Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... ·...
Transcript of Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... ·...
![Page 1: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/1.jpg)
Decoding our bacterial overlords
Torsten Seemann
@torstenseemann
![Page 2: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/2.jpg)
Dedication
This presentation is dedicated to Sabah,
whose body is desperately trying to rid itself of some microbes which managed
to get somewhere they shouldn’t have.
![Page 3: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/3.jpg)
About me
![Page 4: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/4.jpg)
Melbourne, Australia
![Page 5: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/5.jpg)
Bioinformatics
ComputerScientist ❌
![Page 6: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/6.jpg)
“Immunity and infection”● Research● Teaching● Public health and reference labs● Diagnostic services● Clinical care in ID and immunity
![Page 7: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/7.jpg)
Microbiological Diagnostics Unit
● Public health microbiology lab● Established in 1897● Within a University Micro Dept
● Co-locates microbiologists, clinicians, bioinformaticians and epidemiologists
● Strong research links
![Page 8: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/8.jpg)
Mandate: apply WGS wherever it makes sense
Diagnostics Surveillance Outbreak response
![Page 9: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/9.jpg)
Bacteria, Viruses, Archaea, Fungi, Protists
Foodborne, human (clinical), animal and environmental samples
![Page 10: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/10.jpg)
Lots of genomics & transcriptomics
![Page 11: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/11.jpg)
High quality “first” genomes
● Capillary sequences + BACs + primer walking○ 2006 - Leptospira borgpetersenii (abortive agent - cows)○ 2007 - Mycobacterium ulcerans (Buruli ulcer - human)○ 2008 - Mycobacterium marinum (Fish granuloma - model for TB)
● Roche 454 + Illumina + BACs + primer walking○ 2012 - Enterococcus faecium (Human pathogen, highly resistant)
● Ion Torrent + Illumina + BACs● Pacbio RSII + Illumina (~50 done)● Nanopore + Illumina
![Page 12: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/12.jpg)
Software tools for microbial genomics
![Page 13: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/13.jpg)
Annotation
Adding biological information to sequences.
ACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGCCTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGGAAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCCCTGCAGGAACTTCTTCTAGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAGTTTAATTACAGACCTGAAACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGTCCGTCCGTGGGCCACGGCCACCGCTTTTTTTTTTGCC
delta toxinPubMed: 15353161
ribosome binding site
transfer RNALeu-(UUR)
tan
de
m r
ep
eat
CC
GT
x 3
homopolymer10 x T
![Page 14: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/14.jpg)
Bacteria
![Page 15: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/15.jpg)
Bacteria are diverse & often super weird
![Page 16: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/16.jpg)
Help digest our food
Essential for human life
Immune system
Synthesizevitamins
![Page 17: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/17.jpg)
“Good”(colon)
Bacteria are not malicious
E.coli“Bad”
(bladder)
![Page 18: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/18.jpg)
5,000,000,000,000,000,000,000,000,000,000,000 000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000.
Bacteria run the show
100,000,000,000,000
1,000,000
50-90% microbial
![Page 19: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/19.jpg)
Replicons
Usually 1 largechromosome
(1M to 10M bases)
Sometimes 1-6“mini” chromosomes
(4k - 300k bases)
![Page 20: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/20.jpg)
The circle of life
Bacteria have circular replicons
Bacillus anthracis (Anthrax)
![Page 21: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/21.jpg)
The broken circle of life
Bacteria have circular replicons
Bacillus anthracis (Anthrax)
Except when they are linear
Borrelia burgdorferi (Lyme disease)
![Page 22: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/22.jpg)
Bacteria can be polyploid
Neisseria gonorrhoeae has 3-5 copies of its chromosomeRecombination within cell, antigenic variation
1 2 34
![Page 23: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/23.jpg)
Small genome
6,000,000,000letters
30,000 genes
GenomeA T G C
3,000,000 letters
3,000 genes
![Page 24: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/24.jpg)
Bacterial genes
PROTEIN
No introns!
![Page 25: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/25.jpg)
● One RNA transcript, multiple proteins● Proteins are related: assembly, pathway
Operons
Buy 1 get 2 free!
A B CPromoter UTR R
BS UTR
DNA
A B C RNA
PROTEINS
3 coding regions
![Page 26: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/26.jpg)
Bacteria are coding dense
● Overlapping genes● Very few intergenic regions● About 1000 genes per 1 Mbp of genome
![Page 27: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/27.jpg)
(Relatively) fast growers
E.coli ~ 20 minutesM.tb ~ 20 hours
![Page 28: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/28.jpg)
Vertical transfer of DNA
Occurs during cell division
Sometimes it makes an error copying the DNA
eg. A → T
![Page 29: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/29.jpg)
Horizontal/lateral transfer of DNA
Occurs between bacterial cells
Conjugation and sometimes insertion into chromosome
![Page 30: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/30.jpg)
The web of life
![Page 31: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/31.jpg)
Public health and clinical microbiology
![Page 32: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/32.jpg)
Role of a public health laboratory network
Diagnostics Surveillance Outbreak response
![Page 33: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/33.jpg)
Traditional workflow
![Page 34: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/34.jpg)
A bacterial isolate
![Page 35: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/35.jpg)
Focus on a small “informative” section
e.g. MLST, VNTR, PFGE, <insert genotyping method here>
![Page 36: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/36.jpg)
More samples - we have an outbreak!
![Page 37: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/37.jpg)
D’oh!
![Page 38: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/38.jpg)
Modern workflow
![Page 39: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/39.jpg)
A win for genomics... and bioinformatics!
● Many investigations per week
● Dec 2015○ Salmonella Anatum outbreak○ bagged lettuce recall○ cases nationally
● Milestone○ First case definition
to include genomics
![Page 40: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/40.jpg)
“You don’t win friends with salad”
![Page 41: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/41.jpg)
Phylogenomics
![Page 42: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/42.jpg)
Trees show relationship
![Page 43: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/43.jpg)
Same tree!
Dendrogram
Spanning
Radial
![Page 44: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/44.jpg)
Every SNP is sacred
● Chocolate bar tree○ branches were based on phenotypic attributes○ size, colour, filling, texture, ingredients, flavour
● Genomic trees○ want to use every part of the genome sequence○ need to find all differences between isolates○ show me the SNPs!
![Page 45: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/45.jpg)
Finding differences
AGTCTGATTAGCTTAGCTTGTAGCGCTATATTATAGTCTGATTAGCTTAGAT ATTAGCTTAGATTGTAG CTTAGATTGTAGC-C TGATTAGCTTAGATTGTAGC-CTATAT TAGCTTAGATTGTAGC-CTATATT TAGATTGTAGC-CTATATTA TAGATTGTAGC-CTATATTAT
SNP Deletion
Reference
Reads
![Page 46: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/46.jpg)
bug1 GATTACCAGCATTAAGG-TTCTCCAATCbug2 GAT---CTGCATTATGGATTCTCCATTCbug3 G-TTACCAGCACTAA-------CCAGTC
Collate reference alignments
The reference is a “middle man” to generate a “pseudo” whole genome alignment.
![Page 47: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/47.jpg)
bug1 GATTACCAGCATTAAGG-TTCTCCAATCbug2 GAT---CTGCATTATGGATTCTCCATTCbug3 G-TTACCAGCACTAA-------CCAGTCcore | | ||||||||| ||||||
Core sites are present in all genomes.
Core genome
![Page 48: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/48.jpg)
bug1 GATTACCAGCATTAAGG-TTCTCCAATCbug2 GAT---CTGCATTATGGATTCTCCATTCbug3 G-TTACCAGCACTAA-------CCAGTCcore | | ||||||||| ||||||SNPs | | | |
Core SNPS = polymorphic sites in core genome
Core SNPs
![Page 49: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/49.jpg)
bug1 GATTACCAGCATTAAGG-TTCTCCAATCbug2 GAT---CTGCATTATGGATTCRNCATTCbug3 G-TTACCAGCACTAA-------CCAGTCSNPs’ | | | | ata ttc ata atg 1 2 3 4
Allele sites
![Page 50: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/50.jpg)
>bug1
ATAA
>bug2
TTTT
>bug3
ACAG
Alignment ⇢ Distance matrix ⇢Tree
#SNPs bug1 bug2 bug3
bug1 - - -
bug2 3 - -
bug3 2 4 -
+------ bug3 | ---+--- bug1 | +--------- bug2
--- 1 SNP
![Page 51: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/51.jpg)
The pan genome
![Page 52: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/52.jpg)
Five genomes
![Page 53: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/53.jpg)
Whole genome multiple alignment
![Page 54: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/54.jpg)
Find “common” segments
![Page 55: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/55.jpg)
The core genome
Core is common to all & has similar sequence.
![Page 56: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/56.jpg)
The accessory genome
Accessory = not core (but still similar within)
![Page 57: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/57.jpg)
The pan genome
Pan = Core + Accessory .
![Page 58: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/58.jpg)
Core
● Common DNA● Vertical evolution
● Critical genes● Genotyping● Phylogenetics
● Novel DNA● Lateral transfer
● Plasmids● Mobile elements● Phage
Accessory
![Page 59: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/59.jpg)
Determining the pan genome
![Page 60: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/60.jpg)
Whole genome alignment is difficult !
Rearrangements.Sequence divergence.
Duplications.
Does not scale computationally.
![Page 61: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/61.jpg)
Genome or Gene-ome ?
● The DNA sequence of all replicons○ Chromosomes, plasmids
● The set of “genes” in an organism○ “Protein-ome”- just protein coding genes e.g. CDS○ “Gene-ome” - also include non-coding genes e.g. RNAs
![Page 62: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/62.jpg)
Genome vs Proteinome
5 Mbp genome ~5000 genes
![Page 63: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/63.jpg)
Reframing the problem
Align whole genomes (DNA)
⬇Cluster homologous genes
(DNA or AA)
![Page 64: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/64.jpg)
Homologs = common ancestor
OrthologSpeciation
Paralog Duplication
XenologLateral transfer
![Page 65: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/65.jpg)
Homolog clustering
● Group homologous proteins together○ exploit sequence similarity + synteny + operons○ all versus all sequence comparison (not scalable)
■ DNA or amino acid (fast heuristics)
○ difficulty increases with taxa distance
● Depends on annotation quality■ Missing genes■ False genes
![Page 66: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/66.jpg)
● De novo assembly - SPAdes
● Annotation - Prokka
● Pan-genome - Roary
● Visualise - Phandango
Typical workflow
![Page 67: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/67.jpg)
Roary → matrix / spreadsheet
CLUSTER STRAIN1 STRAIN2 STRAIN300001 DNO1000 EHEC1000 MRSA_100000002 DNO1001 EHEC1002 MRSA_100100003 DNO1002 EHEC1003 MRSA_100200004 DNO1003 EHEC1004 MRSA_100300005 DNO1004 EHEC1005 MRSA_1022 : : : :02314 DNO1005 na MRSA_102302315 DNO1451 EHEC3215 na02316 na EHEC3216 MRSA_1923 : : : :04197 DNO1456 na na04198 na EHEC3877 na04199 na na MRSA_0533
Core
Dispensable
Isolate-specific
![Page 68: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/68.jpg)
Example pan genome
Rows are genomes, columns are genes.
![Page 69: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/69.jpg)
Core
Disp.
Disp.Disp.
UniqueUnique
Unique
Three genomes (N=3)
CoreIn all 3 strains (∈ N strains)
DispensableIn 2 strains(∈ [2,N-1] strains)
UniqueIn only 1 strain(∈ 1 strain)
Accessory
![Page 70: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/70.jpg)
Flowery Venn (N=4)
![Page 71: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/71.jpg)
Venn will it end?
![Page 72: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/72.jpg)
Bringing it together
![Page 73: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/73.jpg)
Diagonal-omics
● Phylogenetics○ Based on core SNPs○ Vertical transmission
● Pan-genome○ Looks at accessory genome○ Horizontal transmission
● Combine for best of both worlds
![Page 74: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/74.jpg)
http://jameshadfield.github.io/phandango/
![Page 75: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/75.jpg)
http://jameshadfield.github.io/phandango/
![Page 76: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/76.jpg)
Data sharing
![Page 77: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/77.jpg)
The GenomeTrakr network
US FDA(CFSAN)
+NCBI
+State
reference labs
![Page 78: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/78.jpg)
The GenomeTrakr network is international
![Page 79: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/79.jpg)
Bill Klimke
![Page 80: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/80.jpg)
180 x Listeria monocytogenes
![Page 81: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/81.jpg)
Nightly updates to find new matches
Errol Strain (CFSAN)
![Page 82: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/82.jpg)
![Page 83: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/83.jpg)
![Page 84: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/84.jpg)
![Page 85: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/85.jpg)
![Page 86: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/86.jpg)
● FIXME
![Page 87: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/87.jpg)
Clinical metagenomics
![Page 88: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/88.jpg)
Infectious disease management
● Integrate genomics into patient care
● Identify pathogen(s)○ Polymicrobial infections
● Determine antibiotic resistance profile○ Acquired genes○ Point mutations
● Determine hospital transmission / sources
![Page 89: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/89.jpg)
Diagnosing the undiagnosable
![Page 90: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/90.jpg)
![Page 91: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/91.jpg)
What data do we really have?
Isolate genome
Sequenced reads
Other isolates in sequencing run
ContaminationSequencing adaptorsSpike-in controls eg. phiX
Unsequenced regions
![Page 92: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/92.jpg)
The problem with reference sequences
● Good○ Biased to pathogens
● Bad○ Only a fraction of true diversity○ Protists, fungi poorly represented○ Contamination○ Wrong taxonomic assignment
![Page 93: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/93.jpg)
Conclusions
![Page 94: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/94.jpg)
Summary
● Bacteria are cool
● Data wise, they are smaller,
but we have more of them to deal with
● Small core, huge accessory genome
● Genome wide, SNP resolution has
transformed public health microbiology
● Data sharing is essential to global health
![Page 95: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/95.jpg)
Acknowledgements
Titus Brown
Lisa Johnson
Amanda Charbonneau
Morgan Price
Karen Word
Erich Schwarz
![Page 96: Decoding our bacterial overlords - Read the Docs › en › 2018 › _static › Bacterial... · 2019-10-15 · Foodborne, human (clinical), animal and environmental samples. ...](https://reader033.fdocuments.us/reader033/viewer/2022060416/5f14157cc2203c1a0e727df2/html5/thumbnails/96.jpg)
The end.