doi:10.1016/j.jmb.2008.10.083 J. Mol. Biol. (2009) 385, 568–579

Available online at www.sciencedirect.com

Defining the DNA Substrate Binding Sites onHIV-1 Integrase

James Dolan1, Aiping Chen1, Irene T. Weber2, Robert W. Harrison3

and Jonathan Leis1⁎

1Department of Microbiologyand Immunology,Feinberg School of Medicine,Northwestern University,Chicago, IL 60611, USA2Department of Biology,Georgia State University,Atlanta, GA 30303, USA3Department of ComputerScience, Georgia StateUniversity, Atlanta, GA 30303,USA

Received 22 July 2008;received in revised form24 October 2008;accepted 28 October 2008Available online7 November 2008

*Corresponding author. E-mail addrj-leis@northwestern.edu.Abbreviations used: HIV-1, huma

virus type 1; IN, integrase; LTR, longsimian immunodeficiency virus; ASvirus; LEDGF, lens-epithelium-derivMLV, murine leukemia virus; oligo,oligodeoxyribonucleotide.

0022-2836/$ - see front matter © 2008 E

A tetramer model for human immunodeficiency virus type 1 (HIV-1) inte-grase (IN) with DNA representing long terminal repeat (LTR) termini waspreviously assembled to predict the IN residues that interact with the LTRtermini; these predictions were experimentally verified for nine amino acidresidues [Chen, A., Weber, I. T., Harrison, R. W. & Leis, J. (2006). Identi-fication of amino acids in HIV-1 and avian sarcoma virus integrase subsitesrequired for specific recognition of the long terminal repeat ends. J. Biol.Chem., 281, 4173–4182]. In a similar strategy, the unique amino acids foundin avian sarcoma virus IN, rather than HIV-1 or Mason–Pfizer monkey virusIN, were substituted into the structurally related positions of HIV-1 IN.Substitutions of six additional residues (Q44, L68, E69, D229, S230, andD253) showed changes in the 3′ processing specificity of the enzyme,verifying their predicted interaction with the LTR DNA. The newly iden-tified residues extend interactions along a 16-bp length of the LTR terminiand are consistent with known LTR DNA/HIV-1 IN cross-links. The tetra-mer model for HIV-1 IN with LTR termini was modified to include two INbinding domains for lens-epithelium-derived growth factor/p75. Thetarget DNA was predicted to bind in a surface trench perpendicular tothe plane of the LTR DNA binding sites of HIV-1 IN and extending along-side lens-epithelium-derived growth factor. This hypothesis is supportedby the in vitro activity phenotype of HIV-1 IN mutant, with a K219Ssubstitution showing loss in strand transfer activity while maintaining 3′processing on an HIV-1 substrate. Mutations at seven other residuesreported in the literature have the same phenotype, and all eight residuesalign along the length of the putative target DNA binding trench.

© 2008 Elsevier Ltd. All rights reserved.

Edited by J. Karn

Keywords: HIV-1; integrase; model structure; DNA

Introduction

The integrase (IN) of human immunodeficiencyvirus type 1 (HIV-1) is an attractive target for thera-peutic development, as it is essential for early stepsin viral replication and there are no homologues inthe eukaryotic system for which inhibitors would

ess:

n immunodeficiencyterminal repeat; SIV,

V, avian sarcomaed growth factor;

lsevier Ltd. All rights reserve

negatively affect host viability. This enzyme is bothnecessary and sufficient to catalyze the insertion ofviruses into host DNA.1–3 In the first step or 3′processing reaction, two deoxyribonucleotides areremoved from the 3′ end of long terminal repeat(LTR) strands containing the highly conserved CAdinucleotides. In the second step or strand transferreaction, the newly created 3′ ends undergo a stag-gered nucleophilic attack on two strands of thetarget DNA. These structures are resolved andrepaired by host cell enzymes, resulting in an inte-grated copy of the viral DNA, with the gene-enco-ding sequence colinear to the viral RNA and flankedby a 4- to 6-bp duplication of the target DNA,depending upon the viral IN.Design of inhibitors has been hampered by the

lack of crystal structures available for full-length INmonomers or higher-order IN oligomers, let alone in

d.

569Integrase Amino Acids Involved in Recognition of DNA

complex with DNA. Partial structures with two ofthe three domains have been reported, and thesewere used to assemble a model of a tetramer HIV-1IN with bound LTR DNAs.4 The model was thenused to predict residues that were in close proximityto the viral DNA. To verify these predictions, astructural alignment of the primary sequences ofHIV-1, simian immunodeficiency virus (SIV), andavian sarcoma virus (ASV) INs5 was used to identifyresidues that were unique to each virus enzyme,since viral IN specifically recognizes its cognate LTRend substrates. The unique amino acids from ASVIN were substituted into the equivalent structuralposition of HIV-1 IN. Substitution of the ASV INresidues conferred on the HIV-1 IN mutants thepartial ability to cleave an ASV substrate. Multipleresidues of HIV-1 IN were demonstrated to alterspecificity (V72, S153, K160, I161, G163, Q164, V165,H171, and L172,4 shown in red in Fig. 1) for only oneof the two LTR ends. In this report, we haveidentified six additional HIV-1 IN residues thatinfluence the selection of the LTR end substrates for3′ processing. These include Q44, L68, E69, D229,S230, and D253, which align, along the two LTRbinding grooves, with previous residues that alterrecognition.In addition, the structural model was modified to

include the host protein lens-epithelium-derivedgrowth factor (LEDGF)/p75 IN binding domainsand to predict a trench on the HIV-1 IN surface thatmay accommodate the target DNA. The putativebinding site for target DNA is positioned roughlyperpendicular to the LTR binding sites. Consistentwith this interpretation, we have identified in the

literature a series of amino acids along the length ofone side of this trench, where point amino acidsubstitutions result in enzymes that lose the ability tostrand transfer with little or no effect on 3′ proces-sing. In addition, we have identified a residue on theopposite wall of the trench, K219, where serinesubstitution displays the same phenotype. Thisresidue was found in a peptide that was previouslydemonstrated to cross-link to the target DNA.7

Results

Prediction of additional HIV-1 IN residuesinteracting with LTR DNA ends

In the original selection of amino acids that couldaffect the recognition of LTR ends, we used thestructural alignment of SIV, HIV-1, and ASV INs toidentify those residues that were unique. We subse-quently observed that HIV-1 IN was capable of 3′processing a U5 SIV, but not aMason–Pfizer monkeyvirus, LTR DNA substrate (data not shown). There-fore, we examined the structural alignment of HIV-1and ASV INs with the Mason–Pfizer monkey virusIN sequence.5 This analysis identified additionalunique residues in the IN model near the LTRDNA ends: Ser39, Lys42, Gln44, Leu68, Glu69,Leu74, Lys156, Glu170, Tyr227, Asp229, Ser230,Asp253, Asn254, Lys258, and Arg262 (HIV-1 INnumbering). To test whether any of these residueswere involved in the recognition of LTR ends, 11HIV-1/ASV IN chimeras that substituted the aminoacid from ASV IN into the structurally equivalent

Fig. 1. HIV-1 IN homotetramermodel with bound HIV-1 LTR sub-strates. The IN tetramermodel, withsubunits interacting with the twoviral DNA ends shown in cyan andyellow, andwith two other subunitsshown in gray. The LTR DNA endsare represented by blue helices. Theamino acids that specifically recog-nize the viral DNA are shown in aspace-fill model for only one viralDNA end. Those shown in red arefrom Chen et al., and those newlyidentified are shown in magenta.4

This figurewasmade using PyMol.6

Table 1. Summary of activity in HIV-1/ASV chimeras on 3′ end processing

MutantLTR-end base-pair

interaction Substitutionsa3′ processing ofHIV substrateb

3′ processing ofASV substrateb

Wild type 1–16 None +++ −S39/42 6–8 S39T K42H + −S44 3–6 Q44N ++ +S68–69 5–8 L68E E69P +++ +S74 3–6 L74A − −S156 3–6 K156R + −S170 11–14 E170M + −S227 14–15 Y227I − −S229–S230 15–16 D229I S230E ++++ ++++S253 8–12 D253N +++ +++S254 8–12 N254D ++ −S258/262 19–20, 13–14 K258T R262S − −S7C 1–16 V72W S153R K160D I161R G163R Q164V

V165L H171K L172Q D229I S230E D253N− ++

a Amino acid substitutions are as described, based on the alignment in Supplementary Fig. 1.b Activity against the DNA substrates relative to wild-type activity: N110% (++++), 90–110% (+++), 50–90% (++), 10–50% (+), b10% (−).

570 Integrase Amino Acids Involved in Recognition of DNA

position of HIV-1 IN, as described in Materials andMethods, were constructed. A list of chimeras ispresented in Table 1.

Purification of HIV-1/ASV IN chimeras

HIV-1 IN mutants were constructed and purifiedas described inMaterials andMethods. The chimeraswere assembled in a 3CSF185H background, anenzyme with four amino acid substitutions (C56S,C65S, C280S, and F185H), to improve solubility. Thisenabled purification of the chimeras from the solublefaction. Individually, these amino acid substitutionshave little or no effect on viral replication.8–10 En-zymes purified by this protocol were free of detec-table nonspecific nuclease.4 When an HIV-1 G197Isubstitution, which caused a significant decrease in3′ processing, was combined into chimeras that alterLTR recognition, this resulted in purified enzymesthat did not efficiently 3′ process HIV-1 or ASVsubstrates. As further evidence for the purity of INsprepared by this protocol, 5′ 33P-end-labeled DNAsubstrates representing the HIV-1 U5, ASV U3, andmurine leukemia virus (MLV) U5 LTR termini wereindividually incubatedwith wild-type or selected INchimeras. The 3CSF185H HIV-1 and ASV INs cleavetheir respective homologous substrates, but notheterologous substrates, including the MLVsequence (Fig. 2). The MLV U5 LTR DNA sequenceis cleaved by wild-type MLV IN.11 As previously

and the products were separated by denaturing gel electrophothe −2 cleavage product demonstrates the specific enzymatic p

reported,4 the G163R Q164V V165L chimera in the3CSF185H background cleaved both HIV-1 U5 andASV U3 LTR end substrates (Fig. 2). However, thechimera did not cleave the MLV U5 substrate,indicating that the ability to cleave the ASV substratewas not due to a nonspecific nuclease activity. Asecond HIV-1 IN that contains a K211S substitution,also in the 3CSF185H background, cleaved theHIV-1U5 substrates, but not the ASV U3 or MLV U5substrates. This amino acid is positioned in thestructural model at a distance from the LTR bindingsites, so that it was expected to maintain HIV-1substrate specificity for 3′ processing.

Effect of specific amino acid changes on3′ processing

We screened each HIV-1/ASV IN chimera listed inTable 1 for their ability to 3′ process HIV-1 and ASVLTR duplex DNA substrates. Of the chimeras tested,S39T K42H, Y227I, N254D, K258T, and R262Sshowed decreased or no activity with HIV-1 subs-trates and did not cleave the ASV substrates (datanot shown). As such, these residues were not furtherconsidered. In contrast, Q44N, L68E E69P, D229IS230E, and D253N maintained the ability to cleavethe HIV-1 substrate and gained the ability to cleavethe ASV substrates to different extents (Fig. 3). D229IS230E was unique among these mutants in that itpossessed more 3′ processing activity towards the

Fig. 2. Purified chimeras do notcleave MLV substrates. 33P-end-labeled duplex oligos representingthe HIV-1 U5, ASVU3, andMLVU5LTR ends were incubated with HIV-1 (3CSF185H), ASV, or mutant HIV-1 INs (the triple-substitutionmutantG163R Q164V V165L and K211S),

resis as described in Materials and Methods. Production ofrocessing of the viral DNA substrate.

Fig. 3. The 3′ processing of HIV-1 U5 and ASV U3 LTR duplex oligosubstrates by wild-type and HIV-1/ASV IN chimeras. (a) HIV-1 andASV IN, and Q44N, D229I S230E,D253N, and N254D chimeras wereincubatedwithHIV-1 U5 or ASVU3LTR substrates and analyzed as de-scribed in the legend to Fig. 2. (b)HIV-1 and ASV IN, and S39T K42H,L68E E69P, K258I R262S, and S7Cwere analyzed as in (a). S7C is in anHIV-1 IN background and has 12amino acid substitutions, as de-scribed in Table 1.

571Integrase Amino Acids Involved in Recognition of DNA

HIV-1 substrate than 3CSF185H IN (Fig. 3a). Thus,the residues Q44, L68, E69, D229, S230, and D253have been verified to interact with the viral LTR andare highlighted on the structural model in Fig. 1(magenta residues), along with previously identifiedresidues that affect 3′ processing specificity (redresidues).4 Taken together, these residues strikinglydefine two linear trenches on the HIV-1 INmolecularsurface that accommodate the two LTR ends. Thebinding trenches are asymmetrically positionedalong the two strands of a 16-bp length of the LTRends. Twelve of the 15 amino acid exchanges thataffect LTR recognition in the processing reactionwere combined into a single construct (V72W S153RK160D I161R G163R Q164V V165L H171K L172QD229I S230E D253N) and purified from the solublefraction. As shown in Fig. 3b, this enzyme, designa-ted S7C, is active and has substantially more specific3′ processing activity towards the ASV than the HIV-1 DNA substrate. We also assembled an S7C INchimera in which the substitutions at positions 185and 280 were restored to wild-type residues. Unfor-tunately, this resulted in an enzyme that wasinsoluble; 3′ processing activity, however, could berecovered by renaturation fromurea, and the activityof this enzyme was qualitatively similar to thatshown for S7C. This indicates that these two substitu-tions did not affect the specificity of the 3′ proces-sing reaction. Taken together, these results suggestthat the sum of IN interactions along a 16-bp lengthof the viral DNA ends determines its specificity.While we have been able to alter the specificity for

3′ processing of LTR substrates, we have not beenable to demonstrate specificity changes in strandtransfer activity. Several amino acid changes intro-duced into the HIV-1 IN (L68E and E69P, V72W, andH171K and L172Q) that alter 3′ processing disrupt

the strand transfer activity towards the HIV-1 subs-trates. The reason for this is not known. Substitu-tions at the other 10 residues that affect 3′ processingsupport strand transfer activity with HIV-1 sub-strates. None of the chimeras had strand transferactivity using the ASV substrate. When we com-bined multiple substitutions into the soluble form ofS7C, it also was unable to support a strand transferreaction with either the HIV-1 U5 LTR or the ASVU3LTR preprocessed end substrates. One possibleexplanation for this behavior might be that, sinceIN is a tetramer, single substitutions of one residuewill necessarily change all four subunits, whichmight be responsible for the loss in strand transferactivity.

Activity complementation during drug selection

When HIV-1 is replicated in the presence ofdiketo-acid-based compounds, a number of escapemutants that are believed to act against the strandtransfer reaction are selected. We previously repor-ted that V72 and S153 were among the residues thatinfluence LTR selection, and these residues weremutated in drug-resistant INs.4 Changes at position230 in HIV-1 IN are also found in drug-resistantINs.12 When a substitution in IN that disrupts itscatalytic activity (3′ processing or strand transfer)occurs, we hypothesize that second site mutationsin IN are selected to compensate for the lost activitycaused by the original mutation. In the case of theV72W IN mutant, which has reduced 3′ processingof HIV-1 substrates (79% compared to wild-type;SD=8.6), second site substitutions at F121, T125, andV151 have been reported.13 HIV-1 IN with a T125Ssubstitution resulted in an enzyme that increased its3′ processing reaction relative to 3CSF185H (126%;

572 Integrase Amino Acids Involved in Recognition of DNA

SD=11.7). When the V72W and T125S substitutionswere combined into the same enzyme, the resul-tant chimera had a 3′ processing activity equi-valent to 3CSF185H (97%; SD=2.0). This result

demonstrates that at least one mutation at asecond site associated with substitutions at posi-tion 72 can compensate for its decreased 3′ pro-cessing activity.

Fig. 4. Model of HIV-1 IN tetra-mer interacting with two LEDGFdomains and two viral LTRs. (a) TheLEDGF/p75 domains that interactwith IN are shown in magenta, withthe modeled tetramer of HIV-1 INshown in gray. Residues reported tointeract directly with LEDGF arevisualized in red, while residuesthat affect the IN/LEDGF interac-tion when mutated are shown inyellow.14–16 Only the residues clo-sest to LEDGF are shown. The INtetramer is formed by twodimers, soeach pair of subunits has differentconformations and interactions.LEDGFdomains interactwith oppo-site ends of the tetramer, and viralLTRs interact at the perpendicularends of IN. The equivalent residuesin other subunits of the IN tetramermay be closer to the LTR or other INdomains. The arrows indicate theproposed binding site for targetDNA. (b) The four subunits of INare shown in surface representationto reveal the proposed trench forbinding target DNA in an orienta-tion similar to that in (a). The INsubunits are colored as in Fig. 1,withcyan and yellow indicating subunitsinteracting with the LTRs. The LTRDNA ends are shown in blue, andLEDGF is shown in magenta. Resi-dues 94, 118–120, 123, 130, 132, 141,159, 181, 185, and 203 that interactwith target DNA are shown in greenspace-fill models. Residue 219 (red)is in peptide 213–247, which isknown to cross-link to target DNAin a disintegration model substrate.7

The residues lie on either side of thetrench that circles the IN tetramerrunning approximately perpendicu-lar to and between the modeled LTRends.

573Integrase Amino Acids Involved in Recognition of DNA

Model of IN tetramer with LTR ends andLEDGF/p75 IN binding domains

The model of the IN tetramer with viral LTR endswas augmented with the host protein LEDGF. TheLEDGF IN binding domain from the crystal struc-ture of LEDGF bound to the catalytic domain of IN(2B4J) was docked to the HIV-1 IN tetramer model.Two LEDGF subunits, bound at opposite ends, wereaccommodated (Fig. 4a). Structural data show thatthe binding pocket for the LEDGF IN bindingdomain is formed by residues 102, 128, 129, and132 in one IN subunit and by residues 174 and 178 ina second subunit.14 These residues (shown in red) areat the LEDGF/HIV-1 IN interface. Additional resi-dues that may be involved in the interaction withLEDGF (shown in yellow), based on mutagenesisand structural data, include residues 131, 161, 165,166, 168, and 170–173.14–16 These residues are alsolocated at or near the interaction interface in ourmodel. Therefore, the new model is consistent withinformation for the residues implicated in the INinteraction with LEDGF.

Target DNA binding trench

A groove is observed on the IN tetramer modelbetween the two LTR ends and approximatelyperpendicular to the long axis of the LTR DNA thatcould accommodate the target DNA. The positioningof LEDGF as an extension of the target DNA bindingtrench (Fig. 4a, arrows) would be consistent with itsrole in interacting with chromatin to influence targetsite selection.17–21 We predict from the structural

Fig. 5. The effect of amino acid substitutions on 3′processing and strand transfer at residues in the putativeDNA binding trench. HIV-1 IN, K211S, and K219S INmutants were incubated with HIV-1 U5 LTR end duplexsubstrate, as described in the legend to Fig. 2 (HIV 3′), or apreprocessed HIV-1 U5 LTR duplex substrate, with thetwo bases removed adjacent to the CA dinucleotide (HIVST), as described in Materials and Methods. In the ST lane,products migrating slower than the starting substraterepresent the integration of one oligo into another. Thisfigure was made using PyMol.6

model that mutations introduced into the targetDNAbinding site of IN, but distant from the catalyticand LTR binding sites, would have a phenotypewhere strand transfer would be inactivated withoutimpairment of the 3′ processing reaction. Within theputative DNA binding trench, mutations of a seriesof residues, including S119,22 N120,23 C130,24,25

W132,25 F181, and F185,26 display this activity phe-notype. These residues align along one wall of thetrench (Fig. 4b, green residues). If this trench is thebinding site for the target DNA, we would predictthat point mutations introduced at residues on theopposite wall would have the same phenotype. Wetherefore assembled HIV-1 IN mutants with K211S,K219S, and Q221S substitutions, respectively. Eachwas tested for 3′ end processing and strand transferagainst the homologous HIV-1 DNA substrates. TheK211S mutant showed near-wild-type 3′ processing,while the K219S mutant still had 3′ processing acti-vity towards an HIV-1 substrate, although less thanwild type (Fig. 5). When tested in the strand transferassay using preprocessed HIV-1 LTR DNA, weobserved that the K211S mutant was as active aswild type, while the K219S mutant was inactive. Theactivity of the Q221S mutant in both 3′ end proces-sing and strand transfer was similar to that of K211S(data not shown). Thus, the K219S enzyme lost theability to strand transfer with a decrease in 3′ pro-cessing, while the K211S and Q221S mutants had nodetectable effect on either activity. These resultssuggest that K219 is involved in binding to the targetDNA.

Discussion

The homotetramer form of IN catalyzes all of itsknown enzymatic activities. While dimers of IN arecapable of catalyzing 3′ processing and strandtransfer reactions, they do not support a concertedDNA integration reaction.27 For this reason, a homo-tetramer model was assembled. In the model, two ofthe four subunits are depicted with major contactswith the LTR and target DNAs. The remaining twosubunits are available for contacts with proteins thatinteract with IN,28,29 including the host proteinLEDGF, as shown in our newly augmented IN tetra-mer model. There are at least 15 residues in the LTRbinding groove on the IN surface that are associatedwith LTR specificity. They are predicted to interactasymmetrically along a 15- to 16-base length of DNAduplex (see Fig. 1). When LTR DNA is bound to INand the complex is treated with DNase, a 16-bpduplex length of the LTR is protected from diges-tion.30,31 Thus, there is agreement between the size ofthe protected DNA and residues in close proximityto the LTRDNA that change specificity for substrates(Fig. 1). Moreover, when mutations are introducedinto HIV-1 LTR duplex DNA substrates at 16 bp fromthe ends, changes in concerted DNA integration invitro are detected.32 Interactions between viral DNAand HIV-1 IN have also been demonstrated in cross-linking studies for residues 143, 148, 156, 159, 160,

574 Integrase Amino Acids Involved in Recognition of DNA

230, 246, 262, 263, and 264.33–37 These residues arehighlighted in Fig. 6. A group clusters in and aroundthe catalytic site, in close proximity to the first sixbases/base pairs of the processed LTR ends. Asecond group that includes residues 246, 262, 263,and 264 are in close proximity to base pairs 15 and 16of the LTR DNA that interact with residues 229, 230,and 253 identified in this study. Finally, Agapkina etal. used substrate analogs to probe contacts betweenHIV-1 IN and LTR DNA substrates.39 In this study,they identified 11 contacts with the sugar phosphatebackbones from residues 5–9 and interactions withfour bases asymmetrically distributed between thetwo strands of the LTR ends. The 15 residues thatinfluence specificity for 3′ processing reactions arespatially in close proximity to all of these sugarphosphate backbone contacts and most of the basecontacts.There is a series of naphthyridine carboxamide

and diketo-acid-related drugs that act in the nano-molar range to inhibit HIV-1 IN.12,13,40–47 Drug-resistant enzymes with changes at more than 10different sites were identified. Five of these residueswere unique in the structural alignment of differentINs and were located near the LTR ends in thestructural model. While these drugs were thought toact at strand transfer and not 3′ processing, wefound that HIV-1 IN residues S153 and V72,4 as wellas S230, were among those positions involved inLTR end recognition and 3′ processing. Becausedrug-resistant sites affect specific recognition of theviral DNA ends and change the rate of processing ofHIV-1 substrates, we predict that amino acidchanges at some of these sites will lead to partiallydefective INs in cells. This should subsequentlyresult in selection of second site substitutions thatcompensate for the loss in 3′ processing activitycaused by the initial drug-resistant amino acid subs-titutions. If correct, we predict that, depending uponthe extent of change in 3′ processing observedtowards HIV-1 duplex substrates,4 our data will be

correlated to the appearance of individual or multi-ple residue substitutions detected in drug-resistantenzymes. For example, in the case of a position 153chimera, it gains the ability to 3′ process the ASVLTR end duplex with only a small decrease in itsability to 3′ process the HIV-1 duplex substrate.4 Assuch, we would predict that this mutation would befound by itself and should have only a small effecton replication of HIV-1 in cells, as observed.47,48 Incontrast, the substitution at position 72 (V72W)caused a larger decrease in the ability to process theHIV-1 U5 duplex substrate.4 On this basis, wewouldpredict that the V72I drug-resistant mutation wouldappear in the presence of other substitutions thatcompensate for the loss in its 3′ processing towardsHIV-1 substrates. Second site mutations of F121Yand T125K subsequently appear in HIV-1 IN con-taining the V72I mutation.13 A T125S substitutionincreases the 3′ processing of U5 HIV-1 duplex,4 aswell as the joining of an HIV-1 preprocessed subs-trate. When combined with the V72Wmutation, thisproduces an enzyme with near-wild-type levels of 3′processing, suggesting that a second site mutationcompensates for the decrease in 3′ processingcaused by the initial drug-resistant mutation. Ano-ther illustrative example involves position 230,where substitutions at this residue also affect recog-nition of the viral DNA ends. With the caveat thatthe exchange of S230E was analyzed as a doublemutant in combination with D229I, it gained theability to cleave the ASV substrate; however, incontrast to chimeras with changes at position 72 or153, it displayed an increase in activity towards HIV-1 substrates. Changes at position 230 are reported toappear in conjunction with T66I and M74L substitu-tions in cells.12 We have not analyzed substitutionsat position 66 in vitro, but Lee and Robinsonreported that the T66I substitution caused a smalldecrease in 3′ processing.47 We tested an M74Asubstitution that resulted in a significant loss of 3′processing of HIV-1 substrates. Taken together, this

Fig. 6. Residues reported in theliterature to cross-link to viral LTRDNA. Interactions between viralDNA and HIV-1 IN have beendemonstrated for residues Tyr143,Gln148, Lys156, Lys159, Lys160,Ser230, Glu246, Arg262, Arg263,and Lys264.33–36,38 These residuesare shown in red in space-fill repre-sentation and shown only for oneLTR end.

575Integrase Amino Acids Involved in Recognition of DNA

suggests that substitution at position 230 mightcompensate for the loss in 3′ processing caused bymutations at positions 74 and 66.In examining the structural model, we identified a

trench on the HIV-1 IN surface, with its long axisalmost perpendicular to those accommodating theviral DNA ends.4 We speculate that the target DNAfits into this groove. Moreover, interactions withLEDGF will further stabilize this IN/target DNAcomplex and would be consistent with the role ofLEDGF inpromoting the interaction of the integrationcomplex with host chromosomal DNA.15,18,29,49–51The target DNA is positioned between the viralDNA ends, and this location will facilitate thenucleophilic attack of the 3′ hydroxyl ends of therespective CA strands into each strand of the targetDNA. There are several lines of evidence thatsupport this hypothesis. First, amino acid residuesS119, N120, C130, W132, and K159 are reported tointeract with target DNA based upon activity anddrug sensitivity data.22,23,25,48,52 These residuesstrikingly align along one surface wall of the pro-posed target DNA binding trench. An N120S mutantis reported to increase 3′ processing and strandtransfer activities, while N120Q and N120K mutantsshow little effect on processing, but some decrease instrand transfer.23,48 The C130S and W132A/G/Rsubstitutions are reported to have normal 3′ proces-sing, but little or no joining activity.25 A C130Ssubstitution, in combination with three other muta-tions, shows loss in strand transfer, but somedecrease in 3′ processing.10 More recently, fourHIV-1 IN mutants with W132Y, M178C, F181G,and F185G substitutions, respectively, were cons-tructed.26 The enzymes with mutations at positionsW132, F181, and F185 did not support a strandtransfer reaction, but hadwild-type or near-wild-typelevels of 3′ processing. In contrast, the mutation atM178 showeddecreases in both activities.26 This latterresidue lies below the surface of the target DNAbinding trench (data not shown). An ASV INmutant,structurally equivalent to HIV-1 IN S119, has normal3′ processing, but barely detectable strand transferactivity.22 Similarly, Asp substitutions in ASV INequivalent to HIV-1 IN G94 and S123 show the sameactivity phenotype (Michael Katzman, Penn StateCollege of Medicine, personal communication).Finally, HIV-1 IN substitutions of I141K, I203P, orI203K (Corinne Ronfort, Universite de Lyon, personalcommunication) also show a loss in strand transferwith little effect on 3′ processing. As shown in Fig. 4b,G94, S119, S123, W132, I141, F181, F185, and I203 lieon the IN surface in the putative target DNA bindingtrench (green residues) and are aligned with otherresidues that cause similar activity defects. Asreported here, the K219S mutation also loses strandtransfer, but maintains 3′ processing activity. Incontrast to the above residues, K219 is found on theopposite wall of the trench (Fig. 4b, red residues). AK219A mutation has been analyzed for its effect onHIV-1 replication and was reported to have a limitedeffect.53 It is not known why it did not show astronger phenotype. This may be related to alanine,

rather than serine, being substituted in this study, orthis may reflect differences in sensitivity between invitro and in cell assays.Second, the target DNA binding site contains

peptides previously shown to be cross-linked to thetarget DNA portion of a disintegration substratemodified with an azidophenacyl group.7 After UVphotoactivation, cross-links between the DNA sub-strate and six endoproteinases of GluC-digestedpeptides were established. In terms of our model,peptide 139–152 represents the active site betweenthe two LTR ends and contains Q148, as well asQ137, Q146, and N144. A second peptide, 213–247,is found at a distance from the catalytic site in theputative target DNA binding site and containsK219, but not K211. The K211S mutation has noeffect on the activity of IN in vitro. The other pep-tides identified in that report were implicated inbinding both viral and target DNA substrates, oronly the viral DNA substrate, in agreement with themodel's predictions.Third, we find a series of residues (Arg, Lys, Gln,

and Asn) appearing along the length of the putativeDNA binding pocket, which are found in knownDNA binding sites of other enzymes54–56 and couldtherefore be involved in binding to the target DNA.In contrast to the residues interacting with the LTRends, these residues are conserved among INs todifferent extents. This would be consistent with INinserting the viral DNA into many sites in the targetDNA. Five of these residues (Q62, N117, Q148,N155, and K159) have been mutated and causedefects to 3′ processing, strand transfer, and disin-tegration.9,23,35–37 These residues are predicted to liein the catalytic site between the ends of the twoLTRs so they could interact with both the viral andthe target DNAs. This conclusion is supported by arecent study showing that Q148 cross-linked to theends of the LTRs.57

Fourth, when we examined the positions in thestructural model of 50 amino acid residues describedin the literature,9,23,37,58–61 where mutations result ineither little or no effect on—or decreases in—both 3′processing and joining activities, none lays in theproposed target DNA binding trench. The onlyexception is when the targeted amino acids werepositioned between the two LTR ends, where theycould interact with both viral and target DNAs.Additionally, Puglia et al. reported an analysis ofHIV-1 INwhere in-frame insertions of small peptideswere placed at 56 sites.62 Themutants were analyzedfor changes in the joining reaction (but not 3′processing, since a preprocessed substrate wasused). We examined the positions of these mutationsin our structural model and could interpret theirreported activity changes. For example, when thebulky insertions are near the enzyme surface, but notnear the viral DNA ends or the proposed target DNAbinding site, the model predicts and Puglia et al.report that there is no effect on activity.62 In contrast,when the peptide insertions are at the surface neareither the viral DNA or target DNA binding sites, wepredict that there should be a disruption to the

576 Integrase Amino Acids Involved in Recognition of DNA

joining reaction, as observed. When insertions areburied within the structure, we predict distortionsthat disrupt all activities, and this, too, is seen.Finally, we mapped the naphthyridine carboxa-

mide and diketo-acid-related drug-resistant sites onthe structural model. The drug-resistant sites asso-ciated with diketo acid compounds (residues 66, 74,92, 143, 148, and 151–155) map on the active siteregion of the target DNA binding trench near orbetween the two LTRs. The naphthyridine-carbo-xamide-related drug-resistant sites (residues 121and 125) map on the target DNA binding trenchnear the LEDGF binding sites shown in Fig. 4. Thisobservation suggests that the naphthyridine-carbo-xamide-related drugs might interfere with forma-tion of the LEDGF–HIV-1 IN complex. Others(residues 72 and 150) map on the target DNAbinding site near the LTRs. Taken together, theseresults are consistent with the model and thehypothesis for the binding of target DNA.

Materials and Methods

Reagents

[γ-33P]ATP (2500 Ci/mmol) was purchased from PerkinElmer Life Sciences. HiTrap™ Chelating HP resin andHiTrap™ Heparin HP resin were purchased from GEHealthcare Life Sciences (Piscataway, NJ). T4 polynucleo-tide kinase was obtained fromUSB (Cleveland, OH). IPTGwas obtained from Roche (Indianapolis, IN). The Slide-A-Lyzer Dialysis cassette (molecular weight cutoff, 10,000)was obtained from Pierce (Rockford, IL). CentriPrepcentrifugal filter devices with YM-10 MW membraneswere obtained from Millipore (Bedford, MA). Acrylamideand bisacrylamide solutions were obtained from Bio-Rad(Hercules, CA). SimplyBlue Safe Stain was obtained fromInvitrogen (Carlsbad, CA). DE81 filters were purchasedfrom Whatman International Ltd. (Kent, UK). Unlessspecified, all restriction enzymes were purchased fromNew England Biolabs (Beverly, MA). ASV IN was pro-vided by Dr. Ann Skalka (Fox Chase Cancer Center,Philadelphia, PA). An expression construct for HIV-1 INresidues 1–288 (p28bIN-3CS-F185H) was also obtainedfrom the laboratory of Dr. Ann Skalka and contains thewild-type NY5 HIV-1 sequence (Parke Davis clone) fromthe NdeI site to the HindIII site in the pET28b plasmidvector. The IN sequence encodes four substitutions (C56S,C65S, C280S, and F185H) to increase solubility and a six-amino-acid His-tag separated from the N-terminus of INby a thrombin cleavage site. Two translation stop codonswere added after residue D288. MLV oligodeoxyribonu-cleotide (oligo) substrates were a gift from Monica Roth(University Medical and Dental Center of New Jersey).

Bacterial strains and growth conditions

The protein expression host strain BL21(DE3) waspurchased from Novagen (Madison, WI). Selection ofmutagenesis for chimera construction was performed inSupercompetent XL1-Blue cells from Stratagene (LaJolla, CA). Storage of confirmed clone DNA was carriedout in DH5α at −80 °C using competent cells from Invi-trogen. Unless otherwise noted, bacteria were selectedusing LB+Kan53 media at 37 °C.

Preparation of duplex oligo substrates

The following oligos were used in the IN 3′ processingactivity assay:

HIV-1 U55′ TGTGGAAAATCTCTAGCAGT 3′ (+)3′ ACACCTTTTAGAGATCGTCA 5′ (−)

ASV U35′ GTATTGCATAAGACTACATT 3′ (+)3′ CATAACGTATTCTGATGTAA 5′ (−)

MLV U55′ CCGTCAGCGGGGGTCTTTCATT 3′ (+)3′ GGCAGTCGCCCCCAGAAAGTAA 5′ (−)

The following oligos were used in the IN strand transferactivity assay to simulate preprocessed LTR ends:

HIV-1 preprocessed U55′ TGTGGAAAATCTCTAGCA 3′ (+)3′ ACACCTTTTAGAGATCGTCA 5′ (−)

ASV preprocessed U35′ GAGTATTGCATAAGACTACA 3′ (+)3′ CTCATAACGTATTCTGATGTAA 5′ (−)

The plus-strand substrates (100 pmol, containing theconserved ‘CA’ dinucleotides) were 5′-end-labeled usingT4 polynucleotide kinase (30 U) and [γ-33P]ATP, aspreviously described.4 The specific activity of the radi-olabeled substrates was diluted to 105 cpm/pmol usingunlabeled plus-strand oligo, and the mixture was purifiedand recovered from a 20% denaturing polyacrylamide gel.Duplex oligos were formed by annealing to a molar excessof unlabeled complementary strand, as described.4

Construction of HIV-1 IN mutants

Mutagenesis oligoswere obtained from IntegratedDNATechnologies, Inc. (Coralville, IA) and are listed inSupplementary Table 1. The mutations were constructedusing QuikChange® Site-Directed Mutagenesis Kit fromStratagene in accordance with the manufacturer's direc-tions. Codon preferences for Escherichia coli were used inthe oligo design. The presence of all mutations wasconfirmed by sequencing complete individual DNAclones. The Wizard® Plus SV Miniprep DNA PurificationSystem (Promega,Madison,WI)was used to prepareDNAfor cloning.

Purification of HIV-1 IN chimeras

His-tagged HIV-1 IN chimeras were purified from thesoluble fraction as previously described,63 with somemodifications. Briefly, proteins were induced in BL21(DE3) cells at 20 °C by adding IPTG to 0.5 mM after thebacteria had grown to an optical density at 600 nm of 0.8.The bacteria were lysed in 25 mM bis Tris (pH 6.1), 1 MKCl, 1 M urea, 1% thiodiglycol, and 5 mM imidazole, andthen filtered through a 0.22-μmmembrane from Millipore(Billerica, MA). The lysate fraction was applied to aHiTrap™ Chelating HP Ni-affinity column (5 ml), and INwas eluted with a linear imidazole gradient (5 mM to1.0 M). Fractions containing IN, as detected by absorbanceat 280 nm and as confirmed by SDS-PAGE with stainingusing the SimplyBlue Safe Stain, were applied to aHiTrap™ Heparin HP column (5 ml) and eluted with0.25–1.0 M linear KCl gradient. Selected fractions were

577Integrase Amino Acids Involved in Recognition of DNA

concentrated using a Centriprep filter with YM-10 MWmembrane and then dialyzed against 25 mM bis Tris(pH 6.1), 0.5 M KCl, 1% thiodiglycol, 1 mM DTT, 0.1 mMethylenediaminetetraacetic acid, and 40% glycerol. Thepurified protein was aliquoted and stored at −80 °C. Theprotein concentration was determined using a Bio-Radprotein assay, as described by the manufacturer.

IN 3′ end processing or strand transfer assay usingduplex oligo substrates

The processing reactions for the HIV-1 U5 or ASV U3LTR substrates were carried out as previously described.32

These two substrates were used because they were the“dominant” LTR ends, where substitutions into thesesequences caused large decreases in the rate of concertedintegration in vitro.64–66 Substitutions introduced into theHIV-1 U3 or ASV U5 LTR substrates change the mechan-ism of concerted DNA integration in vitro from two-endedto one-ended insertion events. In a volume of 12 μl, thereoccurred reactions with 25 mM 3-(N-morpholino)propa-nesulfonic acid (pH 7.2), 10 mM DTT, 15 mM potassiumglutamate, 5% polyethylene glycol 8000, 5% dimethylsulfoxide, 500 ng of HIV-1 or HIV-1 chimeras, and 1 pmolof labeled duplex substrate, as indicated. Reactionmixtures were assembled from individual componentsand preincubated overnight at 4 °C. To start the processingreaction, MgCl2 was added to a final concentration at10 mM, and reaction mixtures were incubated at 37 °C for90 min. The reactions were stopped by the addition of 3 μlof stop buffer (95% formamide, 20 mM ethylenediamine-tetraacetic acid, 0.1% xylene cyanol, and 0.1% bromophe-nol blue), heated to 95 °C for 5 min, and then placed on ice.Products of the reaction were separated through a 20%polyacrylamide denaturing sequencing gel. Labeled reac-tion products were visualized using KODAK MR film byexposure overnight. For reactions containing ASV IN, thefinal reaction mixture contained 20 mM 3-(N-morpholino)propanesulfonic acid (pH 7.2), 3 mM DTT, 100 μg/mlbovine serum albumin, 500 ng of ASV IN, and 1 pmol oflabeled duplex substrates, as indicated. For the strandtransfer assay, the reaction conditions are identical withthose used for 3′ end processing; however, the substratesused mimic the preprocessed LTR end (designed with5′-CA dinucleotide overhang) in order to promote strandtransfer. The reaction products were analyzed by denatur-ing gel electrophoresis.4,67

Modeling of LEDGF complex with IN tetramer andLTR DNAs

The crystal structure of LEDGF (residues 345–426)bound to the IN catalytic domain dimer (2B4J) was super-imposed on the IN catalytic domains in the tetramermodel. Then, the program AMMP68 was used to produceand to minimize hydrogen atom positions for the twoLEDGF monomers, and the monomers were minimizedusing conjugate gradients with all nonbonded andgeometric terms. The all-atom sp4 potential set69,70 wasused with the charge generation parameters from Bagossiet al. and a dielectric of 1.0.71 The LEDGF monomers werecombinedwith themodel consisting of the tetramer of full-length IN with Zn and Mg atoms (two 20-mer LTRs), asdescribed in Chen et al.4 The new model with LEDGF wasoptimized by 500 cycles of conjugate gradient minimizationin AMMP to ensure good nonbonded interactions. Thestandard AMMP conjugate gradients algorithm with thePolak–Ribere beta and inexact line search was used for opti-

mization. The total nonbonded energy was minimized from11,754,460.0 kcal/mol to −20,446.6 kcal/mol, and the maxi-mum magnitude (11 norm) of the derivative of the energy(gradient) was reduced from 1,734,389,397.9 kcal/(mol A) to50.03 kcal/(mol A) in the final model comprising 22,162atoms. Figures of the model were made using PyMol.6

Acknowledgements

We thank Yuan-Fang Wang for assistance withmodeling and preparation of structural figures. Thiswork was supported, in part, by United StatesPublic Health Service grants AI054143 (to J.L.),GM6290, and GM065762 (to I.T.W. and R.W.H.). J.D. was supported, in part, by the Training Programin Viral Replication T32 AI060523.

Supplementary Data

Supplementary data associated with this articlecan be found, in the online version, at doi:10.1016/j.jmb.2008.10.083

References

1. Katz, R. A., Merkel, G., Kulkosky, J., Leis, J. & Skalka,A. M. (1990). The avian retroviral IN protein is bothnecessary and sufficient for integrative recombinationin vitro. Cell, 63, 87–95.

2. Li, M. & Craigie, R. (2005). Processing of viral DNAends channels the HIV-1 integration reaction toconcerted integration. J. Biol. Chem. 280, 29334–29339.

3. Sinha, S. & Grandgenett, D. P. (2005). Recombinanthuman immunodeficiency virus type 1 integrase exhi-bits a capacity for full-site integration in vitro that iscomparable to that of purified preintegration com-plexes from virus-infected cells. J. Virol. 79, 8208–8216.

4. Chen, A., Weber, I. T., Harrison, R. W. & Leis, J. (2006).Identification of amino acids in HIV-1 and avian sar-coma virus integrase subsites required for specificrecognition of the long terminal repeat ends. J. Biol.Chem. 281, 4173–4182.

5. Snasel, J., Krejcik, Z., Jencova, V., Rosenberg, I.,Ruml, T., Alexandratos, J. et al. (2005). Integrase ofMason–Pfizer monkey virus. FEBS J. 272, 203–216.

6. De Lano, W. L. (2002). The PyMol MolecularGraphics System v1.00 edit.

7. Heuer, T. S. & Brown, P. O. (1997). Mapping features ofHIV-1 integrase near selected sites on viral and targetDNA molecules in an active enzyme–DNA complexby photo-cross-linking. Biochemistry, 36, 10655–10665.

8. Bischerour, J., Tauc, P., Leh, H., de Rocquigny, H.,Roques, B. & Mouscadet, J. F. (2003). The (52–96)C-terminal domain of Vpr stimulatesHIV-1 IN-media-ted homologous strand transfer of mini-viral DNA.Nucleic Acids Res. 31, 2694–2702.

9. Engelman, A., Liu, Y., Chen, H., Farzan, M. & Dyda, F.(1997). Structure-based mutagenesis of the catalyticdomain of human immunodeficiency virus type 1integrase. J. Virol. 71, 3507–3514.

10. Zhu, K., Dobard, C. &Chow, S. A. (2004). Requirementfor integrase during reverse transcription of humanimmunodeficiency virus type 1 and the effect of

578 Integrase Amino Acids Involved in Recognition of DNA

cysteine mutations of integrase on its interactions withreverse transcriptase. J. Virol. 78, 5045–5055.

11. Villanueva, R. A., Jonsson, C. B., Jones, J., Georgiadis,M. M. & Roth, M. J. (2003). Differential multimeriza-tion of Moloney murine leukemia virus integrasepurified under nondenaturing conditions. Virology,316, 146–160.

12. Fikkert, V., Van Maele, B., Vercammen, J., Hantson, A.,Van Remoortel, B., Michiels, M. et al. (2003). Develop-ment of resistance against diketo derivatives ofhuman immunodeficiency virus type 1 by progressiveaccumulation of integrase mutations. J. Virol. 77,11459–11470.

13. Hazuda, D. J., Anthony, N. J., Gomez, R. P., Jolly,S. M., Wai, J. S., Zhuang, L. et al. (2004). A naphthy-ridine carboxamide provides evidence for discordantresistance betweenmechanistically identical inhibitorsof HIV-1 integrase. Proc. Natl Acad. Sci. USA, 101,11233–11238.

14. Cherepanov, P., Ambrosio, A. L., Rahman, S., Ellen-berger, T. & Engelman, A. (2005). Structural basis forthe recognition between HIV-1 integrase and tran-scriptional coactivator p75. Proc. Natl Acad. Sci. USA,102, 17308–17313.

15. Busschots, K., Vercammen, J., Emiliani, S., Benarous,R., Engelborghs, Y., Christ, F. & Debyser, Z. (2005).The interaction of LEDGF/p75 with integrase is lenti-virus-specific and promotes DNA binding. J. Biol.Chem. 280, 17841–17847.

16. Rahman, S., Lu, R., Vandegraaff, N., Cherepanov, P.& Engelman, A. (2007). Structure-based mutagenesisof the integrase–LEDGF/p75 interface uncouples astrict correlation between in vitro protein binding andHIV-1 fitness. Virology, 357, 79–90.

17. Raghavendra, N. K. & Engelman, A. (2007).LEDGF/p75 interferes with the formation of synap-tic nucleoprotein complexes that catalyze full-siteHIV-1 DNA integration in vitro: implications for themechanism of viral cDNA integration. Virology, 360,1–5.

18. Llano, M., Saenz, D. T., Meehan, A., Wongthida, P.,Peretz, M., Walker, W. H. et al. (2006). An essentialrole for LEDGF/p75 in HIV integration. Science, 314,461–464.

19. Llano, M., Vanegas, M., Hutchins, N., Thompson, D.,Delgado, S. & Poeschla, E. M. (2006). Identificationand characterization of the chromatin-binding do-mains of the HIV-1 integrase interactor LEDGF/p75.J. Mol. Biol. 360, 760–773.

20. Ciuffi, A. & Bushman, F. D. (2006). Retroviral DNAintegration: HIV and the role of LEDGF/p75. TrendsGenet. 22, 388–395.

21. Vanegas, M., Llano, M., Delgado, S., Thompson, D.,Peretz, M. & Poeschla, E. (2005). Identification of theLEDGF/p75 HIV-1 integrase-interaction domain andNLS reveals NLS-independent chromatin tethering.J. Cell Sci. 118, 1733–1743.

22. Konsavage, W. M., Jr, Burkholder, S., Sudol, M.,Harper, A. L. & Katzman, M. (2005). A substitution inrous sarcoma virus integrase that separates its twobiologically relevant enzymatic activities. J. Virol. 79,4691–4699.

23. Gerton, J. L., Ohgi, S., Olsen, M., DeRisi, J. & Brown,P. O. (1998). Effects of mutations in residues near theactive site of human immunodeficiency virus type 1integrase on specific enzyme–substrate interactions.J. Virol. 72, 5046–5055.

24. Al-Mawsawi, L. Q., Sechi, M. & Neamati, N. (2007).Single amino acid substitution in HIV-1 integrase

catalytic core causes a dramatic shift in inhibitorselectivity. FEBS Lett.

25. Al-Mawsawi, L. Q., Fikkert, V., Dayam, R., Witvrouw,M., Burke, T. R., Jr, Borchers, C. H. & Neamati, N.(2006). Discovery of a small-molecule HIV-1 integraseinhibitor-binding site. Proc. Natl Acad. Sci. USA, 103,10080–10085.

26. Al-Mawsawi, L. Q., Hombrouck, A., Dayam, R.,Debyser, Z. & Neamati, N. (2008). Four-tiered piinteraction at the dimeric interface of HIV-1 integrasecritical for DNA integration and viral infectivity.Virology, 377, 355–363.

27. Faure, A., Calmels, C., Desjobert, C., Castroviejo,M., Caumont-Sarcos, A., Tarrago-Litvak, L. et al.(2005). HIV-1 integrase crosslinked oligomers areactive in vitro. Nucleic Acids Res. 33, 977–986.

28. Van Maele, B., Busschots, K., Vandekerckhove, L.,Christ, F. & Debyser, Z. (2006). Cellular co-factors ofHIV-1 integration. Trends Biochem. Sci. 31, 98–105.

29. Cherepanov, P., Maertens, G., Proost, P., Devreese, B.,Van Beeumen, J., Engelborghs, Y. et al. (2003). HIV-1integrase forms stable tetramers and associates withLEDGF/p75 protein in human cells. J. Biol. Chem.278, 372–381.

30. Li, M., Mizuuchi, M., Burke, T. R., Jr & Craigie, R.(2006). Retroviral DNA integration: reaction pathwayand critical intermediates. EMBO J. 25, 1295–1304.

31. Vora, A. & Grandgenett, D. P. (2001). DNase pro-tection analysis of retrovirus integrase at the viralDNA ends for full-site integration in vitro. J. Virol. 75,3556–3567.

32. Jenkins, T. M., Engelman, A., Ghirlando, R. & Craigie, R.(1996). A soluble active mutant of HIV-1 integrase:involvement of both the core and carboxyl-terminaldomains inmultimerization. J. Biol. Chem.271, 7712–7718.

33. Drake, R. R., Neamati, N., Hong, H., Pilon, A. A.,Sunthankar, P., Hume, S. D. et al. (1998). Identificationof a nucleotide binding site in HIV-1 integrase. Proc.Natl Acad. Sci. USA, 95, 4170–4175.

34. Gao, K., Butler, S. L. & Bushman, F. (2001). Humanimmunodeficiency virus type 1 integrase: arrange-ment of protein domains in active cDNA complexes.EMBO J. 20, 3565–3576.

35. Jenkins, T. M., Esposito, D., Engelman, A. & Craigie,R. (1997). Critical contacts between HIV-1 integraseand viral DNA identified by structure-based analysisand photo-crosslinking. EMBO J. 16, 6849–6859.

36. Esposito, D. & Craigie, R. (1998). Sequence specifi-city of viral end DNA binding by HIV-1 integrasereveals critical regions for protein–DNA interaction.EMBO J. 17, 5832–5843.

37. Lutzke, R. A., Vink, C. & Plasterk, R. H. (1994). Charac-terization of the minimal DNA-binding domain of theHIV integrase protein.Nucleic Acids Res. 22, 4125–4131.

38. Heuer, T. S. & Brown, P. O. (1998). Photo-cross-linking studies suggest a model for the architectureof an active human immunodeficiency virus type 1integrase–DNA complex. Biochemistry, 37, 6667–6678.

39. Agapkina, J., Smolov, M., Barbe, S., Zubin, E.,Zatsepin, T., Deprez, E. et al. (2006). Probing of HIV-1 integrase/DNA interactions using novel analogs ofviral DNA. J. Biol. Chem. 281, 11530–11540.

40. Guare, J. P., Wai, J. S., Gomez, R. P., Anthony, N. J.,Jolly, S. M., Cortes, A. R. et al. (2006). A series of 5-aminosubstituted 4-fluorobenzyl-8-hydroxy-[1,6]naphthyridine-7-carboxamide HIV-1 integrase inhi-bitors. Bioorg. Med. Chem. Lett. 16, 2900–2904.

41. Embrey, M. W., Wai, J. S., Funk, T. W., Homnick, C. F.,Perlow, D. S., Young, S. D. et al. (2005). A series of 5-

579Integrase Amino Acids Involved in Recognition of DNA

(5,6)-dihydrouracil substituted 8-hydroxy-[1,6]naph-thyridine-7-carboxylic acid 4-fluorobenzylamide inhi-bitors of HIV-1 integrase and viral replication in cells.Bioorg. Med. Chem. Lett. 15, 4550–4554.

42. Hazuda, D. J., Felock, P., Witmer, M., Wolfe, A.,Stillmock, K., Grobler, J. A. et al. (2000). Inhibitors ofstrand transfer that prevent integration and inhibitHIV-1 replication in cells. Science, 287, 646–650.

43. Grobler, J. A., Stillmock, K., Hu, B., Witmer, M.,Felock, P., Espeseth, A. S. et al. (2002). Diketo acidinhibitor mechanism and HIV-1 integrase: implica-tions for metal binding in the active site of phospho-transferase enzymes. Proc. Natl Acad. Sci. USA, 99,6661–6666.

44. Marchand, C., Zhang, X., Pais, G. C., Cowansage, K.,Neamati, N., Burke, T. R., Jr & Pommier, Y. (2002).Structural determinants for HIV-1 integrase inhibitionby beta-diketo acids. J. Biol. Chem. 277, 12596–12603.

45. Pluymers, W., Pais, G., Van Maele, B., Pannecouque,C., Fikkert, V., Burke, T. R., Jr et al. (2002). Inhibitionof human immunodeficiency virus type 1 integra-tion by diketo derivatives. Antimicrob. Agents Che-mother. 46, 3292–3297.

46. Fikkert, V., Hombrouck, A., Van Remoortel, B., DeMaeyer, M., Pannecouque, C., De Clercq, E. et al.(2004). Multiple mutations in human immunodefi-ciency virus-1 integrase confer resistance to theclinical trial drug S-1360. AIDS, 18, 2019–2028.

47. Lee, D. J. & Robinson, W. E., Jr (2004). Human immu-nodeficiency virus type 1 (HIV-1) integrase: resistanceto diketo acid integrase inhibitors impairs HIV-1replication and integration and confers cross-resis-tance to L-chicoric acid. J. Virol. 78, 5835–5847.

48. Lu, R., Limon, A., Ghory, H. Z. & Engelman, A. (2005).Genetic analyses of DNA-binding mutants in thecatalytic core domain of human immunodeficiencyvirus type 1 integrase. J. Virol. 79, 2493–2505.

49. Maertens, G., Cherepanov, P., Pluymers, W., Busschots,K., De Clercq, E., Debyser, Z. & Engelborghs, Y. (2003).LEDGF/p75 is essential for nuclear and chromosomaltargeting ofHIV-1 integrase inhumancells. J. Biol. Chem.278, 33528–33539.

50. Ciuffi, A., Llano, M., Poeschla, E., Hoffmann, C.,Leipzig, J., Shinn, P. et al. (2005). A role for LEDGF/p75 in targeting HIV DNA integration. Nat. Med. 11,1287–1289.

51. Emiliani, S., Mousnier, A., Busschots, K., Maroun, M.,Van Maele, B., Tempe, D. et al. (2005). Integrasemutants defective for interaction with LEDGF/p75are impaired in chromosome tethering and HIV-1replication. J. Biol. Chem. 280, 25517–25523.

52. Harper, A. L., Skinner, L. M., Sudol, M. & Katzman,M. (2001). Use of patient-derived human immunode-ficiency virus type 1 integrases to identify a proteinresidue that affects target site selection. J. Virol. 75,7756–7762.

53. Lu, R., Limon, A., Devroe, E., Silver, P. A.,Cherepanov, P. & Engelman, A. (2004). Class II inte-grase mutants with changes in putative nuclearlocalization signals are primarily blocked at a post-nuclear entry step of human immunodeficiency virustype 1 replication. J. Virol. 78, 12735–12746.

54. Jeltsch, A., Wenz, C., Wende, W., Selent, U. &Pingoud, A. (1996). Engineering novel restrictionendonucleases: principles and applications. TrendsBiotechnol. 14, 235–238.

55. Winkler, F. K., Banner, D. W., Oefner, C., Tsernoglou,D., Brown, R. S., Heathman, S. P. et al. (1993). Thecrystal structure of EcoRV endonuclease and of its

complexes with cognate and non-cognate DNAfragments. EMBO J. 12, 1781–1795.

56. Yang, Z., Horton, J. R., Maunus, R., Wilson, G. G.,Roberts, R. J. & Cheng, X. (2005). Structure of HinP1Iendonuclease reveals a striking similarity to themonomeric restriction enzyme MspI. Nucleic AcidsRes. 33, 1892–1901.

57. Johnson, A. A., Santos, W., Pais, G. C., Marchand, C.,Amin, R., Burke, T. R., Jr et al. (2006). Integrationrequires a specific interaction of the donor DNAterminal 5′-cytosine with glutamine 148 of the HIV-1integrase flexible loop. J. Biol. Chem. 281, 461–467.

58. Bischerour, J., Leh, H., Deprez, E., Brochon, J. C. &Mouscadet, J. F. (2003). Disulfide-linked integraseoligomers involving C280 residues are formed in vitroand in vivo but are not essential for human immuno-deficiency virus replication. J. Virol. 77, 135–141.

59. Priet, S., Navarro, J. M., Querat, G. & Sire, J. (2003).Reversion of the lethal phenotype of anHIV-1 integrasemutant virus by overexpression of the same integrasemutant protein. J. Biol. Chem. 278, 20724–20730.

60. Sayasith, K., Sauve, G. & Yelle, J. (2000). Characteriza-tion of mutant HIV-1 integrase carrying amino acidchanges in the catalytic domain.Mol. Cells, 10, 525–532.

61. Vincent, K. A., Ellison, V., Chow, S. A. & Brown, P. O.(1993). Characterization of human immunodeficiencyvirus type 1 integrase expressed in Escherichia coliand analysis of variants with amino-terminal muta-tions. J. Virol. 67, 425–437.

62. Puglia, J., Wang, T., Smith-Snyder, C., Cote, M.,Scher, M., Pelletier, J. N. et al. (2006). Revealingdomain structure through linker-scanning analysisof the murine leukemia virus (MuLV) RNase H andMuLV and human immunodeficiency virus type 1integrase proteins. J. Virol. 80, 9497–9510.

63. Yi, J., Asante-Appiah, E. & Skalka, A. M. (1999).Divalent cations stimulate preferential recognition of aviral DNA end by HIV-1 integrase. Biochemistry, 38,8458–8468.

64. Hindmarsh, P., Johnson, M., Reeves, R. & Leis, J.(2001). Base-pair substitutions in avian sarcoma virusU5 and U3 long terminal repeat sequences alter the pro-cess of DNA integration in vitro. J. Virol. 75, 1132–1141.

65. Brin, E. & Leis, J. (2002). Changes in the mechanismof DNA integration in vitro induced by base subs-titutions in the HIV-1 U5 and U3 terminal sequences.J. Biol. Chem. 277, 10938–10948.

66. Brin, E. & Leis, J. (2002). HIV-1 integrase interactionwith U3 and U5 terminal sequences in vitro definedusing substrates with random sequences. J. Biol. Chem.277, 18357–18364.

67. Katzman, M., Katz, R. A., Skalka, A. M. & Leis, J.(1989). The avian retroviral integration protein cleavesthe terminal sequences of linear viral DNA at the invivo sites of integration. J. Virol. 63, 5319–5327.

68. Harrison, R. W. (1993). Stiffness and energy conserva-tion in molecular dynamics: an improved integrator.J. Comput. Chem. 14, 1112–1122.

69. Weber, I. T. & Harrison, R. W. (1996). Molecularmechanics calculations on HIV-1 protease with pep-tide substrates correlate with experimental data.Protein Eng. 9, 679–690.

70. Weber, I. T. & Harrison, R. W. (1997). Molecularmechanics calculations on Rous sarcoma virus pro-tease with peptide substrates. Protein Sci. 6, 2365–2374.

71. Bagossi, P., Zahucky, G., Tozser, J., Weber, I. T. &Harrison, R. W. (1999). Improved parameters forgenerating partial charges: correlation with observeddipole moments. J. Mol. Model, 5, 143–152.