-(Hydroxymethyl)-2,2':6',2"-terpyridine (Compound 11).Ester 10 was converted into compound 11 (72%) as describedfor compound 4. 1H NMR (C2HC13): 8.71 8 (2H, dapp, J = 4.2,H6,6.), 8.62 (2H, dapp, J = 8.0, H3,3.), 8.48 (2H, s, H3,5'), 7.80(2H, tapp, J = 7.8, H4,4.), 7.37 (2H, tapp, J = 6.1, H5,5'), 4.90(2H, s, CH20H), 2.7 (1H, bs, OH). FT-IR (KBr, neat): a 3341,3063, 2978, 2860, 1574, 1554, 1466, 1398, 1059, 795, and 734cm-'. HR-MS (FAB, thioglycerol) calculated for C16H14-N301 [M + H]: 264.1136. Found: 264.1158.

4'-(Methylthioacetate)-2,2':6',2"-terpyridine (Compound12). Alcohol 11 was converted into compound 12 (29%) asdescribed for compound 5. 1H NMR (C2HCl3): 8 8.70 (2H,dapp, J = 5.5, H6.'), 8.60 (2H, dd, J = 8.0, 0.6, H3,3Y), 8.41(2H, s, H3,5), 7.86 (2H, dt, J = 8.0, 1.7, H4,4.), 7.34 (2H, ddd,J = 7.5, 4.8, 1.0, H5,5"), 4.26 (2H, s, SCH2), 2.38 (3H, s,COCH3). FT-IR (KBr, neat): d 3226, 1692,,1586, 1567, 1468,1405, 1126, 796, and 740 cm-'. HR-MS (FAB, thioglycerol)calculated for C18H15N3O1S1 [M + H]: 322.1016. Found:322.1030.

4'-[(2-Pyridine)-methyl disulfide]-2,2' :6' ,2"-terpyridine(Compound 13) (Ts-SS-py). Thioacetate 12 was convertedinto compound 13 (55%) as described for compound 6. 1HNMR (C2H302H): 8 8.63 (2H, ddd, J = 4.8, 1.8, 1.0, H6,6.),8.49 (2H, dtapp, J = 8.0, 1.0, H3,3.), 8.27 (2H, s, H3,5s), 8.11(1H, ddd, J = 4.8, 1.8,0.9, pyH6) 7.94 (2H, dtapp, J = 7.7, 1.8,H44.),7.55 (1H, dtapp, J = 8.1,0.9, pyH3), 7.43 (3H, m, H5,5',and pyH5), 6.94 (1H, ddd, J = 7.3, 5.0, 1.1, pyH4), 4.21 (2H,s, SCH2). FT-IR (KBr, neat): a 3096, 1585, 1567, 1468, 1444,1415, 1403, 1116, 794, 759, and 741 cm-'. HR-MS (FAB,glycerol) calculated for C21H16N4S2 [M + H]: 389.0894.Found: 389.0918.

Peptide-Terpyridyl (G"T) Conjugates. G29T conjugateswere prepared as described (13). Peptides were characterizedby AAA, mass spectroscopy, UV/vis spectroscopy, anddenaturing gel electrophoresis. The sequence of G29 isSAALKRARNTEAARRSRARKLQRMKQGGC-NH2. G29:AAA expected, BTIS2Z3G2A6MlL2K3R7Cl (where B = Asxand Z = Glx); found, B,.OTO.9Sl.7Z3.0G2.OA5.8Mo.9Ll.9K2.9R7.9;MS calculated for [M + H] C131H242N57037S2: 3271.8. Found:3270.5. G29Ts: AAA found, B1.0T0.9S1.7Z2.9G1.9A5.7-Mo.9L,.9K2.9R7.6; MS calculated for [M + H] as Cu(II) com-plex C147H253N60O37S3Cui: 3612. Found: 3612. G29TL: AAAfound, B,.0T0.9S1.8Z2.9G2.0 A5.6Mo.9L1.9K2.8R6.9; MS calcu-lated for [M + H] C149H2s7N60O37S3: 3577. Found: 3577.G29TB: AAA found, Bl.oTo.9Sl.8Z2.9G2.0A5.7Mo.8Ll.9K2.9R6.8;MS calculated for [M + H] as Cu(II) complex Cl48H255-N60O37S4Cu1: 3658. Found: 3657.

[G29TsJ2Fe, [G29TB12Fe, and [G29TLhFe. [G29Tsb2Fe (21):AAA found, B,.oTo.9S,.8Z2.9G2.0A5.7MO.9Ll.9K2.9R7.6; MS ex-pected [M + H] C294H504N120O74S6Fel: 7148. Found: 7150;UV/vis Amax = 277 (3.89), 320 (3.34), 560 (1.32). [G29TB]2Fe:AAA found, B,.oTO.95.8Z2.8G2.OA5.7MO.9Ll.9K2.9R7.2; MS ex-pected [M + H] C2%6HSo9N74S8Fel: 7241. Found: 7242; UV/vis Amax = 284 (3.19), 319 (2.63), 570 (1.22). [G29TLh2Fe: AAAfound, B,.oTO.9SI.7B2.9G2.oA5.7MO.9Ll.9K2.9R7.6; MS expected

C298H512N120O74S6Fe1: 7204. Found: 7204; UV/vis A. =273 (4.94), 281 (4.43), 320 (4.80), 555 (1.47).

Bandshlft Competition Assay. To a mixture of unlabeledDNA (55 pM to 40 ,uM) and radiolabeled CRE (<7.5 pM) inbinding buffer (20 mM Tris HCl, pH 7.4/4 mM KCI/2 mMMgCl2/10 mM EDTA/0.1% Nonidet P-40/5% glycerol) wasadded 4 nM peptide in binding buffer (final vol, 10 jl) (13).Solutions were incubated for 1 hr at 40C before being appliedto a running native gel as described (13). Oligonucleotidesequences: CRE, AGTGGAGATGACGTCATCTCGTGC;AP1, AGTGGAGATGACTCATCTCGTGC; OL1, GATAC-CACTGGCGGTGATATC; SCR, AGTGGAGTAAG-GCCTATCTCGTGC. Kd values were determined by fittingthe fractional saturation data to Eq. 5 by using a nonlinearleast-squares fitting program (KALEIDAGRAPH 2.1.2; Abel-beck Software, Reading, PA) with PT = 4 nM and CT = 10pM. The Kd values determined in this way change by <2%when CT is increased by 10. Better fits (R > 0.99) wereobtained when Kpc and KPA were varied simultaneously.Values of Kpc determined this way (0.52 + 0.41 nM for[G29Tsh2Fe; 0.22 ± 0.06 nM for G29ss) agree well with thosedetermined by direct mobility-shift analysis (0.13 ± 0.01 nMfor [G29Ts]2Fe; 0.50 ± 0.03 nM for G29s5).

RESULTSSynthesis of Bis(peptlde-.terpyridyl)iron(fl) Complexes. Bis

(peptide-terpyridyl)iron(II) complexes were prepared by ad-dition of iron(II) to the appropriate peptide-terpyridyl con-jugate and were purified by HPLC (21). Peptide-terpyridylconjugates were prepared by reacting peptides containing asingle reactive cysteine with appropriately substituted ter-pyridyl thiols activated as thiopyridine disulfides. Thiopyri-dine disulfides 6 and 13 were synthesized as shown in Fig. 2.To generate TB-SS-py 6, a-oxoketenethiocetal 2 reacts withthe potassium enolate of ethyl-2-acetylpyridine-4-carbox-ylate 1 to provide the intermediate 1,5-enedione, which isconverted into a terpyridyl derivative by the action of am-monium acetate and acetic acid using the general methodol-ogy of Potts (22). After esterification, terpyridyl 3 is reducedwith lithium aluminum hydride and converted to thioacetate5 by a modified Mitsunobu reaction (20). Hydrolysis of thethioacetate by reaction with lithium hydroxide in the pres-ence of 2,2'-dithiodipyridine affords TB-SS-py 6. To generateTs-SS-py 13, methylthioterpyridyl 7 is oxidized to methyl-sulfonyl 8 with m-chloroperoxybenzoic acid and convertedinto cyano terpyridyl 9. Acid hydrolysis of the nitrile pro-vides the acid, which is then esterified. Conversion of ester10 to TS-SS-py 13 is carried out as described above forTB-SS-py 6. The activated terpyridyl disulfide used in thepreparation of [G29TL]2Fe has been described (21).

Bandshift Competition Assay. A bandshift competition as-say (14, 24) was used to quantify the affinities of [G29Ts]2Feand G29ss for CRE, AP1, and two nonspecific DNAs. Ra-diolabeled CRE-G29Ts]2Fe or CRE-G29SS complexes wereincubated with increasing concentrations of unlabeled com-petitor DNA and the loss of radiolabeled complex wasmonitored by nondenaturing gel electrophoresis. Four com-petitor DNAs were used: CRE, AP1, OLl (which does notbind GCN4 or GCN4-derived peptides) (25), and SCR (ascrambled version of CRE).The mass action equations describing the two equilibria

observed in a competition experiment may be represented byEqs. 1 and 2

(CT - PC)(PT - PC - PA)- i

PC

Proc. Natl. Acad Sci. USA 90 (1993)

&'&M - I^JJ

Dow

nloa

ded

by g

uest

on

Mar

ch 2

9, 2

020

Proc. Natl. Acad. Sci. USA 90 (1993) 1157

N SCH32 o SCH3

CO2Et1.1 ) KO-'Bu

N COCH3,2. NH4OAc, HOAc3. EtOH, HW

1. mCPBA

2. NaCN rl

8: R=SO2CH39: R=CN

1. UAIH42. AcSH, PPh3,I DEAD

,Et

la HC,80 Clb. EBOH, H'3. UAIH4,4. AcSH, PPh3DEAD

SCH3

e A/drithioltm'

4: X=OH5: X=SAc X

R

N114't N') AldrfthioP ,

1 0: R=CO2Et1 1: R=CH20H1 2: R=CH2SAc

FIG. 2. Scheme illustrating synthesis of substituted terpyridyl derivatives used in preparation of [G29Ts]2Fe and [G29TB]2Fe. PPh3,triphenylphosphine; mCPBA, m-chloroperoxybenzoic acid; DEAD, diisopropyl azodicarboxylate.

KPA =(AT - PA)(PT- PC - PA)

PA

PT, AT, and CT are, respectively, the total conc

[G29TS]2Fe or G29Ss, competitor DNA, and radi(DNA. PC represents the concentration of radiolpeptide complex and PA represents the conipeptide-competitor complex. Kpc represents 1

peptide-CRE complex and KPA represents tipeptide-competitor complex. From these equaderived the basic competition equation (26)

PC =- PT(CT - PC)AT - PA]

KPC[1+ +J (CT - PKPA

The fractional saturation of radiolabeled[G29Ts]2Fe or G29SS may be represented by (where PC is the radioactivity contained in theand CT is the sum of the radioactivity found in tifree bands. Thus, the fractional saturation ofCRE is represented by Eq. 4

PT(1-0)r AT]

KPC 1 + + CT(l- O)KPA

If this quadratic expression is solved in 0, one c(27)

(KPC +-AT +PT+CT- (KPC + K AT +PT + CKPA

T

KPA

2CT

Competition curves showing the dependence ofshown with a representative data set in Fig. 3determined by nonlinear least-squares analysis ofshown in Table 1.

Inspection of Table 1 illustrates that unlabele(petes effectively with radiolabeled CRE for[G29Ts]2Fe, whereas AP1 competes poorly. Desthat the CRE and AP1 sequences differ onlybase-pair insertion, the data demonstrate thatdisplays a 1600-fold preference for CRE oveipreference exhibited by [G29Ts]2Fe corresponds

ential binding free energy (AAGobs) of >4 kcal mol-I (1 cal[2] = 4.184 J) at 4°C. Almost as striking as the preference of

[G29Ts]2Fe for CRE is the preference of AP1 for G29ss.Although [G29Ts]2Fe and G29SS contain exactly the samecentrations of 29-residue peptide, APi interacts with G29ss to form a

oabeled CRE complex that is 150 times more stable (as measured by Kd)labeled CRE than the complex formed with [G29TsJ2Fe. The failure ofcentration of AP1 to compete effectively with CRE for binding tothe Kd of the [G29Ts]2Fe is consistent with our inability to observe a stablehe Kd of the bandshift, a DNase I footprint, or an increase in peptide.tions may be helicity as measured by circular dichroism spectroscopy

when [G29Ts]2Fe is incubated with AP1 (13).In contrast with the results obtained with [G29Ts]2Fe, the

[3] disulfide-linked dimer G29SS prefers CRE to AP1 by a factorof 6. The absolute value ofthe [G29Ts]2Fe-CRE Kd measured

C) by competition (0.098 nM) agrees well with the Kd measuredby mobility-shift analysis (0.13 nM) under similar experimen-

CRE with tal conditions (13). The modest CRE preference displayed== PC/CT, by G29ss is in agreement with results of Talanian et al. (28)

bound band on similar disulfide-linked dimers. Note that the affinityhe bound and of [G29Ts]2Fe for CRE is comparable to that of G29ss.radiolabeled This indicates that the increased selectivity exhibited by[G29Ts]2Fe is not due to an overall diminished affinity that

permits binding to only the more symmetric CRE site. Thetwo nonspecific DNAs display strikingly different peptide

[4] affinities. OL1 binds with dissociation constants in the mi-cromolar range, whereas SCR binds with dissociation con-stants in the nanomolar range.

)btains Eq. 5 DISCUSSION

Synthetic Dimerization Domains in Protein Design. Ourmodel-building studies began with the coordinates of the

2 scissors grip model proposed by Vinson et al. (8). We sought- 4CTPT a kinetically stable, stereochemically well-defined transition

oTJ T T/ metal ion complex whose overall dimensions were comple-mentary to the void produced upon removal of the bZIP

[5] coiled coil and that could be converted synthetically intodimerization domains with alternative geometries. These

0 on PT are requirements were satisfied by the bis(terpyridyl)iron(II)3 Kd values complex first prepared by Morgan and Burstall in 1932 (29).fthe data are The overall diameter of this coordination complex, as mea-

sured by the distance between the 4' carbons on the twod CRE com- terpyridyl ligands in the crystal, is 9.22 A (30). This diameterbinding to may be compared with the average distance between the two

;pite the fact helices in the GCN4 coiled-coil crystal structure, which is 9.3by a single A (7). As illustrated in Fig. 1, attachment of G29 to the 4'[G29TsI2Fe position of the terpyridyl ligand creates a bis(terpyridyl)

r AP1. The iron(II) complex ([G29Ts]2Fe) in which the two peptide car-s to a differ- boxamide termini are separated by a distance of 11 A and

Colloquium Paper: Cuenoud and Schepartz

Dow

nloa

ded

by g

uest

on

Mar

ch 2

9, 2

020

1158 Colloquium Paper: Cuenoud and Schepartz

A

. *._ W4O.,_ . ,-_.......

BW 0.

Alc 0.cc

0.SO

I

.4

.22[G29TeF. a

10.2 i1Io 10' 101 12 1 16

Cg 0.8I.,I 0.6.

,0.4

0.2nU* , fe

[competior DNA] (nM)

.e....o. ....M

10-2 10-1 lop lo'1 o o 1, lolfcompilor DNA] (nM)

FIG. 3. Bandshift competition assay quantifying relative affinities of [G29Tsh2Fe and G29ss for specific and nonspecific DNAs. (A)Autoradiograms illustrating the disappearance of labeled CRE [G29TsI2Fe as a function of added competitor DNA. (B) Semilogarithmic plotsillustrating the fraction labeled CRE (0) bound to [G29Tsh2Fe (Upper) and G29ss (Lower) as a function of added competitor DNA. Error barsshown for competition by CRE (a), AP1 (a), OL1 (A), and SCR (*) represent SD of at least three independent experiments. Solid lines representbest fit of data to Eq. 5.

emerge from the complex with a relative orientation of 1800.Attachment of G29 to the 4 position of the terpyridyl ligandcreates a bis(terpyridyl)iron(II) complex ([G29TBe2Fe) inwhich the two peptide carboxamide termini are separated bya distance of -8 A and emerge with a relative orientation of90°. In addition to these desirable conformational features,the high stability of bis(terpyridyl)iron(II) complexes (31)facilitates HPLC purification and HR-MS analysis.

[G29Ts]2Fe Prefers CRE to APi by >4 kcalmol'1. Ourresults show that the disulfide dimer G29SS, like GCN4 itself,binds the CRE and AP1 target sites with comparable affinity,whereas [G29Ts]2Fe prefers the CRE by a factor of >1600. Ata temperature of 40C, this discrimination corresponds to adifferential binding free energy (AAGobs) of >4 kcal1mol1.The affinity of [G29Tsb2Fe for the API site is lower than orcomparable to its affinity for two nonspecific DNAs, SCRand OLL. We have shown previously that no DNase Ifootprint is observed at the AP1 site when DNA containingboth AP1 and CRE sites is incubated with [G29Ts]2Fe,although a clean footprint is observed at the CRE site (13).G29SS generates a DNase I footprint at both sites (13). A<10% increase in peptide helicity is observed when[G29Ts]2Fe is incubated with AP1 at 5 ,uM, whereas a 60%increase in helicity is observed with CRE (13). We concludethat the interaction between [G29Ts]2Fe and AP1 is largelynonspecific. Apparently, [G29Tsh2Fe interacts with a targetsite of incorrect half-site spacing through a mechanism dif-

Table 1. DNA affinities of [G29Ts]2Fe and G29ss determined bycompetition analysis using radiolabeled CRE

Kd, nM KrelCompetitor [G29Ts]2Fe G29Ss [G29TsI2Fe G29Ss

CRE 0.098 0.19 1.0 2.0AP1 158.2 1.04 1614.0 11.0OLl 337.6 1440.0 3445.0 14,694.0SCR 1.28 5.67 13.0 58.0

Krel is defined as the Kd relative to that for interaction of[G29Ts]2Fe with CRE.

ferent from that utilized by the glucocorticoid receptor. X-raycrystallographic analysis (32) indicates that when the gluco-corticoid receptor binds a sequence with incorrect half-sitespacing, it interacts specifically with the consensus target halfsite and nonspecifically with the adjacent, incorrectly spacedelement. Were this mechanism utilized by [G29Ts]2Fe in itsinteraction with AP1, we would expect a partial increase inpeptide helicity and a Kd value reflecting the energeticconsequences of specific interactions with one half site. Thisis not observed (13). The observation of nonspecific (asopposed to "half specific") binding suggests that recognitionof the AP1 and CRE sites may be very different.The Bis(terpyridyl)iron(l) Dimerization Domain Selects

Against AP1 Rather Than for CRE. Comparison of therelative affinities of [G29Ts]2Fe and G29ss for specific andnonspecific DNAs provides insight into the mechanism bywhich [G29Ts]2Fe discriminates between the CRE and AP1sites. The data in Table 1 reveal that [G29Ts]2Fe binds CRE(a specific DNA) and OLl and SCR (two nonspecific DNAs)3.5 times as well as does G295s. Yet [G29Ts]2Fe binds AP1 150times more poorly than G29ss. This comparison indicates thatsubstitution of the GCN4 coiled coil for a bis(terpyridyl)iro-n(II) complex increases nonspecific DNA binding by a factorof 3.5 and simultaneously decreases specific binding to AP1by a factor of 150. This suggests that the predominantmechanism by which [G29Ts]2Fe discriminates the CRE andAP1 sites involves a 150-fold (2.8 kcal mol-1 at 40C) selectionagainst AP1. That is, increased specificity is not achievedthrough an enhanced interaction with the CRE. Rather,increased specificity is achieved through the absence of afavorable interaction, or more likely through the presence ofa mispositioned interaction, that destabilizes the complexwith AP1 (3). The 3.5-fold increase in nonspecific DNAbinding observed with [G29Ts]2Fe may be due to the highereffective charge on this molecule: at neutral pH, [G29Ts]2Fehas a net charge of +20, whereas G29ss has a net charge of+18.

Implications for the Origins of Sequence Selectivity in Nat-ural bZIP Proteins. Our results show that the bis(terpyridyl)

29%

Proc. Natl. Acad Sci. USA 90 (1993)

Aa

Dow

nloa

ded

by g

uest

on

Mar

ch 2

9, 2

020

Proc. Natl. Acad. Sci. USA 90 (1993) 1159

iron(II) complex, a synthetic dimerization domain, modifiesthe inherent selectivity of the GCN4 basic domain withoutaltering its sequence. [G29Ts]2Fe prefers CRE to AP1 by afactor of 1600, whereas GCN4 (and G29ss) display littleCRE/AP1 selectivity. Although these results do not demon-strate unambiguously that the selectivity exhibited by CREBand ATF proteins is controlled by their zipper domains, itdoes demonstrate that specificity may be modulated byseemingly small conformational changes at the zipper-linkerboundary. Linker domains are not conserved across bZIPfamilies but are conserved within them. We note in particularthat the linker domains in CREB and ATF proteins containa basic residue at position e of the heptad repeat and a largehydrophobic residue at position g. In GCN4 and in the junfamily, the pattern is reversed: leucine is invariably atposition e and arginine is at position g. It may be that subtle,sequence-dependent conformational changes in the linkerdomain control the relative orientation with which the twobasic domain peptides diverge from the coiled coil and enterthe major groove. Alternatively, the sequence specificityobserved here may be the result of the energetic cost ofsequence-specific DNA bending (33-35).

In summary, we demonstrate that the bis(terpyridyl)iron(II) complex in [G29Ts]2Fe is sufficient to mediate preferentialbinding of a GCN4 peptide to CRE. The thermodynamicbasis of CRE preference appears to be dominated by desta-bilization of the interaction of [G29Ts]2Fe with AP1. Theresult is a synthetic molecule with greater sequence speci-ficity than GCN4 itself. The ability to design semisyntheticmolecules with enhanced selectivity could facilitate the de-sign of synthetic peptides and peptidomimetics with predict-able and novel specificities.

We thank the W. M. Keck Foundation Biotechnology ResourceLaboratory at Yale University for peptide synthesis and analysis andmass spectroscopy. B.C. thanks the Arthur Wayland Dox Founda-tion for a predoctoral fellowship. This work was supported by grantsto A.S. from the National Foundation for Cancer Research and theAmerican Cancer Society. A.S. is a David and Lucile PackardFoundation Fellow, an Eli Lilly Biochemistry Fellow, and a NationalScience Foundation Presidential Young Investigator.

1. Steitz, T. A. (1990) Q. Rev. Biophys. 23, 205-280.2. Seeman, N. C., Rosenberg, J. M. & Rich, A. (1976) Proc. Natl.

Acad. Sci. USA 73, 804-808.3. von Hippel, P. H. & Berg, 0. G. (1986) Proc. Natl. Acad. Sci.

USA 83, 1608-1612.4. Pathak, D. & Sigler, P. B. (1992) Curr. Opinion Struct. Biol. 2,

118-123.5. McKnight, S. L. (1991) Sci. Am., 54-64.6. O'Shea, E. K., Rutkowski, R. & Kim, P. S. (1989) Science 243,

538-542.

7. O'Shea, E. K., Klemm, J. D., Kim, P. S. & Alber, T. (1991)Science 254, 539-544.

8. Vinson, C. R., Sigler, P. B. & McKnight, S. L. (1989) Science246, 911-916.

9. O'Neil, K. T., Hoess, R. H. & DeGrado, W. F. (1990) Science249, 774-778.

10. Hai, T., Liu, F., Allegretto, E. A., Karin, M. & Green, M. R.(1988) Genes Dev. 2, 1216-1226.

11. Hai, T., Liu, F., Allegretto, E. A., Karin, M. & Green, M. R.(1989) Genes Dev. 3, 2083-2090.

12. Sellers, J. W., Vincent, A. C. & Struhl, K. (1990) Mol. Cell.Biol. 10, 5077-5086.

13. Cuenoud, B. & Schepartz, A. (1993) Science, in press.14. Schepartz, A. & McDevitt, M. (1989) J. Am. Chem. Soc. 111,

5976-5977.15. Jones, M. W., Gupta, N., Schepartz, A. & Thorpe, H. (1992)

Inorg. Chem. 31, 1308-1310.16. Still, W. C., Kahn, M. & Mitra, A. (1978) J. Org. Chem. 43,

2923-2925.17. Queguiner, G. & Pastour, P. (1969) Bull. Soc. Chim. Fr. 11,

4082-4086.18. Potts, K. T., Ralli, P., Theodoris, G. & Winslow, P. (1985) Org.

Synth. 64, 189-194.19. Mosher, H. & Tessieri, J. (1951) J. Am. Chem. Soc. 51,

4925-4927.20. Volante, R. P. (1981) Tetrahedron Lett. 33, 3119-3122.21. Cuenoud, B. & Schepartz, A. (1991) Tetrahedron Lett. 28,

3325-3328.22. Potts, K. T., Cipullo, M. J., Ralli, P. & Theodoris, G. (1982) J.

Org. Chem. 47, 3027-3037.23. Winslow, P. (1984) Ph.D. dissertation (Rensselaer Polytechnic

Inst., Troy, NY).24. Fried, M. & Crothers, D. M. (1981) Nucleic Acids Res. 9,

6505-6525.25. Weiss, M. A., Ellenberger, T., Wobbe, C. R., Lee, J. P.,

Harrison, S. C. & Struhl, K. (1990) Nature (London) 347,575-578.

26. Lin, S.-Y. & Riggs, A. D. (1977) J. Mol. Biol. 72, 671-690.27. Weeks, K. M. & Crothers, D. M. (1992) Biochemistry 31,

10281-10287.28. Talanian, R. V., McKnight, C. J., Rutkowski, R. & Kim, P. S.

(1992) Biochemistry 31, 6871-6875.29. Morgan, G. T. & Burstall, F. H. (1932) J. Chem. Soc. 134,

20-30.30. Baker, A. T. & Goodwin, H. A. (1985) Aust. J. Chem. 38,

207-214.31. Constable, E. C. (1986) Adv. Inorg. Chem. Radiochem. 30,

69-121.32. Luisi, B. F., Xu, W. X., Otwinowski, Z., Freedman, L. P.,

Yamamoto, K. R. & Sigler, P. B. (1991) Nature (London) 352,497-505.

33. Kerppola, T. M. & Curran, T. (1991) Cell 66, 317-326.34. Kerppola, T. M. & Curran, T. (1991) Science 254, 1210-1214.35. Gartenberg, M. R., Ampe, C., Steitz, T. A. & Crothers, D. M.

(1990) Proc. Natl. Acad. Sci. USA 87, 6034-6038.

Colloquium Paper: Cuenoud and Schepartz

Dow

nloa

ded

by g

uest

on

Mar

ch 2

9, 2

020