de-baaij-thesis.pdf

The research presented in this thesis was performed at the department of Physiology, Radboud Institute for Molecular Life Sciences, Radboud university medical center, The Netherlands and financially supported by the Netherlands Organization for Scientific Research (NWO), ZonMW grant 9120.8026.Financial support by the Dutch Kidney Foundation for the publication of this thesis is gratefully acknowledged.

ISBN

978-94-6259-412-8

Print

Ipskamp Drukkers BV, Enschede, the Netherlands

Cover design

Susan Rolffs, Stevensbeek, the Netherlands

Lay-out

Promotie In Zicht, Arnhem, the Netherlands

© 2014, J.H.F de Baaij, Nijmegen, the NetherlandsAll rights reserved. No part of this thesis may be reproduced or transmitted in any form or by any means without permission in writing of the authors, or, when appropriate, from the publishers of the publications.

Proefschrift

ter verkrijging van de graad van doctoraan de Radboud Universiteit Nijmegen

op gezag van de rector magnificus prof. dr. Th.L.M. Engelen, volgens besluit van het college van decanen

in het openbaar te verdedigen op woensdag 21 januari 2015 om 12.30 uur precies

door

Jeroen Herman Frans de Baaijgeboren op 16 mei 1987te Nijmegen, Nederland

The Distal Convoluted Tubule: The Art of Magnesium Transport

PromotorenProf. dr. J.G.J. Hoenderop Prof. dr. R.J.M. Bindels

ManuscriptcommissieProf. dr. J.M.J. Kremer (voorzitter) Prof. dr. J.H.J.M van Krieken Prof. dr. H. van Goor (UMCG)

“Realists do not fear the results of their study”

Fjodor Dostojevski (1821-1881)

“Happy is he who gets to know the reason for things”

Virgil (70-19 B.C.)

Table of contents

Chapter 1 Art History: An Introduction to Magnesium in Health and Disease

9

Chapter 2 Elucidation of the Distal Convoluted Tubule Transcriptome Identifies New Candidate Genes Involved in Renal Magnesium Handling

41

Chapter 3 Mutations in PCBD1 Cause Hypomagnesemia and Renal Magnesium Wasting

71

Chapter 4 Recurrent FXYD2 p.Gly41Arg Mutation in Patients with Isolated Dominant Hypomagnesemia

99

Chapter 5 Identification of SLC41A3 as a Novel Player in Magnesium Homeostasis

111

Chapter 6 Membrane Topology and Intracellular Processing of Cyclin M2 (CNNM2)

135

Chapter 7 CNNM2 Mutations Cause Impaired Brain Development and Seizures in Patients with Hypomagnesemia

161

Chapter 8 P2X4 Receptor Regulation of Transient Receptor Potential Melastatin Type 6 (TRPM6) Mg2+ Channels

195

Chapter 9 Flavaglines Stimulate Transient Receptor Potential Melastatin Type 6 (TRPM6) Channel Activity

215

Chapter 10 Contemporary Art of Magnesium Transport: A Discussion on the Distal Convoluted Tubule

235

Chapter 11 Summary: The Art of Magnesium Transport 269

Chapter 12 Samenvatting: De Kunst van het Magnesiumtransport 277

Chapter 13 List of Abbreviations 289

List of Publications 295

Curriculum Vitae 297

RIMLS Portfolio 299

Chapter 14 Dankwoord – Acknowledgments – Remerciements 301

Magnesium in Health and Disease | 11

Magnesium BasicsMagnesium (Mg2+) is an essential ion for health. Within the periodic table of elements, Mg has atom number 12 and is classified as an alkaline earth element (group 2). Mg occurs in nature in three stable isotopes, 24Mg, 25Mg, and 26Mg. 24Mg is the most common isotope (78,99 %) and has a relative atomic mass of 24.305 Da, a melting point of 648.8 °C and a boiling point of 1090 °C (97). In the dissolved state, Mg2+ has two hydration shells, making its radius ±400 times larger than its dehydrated radius. Consequently, before passing through channels and transporters, Mg2+ needs to be dehydrated, which is a highly energy consuming process. The radius of hydrated Mg2+ is much bigger than other cations like Na+, K+ and even Ca2+ (28). As a result, Mg2+ is a powerful Ca2+-antagonist, despite their same charge and similar chemical properties. Mg2+ is a co-factor of over 600 enzymes (http://www.metacyc.org, (24)). Among the enzymes that require Mg2+ as co-activator, many enzymes are essential for life. For instance, Mg2+ is necessary for proper structure and activity of DNA and RNA polymerases (15, 139). Knowing that other enzymes using Mg2+ are topisomerases, helicases and exonucleases, Mg2+ is an essential component of DNA replication, RNA transcription, amino acid synthesis and protein formation. Since kinases, ATP-ases, guanylyl cyclases and adenylyl cyclases all depend on Mg-ATP for proper function, Mg2+ plays a role in virtually every process within the human cell.

Magnesium in Health and DiseaseThe first use of Mg2+ in human medicine can be traced back to 1697 when Dr. Nehemiah Grew identified magnesium sulfate (MgSO4) as the major ingredient of Epsom salt (51). Epsom Salt was extracted from a well in Epsom, England and was used over the years to treat abdominal pain, constipation, sprains, muscle strains, hyaline membrane disease, and cerebral edema. Subsequently, Mg2+ was recognized as an element (Mg) by Joseph Black in 1755 and first isolated by Sir Humphrey Davy from magnesia (Mg3SO4O10(OH)2) and mercury (Hg) in 1808 (30). The role of Mg2+ in the human body emerged once Mg2+ was described in blood plasma by Willey Glover Denis in 1920 (31). Subsequently, Jehan Leroy demonstrated that Mg2+ is essential for life in mice (85). These findings were translated to humans, and the first reports of Mg2+ deficiency in man were by Arthur Hirschfelder & Victor Haury in 1934 (61). Since then, Mg2+ has been implicated in and used for treatment of a variety of diseases, including migraines, cardiovascular diseases and diabetes (Figure 1). Although the importance of Mg2+ is widely acknowledged, serum Mg2+ values are not generally determined in clinical medicine. Therefore, Mg2+ is often referred to as the ‘forgotten’ cation in human health.

BrainIn brain, intracellular Mg2+ regulates the activity of the N-Methyl-D-aspartic acid (NMDA) receptor. During Mg2+ deficiency, NMDA receptors become hyperexcitable, resulting in

12 | Chapter 1

Figure 1 Magnesium in health and disease

Overview of the major diseases in which Mg2+ disturbances have been reported or in which Mg2+

supplementation has been considered as potential treatment.

- Myocardial infarction- Arrythmias- Preeclampsia- Hypertension

- Asthma- COPD- Cystic Fibrosis

- Osteoporosis

- Muscle Cramps

- Migraine- Depression- Epilepsy- Stroke- Traumatic Brain Injury


severe brain pathologies (92, 103). Patients with migraines, depression, epilepsy and traumatic brain injury have lower blood Mg2+ values (6, 32, 115, 137). Therefore, Mg2+ supplementation has been proposed as potential treatment for these disorders. In a recent large-scale trial Mg2+ was shown to decrease death and disability after stroke when applied within three hours of the onset of the stroke (99). In contrast, Mg2+ was unsuccessful to improve outcome after traumatic brain injury (140). Despite the absence of large-scale clinical trials, Mg2+ is considered second-line treatment for migraine and epilepsy (62, 131).

Heart and VasculatureMg2+ regulates the activity of ion channels in the cardiac cells, thereby affecting the electrical properties of the myocardium (98). Moreover, it determines myocardial contractility by influencing the intracellular Ca2+ mobility and Mg2+ has an anti-inflammatory and vasodilatory effect. Patients with severe hypomagnesemia may, therefore, suffer from arrhythmias and hypertension. Mg2+ is the most important treatment for patients with preeclampsia and has been widely advocated by the world health organization (WHO) in third world countries to reduce child mortality (59). Additionally, Mg2+ is the first treatment option for patients with torsades des pointes type of cardiac arrhythmias (158).

LungGiven the bronchodilatory and anti-inflammatory effects of Mg2+, the use of Mg2+ has also been advocated in lung disease (104). Specifically, Mg2+ is considered second-line treatment for acute asthma patients (2). Recently, a large randomized controlled study In children with asthma showed the improvement of the asthma severity after inhalation of MgSO4 (111). Large-scale studies are necessary to examine the efficacy of Mg2+ in the treatment of chronic obstructive pulmonary disorder (COPD) and cystic fibrosis.

MuscleIn muscle, the main effect of Mg2+ is as a Ca2+ antagonist on Ca2+-permeable channels and Ca2+-binding proteins (63, 110). Muscle contraction is a highly Ca2+-dependent process, since Ca2+ will bind to troponin C and myosin to induce contraction (50). Mg2+ competes for the Ca2+-binding sites on these proteins. Consequently, more Ca2+ will bind troponin C and myosin in Mg2+ deficiency, resulting in hypercontractibility, which presents as muscle cramps and spasms in the clinic. Therefore, Mg2+ supplementation is considered second line treatment for muscle cramps (74).

Magnesium DeficiencyThe US Food and Nutrition Board recommends a daily intake of 420 mg for men and 320 mg for women (1). However, recent reports estimate that at least 60 % of the population does not meet daily-required Mg2+ intake (76). Part of the problem stems from the soil used for agriculture, which is becoming increasingly deficient in essential minerals. Over

14 | Chapter 1

the last 60 years the Mg2+ content in fruit and vegetables decreased by 20-30 % (151). Moreover, the Western diet is containing more refined grains and processed food. Estimates are that 80-90 % of Mg2+ is lost during food processing. As a result, a significant number of people are Mg2+ deficient, which may comprise up to 60 % of critically ill patients (26, 35). Mg2+ deficiency is commonly determined by measuring the total serum Mg2+ concentration, which ranges between 0.7 and 1.1 mmol/L in healthy persons (90). Hypomagnesemia is generally defined as serum Mg2+ levels below 0.7 mmol/L (Table 1). Patients suffer from non-specific symptoms such as depression, tiredness, muscle spasms and muscle weakness and diagnosis therefore may take years (44, 143). Only severe Mg2+ depletion (< 0.4 mmol/L) may lead to cardiac arrhythmias, tetany and seizures. Secondary to hypomagnesemia, disturbances in K+ and Ca2+ handling are often detected. Hypokalemia

Table 1 Symptoms of Mg2+ Disturbances

Hypomagnesemia

Concentration Clinical manifestation

< 0.7 mmol/L Neuromuscular irritability

Hypocalcemia

Hypokalemia

< 0.4 mmol/L Tetany

Seizures

Arrhythmias

Hypermagnesemia

Concentration Clinical manifestation

> 1.1 mmol/L Lethargy

> 2 mmol/L Drowsiness

Flushing

Nausea and vomiting

Diminished deep tendon reflex

> 3 mmol/L Somnolence

Loss of deep tendon reflexes

Hypotension

ECG changes

> 5 mmol/L Complete heart block

Cardiac arrest

Apnea

Paralysis

Coma

Death

Clinical symptoms of disturbed Mg2+ homeostasis.


can be attributed to increased renal K+ secretion via ROMK in the connecting tubule (CNT) and collecting duct (CD) (67). Low intracellular Mg2+ levels release the Mg2+-dependent inhibition of renal outer medullary potassium channel (ROMK) channels, resulting in increased renal K+ secretion. Hypocalcemia can be explained by low parathyroid hormone (PTH) levels due to altered activation of the calcium-sensing receptor (CaSR) (154). Hypomagnesemia is generally treated by oral Mg2+ supplementation (± 360 mg/day), although oral Mg2+ intake may cause diarrhea at high doses. Intravenous Mg2+ supple-mentation may be more effective, but this treatment has the disadvantage that it requires regular hospital visits (143). When serum Mg2+ levels are extremely low or are associated with hypokalemia, Mg2+ supplementation may not be sufficient to restore normal Mg2+ levels. In that case, patients are often co-supplemented with K+ or receive amiloride to prevent K+ secretion. The human body contains approximately 24 g of Mg2+ of which 99 % is stored in bone, muscle and other soft tissues (Figure 2). Since serum Mg2+ values reflect only 1 % of the body Mg2+ content, serum values may be within the normal range whereas the body may be in a severely Mg2+-depleted state. As a result, the clinical impact of Mg2+ deficiency may be largely underestimated.

Magnesium Uptake in IntestineGiven a daily Mg2+ intake of 370 mg, approximately 30-50 % of Mg2+ is absorbed in the intestine, resulting in a net uptake of ±100 mg (Figure 2). However, if Mg2+ intake is low, up to 80 % of dietary Mg2+ can be absorbed (48). Mg2+ absorption in the gut depends on two separate pathways; paracellular transport is responsible for bulk Mg2+ absorption and takes place mostly in the small intestine, whereas fine-tuning occurs in the cecum and colon via transcellular transport. In spite of this, the intestine seems to have a limited role in regulation of the Mg2+ balance. In contrast to other minerals, intestinal Mg2+ absorption is poorly regulated and depends mainly on Mg2+ intake (58, 126). Thus, the kidneys presumably primarily regulate the maintenance of Mg2+ homeostasis.

Small IntestineMg2+ absorption in the small intestine is hypothesized to be exclusively of a paracellular nature (Figure 3), since Mg2+ absorption in this region of the intestine correlates linearly to luminal Mg2+ concentrations (73, 112). Moreover, epithelial Mg2+ channel Transient receptor potential melastatin type 6 (TRPM6) is not expressed in the small intestine (52). Mg2+ is poorly absorbed in the duodenum, where unfavorable electrochemical gradients may even result in a limited amount of paracellular Mg2+ excretion (107). In later parts of the small intestine, such as late jejunum and ileum, the driving force for passive Mg2+ transport is established by the high luminal Mg2+ concentration and the lumen-positive transepithelial voltage of ±15 mV (38). The Km for Mg2+ transport in the late small intestine has been reported to be in the range of 4-12 mmol/L (95, 126). These results suggest that

16 | Chapter 1

NaCl and water absorption are prerequisites for Mg2+ uptake, since water absorption concentrates luminal Mg2+. Tight junction permeability underlying paracellular Mg2+ transport is still poorly understood. The small intestine has been described to be the most permeable for ions because of the relatively low expression of ‘tightening’ claudins 1, 3, 4, 5 and 8 (7, 83). Claudins 16 and 19, which are linked to Mg2+ transport, are not expressed in the intestine (7, 65). The exact composition of the tight junction complex facilitating intestinal Mg2+ absorption remains to be elucidated.

Figure 2 Magnesium Homeostasis

Panels represent the daily amount of Mg2+ intake and excretion. Daily the intestines absorption

approximately 120 mg and secrete 20 mg of Mg2+, resulting in a net absorption of 100 mg. In the

kidney daily about 2,400 mg Mg2+ is filtered by the glomerulus, of which 2,300 mg is reabsorbed

along the kidney tubule. This results in a net excretion of 100 mg, which matches the intestinal

absorption. Bone and muscle provide the most important Mg2+ stores.

0.7-1.1 mmol/L


Large IntestineMg2+ absorption in cecum and colon is thought to be transcellular of nature and is on the luminal side of the enterocyte mediated by TRPM6 and TRPM7 Mg2+ channels (Figure 3). Specifically, the intestinal expression of TRPM6 is located in caecum and colon (52, 82). In a study with rat colon epithelium, 37 % of Mg2+ was transported transcellularly (72). This suggests the existence of significant paracellular transport of Mg2+ in the colon, which would be unlikely given the expression of tight claudins 3, 4 and 8 in this segment (83). In contrary to Ca2+, Mg2+ transport in colon is independent of 1,25-dihydroxyvitamin D3 (1,25(OH)2D3) signaling, nor is TRPM6 expression dependent on 1,25(OH)2D3 (52, 72). It has

Figure 3 Magnesium Absorption in the Intestine

Bulk Mg2+ is absorbed paracellular by the late part of the small intestine. Fine-tuning of Mg2+

absorption takes place transcellular by the colon, where TRPM6 and TRPM7 Mg2+ channels facilitate

luminal Mg2+ uptake in the enterocyte. CNNM4 provides the basolateral Mg2+ extrusion mechanism.

TRPM6: Transient receptor potential melastatin type 6, TRPM7: Transient receptor potential melastatin type

7, ENaC: Epithelial Sodium Channel, CNNM4: Cyclin M4.

18 | Chapter 1

been suggested that the basolateral Mg2+ extrusion mechanism of the enterocyte is coupled to the Na+ gradient (117). Indeed, a recent study using Cyclin M4 (CNNM4) KO mice, suggests that CNNM4 may act as a Na+/Mg2+ exchanger at the basolateral membrane of enterocytes (155). CNNM4 knockout mice suffer from hypomagnesemia, and functional analysis using Magnesium Green showed that CNNM4 overexpression increased Mg2+ efflux in HEK293 cells. However, patients with CNNM4 mutations do not suffer from hypomagnesemia (106, 109).

Magnesium Storage in BoneApproximately 50-60 % of the total body Mg2+ content is stored in bone (Figure 2). Serum Mg2+ concentrations are closely related to bone metabolism; bone surface Mg2+ is continuously exchangeable with blood Mg2+ (5). Bone hydroxy-apatite structures mainly consist of Pi and Ca2+ and are bound by Mg2+ ions at the surface of the hydroxy-apatite crystals. Mg2+ increases the solubility of the minerals and thereby acts on the crystal size and formation (120). Crystals in Mg2+-deficient bone are larger and the bones may therefore be brittle and more susceptible to fractures (27). Moreover, Mg2+ stimulates osteoblast proliferation, suggesting that Mg2+ deficiency results in decreased bone formation (88). Mg2+-deficient rats have reduced osteoblast numbers and decreased bone mass (118). Moreover, Mg2+ deficiency increases the secretion of pro-inflammatory cytokines such as TNFα, IL1β and substance P (118, 148), all of which have been implicated in increased osteoclastic bone resorption (75). These effects may be further enhanced by reduced PTH and 1,25(OH)2D3 levels, which are often associated with hypomagnesemia (119).

Magnesium Reabsorption in KidneyApproximately 2,400 mg of Mg2+ is filtered by the glomeruli on a daily basis. The nephron recovers 95-99 % of this; the remaining 100 mg leaves the body via the urine (Figure 2).

Proximal TubuleThe mechanisms of proximal tubule (PT) Mg2+ reabsorption are poorly understood, but early micropuncture studies show that approximately 10-25 % of Mg2+ is reabsorbed by the proximal convoluted tubule segment of the nephron (Figure 4) (84, 114). In the glomeruli, 70 % of the serum Mg2+ is freely filterable, suggesting that the concentration in the glomerular filtrates and thus the start of the PT ranges between 0.5-0.7 mmol/L. The transepithelial potential difference ranges from slightly lumen negative (-6 mV) at the early parts of the PT to positive (3 mV) in later parts (78). Micropuncture studies have shown that a 1.9 ratio between the concentration of Mg2+ in the tubular fluid and the interstitial fluid is necessary to initiate Mg2+ transport (84). This finding could be explained by the poor tight junction permeability for Mg2+ in PT. As a result, water uptake via aquaporin1 (AQP1) precedes Mg2+ reabsorption (113). Consequently, Mg2+ reabsorption mainly occurs in the late parts of the PT, where the transepithelial chemical Mg2+ gradient


is sufficient to favor Mg2+ transport. Generally, PT Mg2+ reabsorption is considered to be a passive paracellular process, but there might be some transcellular Mg2+ transport via a poorly characterized amiloride-sensitive mechanism (69). In both cases, sufficient Na+ transport is required to drive water transport that is prerequisite for Mg2+ reabsorption. Therefore, hormonal effects on Na+ reabsorption in the PT will also affect Mg2+ reabsorption in this segment. However, disturbances of proximal tubular Mg2+ reabsorption generally do not result in clinical symptoms, since more distal segments will compensate for reduced Mg2+ uptake in PT.

Thick Ascending Limb of Henle’s LoopWhereas most electrolytes are majorly transported in the PT, the Thick Ascending Limb of Henle’s Loop (TAL) is the main location for Mg2+ reabsorption. Due to the unique properties of this segment, approximately 50-70 % of filtered Mg2+ is reabsorbed here. Most of the Mg2+ is reabsorbed by the cortical part of the TAL, since medullary Mg2+ reabsorption is negligible (130). Paracellular bulk Mg2+ transport is dependent on the lumen-positive transepithelial voltage (+10 mV) that is determined by the activity of the Na+-K+-2Cl- co-transporter (NKCC2) and the subsequent secretion of K+ at the apical membrane (49). Inhibition of the NKCC2 by furosemide diuretics therefore results in decreased TAL Mg2+ reabsorption. Further contributors to the transepithelial membrane voltage are K+ secretion via ROMK and paracellular back flux of Na+ ions as a result of decreasing luminal Na+ concentrations. The reabsorption of Mg2+ in the TAL follow the paracellular pathway and therefore depends on the tight junction permeability (Figure 4). Tight junctions form a physical and chemical barrier between the epithelial cells. The major components of tight junctions are proteins of the claudin family. Currently, 26 claudins have been described in humans (57). Tight junction permeability is determined by the individual claudins in each tight junction complex. TAL tubules are known to express claudins 3, 10, 11, 14, 16 and 19. Claudin 16 and 19 are considered to be the main claudins influencing Mg2+ permeability, since mutations in these proteins results in renal Mg2+ wasting (80, 135). However, the role of claudin 16 in Mg2+ reabsorption is controversial. Claudin 16 was initially considered to act as a paracellular Mg2+ channel, but this hypothesis has not been unequivocally confirmed (55, 64). Reports using the claudin 16 knockdown (KD) mouse model and the LLC-PK1 cell model suggest that claudin 16 increases Na+ permeability (60, 64, 129). This would imply that claudin 16 is mainly involved in the regulation of the tran-sepithelial voltage gradient by controlling the paracellular Na+ back leak. However, in MDCK-C7 cells overexpressing claudin 16, Na+ permeability remained stable, whereas Mg2+ permeability increased significantly (55). Claudin 16 KD mice demonstrate 2-fold lower permeability ratio for Na+ over Cl− without a change in paracellular conductance. Consequently, the transepithelial voltage collapsed, reducing the driving force for Mg2+ reabsorption in TAL (128).

20 | Chapter 1

Figure 4 Magnesium Reabsorption in the Kidney

Along the nephron 95 % is reabsorbed. 10-25 % of Mg2+ is reabsorbed in the late proximal tubule

(PT), where Na+ and H2O reabsorption via NHE3 and AQP1 are prerequisites for paracellular Mg2+

transport. Bulk Mg2+ reabsorption (50-70 %) takes place in the thick ascending limb of Henle’s Loop

(TAL). In TAL, Mg2+ reabsorption take place paracellular and depends on the uptake of Na+ and K+ via

NKCC2. Fine-tuning (10 %) of Mg2+ transport takes place transcellular in the distal convoluted tubule

(DCT). In DCT, TRPM6 facilitates Mg2+ uptake from the pro-urine, which depends on the voltage-gra-

dient set by back leak of K+ via ROMK and Kv1.1 potassium channels. At the basolateral membrane,

Mg2+ is extruded via an unknown mechanism, which may be regulated by CNNM2 acting as

Mg2+-sensor. Mg2+ extrusion depends on the Na+ gradient, set by the Na+-K+-ATPase. The activity of

the Na+-K+-ATPase is in turn dependent on K+ recycling via Kir4.1. FXYD2 transcription encoding the

γ-subunit of the Na+-K+-ATPase, is regulated by HNF1β. Upon activation of the EGFR and IR an

intracellular signaling cascade (PI3K, Akt and Rac1) results in an increased TRPM6 membrane

expression and channel activity. Additionally, estrogens stimulate TRPM6 mRNA expression.


Claudin 19 has been studied less extensively, but claudin 19 has been suggested to increase the tight junction barrier function (8). The claudin 19 KD mouse exhibits highly increased urinary excretion of K+, Mg2+ and Ca2+, but Mg2+ is the only electrolyte changed at serum level (65). The discrepancy between studies with claudin 16 and claudin 19 isoforms might be explained by their interdependence in forming functional tight junction barriers (65, 66). Both in vitro and in vivo studies demonstrated that claudin 16 and 19 need to interact for proper insertion in the tight junction to be become functionally active. Further differences in experimental results may depend on the endogenous expression of other claudin isoforms in the specific cell types used in these experiments.Claudin 14 reduces the cation specificity of tight junction barriers, when co-expressed with claudin 16, or with claudin 16 - claudin 19 complexes (46). Consequently, claudin 14 KO mice exhibit increased serum Mg2+ values and decreased urinary Mg2+ excretion. This agrees with previous findings in Madin-Darby canine kidney (MDCK) cells showing that claudin 14 acts as a non-specific cation blocker (12, 149). Studies on claudin 14 KO mice have mainly focused on Ca2+ homeostasis, since claudin 14 expression is highly Ca2+ sensitive (33, 46). The CaSR regulates claudin 14 expression and Ca2+ reabsorption in the TAL by downregulation of two microRNAs, miR-9 and miR-374. Since CaSR is also activated by Mg2+, although to a lesser extent than Ca2+, it would be interesting to address the effect of elevated serum Mg2+ levels on claudin 14 expression in future studies. Recently, claudin 10 has been identified as an important factor in cation selectivity in TAL, as demonstrated in a mouse model where claudin 10 was deleted specifically in this segment (16). Claudin 10 TAL-KO mice show hypermagnesemia, nephrocalcinosis and impaired paracellular Na+ permeability. In the absence of claudin 10, TAL tight junctions become more permeable for Ca2+ and Mg2+ and the transepithelial voltage increases. These results are in line with in vitro studies overexpressing claudin 10b, suggesting that this splice variant is mainly expressed in TAL (16, 56). Over the last decades several mutations have been found that result in disturbed Mg2+ reabsorption in the TAL. An overview of TAL-caused genetic Mg2+ disorders is presented in Box 1.

PT: Proximal Tubule, TAL: Thick Ascending Limb of Henle’s Loop, DCT: Distal Convoluted Tubule, CNT:

Connecting Tubule, CD: Collecting Duct, NHE3: Na+-H+-exchanger type 3, AQP1: Aquaporin 1, NKCC2: Na+-

K+-2Cl--cotransporter, ROMK: Renal Outer Medulla K+ channel, ClC-Kb: Chloride channel Kb, Kv1.1: Voltage

gated K+ channel 1.1,TRPM6: Transient receptor potential melastatin type 6, NCC: Na+-Cl- co-transporter,

CNNM2: Cyclin M2, FXYD2: FXYD-domain containing 2, HNF1β: Hepatocyte Nuclear Factor 1β, EGF:

Epidermal Growth Factor, EGFR: Epidermal Growth Factor Receptor, IR: Insulin Receptor, PI3K: Phosphoinos-

itide 3-kinase, Rac1: Ras-related C3 botulinum toxin substrate 1, Cdk5: Cyclin-dependent kinase 5.

22 | Chapter 1

Box 1 Genetic Disorders of TAL Mg2+ ReabsorptionCLDN16 Familial hypomagnesemia with hypercalciuria and nephrocalcinosis Type 1

(FHHNC Type 1; OMIM: 248250) is caused by mutations in claudin 16 previously

known as Paracellin-1 (135). Patients suffer from renal Mg2+ wasting, hypo-

magnesemia, renal Ca2+ wasting, renal parenchymal calcification (nephro-

calcinosis) and renal failure. Serum and urinary Na+, K+, Cl- and HCO3- are

initially normal, but may get indirectly affected after progression of renal

failure. Sometimes these symptoms are extended to urinary tract infections,

kidney stones and hyperuricemia. Mg2+ supplementation is not capable in

restoring normal serum Mg2+ levels or slow down disease progression (150).

A few dozen different mutations have been reported, all characterized by a

recessive mode of inheritance (44). All symptoms can be traced to the TAL, the

main site for paracellular Ca2+ and Mg2+ reabsorption. Claudin 16 is part of the

tight junction barrier between the cells. The TAL is the main site for paracellular

Ca2+ and Mg2+ reabsorption, and disruption of these tight junctions result in

a lack of Ca2+ and Mg2+ absorption in TAL, which can only be partially be

compensated for in the downstream DCT and CNT segments.

CLDN19 Similar to FHHNC Type 1, patients with FHHNC type 2 (OMIM: 248190) suffer

from severe hypomagnesemia accompanied with hypercalciuria and nephro-

calcinosis. Additionally, patients have ocular defects consisting of macular

colobomata, significant myopia, and horizontal nystagmus. FHHNC type 2 is

caused by mutations in Claudin 19, which is expressed in the TAL segment of

the kidney. In the initial publication from Konrad and colleagues 12 patients

from 10 families were genotyped and characterized (80). Remarkably, 9 out

of 12 patients developed chronic kidney disease or underwent kidney

transplantation. Indeed, other studies confirmed that FHHNC type 2 patients

are more prone to developing CKD and develop the disease at an earlier age

compared to Type 1 patients (44), Over the years, several treatment regimens

have been proposed including oral magnesium supplementation, thiazide

diuretics and indomethacin. However, none of these treatments significantly

increased serum Mg2+ values (44).

SLC12A1 BSND CLCNKB KCNJ1

Bartter’s syndrome was originally described by Dr. Bartter in 1962 and is

characterized by salt wasting, hypokalemic alkalosis, elevated renin and

aldosterone levels and low blood pressure (10). Mutations in SLC12A1,

encoding NKCC2, Barttin, ClC-Kb, KCNJ1, encoding ROMK and the CaSR form

the genetic basis of Bartter’s syndrome (13, 132-134). Mild hypomagnesemia is

sometimes observed in Bartter’s patients, which could be explained by a

reduced driving force for paracellular Mg2+ reabsorption in the TAL.

Compensation for reduced TAL Mg2+ reabsorption may take place in the DCT,

which explains why Bartter’s patients often have normal Mg2+ levels. ClC-Kb

and Barttin are also expressed in DCT, which justifies why patients with

mutations in these genes more often show hypomagnesemia (70).


Distal Convoluted TubuleThe distal convoluted tubule (DCT) determines the final urinary Mg2+ excretion, since no reabsorption of Mg2+ take place beyond this segment. Approximately 10 % of the total Mg2+ is reabsorbed by tightly regulated transcellular transport mechanisms (Figure 2) (18). DCT cells form a high-resistance epithelium with a lumen negative voltage of approximately −5 mV (49, 152). In DCT, TRPM6 divalent cation channels mediate luminal Mg2+ uptake (Figure 4). Within the kidney, TRPM6 is specifically expressed in DCT and its activity is regulated by intracellular Mg2+ (144). TRPM6 contains six transmembrane spanning domains with a pore region between the fifth and sixth segment and a large kinase domain fused to the channel’s intracellular C-terminus. TRPM6 may function in homo- and heteromeric tetramers with TRPM7, although there is some controversy about the necessity of TRPM7 for TRPM6 function (87, 157). TRPM6 is regulated by numerous factors at the level of transcription, plasma membrane availability and activity (21). Epidermal growth factor (EGF) and insulin act on TRPM6 by a PI3K-Akt-Rac1 dependent mechanism, increasing the insertion of TRPM6 in the membrane (100, 141). Insulin may directly affect TRPM6 activity through cyclin-dependent kinase 5 (cdk5)-dependent phosphorylation of the channel. Patients with reduced EGF receptor or insulin receptor activity are therefore more susceptible to hypomagnesemia (100, 124). Additionally, estrogens increase TRPM6 mRNA expression (52). Over the last decade, several important interactors of TRPM6, including guanine nucleotide-binding protein subunit beta-2-like 1 (GNB2L1/RACK1) and prohibitin2 (PHB2/REA), have been identified (22, 23). Interestingly, GNB2L1 interacts with the α-kinase domain of TRPM6 in the auto-phosphorylated state thereby reducing channel activity (22). Other modulators of TRPM6 activity include dietary Mg2+, pH and ATP (142). Interestingly, acidification-induced current potentiation is dependent on residues p.Glu1024 and p.Glu1029, which also determine the pore selectivity for Mg2+ (86, 101). Moreover, recent findings indicate that TRPM6 is inhibited by low concentrations of intracellular ATP (IC50: 29 μmol/L), questioning the physiological activity of monomeric TRPM6 channels (157). A chemical gradient for Mg2+ entry in DCT cells is almost absent. The luminal Mg2+ concentrations vary between 0.2-0.7 mmol/L and the intracellular Mg2+ levels are typically in the range of 0.5-1.0 mmol/L. Therefore, luminal Mg2+ entry is purely dependent on the negative membrane potential in the DCT cell. Luminal K+ channels are indispensable for maintaining the necessary driving force for Mg2+ uptake. The voltage-gated K+ channel Kv1.1 has been suggested to provide efflux K+ currents resulting in hyperpolarization of the luminal membrane, although expression levels in the DCT are limited (43). To prevent Mg2+ overload and hyperpolarization of the luminal membrane, intracellular Mg2+ blocks Kv1.1 (45). Interestingly, recent studies suggest that other K+ channels in the luminal membrane of DCT cells may have similar roles. ROMK is prominently expressed in DCT and its expression in this segment is regulated by dietary Mg2+ (153). Similar to Kv1.1, intracellular Mg2+ blocks ROMK currents, suggesting a regulatory function on Mg2+ homeostasis (156).

24 | Chapter 1

Moreover, indirect inhibition of ROMK by aldosterone or Epithelial Na+ Channel (ENaC) blockers represent the only effective approach to prevent renal Mg2+ wasting in most clinical situations (34). Several proteins have been suggested to mediate Mg2+ extrusion to the bloodstream, but general consensus of the extrusion mechanism has not been reached. Due to the absence of a representative DCT cell model, the properties of Mg2+ extrusion have not been elucidated. Nevertheless, over the last decade several groups have claimed to identify Mg2+ extrusion proteins. Originally described in 2002, Cyclin M2 (CNNM2 previously known as ACDP2) is exclusively expressed at the basolateral membrane of DCT and CNT cells within the kidney (138, 147). Moreover, expression of CNNM2 is sensitive to dietary Mg2+ availability (138). CNNM2 was initially depicted as Mg2+ transporter, since overexpression in Xenopus laevis oocytes allows uptake of a variety of divalent cations, with highest affinity for Mg2+ (47). However, these results could not be confirmed in mammalian cell lines (138). Thus, it remains unclear whether CNNM2 mediates Mg2+ uptake directly or activates other Mg2+ carriers. Recently, mutations in the SLC41A1 Mg2+ transporter were described to be causative for a nephronophthisis-like phenotype (68). Localization studies showed expression in DCT, however the immunostainings were not conclusive about the subcellular localization (apical or basolateral) of SLC41A1 proteins (68). Using Mag-Fura, SLC41A1 was demonstrated to increase both Mg2+ absorption and Mg2+ extrusion (68, 79). These results suggest that SLC41A1 plays a role in DCT Mg2+ reabsorption, although further studies are necessary to elucidate the mechanisms by which SLC41A1 mediates Mg2+ transport. Since parvalbumin is within the kidney exclusively expressed in DCT, it has been suggested that this cytosolic protein acts as a Ca2+/Mg2+ buffer in DCT (122). Although parvalbumin has much higher affinity for Ca2+ than for Mg2+ (dissociation constants are 5–10 nmol/L for Ca2+ and ±30 µmol/L for Mg2+), the cation binding sites of parvalbumin will be mainly occupied by Mg2+ (105). This can be explained by the fact that the intracellular concentration of Mg2+ (0.5–1.0 mmol/L) exceeds largely that of Ca2+ (50–100 nmol/L). In mouse and human kidney, parvalbumin is exclusively expressed in the early DCT (11). In late DCT and CNT, calbindin-D28K is the main Ca2+-binding protein. The exact role of parvalbumin in DCT remains to be elucidated. Parvalbumin KO mice do not have altered serum or urine Mg2+ levels under basal conditions (11). The mice have reduced NCC expression, but display normal tubule morphology. DCT parvalbumin expression is highly sensitive to dietary Mg2+ availability, suggesting that parvalbumin plays an important role in DCT Mg2+ reabsorption. Disturbed Mg2+ reabsorption in the DCT inevitably results in renal Mg2+ wasting, since no Mg2+ is reabsorbed beyond this segment. An overview of genetic Mg2+ disorders due to DCT defects is presented in Box 2.


Box 2 Genetic Disorders of DCT Mg2+ Reabsorption TRPM6 Hypomagnesemia with secondary hypocalcemia (HSH, OMIM: 602014) is

characterized by extremely low serum Mg2+ levels (0.1-0.3 mmol/L) accompanied by low serum Ca2+ levels, which result in severe muscular and neurological complications including seizures and mental retardation (121, 145). The disorder was first characterized by Paunier and colleagues and 1968 and later mapped to a region at chromosome 9q in 1997 (108, 146). In 2002, two independent groups identified mutations in TRPM6 to be causative for HSH (121, 145). TRPM6 forms the epithelial Mg2+ channel responsible for transcellular Mg2+ transport in the colon and DCT segment of the kidney (144). Therefore, mutations result in reduced intestinal absorption and renal Mg2+ wasting. HSH has an autosomal-recessive mode of inheritance and until now a few dozen mutations have been identified. Patients are generally treated with Mg2+ supplements and anti-epileptic drugs against seizures. Serum Mg2+ levels improve after supplementation, but normally do not recover to normal levels (81).

EGF Isolated autosomal recessive hypomagnesemia (IRH, OMIM: 611718) is caused by mutations in the EGF gene (53). In a consanguine family from Dutch origin, two sisters presented with serum Mg2+ levels of 0.53 mmol/L and 0.56 mmol/L and urinary Mg2+ values of 3.9 mmol/24 h and 3.7 mmol/24 h, respectively (41). Serum Ca2+, Na+, K+, Cl–, HCO3

–, and blood pH values were normal. The patients presented with epileptic seizures during their first year of life, which could be controlled by anti-epileptic drugs. Moreover, psychomotor retardation was observed in these patients. Plasma renin activity, plasma aldosterone, and parathyroid hormone concentrations were in the normal range. Homozygosity mapping and subsequent Sanger sequencing of gene candidates resulted in the identification of a homozygous c.3209C>T mutation in exon 22 resulting a p.P1070L missense mutation at protein level (53). This residue is particularly important for membrane targeting of the EGF molecule and the mutation results in impaired basolateral sorting of EGF. Therefore, TRPM6 is not stimulated, resulting in renal Mg2+ wasting (53, 141). Until now, only a single family has been described with EGF mutations, but studies with EGFR antagonists further underline the clinical importance of EGF for renal Mg2+ handling.

KCNA1 In a Brazilian family mutations in KCNA1 encoding voltage-gated K+ channel Kv1.1 were shown to cause autosomal dominant hypomagnesemia (OMIM: 176260) (43). The patient presented in the clinic with muscle cramps, muscle, weakness, tetanic episodes and tremor. Serum Mg2+ values were low (0.37 mmol/L), whereas other electrolytes and metabolites including Na+, K+, Ca2+, Pi, uric acid, bicarbonate, urea, creatinine, glucose, bilirubin, aminotransferases, alkaline phosphate, and lactate dehydrogenase were all normal. Urinary creatinine clearance, Mg2+ and Ca2+ excretion were within the normal range. KCNA1 mutations were previously linked to ataxia and myokymia (17, 36).

26 | Chapter 1

Box 2 Continued KCNA1 Therefore, a cerebral MRI was performed in this patient, showing slight

atrophia of the cerebral vermis. Family members suffer from myokymic discharge in electromyograph analysis, which is in line with the previously observed mixed phenotype. Intravenous Mg2+ infusion improved the clinical symptoms. Kv1.1 has been proposed to cause apical hyperpolarization, which allows the uptake of Mg2+ via TRPM6. The p.N255D (c.763A>G) mutation identified in the Brazilian family disrupts Kv1.1 activity and therefore may reduce the driving force for Mg2+ transport. Although many KCNA1 mutations have been reported, even in residues very close to the p.N255, none of these have been associated with hypomagnesemia (4, 71). Identification of additional hypomagnesemic families with Kv1.1 mutations may aid our understanding of Kv1.1 function in DCT. It has been suggested that other factors contribute to the apical membrane potential and may compensate for a loss of Kv1.1 function; ROMK may be one of them (34).

SLC12A3 Hypomagnesemia with hypokalemia are the cardinal symptoms of a hereditary electrolyte disorder characterized by Dr. Gitelman in 1966, that has been known since as Gitelman’s syndrome (42). Patients present with tetany, paresthesias, and chondrocalcinosis (77). The severity of the symptoms often depends on the degree of the hypokalemia. Except hypokalemia and hypomagnesemia, laboratory investigations often show metabolic alkalosis and hypocalciuria, sometimes associated with a mild hypotension and prolonged QT interval. Mutations in SLC12A3 encoding the thiazide-sensitive Na+-Cl--co-transporter (NCC) cause Gitelman’s syndrome (39, 136). Patients with Gitelman’s syndrome are often treated with oral Mg2+ supplements (77). Interestingly, in some patients Mg2+ supplementation results in restoration of normal K+ levels, suggesting that hypokalemia is secondary to hypo-magnesemia (54). This hypothesis is further substantiated by the NCC KO mouse, which is hypomagnesemic but does not display K+ disturbances under basal conditions (125). NCC KO mice have markedly reduced TRPM6 expression levels, which may explain the renal Mg2+ wasting observed in Gitelman’s syndrome (102). However, the mechanisms explaining why a loss of NCC function results in reduced TRPM6 expression remains unresolved. It has been suggested that atrophy of the DCT segment observed in KO mice, may partially explain this phenomenon (89).

CNNM2 Mutations in CNNM2 have been shown to be causative for hypomagnesemia with seizures and mental retardation (HSMR, OMIM: 613882). Originally, two unrelated families with seizures and dominant hypomagnesemia were reported to carry CNNM2 mutations (138). In these patients, serum Mg2+ levels range between 0.3-0.5 mmol/L, but no other electrolyte disturbances were detected. The patients’ symptoms include seizures, loss of consciousness, loss of muscle tone, headaches and staring (94). HSMR patients are treated with anti-epileptic drugs and Mg2+ supplements. Mg2+ levels improve after sup-plementation but didn’t reach to normal levels.


KCNJ10 Mutations in KCNJ10 encoding the Kir4.1 K+ channel are causative for Seizures, sensorineural deafness, ataxia, mental retardation, and electrolyte imbalance / epilepsy, ataxia, sensorineural deafness, and renal tubulopathy syndrome (SeSAME/EAST, OMIM: 612780) (14, 116, 123). Patients have marked electrolyte abnormalities, including hypokalemic metabolic alkalosis without hypertension, severe hypomagnesemia and renal Na+, K+ and Mg2+ wasting. In some patients, high renin and aldosterone levels, salt craving and polyuria were observed. Kir4.1 is hypothesized to be involved in K+ recycling at the basolateral membrane of DCT cells. When Kir4.1 is mutated, K+ availability becomes rate limiting for Na+-K+-ATPase activity. Thus, the Na+-K+-ATPase will be inhibited resulting in a reduced potential across the basolateral membrane. Consequently, Na+ and Mg2+ transport will be reduced in DCT. To compensate for this, ENaC activity in CNT will be increased at the expense of K+ excretion via ROMK. Therefore, SeSAME/EAST patients suffer from severe hypomagnesemia and hypokalemia. To treat the hypomagnesemia, patients are often treated with Mg2+ and K+ supplements in combination with aldosterone antagonists or ENaC inhibitors (9). SeSAME/EAST patients suffer from a severe neurological phenotype consisting of tonic-clonic seizures in infancy, cerebellar ataxia and hearing loss. Moreover, magnetic resonance imaging evidenced subtle symmetrical signal changes in the cerebellar dentate nuclei (29).

FXYD2 Gene linkage studies identified FXYD domain containing ion transport regulator 2 (FXYD2) mutations in a family with dominant isolated renal Mg2+ wasting (IDH, OMIM: 154020) (93). The patients in this family suffered from low serum Mg2+ values (±0.4 mmol/L), without other plasma electrolyte abnormalities including Na+, K+, Ca2+, Cl-, HCO3

-. Urinary Mg2+ excretion was increased, whereas Ca2+ excretion was slightly low (40). The c.121G>A mutation results in a p.G41R missense mutation at protein level which causes misrouting of FXYD2 to the membrane (19). FXYD2 encodes for the γ-subunit of the Na+-K+-ATPase. Although the exact role of FXYD2 in the DCT it is unknown. It has been hypothesized to stabilize the Na+-K+-ATPase, influencing the membrane potential necessary for Mg2+ transport (96). However, other reports suggest that it may function as inward rectifier channel on its own (127). Functional analysis of patient’s proximal tubular cells showed no differences in Na+, K+ or ATP-affinity of the Na+-K+-ATPase, but demonstrated a lower FXYD2 protein expression (20).

HNF1B Renal cysts and diabetes syndrome (RCAD, OMIM: 137920) is caused by mutations in Hepatocyte nuclear factor 1B (HNF1B) and consists of a heterogenous group of symptoms including renal cysts (± 70 % of patients), maturity onset diabetes of the young subtype 5 (MODY5, ± 50 %) and hypomagnesemia (± 45 %) (3, 25). HNF1β is a transcription factor regulating gene expression in kidney development (91). Amongst others, FXYD2b expression has been shown to be regulated by HNF1β (37), which may explain its role in renal Mg2+ handling. However, it cannot be excluded that HNF1β additionally regulates other DCT genes involved in renal Mg2+ transport.

28 | Chapter 1

Outline of this Thesis

The aim of this thesis was to understand the physiological mechanism of Mg2+ reabsorption in the DCT. Dissecting the biochemical and molecular basis of Mg2+ transport pathways and their regulatory mechanisms may aid to provide clinical tools for patients with genetic or acquired Mg2+ deficiencies. In particular, this thesis aims to identify and to characterize new genes involved in DCT Mg2+ transport. Chapter 2 provides a large-scale screening of Mg2+ sensitive gene expression in the DCT by microarray analysis on isolated DCT cells form mice fed Mg2+-enriched and Mg2+-deficient diets. This study resulted in the identification of several new genes regulating Mg2+ reabsorption in the DCT, including PCBD1 and SLC41A3. In Chapter 3, the role of PCBD1 as transcriptional co-activator of HNF1B has been further characterized using luciferase assays to determine its effect on FXYD2 transcription. It was acknowledged that patients with mutations in PCBD1 develop hypomagnesemia and MODY5-like diabetes, which may partially be the result of reduced FXYD2 transcription in the kidney. Within the DCT cell the extrusion mechanism for Mg2+ remains to be identified. In Chapter 4, two new patient families with hypomagnesemia caused by FXYD2 mutation were described. Extensive clinical examinations aimed to further describe the clinical presentation of patients with FXYD2 mutations. Moreover, haplotype and genealogical analysis was performed to identify the genetic origin of FXYD2 mutations. Several transporters have been proposed to mediate Mg2+ transport at the basolateral membrane of the DCT cell. Chapter 5 aimed to examine whether SLC41A3 may be one of these extrusion mechanisms. Using Slc41a3 knockout mice, the effect on Mg2+ homeostasis and renal function was investigated. Although patients with CNNM2 mutations develop severe hypomagnesemia and renal Mg2+ wasting, CNNM2 was excluded as Mg2+ extrusion protein. In Chapter 6, biochemical and molecular characterization of the CNNM2 protein aimed to elucidate the structure and regulation of CNNM2. Using epitope-stainings the membrane topology was determined and by homology modeling the ability of CNNM2 to bind Mg-ATP was studied. In Chapter 7, it was shown that patients with CNNM2 mutations develop severe seizures and mental retardation. By introducing 25Mg2+ uptakes studies to measure Mg2+ transport, the goal was test which patient mutations could alter CNNM2 function. Moreover, we used the zebrafish knockdown system to test the effect of CNNM2 on brain development and activity. The last part of this thesis is dedicated to new regulatory mechanisms of TRPM6 activity. In Chapter 8, expression profiling of P2X purinoreceptors aimed to identify the purinoreceptors involved in ATP-mediated regulation of Mg2+ transport. By patch clamp analysis the effect of ATP was studied on TRPM6 activity via P2X4 purinoreceptors. Chapter 9 examines the effect of the small molecules belonging to the flavagline class of compounds, on TRPM6 activity using patch clamp analysis. Studying new activators of TRPM6-mediated Mg2+ transport may provide new potential treatment for patients with


hypomagnesemia. In chapter 10 the findings of this thesis are summarized and discussed by placing them in the context of the current knowledge of renal Mg2+ transport in the DCT.

30 | Chapter 1

References1. In: Dietary Reference Intakes for Calcium, Phosphorus, Magnesium, Vitamin D, and Fluoride. Washington (DC): 1997.2. Expert Panel Report 3 (EPR-3): Guidelines for the Diagnosis and Management of Asthma-Summary Report

2007. The Journal of allergy and clinical immunology 120: S94-138, 2007.3. Adalat S, Woolf AS, Johnstone KA, Wirsing A, Harries LW, Long DA, Hennekam RC, Ledermann SE,

Rees L, van’t Hoff W, Marks SD, Trompeter RS, Tullus K, Winyard PJ, Cansick J, Mushtaq I, Dhillon HK, Bingham C, Edghill EL, Shroff R, Stanescu H, Ryffel GU, Ellard S, and Bockenhauer D. HNF1B mutations associate with hypomagnesemia and renal magnesium wasting. Journal of the American Society of Nephrology : JASN 20: 1123-1131, 2009.

4. Adelman JP, Bond CT, Pessia M, and Maylie J. Episodic ataxia results from voltage-dependent potassium channels with altered functions. Neuron 15: 1449-1454, 1995.

5. Alfrey AC, Miller NL, and Trow R. Effect of age and magnesium depletion on bone magnesium pools in rats. The Journal of clinical investigation 54: 1074-1081, 1974.

6. Altura BT, Memon ZI, Zhang A, Cheng TP, Silverman R, Cracco RQ, and Altura BM. Low levels of serum ionized magnesium are found in patients early after stroke which result in rapid elevation in cytosolic free calcium and spasm in cerebral vascular muscle cells. Neuroscience letters 230: 37-40, 1997.

7. Amasheh S, Fromm M, and Gunzel D. Claudins of intestine and nephron - a correlation of molecular tight junction structure and barrier function. Acta Physiol (Oxf) 201: 133-140, 2011.

8. Angelow S, El-Husseini R, Kanzawa SA, and Yu AS. Renal localization and function of the tight junction protein, claudin-19. American journal of physiology Renal physiology 293: F166-177, 2007.

9. Bandulik S, Schmidt K, Bockenhauer D, Zdebik AA, Humberg E, Kleta R, Warth R, and Reichold M. The salt-wasting phenotype of EAST syndrome, a disease with multifaceted symptoms linked to the KCNJ10 K+ channel. Pflugers Archiv : European journal of physiology 461: 423-435, 2011.

10. Bartter FC, Pronove P, Gill JR, Jr., and Maccardle RC. Hyperplasia of the juxtaglomerular complex with hyper-aldosteronism and hypokalemic alkalosis. A new syndrome. The American journal of medicine 33: 811-828, 1962.

11. Belge H, Gailly P, Schwaller B, Loffing J, Debaix H, Riveira-Munoz E, Beauwens R, Devogelaer JP, Hoenderop JG, Bindels RJ, and Devuyst O. Renal expression of parvalbumin is critical for NaCl handling and response to diuretics. Proceedings of the National Academy of Sciences of the United States of America 104: 14849-14854, 2007.

12. Ben-Yosef T, Belyantseva IA, Saunders TL, Hughes ED, Kawamoto K, Van Itallie CM, Beyer LA, Halsey K, Gardner DJ, Wilcox ER, Rasmussen J, Anderson JM, Dolan DF, Forge A, Raphael Y, Camper SA, and Friedman TB. Claudin 14 knockout mice, a model for autosomal recessive deafness DFNB29, are deaf due to cochlear hair cell degeneration. Human molecular genetics 12: 2049-2061, 2003.

13. Birkenhager R, Otto E, Schurmann MJ, Vollmer M, Ruf EM, Maier-Lutz I, Beekmann F, Fekete A, Omran H, Feldmann D, Milford DV, Jeck N, Konrad M, Landau D, Knoers NV, Antignac C, Sudbrak R, Kispert A, and Hildebrandt F. Mutation of BSND causes Bartter syndrome with sensorineural deafness and kidney failure. Nature genetics 29: 310-314, 2001.

14. Bockenhauer D, Feather S, Stanescu HC, Bandulik S, Zdebik AA, Reichold M, Tobin J, Lieberer E, Sterner C, Landoure G, Arora R, Sirimanna T, Thompson D, Cross JH, van’t Hoff W, Al Masri O, Tullus K, Yeung S, Anikster Y, Klootwijk E, Hubank M, Dillon MJ, Heitzmann D, Arcos-Burgos M, Knepper MA, Dobbie A, Gahl WA, Warth R, Sheridan E, and Kleta R. Epilepsy, ataxia, sensorineural deafness, tubulopathy, and KCNJ10 mutations. The New England journal of medicine 360: 1960-1970, 2009.

15. Brautigam CA, and Steitz TA. Structural and functional insights provided by crystal structures of DNA polymerases and their substrate complexes. Current opinion in structural biology 8: 54-63, 1998.

16. Breiderhoff T, Himmerkus N, Stuiver M, Mutig K, Will C, Meij IC, Bachmann S, Bleich M, Willnow TE, and Muller D. Deletion of claudin-10 (Cldn10) in the thick ascending limb impairs paracellular sodium permeability and leads to hypermagnesemia and nephrocalcinosis. Proceedings of the National Academy of Sciences of the United States of America 109: 14241-14246, 2012.

17. Browne DL, Gancher ST, Nutt JG, Brunt ER, Smith EA, Kramer P, and Litt M. Episodic ataxia/myokymia syndrome is associated with point mutations in the human potassium channel gene, KCNA1. Nature genetics 8: 136-140, 1994.


18. Brunette MG, Vigneault N, and Carriere S. Micropuncture study of magnesium transport along the nephron in the young rat. The American journal of physiology 227: 891-896, 1974.

19. Cairo ER, Friedrich T, Swarts HG, Knoers NV, Bindels RJ, Monnens LA, Willems PH, De Pont JJ, and Koenderink JB. Impaired routing of wild type FXYD2 after oligomerisation with FXYD2-G41R might explain the dominant nature of renal hypomagnesemia. Biochimica et biophysica acta 1778: 398-404, 2008.

20. Cairo ER, Swarts HG, Wilmer MJ, Willems PH, Levtchenko EN, De Pont JJ, and Koenderink JB. FXYD2 and Na,K-ATPase expression in isolated human proximal tubular cells: disturbed upregulation on renal hypomagnesemia? The Journal of membrane biology 231: 117-124, 2009.

21. Cao G, Hoenderop JG, and Bindels RJ. Insight into the molecular regulation of the epithelial magnesium channel TRPM6. Current opinion in nephrology and hypertension 17: 373-378, 2008.

22. Cao G, Thebault S, van der Wijst J, van der Kemp A, Lasonder E, Bindels RJ, and Hoenderop JG. RACK1 inhibits TRPM6 activity via phosphorylation of the fused alpha-kinase domain. Current biology : CB 18: 168-176, 2008.

23. Cao G, van der Wijst J, van der Kemp A, van Zeeland F, Bindels RJ, and Hoenderop JG. Regulation of the epithelial Mg2+ channel TRPM6 by estrogen and the associated repressor protein of estrogen receptor activity (REA). The Journal of biological chemistry 284: 14788-14795, 2009.

24. Caspi R, Altman T, Dreher K, Fulcher CA, Subhraveti P, Keseler IM, Kothari A, Krummenacker M, Latendresse M, Mueller LA, Ong Q, Paley S, Pujar A, Shearer AG, Travers M, Weerasinghe D, Zhang P, and Karp PD. The MetaCyc database of metabolic pathways and enzymes and the BioCyc collection of pathway/genome databases. Nucleic acids research 40: D742-753, 2012.

25. Chen YZ, Gao Q, Zhao XZ, Chen YZ, Bennett CL, Xiong XS, Mei CL, Shi YQ, and Chen XM. Systematic review of TCF2 anomalies in renal cysts and diabetes syndrome/maturity onset diabetes of the young type 5. Chinese medical journal 123: 3326-3333, 2010.

26. Chernow B, Bamberger S, Stoiko M, Vadnais M, Mills S, Hoellerich V, and Warshaw AL. Hypomagnesemia in patients in postoperative intensive care. Chest 95: 391-397, 1989.

27. Cohen L, and Kitzes R. Infrared spectroscopy and magnesium content of bone mineral in osteoporotic women. Israel journal of medical sciences 17: 1123-1125, 1981.

28. Cowan JA. The biological chemistry of magnesium. VCH Publishers, 1995.29. Cross JH, Arora R, Heckemann RA, Gunny R, Chong K, Carr L, Baldeweg T, Differ AM, Lench N, Varadkar

S, Sirimanna T, Wassmer E, Hulton SA, Ognjanovic M, Ramesh V, Feather S, Kleta R, Hammers A, and Bockenhauer D. Neurological features of epilepsy, ataxia, sensorineural deafness, tubulopathy syndrome. Developmental medicine and child neurology 55: 846-856, 2013.

30. Davy H. Electro-Chemical Researches, on the Decomposition of the Earths; With Observations on the Metals Obtained from the Alkaline Earths, and on the Amalgam Procured from Ammonia. Philosophical Transactions of the Royal Society of London 98: 333-370, 1808.

31. Denis W. Determination of magnesium in blood. Journal of Biological Chemistry 41: 363-365, 1920.32. Derom ML, Sayon-Orea C, Martinez-Ortega JM, and Martinez-Gonzalez MA. Magnesium and

depression: a systematic review. Nutritional neuroscience 2012.33. Dimke H, Desai P, Borovac J, Lau A, Pan W, and Alexander RT. Activation of the Ca(2+)-sensing receptor

increases renal claudin-14 expression and urinary Ca(2+) excretion. American journal of physiology Renal physiology 304: F761-769, 2013.

34. Ellison DH. The voltage-gated K+ channel subunit Kv1.1 links kidney and brain. The Journal of clinical investigation 119: 763-766, 2009.

35. Escuela MP, Guerra M, Anon JM, Martinez-Vizcaino V, Zapatero MD, Garcia-Jalon A, and Celaya S. Total and ionized serum magnesium in critically ill patients. Intensive care medicine 31: 151-156, 2005.

36. Eunson LH, Rea R, Zuberi SM, Youroukos S, Panayiotopoulos CP, Liguori R, Avoni P, McWilliam RC, Stephenson JB, Hanna MG, Kullmann DM, and Spauschus A. Clinical, genetic, and expression studies of mutations in the potassium channel gene KCNA1 reveal new phenotypic variability. Annals of neurology 48: 647-656, 2000.

37. Ferre S, Veenstra GJ, Bouwmeester R, Hoenderop JG, and Bindels RJ. HNF-1B specifically regulates the transcription of the gammaa-subunit of the Na+/K+-ATPase. Biochemical and biophysical research communications 404: 284-290, 2011.

32 | Chapter 1

38. Fordtran JS, Rector FC, Jr., and Carter NW. The mechanisms of sodium absorption in the human small intestine. The Journal of clinical investigation 47: 884-900, 1968.

39. Gamba G, Saltzberg SN, Lombardi M, Miyanoshita A, Lytton J, Hediger MA, Brenner BM, and Hebert SC. Primary structure and functional expression of a cDNA encoding the thiazide-sensitive, electroneutral sodium-chloride cotransporter. Proceedings of the National Academy of Sciences of the United States of America 90: 2749-2753, 1993.

40. Geven WB, Monnens LA, Willems HL, Buijs WC, and ter Haar BG. Renal magnesium wasting in two families with autosomal dominant inheritance. Kidney international 31: 1140-1144, 1987.

41. Geven WB, Monnens LA, Willems JL, Buijs W, and Hamel CJ. Isolated autosomal recessive renal magnesium loss in two sisters. Clinical genetics 32: 398-402, 1987.

42. Gitelman HJ, Graham JB, and Welt LG. A new familial disorder characterized by hypokalemia and hypomagnesemia. Transactions of the Association of American Physicians 79: 221-235, 1966.

43. Glaudemans B, van der Wijst J, Scola RH, Lorenzoni PJ, Heister A, van der Kemp AW, Knoers NV, Hoenderop JG, and Bindels RJ. A missense mutation in the Kv1.1 voltage-gated potassium channel-encod-ing gene KCNA1 is linked to human autosomal dominant hypomagnesemia. The Journal of clinical investigation 119: 936-942, 2009.

44. Godron A, Harambat J, Boccio V, Mensire A, May A, Rigothier C, Couzi L, Barrou B, Godin M, Chauveau D, Faguer S, Vallet M, Cochat P, Eckart P, Guest G, Guigonis V, Houillier P, Blanchard A, Jeunemaitre X, and Vargas-Poussou R. Familial hypomagnesemia with hypercalciuria and nephrocalcinosis: pheno-type-genotype correlation and outcome in 32 patients with CLDN16 or CLDN19 mutations. Clinical journal of the American Society of Nephrology : CJASN 7: 801-809, 2012.

45. Gomez-Hernandez JM, Lorra C, Pardo LA, Stuhmer W, Pongs O, Heinemann SH, and Elliott AA. Molecular basis for different pore properties of potassium channels from the rat brain Kv1 gene family. Pflugers Archiv : European journal of physiology 434: 661-668, 1997.

46. Gong Y, Renigunta V, Himmerkus N, Zhang J, Renigunta A, Bleich M, and Hou J. Claudin-14 regulates renal Ca(+)(+) transport in response to CaSR signalling via a novel microRNA pathway. The EMBO journal 31: 1999-2012, 2012.

47. Goytain A, and Quamme GA. Functional characterization of ACDP2 (ancient conserved domain protein), a divalent metal transporter. Physiological genomics 22: 382-389, 2005.

48. Graham LA, Caesar JJ, and Burgen AS. Gastrointestinal absorption and excretion of Mg 28 in man. Metabolism: clinical and experimental 9: 646-659, 1960.

49. Greger R, and Velazquez H. The cortical thick ascending limb and early distal convoluted tubule in the urinary concentrating mechanism. Kidney international 31: 590-596, 1987.

50. Greising SM, Gransee HM, Mantilla CB, and Sieck GC. Systems biology of skeletal muscle: fiber type as an organizing principle. Wiley interdisciplinary reviews Systems biology and medicine 4: 457-473, 2012.

51. Grew N. A Treatise of the Nature and Use of the Bitter Purging Salt Contain’d in Epsom, and Such Other Waters. printed in the year, 1697.

52. Groenestege WM, Hoenderop JG, van den Heuvel L, Knoers N, and Bindels RJ. The epithelial Mg2+ channel transient receptor potential melastatin 6 is regulated by dietary Mg2+ content and estrogens. Journal of the American Society of Nephrology : JASN 17: 1035-1043, 2006.

53. Groenestege WM, Thebault S, van der Wijst J, van den Berg D, Janssen R, Tejpar S, van den Heuvel LP, van Cutsem E, Hoenderop JG, Knoers NV, and Bindels RJ. Impaired basolateral sorting of pro-EGF causes isolated recessive renal hypomagnesemia. The Journal of clinical investigation 117: 2260-2267, 2007.

54. Gullner HG, Gill JR, Jr., and Bartter FC. Correction of hypokalemia by magnesium repletion in familial hypokalemic alkalosis with tubulopathy. The American journal of medicine 71: 578-582, 1981.

55. Gunzel D, Amasheh S, Pfaffenbach S, Richter JF, Kausalya PJ, Hunziker W, and Fromm M. Claudin-16 affects transcellular Cl- secretion in MDCK cells. The Journal of physiology 587: 3777-3793, 2009.

56. Gunzel D, Stuiver M, Kausalya PJ, Haisch L, Krug SM, Rosenthal R, Meij IC, Hunziker W, Fromm M, and Muller D. Claudin-10 exists in six alternatively spliced isoforms that exhibit distinct localization and function. Journal of cell science 122: 1507-1517, 2009.

57. Gunzel D, and Yu AS. Claudins and the modulation of tight junction permeability. Physiological reviews 93: 525-569, 2013.


58. Hardwick LL, Jones MR, Buddington RK, Clemens RA, and Lee DB. Comparison of calcium and magnesium absorption: in vivo and in vitro studies. The American journal of physiology 259: G720-726, 1990.

59. Health WHOR. Managing complications in pregnancy and childbirth: a guide for midwives and doctors. World Health Organization, 2003.

60. Himmerkus N, Shan Q, Goerke B, Hou J, Goodenough DA, and Bleich M. Salt and acid-base metabolism in claudin-16 knockdown mice: impact for the pathophysiology of FHHNC patients. American journal of physiology Renal physiology 295: F1641-1647, 2008.

61. HIRSCHFELDER AD, and Haury VG. CLINICAL MANIFESTATIONS OF HIGH AND LOW PLASMA MAGNESIUM DANGERS OF EPSOM SALT PURGATION IN NEPHRITIS. Journal of the American Medical Association 102: 1138-1141, 1934.

62. Holland S, Silberstein SD, Freitag F, Dodick DW, Argoff C, and Ashman E. Evidence-based guideline update: NSAIDs and other complementary treatments for episodic migraine prevention in adults: report of the Quality Standards Subcommittee of the American Academy of Neurology and the American Headache Society. Neurology 78: 1346-1353, 2012.

63. Holroyde MJ, Potter JD, and Solaro RJ. The calcium binding properties of phosphorylated and unphos-phorylated cardiac and skeletal myosins. The Journal of biological chemistry 254: 6478-6482, 1979.

64. Hou J, Paul DL, and Goodenough DA. Paracellin-1 and the modulation of ion selectivity of tight junctions. Journal of cell science 118: 5109-5118, 2005.

65. Hou J, Renigunta A, Gomes AS, Hou M, Paul DL, Waldegger S, and Goodenough DA. Claudin-16 and claudin-19 interaction is required for their assembly into tight junctions and for renal reabsorption of magnesium. Proceedings of the National Academy of Sciences of the United States of America 106: 15350-15355, 2009.

66. Hou J, Renigunta A, Konrad M, Gomes AS, Schneeberger EE, Paul DL, Waldegger S, and Goodenough DA. Claudin-16 and claudin-19 interact and form a cation-selective tight junction complex. The Journal of clinical investigation 118: 619-628, 2008.

67. Huang CL, and Kuo E. Mechanism of hypokalemia in magnesium deficiency. Journal of the American Society of Nephrology : JASN 18: 2649-2652, 2007.

68. Hurd TW, Otto EA, Mishima E, Gee HY, Inoue H, Inazu M, Yamada H, Halbritter J, Seki G, Konishi M, Zhou W, Yamane T, Murakami S, Caridi G, Ghiggeri G, Abe T, and Hildebrandt F. Mutation of the Mg2+ transporter SLC41A1 results in a nephronophthisis-like phenotype. Journal of the American Society of Nephrology: JASN 24: 967-977, 2013.

69. Ikari A, Kano T, and Suketa Y. Magnesium influx enhanced by nitric oxide in hypertensive rat proximal tubule cells. Biochemical and biophysical research communications 294: 710-713, 2002.

70. Jeck N, Konrad M, Peters M, Weber S, Bonzel KE, and Seyberth HW. Mutations in the Chloride Channel Gene, CLCNKB, Leading to a Mixed Bartter-Gitelman Phenotype. Pediatr Res 48: 754-758, 2000.

71. Jen JC, Graves TD, Hess EJ, Hanna MG, Griggs RC, and Baloh RW. Primary episodic ataxias: diagnosis, pathogenesis and treatment. Brain : a journal of neurology 130: 2484-2493, 2007.

72. Karbach U. Cellular-mediated and diffusive magnesium transport across the descending colon of the rat. Gastroenterology 96: 1282-1289, 1989.

73. Karbach U, and Rummel W. Cellular and paracellular magnesium transport across the terminal ileum of the rat and its interaction with the calcium transport. Gastroenterology 98: 985-992, 1990.

74. Katzberg HD, Khan AH, and So YT. Assessment: symptomatic treatment for muscle cramps (an evidence-based review): report of the therapeutics and technology assessment subcommittee of the American academy of neurology. Neurology 74: 691-696, 2010.

75. Kimble RB, Srivastava S, Ross FP, Matayoshi A, and Pacifici R. Estrogen deficiency increases the ability of stromal cells to support murine osteoclastogenesis via an interleukin-1and tumor necrosis factor-mediated stimulation of macrophage colony-stimulating factor production. The Journal of biological chemistry 271: 28890-28897, 1996.

76. King DE, Mainous AG, 3rd, Geesey ME, and Woolson RF. Dietary magnesium and C-reactive protein levels. Journal of the American College of Nutrition 24: 166-171, 2005.

77. Knoers NV, and Levtchenko EN. Gitelman syndrome. Orphanet journal of rare diseases 3: 22, 2008.78. Kokko JP. Proximal tubule potential difference. Dependence on glucose on glucose, HCO 3 , and amino acids.

The Journal of clinical investigation 52: 1362-1367, 1973.

34 | Chapter 1

79. Kolisek M, Nestler A, Vormann J, and Schweigel-Rontgen M. Human gene SLC41A1 encodes for the Na+/Mg(2)+ exchanger. American journal of physiology Cell physiology 302: C318-326, 2012.

80. Konrad M, Schaller A, Seelow D, Pandey AV, Waldegger S, Lesslauer A, Vitzthum H, Suzuki Y, Luk JM, Becker C, Schlingmann KP, Schmid M, Rodriguez-Soriano J, Ariceta G, Cano F, Enriquez R, Juppner H, Bakkaloglu SA, Hediger MA, Gallati S, Neuhauss SC, Nurnberg P, and Weber S. Mutations in the tight-junction gene claudin 19 (CLDN19) are associated with renal magnesium wasting, renal failure, and severe ocular involvement. American journal of human genetics 79: 949-957, 2006.

81. Lainez S, Schlingmann KP, van der Wijst J, Dworniczak B, van Zeeland F, Konrad M, Bindels RJ, and Hoenderop JG. New TRPM6 missense mutations linked to hypomagnesemia with secondary hypocalcemia. European journal of human genetics : EJHG 2013.

82. Lameris AL, Hess MW, van Kruijsbergen I, Hoenderop JG, and Bindels RJ. Omeprazole enhances the colonic expression of the Mg(2+) transporter TRPM6. Pflugers Archiv : European journal of physiology 465: 1613-1620, 2013.

83. Lameris AL, Huybers S, Kaukinen K, Makela TH, Bindels RJ, Hoenderop JG, and Nevalainen PI. Expression profiling of claudins in the human gastrointestinal tract in health and during inflammatory bowel disease. Scandinavian journal of gastroenterology 48: 58-69, 2013.

84. Le Grimellec C. Micropuncture study along the proximal convoluted tubule. Electrolyte reabsorption in first convolutions. Pflugers Archiv : European journal of physiology 354: 133-150, 1975.

85. LERoY J. Necessite du magnesium pour la croissance de la souris. CR Soc Biol(Paris) 94: 431, 1926.86. Li M, Du J, Jiang J, Ratzan W, Su LT, Runnels LW, and Yue L. Molecular determinants of Mg2+ and Ca2+

permeability and pH sensitivity in TRPM6 and TRPM7. The Journal of biological chemistry 282: 25817-25830, 2007.87. Li M, Jiang J, and Yue L. Functional characterization of homo- and heteromeric channel kinases TRPM6 and

TRPM7. The Journal of general physiology 127: 525-537, 2006.88. Liu C, Yeh J, and Aloia J. Magnesium directly stimulates osteoblast proliferation. Journal of Bone and Mineral

Research 3: S104, 1988.89. Loffing J, Vallon V, Loffing-Cueni D, Aregger F, Richter K, Pietri L, Bloch-Faure M, Hoenderop JGJ,

Shull GE, Meneton P, and Kaissling B. Altered Renal Distal Tubule Structure and Renal Na+ and Ca2+ Handling in a Mouse Model for Gitelman’s Syndrome. Journal of the American Society of Nephrology 15: 2276-2288, 2004.

90. Lowenstein FW, and Stanton MF. Serum magnesium levels in the United States, 1971-1974. Journal of the American College of Nutrition 5: 399-414, 1986.

91. Massa F, Garbay S, Bouvier R, Sugitani Y, Noda T, Gubler MC, Heidet L, Pontoglio M, and Fischer E. Hepatocyte nuclear factor 1beta controls nephron tubular development. Development 140: 886-896, 2013.

92. Mayer ML, Westbrook GL, and Guthrie PB. Voltage-dependent block by Mg2+ of NMDA responses in spinal cord neurones. Nature 309: 261-263, 1984.

93. Meij IC, Koenderink JB, van Bokhoven H, Assink KF, Groenestege WT, de Pont JJ, Bindels RJ, Monnens LA, van den Heuvel LP, and Knoers NV. Dominant isolated renal magnesium loss is caused by misrouting of the Na(+),K(+)-ATPase gamma-subunit. Nature genetics 26: 265-266, 2000.

94. Meij IC, van den Heuvel LP, Hemmes S, van der Vliet WA, Willems JL, Monnens LA, and Knoers NV. Exclusion of mutations in FXYD2, CLDN16 and SLC12A3 in two families with primary renal Mg2+ loss. Nephrology, dialysis, transplantation : official publication of the European Dialysis and Transplant Association - European Renal Association 18: 512-516, 2003.

95. Milla PJ, Aggett PJ, Wolff OH, and Harries JT. Studies in primary hypomagnesaemia: evidence for defective carrier-mediated small intestinal transport of magnesium. Gut 20: 1028-1033, 1979.

96. Mishra NK, Peleg Y, Cirri E, Belogus T, Lifshitz Y, Voelker DR, Apell HJ, Garty H, and Karlish SJ. FXYD proteins stabilize Na,K-ATPase: amplification of specific phosphatidylserine-protein interactions. The Journal of biological chemistry 286: 9699-9712, 2011.

97. Mordike BL, and Ebert T. Magnesium: Properties — applications — potential. Materials Science and Engineering: A 302: 37-45, 2001.

98. Mubagwa K, Gwanyanya A, Zakharov S, and Macianskiene R. Regulation of cation channels in cardiac and smooth muscle cells by intracellular magnesium. Archives of biochemistry and biophysics 458: 73-89, 2007.


99. Muir KW, Lees KR, Ford I, and Davis S. Magnesium for acute stroke (Intravenous Magnesium Efficacy in Stroke trial): randomised controlled trial. Lancet 363: 439-445, 2004.

100. Nair AV, Hocher B, Verkaart S, van Zeeland F, Pfab T, Slowinski T, Chen YP, Schlingmann KP, Schaller A, Gallati S, Bindels RJ, Konrad M, and Hoenderop JG. Loss of insulin-induced activation of TRPM6 magnesium channels results in impaired glucose tolerance during pregnancy. Proceedings of the National Academy of Sciences of the United States of America 109: 11324-11329, 2012.

101. Nijenhuis T, Renkema KY, Hoenderop JG, and Bindels RJ. Acid-base status determines the renal expression of Ca2+ and Mg2+ transport proteins. Journal of the American Society of Nephrology : JASN 17: 617-626, 2006.

102. Nijenhuis T, Vallon V, van der Kemp AW, Loffing J, Hoenderop JG, and Bindels RJ. Enhanced passive Ca2+ reabsorption and reduced Mg2+ channel abundance explains thiazide-induced hypocalciuria and hypomagnesemia. The Journal of clinical investigation 115: 1651-1658, 2005.

103. Nowak L, Bregestovski P, Ascher P, Herbet A, and Prochiantz A. Magnesium gates glutamate-activated channels in mouse central neurones. Nature 307: 462-465, 1984.

104. Okayama H, Aikawa T, Okayama M, Sasaki H, Mue S, and Takishima T. Bronchodilating effect of intravenous magnesium sulfate in bronchial asthma. JAMA : the journal of the American Medical Association 257: 1076-1078, 1987.

105. Olinger E, Schwaller B, Loffing J, Gailly P, and Devuyst O. Parvalbumin: calcium and magnesium buffering in the distal nephron. Nephrology, dialysis, transplantation : official publication of the European Dialysis and Transplant Association - European Renal Association 27: 3988-3994, 2012.

106. Parry DA, Mighell AJ, El-Sayed W, Shore RC, Jalili IK, Dollfus H, Bloch-Zupan A, Carlos R, Carr IM, Downey LM, Blain KM, Mansfield DC, Shahrabi M, Heidari M, Aref P, Abbasi M, Michaelides M, Moore AT, Kirkham J, and Inglehearn CF. Mutations in CNNM4 cause Jalili syndrome, consisting of autosomal-recessive cone-rod dystrophy and amelogenesis imperfecta. American journal of human genetics 84: 266-273, 2009.

107. Partridge IG. Studies on digestion and absorption in the intestines of growing pigs. 3. Net movements of mineral nutrients in the digestive tract. The British journal of nutrition 39: 527-537, 1978.

108. Paunier L, Radde IC, Kooh SW, Conen PE, and Fraser D. Primary hypomagnesemia with secondary hypocalcemia in an infant. Pediatrics 41: 385-402, 1968.

109. Polok B, Escher P, Ambresin A, Chouery E, Bolay S, Meunier I, Nan F, Hamel C, Munier FL, Thilo B, Megarbane A, and Schorderet DF. Mutations in CNNM4 cause recessive cone-rod dystrophy with amelogenesis imperfecta. American journal of human genetics 84: 259-265, 2009.

110. Potter JD, and Gergely J. The calcium and magnesium binding sites on troponin and their role in the regulation of myofibrillar adenosine triphosphatase. The Journal of biological chemistry 250: 4628-4633, 1975.

111. Powell C, Kolamunnage-Dona R, Lowe J, Boland A, Petrou S, Doull I, Hood K, and Williamson P. MAGNEsium Trial In Children (MAGNETIC): a randomised, placebo-controlled trial and economic evaluation of nebulised magnesium sulphate in acute severe asthma in children. Health Technol Assess 17: 1-216, 2013.

112. Quamme GA. Recent developments in intestinal magnesium absorption. Current opinion in gastroenterology 24: 230-235, 2008.

113. Quamme GA, and Smith CM. Magnesium transport in the proximal straight tubule of the rabbit. The American journal of physiology 246: F544-550, 1984.

114. Quamme GA, Wong NL, Dirks JH, Roinel N, De Rouffignac C, and Morel F. Magnesium handling in the dog kidney: a micropuncture study. Pflugers Archiv : European journal of physiology 377: 95-99, 1978.

115. Ramadan NM, Halvorson H, Vande-Linde A, Levine SR, Helpern JA, and Welch KM. Low brain magnesium in migraine. Headache 29: 590-593, 1989.

116. Reichold M, Zdebik AA, Lieberer E, Rapedius M, Schmidt K, Bandulik S, Sterner C, Tegtmeier I, Penton D, Baukrowitz T, Hulton SA, Witzgall R, Ben-Zeev B, Howie AJ, Kleta R, Bockenhauer D, and Warth R. KCNJ10 gene mutations causing EAST syndrome (epilepsy, ataxia, sensorineural deafness, and tubulopathy) disrupt channel function. Proceedings of the National Academy of Sciences of the United States of America 107: 14490-14495, 2010.

117. Romani A. Regulation of magnesium homeostasis and transport in mammalian cells. Archives of biochemistry and biophysics 458: 90-102, 2007.

36 | Chapter 1

118. Rude RK, Gruber HE, Norton HJ, Wei LY, Frausto A, and Mills BG. Bone loss induced by dietary magnesium reduction to 10% of the nutrient requirement in rats is associated with increased release of substance P and tumor necrosis factor-alpha. The Journal of nutrition 134: 79-85, 2004.

119. Rude RK, Oldham SB, Sharp CF, Jr., and Singer FR. Parathyroid hormone secretion in magnesium deficiency. The Journal of clinical endocrinology and metabolism 47: 800-806, 1978.

120. Salimi MH, Heughebaert JC, and Nancollas GH. Crystal growth of calcium phosphates in the presence of magnesium ions. Langmuir 1: 119-122, 1985.

121. Schlingmann KP, Weber S, Peters M, Niemann Nejsum L, Vitzthum H, Klingel K, Kratz M, Haddad E, Ristoff E, Dinour D, Syrrou M, Nielsen S, Sassen M, Waldegger S, Seyberth HW, and Konrad M. Hypomagnesemia with secondary hypocalcemia is caused by mutations in TRPM6, a new member of the TRPM gene family. Nature genetics 31: 166-170, 2002.

122. Schneeberger PR, and Heizmann CW. Parvalbumin in rat kidney. Purification and localization. FEBS letters 201: 51-56, 1986.

123. Scholl UI, Choi M, Liu T, Ramaekers VT, Hausler MG, Grimmer J, Tobe SW, Farhi A, Nelson-Williams C, and Lifton RP. Seizures, sensorineural deafness, ataxia, mental retardation, and electrolyte imbalance (SeSAME syndrome) caused by mutations in KCNJ10. Proceedings of the National Academy of Sciences of the United States of America 106: 5842-5847, 2009.

124. Schrag D, Chung KY, Flombaum C, and Saltz L. Cetuximab therapy and symptomatic hypomagnesemia. Journal of the National Cancer Institute 97: 1221-1224, 2005.

125. Schultheis PJ, Lorenz JN, Meneton P, Nieman ML, Riddle TM, Flagella M, Duffy JJ, Doetschman T, Miller ML, and Shull GE. Phenotype Resembling Gitelman’s Syndrome in Mice Lacking the Apical Na+-Cl− Cotransporter of the Distal Convoluted Tubule. Journal of Biological Chemistry 273: 29150-29155, 1998.

126. Schweigel M, and Martens H. Magnesium transport in the gastrointestinal tract. Frontiers in bioscience : a journal and virtual library 5: D666-677, 2000.

127. Sha Q, Pearson W, Burcea LC, Wigfall DA, Schlesinger PH, Nichols CG, and Mercer RW. Human FXYD2 G41R mutation responsible for renal hypomagnesemia behaves as an inward-rectifying cation channel. American journal of physiology Renal physiology 295: F91-99, 2008.

128. Shan Q, Himmerkus N, Hou J, Goodenough DA, and Bleich M. Insights into Driving Forces and Paracellular Permeability from Claudin-16 Knockdown Mouse. Annals of the New York Academy of Sciences 1165: 148-151, 2009.

129. Shan Q, Himmerkus N, Hou J, Goodenough DA, and Bleich M. Insights into driving forces and paracellular permeability from claudin-16 knockdown mouse. Annals of the New York Academy of Sciences 1165: 148-151, 2009.

130. Shareghi GR, and Agus ZS. Magnesium transport in the cortical thick ascending limb of Henle’s loop of the rabbit. The Journal of clinical investigation 69: 759-769, 1982.

131. Shorvon S, and Ferlisi M. The treatment of super-refractory status epilepticus: a critical review of available therapies and a clinical treatment protocol. Brain : a journal of neurology 134: 2802-2818, 2011.

132. Simon DB, Bindra RS, Mansfield TA, Nelson-Williams C, Mendonca E, Stone R, Schurman S, Nayir A, Alpay H, Bakkaloglu A, Rodriguez-Soriano J, Morales JM, Sanjad SA, Taylor CM, Pilz D, Brem A, Trachtman H, Griswold W, Richard GA, John E, and Lifton RP. Mutations in the chloride channel gene, CLCNKB, cause Bartter’s syndrome type III. Nature genetics 17: 171-178, 1997.

133. Simon DB, Karet FE, Hamdan JM, DiPietro A, Sanjad SA, and Lifton RP. Bartter’s syndrome, hypokalaemic alkalosis with hypercalciuria, is caused by mutations in the Na-K-2Cl cotransporter NKCC2. Nature genetics 13: 183-188, 1996.

134. Simon DB, Karet FE, Rodriguez-Soriano J, Hamdan JH, DiPietro A, Trachtman H, Sanjad SA, and Lifton RP. Genetic heterogeneity of Bartter’s syndrome revealed by mutations in the K+ channel, ROMK. Nature genetics 14: 152-156, 1996.

135. Simon DB, Lu Y, Choate KA, Velazquez H, Al-Sabban E, Praga M, Casari G, Bettinelli A, Colussi G, Ro-driguez-Soriano J, McCredie D, Milford D, Sanjad S, and Lifton RP. Paracellin-1, a renal tight junction protein required for paracellular Mg2+ resorption. Science 285: 103-106, 1999.

136. Simon DB, Nelson-Williams C, Bia MJ, Ellison D, Karet FE, Molina AM, Vaara I, Iwata F, Cushner HM, Koolen M, Gainza FJ, Gitleman HJ, and Lifton RP. Gitelman’s variant of Bartter’s syndrome, inherited hypokalaemic alkalosis, is caused by mutations in the thiazide-sensitive Na-Cl cotransporter. Nature genetics 12: 24-30, 1996.


137. Sood AK, Handa R, Malhotra RC, and Gupta BS. Serum, CSF, RBC & urinary levels of magnesium & calcium in idiopathic generalised tonic clonic seizures. The Indian journal of medical research 98: 152-154, 1993.

138. Stuiver M, Lainez S, Will C, Terryn S, Gunzel D, Debaix H, Sommer K, Kopplin K, Thumfart J, Kampik NB, Querfeld U, Willnow TE, Nemec V, Wagner CA, Hoenderop JG, Devuyst O, Knoers NV, Bindels RJ, Meij IC, and Muller D. CNNM2, encoding a basolateral protein required for renal Mg2+ handling, is mutated in dominant hypomagnesemia. American journal of human genetics 88: 333-343, 2011.

139. Suh WC, Leirmo S, and Record MT, Jr. Roles of Mg2+ in the mechanism of formation and dissociation of open complexes between Escherichia coli RNA polymerase and the lambda PR promoter: kinetic evidence for a second open complex requiring Mg2+. Biochemistry 31: 7815-7825, 1992.

140. Temkin NR, Anderson GD, Winn HR, Ellenbogen RG, Britz GW, Schuster J, Lucas T, Newell DW, Mansfield PN, Machamer JE, Barber J, and Dikmen SS. Magnesium sulfate for neuroprotection after traumatic brain injury: a randomised controlled trial. Lancet neurology 6: 29-38, 2007.

141. Thebault S, Alexander RT, Tiel Groenestege WM, Hoenderop JG, and Bindels RJ. EGF increases TRPM6 activity and surface expression. Journal of the American Society of Nephrology : JASN 20: 78-85, 2009.

142. Thebault S, Cao G, Venselaar H, Xi Q, Bindels RJ, and Hoenderop JG. Role of the alpha-kinase domain in transient receptor potential melastatin 6 channel and regulation by intracellular ATP. The Journal of biological chemistry 283: 19999-20007, 2008.

143. Topf JM, and Murray PT. Hypomagnesemia and hypermagnesemia. Reviews in endocrine & metabolic disorders 4: 195-206, 2003.

144. Voets T, Nilius B, Hoefs S, van der Kemp AW, Droogmans G, Bindels RJ, and Hoenderop JG. TRPM6 forms the Mg2+ influx channel involved in intestinal and renal Mg2+ absorption. The Journal of biological chemistry 279: 19-25, 2004.

145. Walder RY, Landau D, Meyer P, Shalev H, Tsolia M, Borochowitz Z, Boettger MB, Beck GE, Englehardt RK, Carmi R, and Sheffield VC. Mutation of TRPM6 causes familial hypomagnesemia with secondary hypocalcemia. Nature genetics 31: 171-174, 2002.

146. Walder RY, Shalev H, Brennan TM, Carmi R, Elbedour K, Scott DA, Hanauer A, Mark AL, Patil S, Stone EM, and Sheffield VC. Familial hypomagnesemia maps to chromosome 9q, not to the X chromosome: genetic linkage mapping and analysis of a balanced translocation breakpoint. Human molecular genetics 6: 1491-1497, 1997.

147. Wang CY, Shi JD, Yang P, Kumar PG, Li QZ, Run QG, Su YC, Scott HS, Kao KJ, and She JX. Molecular cloning and characterization of a novel gene family of four ancient conserved domain proteins (ACDP). Gene 306: 37-44, 2003.

148. Weglicki WB, Dickens BF, Wagner TL, Chmielinska JJ, and Phillips TM. Immunoregulation by neuropeptides in magnesium deficiency: ex vivo effect of enhanced substance P production on circulating T lymphocytes from magnesium-deficient mice. Magnesium research : official organ of the International Society for the Development of Research on Magnesium 9: 3-11, 1996.

149. Wilcox ER, Burton QL, Naz S, Riazuddin S, Smith TN, Ploplis B, Belyantseva I, Ben-Yosef T, Liburd NA, Morell RJ, Kachar B, Wu DK, Griffith AJ, Riazuddin S, and Friedman TB. Mutations in the gene encoding tight junction claudin-14 cause autosomal recessive deafness DFNB29. Cell 104: 165-172, 2001.

150. Wolf MT, Dotsch J, Konrad M, Boswald M, and Rascher W. Follow-up of five patients with FHHNC due to mutations in the Paracellin-1 gene. Pediatr Nephrol 17: 602-608, 2002.

151. Worthington V. Nutritional quality of organic versus conventional fruits, vegetables, and grains. J Altern Complement Med 7: 161-173, 2001.

152. Wright FS. Increasing magnitude of electrical potential along the renal distal tubule. The American journal of physiology 220: 624-638, 1971.

153. Xu JZ, Hall AE, Peterson LN, Bienkowski MJ, Eessalu TE, and Hebert SC. Localization of the ROMK protein on apical membranes of rat kidney nephron segments. The American journal of physiology 273: F739-748, 1997.

154. Yamamoto M, Yamaguchi T, Yamauchi M, Yano S, and Sugimoto T. Acute-onset hypomagnesemia-in-duced hypocalcemia caused by the refractoriness of bones and renal tubules to parathyroid hormone. Journal of bone and mineral metabolism 29: 752-755, 2011.

155. Yamazaki D, Funato Y, Miura J, Sato S, Toyosawa S, Furutani K, Kurachi Y, Omori Y, Furukawa T, Tsuda T, Kuwabata S, Mizukami S, Kikuchi K, and Miki H. Basolateral Mg<sup>2+</sup> Extrusion via CNNM4 Mediates Transcellular Mg<sup>2+</sup> Transport across Epithelia: A Mouse Model. PLoS genetics 9: e1003983, 2013.

38 | Chapter 1

156. Yang L, Frindt G, and Palmer LG. Magnesium modulates ROMK channel-mediated potassium secretion. Journal of the American Society of Nephrology : JASN 21: 2109-2116, 2010.

157. Zhang Z, Yu H, Huang J, Faouzi M, Schmitz C, Penner R, and Fleig A. The TRPM6 Kinase Domain Determines the Mg.ATP Sensitivity of TRPM7/M6 Heteromeric Ion Channels. The Journal of biological chemistry 289: 5217-5227, 2014.

158. Zipes DP, Camm AJ, Borggrefe M, Buxton AE, Chaitman B, Fromer M, Gregoratos G, Klein G, Moss AJ, Myerburg RJ, Priori SG, Quinones MA, Roden DM, Silka MJ, Tracy C, Smith SC, Jr., Jacobs AK, Adams CD, Antman EM, Anderson JL, Hunt SA, Halperin JL, Nishimura R, Ornato JP, Page RL, Riegel B, Blanc JJ, Budaj A, Dean V, Deckers JW, Despres C, Dickstein K, Lekakis J, McGregor K, Metra M, Morais J, Osterspey A, Tamargo JL, and Zamorano JL. ACC/AHA/ESC 2006 Guidelines for Management of Patients With Ventricular Arrhythmias and the Prevention of Sudden Cardiac Death: a report of the American College of Cardiology/American Heart Association Task Force and the European Society of Cardiology Committee for Practice Guidelines (writing committee to develop Guidelines for Management of Patients With Ventricular Arrhythmias and the Prevention of Sudden Cardiac Death): developed in collaboration with the European Heart Rhythm Association and the Heart Rhythm Society. Circulation 114: e385-484, 2006.

42 | Chapter 2

Abstract

The kidney plays a key role in the maintenance of the magnesium (Mg2+) homeostasis. Specifically, the distal convoluted tubule (DCT) is instrumental in fine-tuning of the renal Mg2+ handling. In recent years hereditary Mg2+ transport disorders have helped to identify important players in DCT Mg2+ homeostasis. Nevertheless, several proteins involved in DCT-mediated Mg2+ reabsorption remains to be discovered and a full expression profile of this complex nephron segment may facilitate the discovery of new Mg2+-related genes. Here, we report the Mg2+-sensitive expression of the DCT transcriptome. To this end, transgenic mice expressing eGFP under a DCT-specific parvalbumin promoter were subjected to Mg2+-deficient or Mg2+-enriched diets. Subsequently, the Complex Object Parametric Analyzer and Sorter (COPAS) allowed for the first time isolation of eGFP-positive DCT cells. RNA extracts thereof were analyzed by DNA microarrays comparing high vs. low Mg2+ to identify Mg2+ regulatory genes. Based on statistical significance and a fold-change of at least two, 46 genes showed differential expression. Several known magnesiotropic genes, such as Trpm6 and Parvalbumin, were upregulated under low dietary Mg2+. Moreover, new genes were identified that are potentially involved in renal Mg2+ handling. To confirm that the selected candidate genes were regulated by dietary Mg2+ availability, the expression levels of Slc41a3, Pcbd1, Tbc1d4 and Umod were determined by RT-PCR analysis. Indeed, all four genes show significant upregulation in the DCT of mice fed the Mg2+-deficient diet. By elucidating the Mg2+-sensitive DCT transcriptome new candidate genes in renal Mg2+ handling have been identified.

Keywords: Magnesium Homeostasis, Hypomagnesemia, Gene Expression Microarray, COPAS,

Distal Convoluted Tubule

Elucidation of the Mg2+-sensitive DCT Transcriptome | 43

Introduction

Hypomagnesemia is a common clinical manifestation associated with type 2 diabetes, hypertension, osteoporosis, tetany, seizures, depression and the use of a variety of drugs (6, 21). Clinical studies addressing the Mg2+ status of critically ill patients showed that a substantial number of patients is hypomagnesemic. Moreover, low blood Mg2+ levels are associated with a poor clinical outcome (23, 40). Regulation of blood Mg2+ levels is an equilibrium between intestinal Mg2+ absorption and renal Mg2+ reabsorption. In kidney, Mg2+ reabsorption in the proximal tubule (PT) and the thick ascending limb of Henle (TAL) is a passive paracellular process, whereas in the distal convoluted tubule (DCT) Mg2+ reabsorption is a highly regulated and transcellular mechanism. This latter segment facilitates the fine-tuning of renal Mg2+ uptake, since no reabsorption takes places beyond DCT. Over the last decade, the elucidation of the molecular origin of human genetic diseases has helped to identify new proteins involved in Mg2+ transport in DCT (6). In patients with hypomagnesemia and secondary hypocalcemia (HSH), mutations were identified in the transient receptor potential melastatin 6 (TRPM6), the gatekeeper of Mg2+ entry in the DCT cell (39, 47). The abundance of TRPM6 at the plasma membrane is regulated by the epidermal growth factor (EGF) and as a result mutations in the pro-EGF gene are causative for hypomagnesemia (16). Mg2+ transport via TRPM6 is a passive process that depends on the membrane potential across the luminal membrane (14). Therefore, several players involved in the maintenance of this membrane potential have been identified by gene-linkage analyses in patients with hereditary hypomagnesemia. For instance, a mutation in KCNA1 encoding the voltage-gated K+ channel Kv1.1 impairs the luminal extrusion of K+ ions necessary to maintain a substantial luminal membrane potential (14). At the basolateral membrane, the K+ channel Kir4.1 acts an important player in the K+ recycling which seems necessary to maintain a high Na+-K+-ATPase activity (1). Indeed, mutations in KCNJ10 coding for Kir4.1 and mutations in the γ-subunit of the Na+-K+-ATPase, FYXD2, are linked to hypomagnesemia (1, 4). Moreover, mutations in transcription factor HNF1β, that regulates the transcription of FXYD2, cause a similar phenotype (27). Recently, mutations in the DCT-expressed CNNM2 gene were linked to hypomagnesemia (43). It was postulated that CNNM2 may act as an intracellular Mg2+ sensor regulating Mg2+ transport (7). Although gene-linkage studies have gained insight in Mg2+ reabsorption in DCT over the last years, several factors remain unidentified. For instance, the Mg2+ extrusion mechanism of DCT cells is still unknown. The aim of the present study was, therefore, to elucidate the Mg2+-sensitive transcriptome of the DCT cell. To this end, primary DCT cells were isolated from mice kidneys and a comprehensive expression profile specific for DCT cells was established using gene expression microarrays. Furthermore, by comparing DCT expression profiles of mice fed high and low Mg2+-containing diets, the Mg2+-sensitivity of the DCT transcriptome has

44 | Chapter 2

been determined. Here, we describe the identification of new candidate genes potentially involved in Mg2+ reabsorption in DCT.

Results

Experimental DesignIn our study, transgenic mice, that express enhanced Green Fluorescent Protein (eGFP) downstream a parvalbumin (Pv) promoter, were subjected to Mg2+ diets. Within the kidney, PV is exclusively expressed in DCT (3). Combining Pv-eGFP mice with the COPAS tissue sorting system allowed the specific isolation of DCT cells (26). Here, Pv-eGFP mice were subdivided into 2 groups consisting of 12 mice each. Each group was subjected to a high (0.48 % (w/w)) Mg2+ or a low (0.02 % (w/w)) Mg2+-containing diet for 15 days. Subsequently, DCT tubules were isolated using COPAS and total RNA was extracted (Figure 1A). 4 out of 12 pairs of RNA extracts were processed for and subjected to pair-wise (high vs. low) microarray analysis. The 8 remaining RNA extracts per group were used to validate the results of the microarray experiments by RT-PCR. As a control for purity, transcriptional expression levels of DCT marker genes, Trpm6 and Ncc were determined by RT-PCR (Figure 1B-1C). Indeed, the expression of the thiazide- sensitive sodium-chloride cotransporter (Ncc) and Trpm6 are enriched 200-fold and 8-fold, respectively, compared to total kidney material of the same mice. Moreover, expression of protein markers for proximal tubules (Aqp1) and the collecting duct (Aqp2) was reduced. Slight overlap was detected with thick ascending limb and connecting tubules, when testing for marker genes, Nkcc2 and Trpv5, respectively (Figure 1B). These results indicate that the COPAS-sorted tubules contain primarily DCT transcripts.

Effects of Mg2+ DietsBefore subjecting mRNA transcripts to microarray hybridization, the effect of the Mg2+ diets on plasma and urinary Mg2+ levels were assessed (Figure 2A-2C). In line with our previous experiments, the serum Mg2+ concentration dropped significantly in the mice fed with the Mg2+-deficient diet (Figure 2A)(15). The Mg2+-enriched diet resulted in a slight, albeit significant, hypermagnesemia (Figure 2A). The urinary Mg2+ excretion showed the same pattern: high excretion in the Mg2+-enriched diets and low excretion in the Mg2+-deficient mice (Figure 2B). Serum Ca2+ concentrations did not change significantly (Figure 2C). In contrast, the urinary Ca2+ concentration was significantly increased in mice fed a high Mg2+ diet (Figure 2D). Urinary and serum Na+ and K+ values were not significantly altered by the dietary Mg2+ availability (Figure 2E-H).


DCT Transcriptome AnalysisThe DCT transcriptome was first analyzed for abundance of individual mRNAs. This was achieved by analyzing the average log2 intensity of the two channel microarray data (the so-called A value, A=½log2(RG)) after normalization between the two channels. Although the A value is influenced by the amplification of the transcripts and the position of microarray feature sequences, it gives a qualitative view of the gene expression levels in the DCT

Figure 1 Isolation of Distal Convoluted Tubule Cells

A, Timeline of animal experiment. Mice were placed on Mg2+ diets for 15 days (gray bar). Blood samplings

are indicated by black arrows, metabolic cages are represented by the black bar. B-C, mRNA expression

levels of Aqp1, Nkcc2, Trpm6, Trpv5, Aqp2 (B) and Ncc (C) in COPAS-selected mouse DCT (black bar)

and control (none-selected, white bar) kidney tubules were measured by quantitative RT-PCR and

normalized for Gapdh expression. Data represent means (n=8) ± SEM and are expressed as fold

difference when compared with the expression in none-selected tubules. *P < 0.05 indicates significant

difference from none-selected tubules.

A

B

Day

1Day

13Day

15

Blood Sampling Metabolic Cages Blood Sampling

Mg2+ diets

Low Mg 2+

High Mg 2+

Pairwise Microarray

RT-PCR

C

01

180200

280

NCC

mRN

A e

xpre

ssio

n(R

elat

ive

to to

tal k

idne

y, fo

ld c

hang

e)

2

220240260

DCT Kidney

*

160140

Aqp1

Nkcc2

Trpm

6Trp

v5Aqp2

0

2

4

6

8

10

mRN

A e

xpre

ssio

n (R

elat

ive

to to

tal k

idne

y, fo

ld c

hang

e)

*

*

**

46 | Chapter 2

Figure 2 Effect of Dietary Mg2+ Availability on Serum and Urinary Mg2+ and Ca2+ Concentrations.

A-H, Serum Mg2+ (A) and Ca2+ (C) concentrations at day 0 (black bars) and day 15 (white bars) of mice

fed with a low or high Mg2+-containing diet for 15 days. 24hrs urinary Mg2+ (B) and Ca2+ (D) excretion

at day 15 of mice fed with a low or high Mg2+-containing diet for 15 days. Serum Na+ (E) and K+ (G)

concentrations at day 15 of mice fed with a low or high Mg2+-containing diet for 15 days. 24hr urinary

Na+ (F) and K+ (H) excretion at day 15 of mice fed with a low or high Mg2+-containing diet for 15 days.

Values are presented as means ± SEM (n=12). *P < 0.05 is considered statistically significant compared

to day 0. #P < 0.05 is considered statistically significant to the low Mg2+ group.

0

0.5

1.0

2.0

2.5

3.0

Day 0 Day 15

Seru

m [C

a2+]

(mM

)

1.5

0

2

6

8

12

14

16

18

Low Mg 2+ diet High Mg 2+ diet

Urin

ary

Ca2+

exc

retio

n(µ

mol

/24h

r urin

e)

10

4

#

0

10

20

30

40

50

60

70


Urin

ary

Mg2+

exc

retio

n(µ

mol

/24h

r urin

e)

#

B

DC

A*

*

0

0.5

1.0

2.0

2.5

Day 0 Day 15

Seru

m [M

g2+]

(mM

) 1.5

#

FE

HG

Low M

g2+

High Mg2+

0

2

4

6

8

10

Se

rum

Po

tass

ium

(mM

)

Low M

g2+

High Mg2+

0

50

100

150

200

Se

rum

So

diu

m (m

M)

Low M

g2+

High Mg2+

0

200

400

600

24

hrs

Po

tass

ium

Exc

retio

n (

mo

l)

Low M

g2+

High Mg2+

0

50

100

150

200

250

24

hrs

So

diu

m E

xcre

tion

(m

ol)





Seru

m [N

a+ ](m

M)

Seru

m [K

+ ] (m

M)

Urin

ary

Na+

exc

retio

n(µ

mol

/24h

r urin

e)U

rinar

y K+

exc

retio

n(µ

mol

/24h

r urin

e)


tubules. Of the most abundant transcripts more then a third are directly linked to mitochondrial function (Table 1). DCT cells are the cells with the highest mitochondrial density in the mammalian kidney (9). Moreover, DCT marker genes have moderate to high A values. Ncc gave an average expression signal of 11.9 and Trpm6 had a value of 11.7. Several genes implicated in DCT-mediated Mg2+ transport were highly expressed. Egf and Fxyd2 were with expression values of 16.7 and 16.5 among the 50 most expressed DCT genes. Interestingly, marker proteins of the TAL showed low expression levels. For instance, Slc12a1 had a value of 8.6 and Claudin16 had an expression level of 6.9. Taken together these results confirm the purity of the COPAS-selected DCT cells.

Mg2+-sensitive Gene ExpressionTo identify DCT genes involved in Mg2+ homeostasis, the Mg2+-sensitive differential expression of the transcriptome was determined by pair-wise comparison of high versus low Mg2+ samples. As a first approach, we examined the expression of the genes that are associated with hypomagnesemia in genetic disease (6). Interestingly, only Trpm6 and Egf were shown significantly upregulated in the low Mg2+ diet compared to mice fed with high Mg2+ diets (Table 2). To assess the reproducibility of our microarray data, the microarray results were validated by RT-PCR on a separate set of DCT mRNA transcripts (Figure 3A-3H). Indeed, this analysis confirmed that dietary Mg2+ regulates Trpm6 expression. The Trpm6 expression in the low Mg2+-fed diet mice was 2.3 fold enriched in comparison to mice fed with high Mg2+ diets (Figure 3A). Additionally, only Egf and Cnnm2 were differentially regulated (Figure 3B and 3F). RT-PCR analyses showed enrichment in the low Mg2+ diet-fed mice of 1.5 and 2.1 fold, respectively, relatively to high Mg2+ diet-fed mice. The enrichment of Cnnm2 was not significant in the microarray data (P=0.68), but was highly significant in the RT-PCR analysis (P<0.002). Kcna1 transcripts, encoding Kv1.1, were not detectable in the pure DCT material (Figure 3C), confirming the low signal in the microarray (A value: 5.7). No major differences between microarray and RT-PCR data were observed, indicating high reproducibility between the RT-PCR and microarray analyses. Next, we analyzed the microarray Mg2+ sensitivity of all potential mammalian Mg2+ transporters that have been described in literature (34). In comparison with mice fed an Mg2+-enriched diet, only Trpm6 and Slc41a3 mRNA transcripts show a significant enrichment in mice fed a Mg2+-deficient diet (Table 3). Slc41a3 has been previously linked to Mg2+ transport, although the exact function of this gene was never examined (34). Cnnm1, Cnnm3, Cnnm4, Slc41a1, Slc41a2 and all other transporters of the Nipa, MagT, MMgT,

Mrs and Zdhhc families are not Mg2+ sensitive and present a relatively low A value, suggesting low DCT abundance.

48 | Chapter 2

Table 1 Most Abundantly Expressed Genes in the Distal Convoluted Tubule

GeneName

GeneDescription

AverageSignal

(A value)

Fjx1 four jointed box 1 17.2

Olfr215 olfactory receptor 215 17.1

Klk1b5 kallikrein 1-related peptidase b5 17.1

Neurog3 neurogenin 3 17.1

mt-Co2 mitochondrially encoded cytochrome c oxidase II 17.1

Fth1 ferritin heavy chain 1 17.1

Ccdc78 coiled-coil domain containing 78 17.1

Ccl4 chemokine (C-C motif ) ligand 4 17.1

Klk1b26 kallikrein 1-related petidase b26 17.1

Aspscr1 alveolar soft part sarcoma chromosome region, candidate 1 (human) 17.1

Slc45a3 solute carrier family 45, member 3 17.0

Atp5a1 ATP synthase, H+ transporting, alpha subunit 1 17.0


Lrsam1 leucine rich repeat and sterile alpha motif containing 1 17.0

mt-Nd4 mitochondrially encoded NADH dehydrogenase 4 17.0


Atp5g3 ATP synthase, H+ transporting, subunit C3 (subunit 9) 16.9

Dnajc19 DnaJ (Hsp40) homolog, subfamily C, member 19 16.9

Ddx51 DEAD (Asp-Glu-Ala-Asp) box polypeptide 51 16.9

Porcn porcupine homolog 16.9

Fgf17 fibroblast growth factor 17 16.9

Gabarapl1 gamma-aminobutyric acid A receptor-associated protein-like 1 16.9

Atp5b ATP synthase, H+ transporting beta subunit 16.9

mt-Atp8 mitochondrially encoded ATP synthase 8 16.9

Mdh1 malate dehydrogenase 1, NAD (soluble) 16.9


Nudt4 nudix (nucleoside diphosphate linked moiety X)-type motif 4 16.8


mt-Cytb mitochondrially encoded cytochrome b 16.8

Ulk1 Unc-51 like kinase 1 16.8

mt-Co3 mitochondrially encoded cytochrome c oxidase III 16.8

Avpr2 arginine vasopressin receptor 2 16.8

Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 16.8

Plekho2 pleckstrin homology domain containing, family O member 2 16.8


Table 1 Continued

GeneName

GeneDescription

AverageSignal

(A value)

Vsig10l ZV-set and immunoglobulin domain containing 10 like 16.7

Chchd2 coiled-coil-helix-coiled-coil-helix domain containing 2 16.7

Egf epidermal growth factor 16.7

Atp1a1 ATPase, Na+/K+ transporting, alpha 1 polypeptide 16.7

Eef1a1 eukaryotic translation elongation factor 1 alpha 1 16.7

mt-Atp6 mitochondrially encoded ATP synthase 6 16.7

Uqcrh ubiquinol-cytochrome c reductase hinge protein 16.7

Oxct1 3-oxoacid CoA transferase 1 16.6

Uqcrfs1 ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 16.6

Slc25a3 solute carrier family 25 member 3 16.5

SNORA17 Small nucleolar RNA SNORA17 16.5

Cox6c cytochrome c oxidase, subunit VIc 16.5

Ldhb lactate dehydrogenase B 16.5

Mtx1 metaxin 1 16.5

Fxyd2 FXYD domain-containing ion transport regulator 2 16.5

Id3 inhibitor of DNA binding 3 16.4

Hspa12b heat shock protein 12B 16.4

Wfdc15b WAP four-disulfide core domain 15B 16.4

Umod uromodulin 16.3

Atp5l ATP synthase, H+ transporting, mitochondrial F0 complex, subunit g 16.3

Mal myelin and lymphocyte protein, T-cell differentiation protein 16.3

Cox8a cytochrome c oxidase, subunit VIIIa 16.2

Igfbp7 insulin-like growth factor binding protein 7 16.2

Ndufa4 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4 16.2

Stat5b signal transducer and activator of transcription 5B 16.2

Kcnj1 potassium inwardly-rectifying channel, subfamily J, member 1 16.2

Krt16 keratin 16 16.1

Cox6a1 cytochrome c oxidase, subunit VI a, polypeptide 1 16.1

Dlx3 distal-less homeobox 3 16.1

Rpl7 ribosomal protein L7 16.1

Rpl10 ribosomal protein 10 16.1

Slc48a1 solute carrier family 48 (heme transporter), member 1 16.0

Cox7c cytochrome c oxidase, subunit VIIc 16.0

Cox7a2 cytochrome c oxidase, subunit VIIa 2 16.0

50 | Chapter 2

Table 1 Continued

GeneName

GeneDescription

AverageSignal

(A value)

Efhd1 EF hand domain containing 1 16.0

Atp5h ATP synthase, H+ transporting, subunit d 16.0

Rpl23 ribosomal protein L23 16.0

Ndufa1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 16.0

Fryl furry homolog-like 16.0

This table summarizes the genes that are most abundantly expressed (A value >16) in the distal

convoluted tubule (DCT) of mice, as determined by microarray expression analysis on mRNA specifically

isolated from DCT material. The total signal is expressed as the 2log of the sum of the red and green

signal divided by 2, A=½log2 (RG).

Table 2 Mg2+-sensitivity in the Distal Convoluted Tubule of Genes Associated with Hypomagnesemia.

Name Average Signal(A value)

Fold Change in the Low Mg2+ group

P value

Trpm6 11.8 2.05 0.03

Egf 16.7 1.74 0.05

Kcna1 5.7 0.97 1

Kcnj10 14.9 1.08 1

Fxyd2 16.5 0.88 1

Hnf1b 8.7 0.84 1

Cnnm2 10.4 1.69 0.68

Slc12a3 11.9 1.11 1

Shown is a summary of Mg2+-sensitive expression of all distal convoluted tubule (DCT) genes

previously linked with human genetic forms of hypomagnesemia by microarray expression analysis

on mRNA specifically isolated from DCT material. The average signal is expressed as the ½log2 of the

sum of the red and green signal. The fold change is the differential expression between high- and

low-Mg2+ diet-fed mice and is expressed as enrichment in the low-Mg2+ diet compared with the

high-Mg2+ diet. Numbers above 1 indicate enrichment in mice fed a low-Mg2+ diet. Numbers below

1 designate enrichment in mice fed with high-Mg2+ diet. The P value shows the statistical significance

of the differential expression.

Trpm6, transient receptor potential cation channel, subfamily M, member 6; Egf, Epidermal growth

factor; Kcna1, K+ voltage-gated channel, shaker-related subfamily, member 1; Kcnj10, K+ inwardly

rectifying channel, subfamily J, member 10; Fxyd2, FXYD domain containing ion transport regulator

2; Hnf1b, hepatocyte nuclear factor-1β; Cnnm2, cyclin M2; Slc12a3, solute carrier family 12, member 3.


Figure 3 Effects of Dietary Mg2+ Availability on mRNA Transcript Expression of Hypomagnesemia-linked Genes

A–H, the mRNA expression levels of Trpm6 (A), Egf (B), Kcna1 (C), Kcnj10 (D), Fxyd2 (E), Hnf1b (F), Cnnm2

(G) and Ncc (H) in COPAS-selected DCT tubules of mice fed with a low or high Mg2+-containing

diet for 15 days were measured by quantitative RT-PCR and normalized for Gapdh expression. Data

represent means (n=8) ± SEM and are expressed fold difference when compared to the expression

in the high Mg2+ group. ND = Not detectable. *P < 0.05 indicates significant difference from the

high Mg2+ group.

0

0.5

1.0

1.5

2.0

2.5

3.0

Low Mg 2+ High Mg 2+

Trpm

6 m

RNA

expr

essi

on(fo

ld c

hang

e)

0

0.5

1.0

1.5

2.0

2.5

3.0


Egf

mRN

A ex

pres

sion

(fold

cha

nge)

0

0.5

1.0

1.5

2.0

Low Mg 2+ High Mg 2+ Kcna

1 m

RNA

expr

essi

on(fo

ld c

hang

e)

0

0.5

1.0

1.5

2.0

Low Mg 2+ High Mg 2+ Kcnj

10 m

RNA

expr

essi

on(fo

ld c

hang

e)

0

0.5

1.0

1.5

2.0

Low Mg 2+ High Mg 2+ Fxyd

2 m

RNA

expr

essi

on(fo

ld c

hang

e)

0

0.5

1.0

1.5

2.0

Low Mg 2+ High Mg 2+ Hnf

1b m

RNA

expr

essi

on(fo

ld c

hang

e)

0

0.5

1.0

1.5

2.0

2.5


Cnnm

2 m

RNA

expr

essi

on(fo

ld c

hang

e)

0

0.5

1.0

1.5

2.0

2.5


Slc1

2a3

mRN

A ex

pres

sion

(fold

cha

nge)

NDND

*

*

BA

C

E

G H

F

D

52 | Chapter 2

New Candidate GenesThe main objective of this study was to identify new players in renal Mg2+ handling. Therefore, we subsequently selected differentially expressed genes with statistical significance (P < 0.05) and a minimal fold-change in expression of two. As a result of this

Table 3 Distal Convoluted Tubule Mg2+-sensitivity of Mg2+ Channels and Transporters



P-value

Trpm6 11.8 2.05 0.03

Trpm7 14.3 1.37 0.49

Cnnm1 8.4 0.86 1

Cnnm2 13.5 1.69 0.68

Cnnm3 11.5 1.21 1

Cnnm4 7.1 0.95 1

Slc41a1 6.8 1.03 1

Slc41a2 5.6 0.99 1

Slc41a3 7.8 0.49 0.02

Nipa1 8.6 0.98 1

Nipa2 9.9 1.15 1

Nipal1 5.9 1.01 1

Nipal2 5.8 0.94 1

Nipal3 11.8 1.09 1

Nipal4 5.1 1.00 1

Mrs2 8.3 0.75 1

MagT1 7.8 0.98 1

MMgT1 7.8 1.06 1

MMgT2 8.3 1.29 1

Tusc3 8.7 0.98 1

Zdhhc17 7.9 1.20 1

Zdhhc13 8.5 1.05 1

Shown is Mg2+ sensitive expression of all putative mammalian Mg2+ transporters by microarray

expression analysis on mRNA specifically isolated from DCT material. The average signal is expressed

as the ½log2 of the sum of the red and green signal. The fold change gives the differential expression

between high and low Mg2+-fed mice and is expressed as enrichment in the low diet compared to

the high Mg2+ diet. Numbers above 1 indicate enrichment in mice fed with a low Mg2+-diet.

Numbers smaller than 1 designate enrichment in mice fed with a high Mg2+-diet. The P value shows

the statistical significance of the differential expression.

Nipa, NaCl-inducible protein; MMgT, membrane Mg2+ transporter; Tusc3, tumor suppressor candidate

3; Zdhhc, putative ZDHHC-type palmitoyltransferase 6-like.


stringent analysis, 46 gene candidates were identified (Table 4). Among the genes that were enriched in Mg2+-deficient mice, the previously mentioned Trpm6 and Slc41a3 were detected. Additionally, 33 genes were identified that were enriched in the low Mg2+ group (compared to the high Mg2+ group). The gene with the highest fold change was Sox9 encoding a transcription factor involved in renal development. Other high ranking genes are the DCT marker Pv, glycoprotein Umod and complement factor Cd55. Furthermore, we identified direct and indirect regulators of the Na+-K+-ATPase, Tbc1d4 and Pcbd1. Notable is the presence of several genes that are mainly known for their role in Ca2+ homeostasis, such as calbindin28K and the vitamin D receptor. Only 11 genes were significantly enriched with a minimal fold change of 2 in the high Mg2+ group, compared to low Mg2+-fed mice. None of these genes were earlier linked to Mg2+ homeostasis. The most profound differential expression was measured with the Ptger3 gene, a prostaglandin receptor. To confirm the results of the microarray analysis, mRNA transcript levels of all major candidate genes were determined using RT-PCR (Figure 4A-D). Indeed, Slc41a3 mRNA expression was 1.8 fold enriched in the Mg2+-deficient mice, similar to the values observed

Table 4 Mg2+-regulated Genes in the Distal Convoluted Tubule



P value

Sox9 9.6 4.83 0.01

Cd55 7.1 4.16 0.00

Dnaja4 11.8 3.28 0.00

Gulo 8.4 3.27 0.02

Pck1 9.0 3.27 0.03

Prkd1 9.7 3.17 0.0004

Calb1 13.5 3.01 0.02

Umod 16.3 2.91 0.01

Pvalb 13.4 2.71 0.01

Ptgs1 10.0 2.52 0.0008

Tppp 6.4 2.52 0.01

Unc5b 10.6 2.37 0.00

Rd3 9.5 2.36 0.01

Acss1 15.7 2.30 0.03

Wdr72 11.8 2.27 0.02

Pdlim1 7.8 2.20 0.03

Pcbd1 14.8 2.20 0.01

Tbc1d4 11.6 2.18 0.01

Gsn 12.8 2.17 0.02

54 | Chapter 2

Table 4 Continued



P value

Ilvbl 8.2 2.12 0.01

Spag5 6.5 2.12 0.03

Etv5 10.3 2.11 0.01

Vdr 10.7 2.10 0.01

Hmgcll1 8.1 2.09 0.0012

Iyd 7.4 2.08 0.03

Zscan4c 9.4 2.08 0.02

Plekha1 12.0 2.08 0.0018

Trpm6 11.8 2.05 0.03

Tspan33 10.8 2.04 0.01

Abcg1 8.1 2.04 0.02

Dusp6 10.6 2.03 0.02

Gpm6b 8.7 2.02 0.01

Slc41a3 7.8 2.02 0.02

Cwh43 13.3 2.01 0.03

Tdrd3 12.9 2.00 0.0008

Pdpn 9.0 0.49 0.002

Gpc3 7.0 0.49 0.02

Lrtm2 8.3 0.48 0.05

Nqo1 8.3 0.46 0.03

Tmed6 8.7 0.45 0.0004

Grin3a 6.8 0.44 0.01

Ell3 8.3 0.42 0.00

Kap 9.2 0.40 0.01

Mreg 9.6 0.38 0.00

Ndrg4 9.1 0.37 0.01

Ptger3 9.5 0.23 0.01

Shown is a summary of all genes that are significantly (P < 0.05) differentially expressed with a

minimal fold change of 2 in the distal convoluted tubule (DCT) of mice fed with a high or low Mg2+

diet for 15 days, as determined by microarray expression analysis on mRNA specifically isolated from

DCT material. The average signal is expressed as the ½log2 of the sum of the red and green signal.

The fold change gives the differential expression between high and low Mg2+-fed mice and is

expressed as enrichment in the low diet compared to the high Mg2+ diet. Numbers above 1 indicate

enrichment in mice fed with a low Mg2+-diet. Numbers smaller than 1 designate enrichment in mice

fed with a high Mg2+-diet. The P-value shows the statistical significance of the differential expression.

The full lists of 35,000 genes can be accessed at GEO database Ac: GSE40208.


on the microarray (Figure 4A). Likewise, mRNA expression levels were determined for Pcbd1, Tbc1d4 and Umod, since all three genes are potentially involved in Mg2+ handling (Figure 4B-D). Pcbd1 is a regulator of HNF1β function, Tbc1d4 has been shown to modulate Na+-K+-ATPase activity and uromodulin effects transcellular Na+ transport (2, 28, 31). The fold enrichment values for these three genes estimated by RT-PCR correspond to the values obtained by the microarray analysis. Since Umod is mainly described as TAL gene, we further examined uromodulin DCT expression with immunohistological staining and RT-PCR. Interestingly, Umod was 3.5 times more expressed in DCT cells compared to total kidney material (Figure 5A). Uromodulin co-localized with NCC in early DCT cells (Figure 5C). Moreover, only the DCT fraction of Umod expression, but not the total kidney sample mainly containing TAL Umod expression, was shown to be Mg2+-sensitive (Figure 5B). To determine whether the differentially regulated genes belong to the same functional pathways or cellular processes, GO-term enrichment analysis was performed by gene set enrichment analysis (GSEA, Table 5). In the DCT samples from Mg2+-deficient mice EGF

Figure 4 Effects of Dietary Mg2+ Availability on mRNA Transcript Expression of Newly Identified Candidate Genes

A–D, the mRNA expression levels of Slc41a3 (A), Pcbd1 (B), Tbc1d4 (C) and Umod (D) in COPAS-select-

ed DCT tubules of mice fed with a low or high Mg2+-containing diet were measured by quantitative

RT-PCR and normalized for Gapdh expression. Data represent means (n=8) ± SEM and are expressed

fold difference when compared to the expression in the high Mg2+ group. *P < 0.05 indicates significant

difference from the high Mg2+ group.

0

0.5

1.0

1.5

2.0

2.5


Slc4

1a3

mRN

A ex

pres

sion

(fold

cha

nge)

0

0.5

1.0

1.5

2.0

2.5


Pcbd

1 m

RNA

expr

essi

on(fo

ld c

hang

e)

0

0.5

1.0

1.5

2.0

2.5

3.0


Tbc1

d4 m

RNA

expr

essi

on

(fold

cha

nge)

0

0.5

1.0

1.5

2.0

2.5

3.0


Uro

mod

ulin

mRN

A ex

pres

sion

(fold

cha

nge)

*

* *

*

BA

DC

56 | Chapter 2

Figure 5 Expression of Uromodulin in Distal Convoluted Tubules

A, the mRNA expression levels of Umod, in COPAS-selected mouse DCT and control (none-selected)

kidney tubules were measured by quantitative RT-PCR and normalized for Gapdh expression. Data

represent means (n=8) ± SEM and are expressed as fold difference when compared with the expres-

sion in none-selected tubules. *P < 0.05 indicates significant difference from none-selected tubules.

B, the mRNA expression levels of Umod in COPAS-selected DCT tubules and control (none-selected)

kidney tubules of mice fed with a low or high Mg2+-containing diet were measured by quantitative

RT-PCR and normalized for Gapdh expression. Data represent means (n=8) ± SEM and are expressed

fold difference when compared to the expression in the high Mg2+ group. *P < 0.05 indicates sig-

nificant difference from the high Mg2+ group. C. Double immunofluorescence staining of mouse

kidney sections for NCC (in green) and UMOD (in red). Bars represent 20 µm.

TAL: Thick ascending limb of Henle’s loop. DCT: Distal Convoluted Tubule.

C

0

1

2

3

4

5

UM

OD

mRN

A e

xpre

ssio

n(R

elat

ive

to to

tal k

idne

y, fo

ld c

hang

e)

Kidney DCTKidney DCT

0.0

0.5

1.0

1.5

2.0

2.5

UM

OD

mRN

A e

xpre

ssio

n(R

elat

ive

to h

igh

Mg 2

+ d

iet,

fold

cha

nge)

BA

TAL

DCT

NCC

UMOD

Merge 1

2

1

2

* *


Table 5 GO-term Enrichment Analysis of Mg2+-sensitive Expression in the Distal Convoluted Tubule

GO-Term Description P value Mean Difference

GO:0060009 Sertoli cell development 0.0004 -0.26

GO:0061036 positive regulation of cartilage development 0.0002 -0.26

GO:0030238 male sex determination 0.0018 -0.25

GO:0060170 cilium membrane 2.4E-05 -0.25

GO:0002237 response to molecule of bacterial origin 0.0043 -0.23

GO:0001158 enhancer sequence-specific DNA binding 0.0015 -0.22

GO:0030502 negative regulation of bone mineralization 0.0056 -0.21

GO:0016585 chromatin remodeling complex 0.0001 -0.20

GO:0043536 positive regulation of blood vessel endothelial cell migration

0.0065 -0.20

GO:0030903 notochord development 0.0053 -0.20

GO:0007173 epidermal growth factor receptor signaling pathway 0.0011 -0.18

GO:0032331 negative regulation of chondrocyte differentiation 4.2E-07 -0.17

GO:0006107 oxaloacetate metabolic process 0.0059 -0.17

GO:0030279 negative regulation of ossification 0.0001 -0.16

GO:0010634 positive regulation of epithelial cell migration 9.5E-06 -0.15

GO:0045732 positive regulation of protein catabolic process 0.0090 -0.14

GO:0071347 cellular response to interleukin-1 0.0010 -0.13

GO:0016614 oxidoreductase activity, acting on CH-OH group of donors

0.0054 -0.13

GO:0035924 cellular response to vascular endothelial growth factor stimulus

0.0075 -0.11

GO:0005840 ribosome 2.3E-20 0.10

GO:0003735 structural constituent of ribosome 9.4E-20 0.10

GO:0006694 steroid biosynthetic process 0.0001 0.11

GO:0022627 cytosolic small ribosomal subunit 0.0007 0.12

GO:0022900 electron transport chain 7.7E-14 0.14

GO:0005903 brush border 0.0010 0.14

GO:0006637 acyl-CoA metabolic process 0.0032 0.16

GO:0005762 mitochondrial large ribosomal subunit 1.1E-05 0.18

GO:0005747 mitochondrial respiratory chain complex I 2.4E-12 0.20

GO:0070469 respiratory chain 3.7E-19 0.21

GO:0008137 NADH dehydrogenase (ubiquinone) activity 5.3E-10 0.23

GO:0015238 drug transmembrane transporter activity 0.0003 0.23

GO:0015893 drug transport 0.0035 0.24

58 | Chapter 2

signaling was upregulated, as evidenced by the differentially regulated GO-term ‘EGF pathway’. EGF activates a signaling pathway leading to increased TRPM6 plasma membrane expression, hence more Mg2+ reabsorption (44). Interestingly, ‘bone mineralization’ was also among the enriched GO-terms in the mice fed with low Mg2+-diets. Mg2+ plays an important role in this latter process (38). The most evidently enriched functional pathways were observed in the high Mg2+ fed mice. Among the upregulated functions many GO-terms indicating mitochondrial activity were evidenced.

Discussion

In this study, the Mg2+-sensitive transcriptome of the DCT was elucidated. By taking advantage of the COPAS sorting system, we are the first to isolate primary DCT material with high purity for gene expression analysis. As a result of our approach new promising candidate players in renal Mg2+ homeostasis were identified. Among the candidates: i) SLC41A3 has been proposed as a potential Na+/Mg2+ exchanging mechanism; ii) PCBD1 might influence HNF1β activity; iii) TBC1D4 is a possible regulator of ion channel membrane availability; iv) Uromodulin could regulate Mg2+ transport by decreasing the urinary flow rate. We isolated DCT cells from mice kidneys combining the COPAS sorting system with Pv-eGFP mice. Until now, it was difficult to obtain high quality expression profiles of the isolated DCT fraction because of the quantitative limits of the microdissection technique. Therefore, previously reported expression analyses resulted in a gene expression profile of the combined DCT and CNT fraction (33). The COPAS system provides the only high efficiency and high quality alternative for microdissection. The purity of the COPAS-sorted DCT cells was significantly higher then previous reports, as was demonstrated by the impressive fold-enrichments of 200 and 8 for Ncc and Trpm6 (26). The high abundance of mitochondrial genes in our microarray data set further showed sample purity. In kidney,

Table 5 Continued

GO-Term Description P-value Mean Difference

GO:0003954 NADH dehydrogenase activity 0.0004 0.24

GO:0035634 response to stilbenoid 0.0002 0.26

GO:0016651 oxidoreductase activity, acting on NADH or NADPH 6.7E-06 0.28

Shown is a summary of the significantly differentially expressed GO-terms in the Distal Convoluted

Tubule of mice fed with a high or low Mg2+ diets with a minimal difference of 0.1. GO-term

enrichment was determined by gene set enrichment analysis (GSEA) analysis of the microarray

expression data from mRNA specifically isolated from DCT material.


DCT cells contain the highest amount of mitochondria (9). Inevitably, COPAS-sorted DCT cells can contain adjacent TAL and CNT cells. Although the TAL marker Slc12a1, encoding NKCC2, was not significantly enriched compared to total kidney samples, transcripts isolated from COPAS-sorted cells may contain genes expressed in TAL. More importantly, Trpv5 expression was upregulated in COPAS-sorted DCT cells, which can be explained by the gradual transition of DCT1, via DCT2 to CNT region, causing a partial overlap of Pv and Trpv5 expression. Since the aim of our study was to identify Mg2+-sensitive gene transcription, the potential limit of sample purity will not affect the results of the microarray analysis. Altogether, this approach allowed the identification of magnesiotropic DCT genes. Slc41a3 is probably the most interesting candidate among the newly identified Mg2+-sensitive DCT genes. SLC41A3 is part of a family of three putative Mg2+ transporters that were first described by Quamme et al. (34) Using the Xenopus laevis oocyte voltage-clamp model it was shown that all three SLC41 proteins transport Mg2+ within its physiological range, although these findings have never been repeated in mammalian cell models (19, 34). SLC41A3 has never been investigated in detail, but lessons from the other SLC41 family members have learned that it consists of 11 transmembrane domains (24). Recent reports claim that SLC41A1 could act as a Na+/Mg2+ exchanger (20). Likewise, the highly homologous SLC41A3 protein could have a similar function. Since SLC41A1 and SLC41A2 are not differentially regulated in DCT, it seems possible that SLC41A3 is the DCT-specific Mg2+ extrusion mechanism. Further research characterizing the function of SLC41A3 is needed to confirm this hypothesis. Interestingly, the expression of Hnf1b and Fxyd2 were not differentially regulated in this study. Nevertheless, we identified in Pcbd1 a potential modulator of HNF1β/FXYD2 activity. First described in 1991, PCBD1 is a protein with a dual activity (28). PCBD1 can stimulate the HNF1α and HNF1β transcription and has a role in tetrahydrobiopterin regeneration (42). HNF1 transcriptional activation by PCBD1 does not depend on its enzymatic activity (17). Its role in HNF1β activation seems of special interest with respect to the Mg2+ homeostasis. HNF1β is a transcription factor that stimulates FXYD2 expression, encoding the γ-subunit of the Na+-K+-ATPase (11). PCBD1, also known as Dimerization Cofactor of HNF1 (DCOH), stabilizes HNF1 dimer formation necessary for Fxyd2 transcription. Although PCBD1 activation has never been linked to FXYD2 directly, PCBD1 could indirectly stimulate Fxyd2 transcription by enhancing HNF1β function. Given that Pcbd1 is transcriptionally upregulated in Mg2+-deficient conditions and that such regulation is absent for Fxyd2 and Hnf1b, PCBD1 might be the trigger in FXYD2-mediated fine-tuning of Mg2+ reabsorption in DCT. During analyses of the microarray data, another modulator of Na+-K+-ATPase activity caught attention. Tbc1d4, previously known as AS160, was significantly upregulated in the low Mg2+-fed mice. TBC1D4 has been described as Rab-GTPase activating kinase involved in the regulation of Na+-K+-ATPase plasma membrane availability (2). In this ability, it might directly influence the transmembrane potential that is necessary for Mg2+ reabsorption.

60 | Chapter 2

Interestingly, the function of TBC1D4 is not limited to regulation of the Na+-K+-ATPase. Originally described as regulator of GLUT4 glucose transporters, TBC1D4 has recently been linked to the regulation of channels including AQP2 and ENaC (18, 22, 30). Thus, it might be relevant to consider TBC1D4 as a modulator of TRPM6 plasma membrane trafficking. This notion is further supported by the fact that a PI3K/Akt/RAC1-mediated pathway activated upon EGF stimulation regulates TRPM6 plasma membrane abundance and that TBC1D4 is an Akt-substrate that can also be stimulated by EGF (12, 44). GO-term enrichment analysis of our microarray results taught that the EGF pathway was upregulated in the low Mg2+ diet-fed mice. Although previously implicated in renal ion homeostasis, our finding that Umod expression is highly Mg2+-sensitive is unprecedented (31). Uromodulin, also described as Tamm-Horshfall glycoprotein, is the most abundant protein in urine, but its exact function remains to be determined (8). It has been proposed that after excretion in the pro-urine uromodulin forms an anionic gel-like structure that retards the flow of positively charged ions (46). Then, increasing Umod expression would decrease the urinary flow rate and thereby enhance the uptake of cations, such as Mg2+. Although often used as a marker for the TAL, Umod expression has been described to be not exclusively restricted to TAL, but also to be profound in the early DCT (33, 41). Studies using gene expression microarrays of microdissected DCT tubules are inconclusive. Whereas Pradervand and colleagues showed clear enrichment of Umod mRNA expression, other studies detected barely Umod mRNA transcripts in DCT (5, 33). Immunohistological stainings confirmed co-localization of uromodulin with the DCT-marker NCC, although it cannot be excluded that TAL-cleaved uromodulin reached DCT by urinary flow and sticked to the luminal membranes. Interestingly, RT-PCR analysis showed that only DCT expression of Umod was shown to be Mg2+ sensitive, in contrary to Umod expression in total kidney samples. This suggests different functional roles of UMOD in DCT and TAL segments of the kidney. Of all genes that have been linked to hypomagnesemia in human genetic diseases, only a few are transcriptionally regulated (6). Trpm6, Egf and Cnnm2 were modulated, indicating that Mg2+ transport is partially regulated on the transcriptional level. Major regulatory pathways are executed on protein level. The EGF signaling pathway is one of the best-described regulatory mechanisms of TRPM6-mediated Mg2+ transport in DCT (16, 44). Although its mean effectors, such as PI3K, Akt and RAC1, are not transcriptionally affected by alterations in dietary Mg2+ availability, EGF is among the enriched GO-terms. Futhermore, Kcna1 coding for K+ channel Kv1.1 could not be detected in the mouse DCT material by RT-PCR. Kcna1 is part of a larger family of voltage-gated K+ channels that are known to form heteromeric complexes. Although Kv1.1 has been implicated in Mg2+ handling in patients, its function might be compensated for by other K+-channels in the Pv-eGFP mouse model (14). In this context, it is interesting to note that ROMK is 1.7-fold upregulated in the low Mg2+ mice. Although this result does not reach statistical significance (P=0.06), it suggests that ROMK might play a role in the maintenance of the luminal membrane potential necessary for Mg2+ reabsorption in DCT.


Inevitably, although changing only the dietary Mg2+ availability, our approach also led to the detection of many Ca2+ homeostasis-related genes, such as vitamin D receptor, klotho and calbindin-D28K (35). Activation of the calcium-sensing receptor (CaSR) is hypothesized to explain this phenomenon (10). The CaSR is not only sensitive to Ca2+ ions, but is also activated upon Mg2+ binding. As a result, changes in Mg2+ availability activate the Ca2+-regulatory pathways at the local and whole-body level. Hypomagnesemia is, therefore, often associated with a disturbed Ca2+ balance in patients (39, 47). In a similar fashion the dietary Mg2+ availability influenced the Ca2+ homeostasis in our mice, as evidenced by the altered serum and urinary Ca2+ levels in the present and previous studies (15). Therefore, differential gene expression induced by dietary Mg2+ should be analyzed with care. Although serum Ca2+ and Mg2+ measurements showed that the alterations in Mg2+ balance are more profound, it has to be taken into account that differential gene expression might be the effect of Ca2+ alterations. Interlink between Ca2+ and Mg2+ homeostasis was further evidenced in the GO-term analysis of the microarray data. Although analyzing renal samples, bone mineralization was among the enriched GO-terms. This might be explained by the fact that many genes involved in renal mineral homeostasis play similar roles in bone formation (6, 38, 44). In addition, GO-term analysis identified upregulation of mitochondrial genes in mice fed the Mg2+-rich diet. This could be a response to an increased intracellular Mg2+ concentration in these mice. Intracellular Mg2+ is an important ATP-binding factor. Therefore, high Mg2+ concentrations in the cell could result in a low unbound ATP availability. Mitochondrial activation will lead to increased ATP production and thereby compensate for the Mg2+ binding. In conclusion, gene expression microarray analysis on primary DCT cells allowed the identification of ample Mg2+-sensitive genes of the mouse genome. Particularly, Slc41a3, Pcbd1, Tbc1d4 and Umod are candidates that require further investigation. We suggest that patients suffering from hereditary hypomagnesemia of unknown cause are screened for mutations in these candidate genes. The COPAS sorting system provides an excellent mechanism to obtain primary DCT cells. Establishing COPAS-sorted DCT monolayers have been proven to be an accurate method to study thiazide-sensitive Na+ transport (26, 36). By the use of stable Mg2+ isotopes such as 25Mg2+ and 26Mg2+, this primary DCT culture could provide a unique model to examine DCT-specific Mg2+ transport. Furthermore, crossbreeding of Pv-eGFP mice with the available knock out mouse models including TRPM6 and NCC knock out mice, further expands the possibilities of the established procedure. It will in particular further substantiate the physiological importance of the studied target molecule (6, 48).

AcknowledgementsThe authors thank AnneMiete van der Kemp, Judy Lin, Maikel School, Anke Lameris, Ellen van Loon and Fariza Bouallala for their technical support. Furthermore, Dr. Hannah Monyer, University of Heidelberg kindly donated the PV-eGFP mice. The authors are grateful to Drs

62 | Chapter 2

Nicolas Markadieu and Titia Woudenberg-Vrenken for optimizing the COPAS sorting system for PV-eGFP tubule sorting and to Dr. Sjoerd Verkaart for critical reading of the manuscript. This work was supported by grants from the Netherlands Organization for Scientific Research (ZonMw 9120.8026, NWO ALW 818.02.001), a Vici Grant for J. Hoenderop (NWO-ZonMw 016.130.668) and EURenOmics funding from the European Union seventh Framework Programme (FP7/2007-2013, agreement n° 305608).

Methods

Animal StudiesAll the experimental procedures are in compliance with the animal ethics board of the Radboud University Nijmegen. Transgenic C57Bl/6 mice expressing eGFP under the parvalbumin (Pv) promotor were kindly provided by Dr. Hannah Monyer (University of Heidelberg, Germany)(29). Genotype was determined under UV light by checking fluorescent emission of muscular PV expression in the mouse legs. Littermates were housed in a temperature- and light-controlled room with the standard pellet chow (SSNIFF spezialdiäten GmbH, Soest, Germany) and deionized drinking water available ad

libitum until the start of the experiment. Pv-eGFP positive mice were selected for experiments at the age of 4-6 weeks. During the experiments the mice were fed low (0.02 % (w/w)) or high (0.48 % (w/w)) Mg2+-containing diets for 15 days (SSNIFF spezialdiäten GmbH, Soest, Germany). During the last 48 hrs of the experiment the mice were housed in metabolic cages for urine and faeces collection (24 hrs adaptation, 24 hrs sampling). Blood samples were taken at the start of the experiment and just before sacrifice.

Isolation of DCT using COPAS SortingPv-eGFP positive tubules were isolated as described previously (26). In short, mice aged from 4 to 6 weeks were anesthetized and perfused transcardially with ice-cold KREBS buffer (in mmol/L: 145 NaCl, 5 KCl, 1 NaH2PO4, 2.5 CaCl2, 1.8 MgSO4, 10 glucose, 10 HEPES/NaOH pH: 7.4). Directly after perfusion of the mice, the whole kidneys were harvested and GFP-positive kidney material was manually selected under a microscope. This part of the procedure may take up 30-45 min. Subsequently, the kidney fragments were digested in KREBS buffer containing 1 mg/mL collagenase (Worthington, Lakewood, NJ, USA) and 2,000 units/mL hyaluronidase (Sigma, Houten, the Netherlands) for 15 min at 37 °C. Subsequently, the kidney tubules sized between 100 μm and 40 μm were collected by filtration. Oversized material was digested again in two additional cycles of 10 min digestion and filtration. Tubules collected from the three digestions were ice-cooled and sorted by the Complex Object Parametric Analyzer and Sorter (COPAS, Union Biometrica, Holliston, MA, USA) at a rate of 2,000-4,000 tubules / hr. Sorted tubules were directly collected in 1 % (v/v) β-mercaptoethanol containing RLT buffer that was supplied by the


RNeasy RNA extraction kit (Qiagen, Venlo, the Netherlands). In total the sorting procedure of tubules from one mouse takes several hours. Per mouse, 4,000 eGFP-fluorescent tubules were collected and as control an additional 4,000 tubules were sorted from the same kidney sample without selection for eGFP positive cells. This control sample contained both eGFP-positive and eGFP-negative cells of the same size as the selected sample. 4,000 tubules were pooled on a Qiagen Rneasy micro column for RNA extraction according to the manufacturer’s protocol.

Microarray AnalysisFor microarray experiments RNA from two male and two female mice per group was taken. RNA from the low Mg2+ and the high Mg2+ group was matched in pairs based on gender of the mice. Double round RNA amplifications and labeling were performed as described before (37) on an automated system (Caliper Life Sciences NV/SA, Belgium) with 10-50 ng total RNA from each sample. Briefly, total RNA was amplified twice from ~50,000 cells by cDNA synthesis with oligo(dT) double-anchored primers, followed by in vitro

transcription using a T7 RNA polymerase kit (Ambion, Bleiswijk, the Netherlands). During second round of transcription, 5-(3-aminoallyl)-UTP was incorporated into the single stranded cRNA. Cy3 and Cy5 NHS-esters (Amersham Biosciences, Roosendaal, the Netherlands) were coupled to 2 μg cRNA. RNA quality was monitored after each successive step using the equipment described above. Mouse Whole Genome Gene Expression Microarrays V2 (Agilent Technologies, Belgium) representing 39,429 mus musculus 60-mer probes in a 4x44K layout were used for hybridizations with 1 μg of each alternatively labeled cRNA on a HS4800PRO system supplemented with QuadChambers (Tecan Benelux B.V.B.A.) according to van de Peppel et al. (45). Two independent dye-swap hybridizations (4 arrays) were performed for each experimental group. After hybridization the slides were washed extensively and scanned using the Agilent G2565AA DNA Microarray Scanner. After automated data extraction using Imagene 8.0 Software (BioDiscovery), Lowess normalization was performed on mean spot-intensities, followed by dye bias correction based on a within-set estimate as described before (25, 50). Data was analysed using MAANOVA (49). In a fixed effect analysis, sample, array and dye effects were modeled. P-values were determined by a permutation F2-test, in which residuals were shuffled 5,000 times globally. Genes with P < 0.05 after family wise error correction (FWER) were considered significantly changed. Additionally a 2-fold change cutoff was applied. The complete microarray dataset is deposited in Gene expression omnibus (GEO) database (http://www.ncbi.nlm.nih.gov/geo/) under accession number GSE40208. The 8,000 mos t expressed DCT genes are also available via http://helixweb.nih.gov/ESBL/Database/Non_ESBL_datasets/Nijmegen-Webpage/index1.html.

64 | Chapter 2

Mg2+ and Ca2+ AnalysisSerum and urine total Mg2+ and Ca2+ concentrations were determined using a colorimetric assay kit according to the manufacturer’s protocol (Roche Diagnostics, Woerden, the Netherlands). Urine volume was measured to calculate 24 hrs Mg2+ excretion.

Quantitative Real Time PCR The obtained mRNA from 4,000 tubules was reverse transribed using M-MLV reverse transcriptase (Invitrogen, Bleiswijk, the Netherlands) for 1 hr at 37 °C. The cDNA was subsequently used to measure Pv, Ncc, Trpm6, Kcna1, Kcnj10, Egf, Fxyd2, Hnf1b, Cnnm2, Slc41a3, Pcbd1, Tbc1d4 and Umod mRNA levels. Gene expression levels were determined by quantitative real-time PCR on a Bio-Rad analyzer and normalized for Gapdh expression. Primer sequences are provided in Table 6.

ImmunohistochemistryImmunohistochemistry was performed as described previously (13). In short, co-staining for Uromodulin with thiazide-sensitive Na+-Cl- cotransporter (NCC) was performed on 5 µm sections of fixed frozen mouse kidney samples. The sections were incubated for 16 hrs at 4 °C with the following primary antibodies: guinea pig anti-UMOD (1:750, BioTrend, Köln, Germany) and rabbit anti-NCC (1:100 (32)). For detection, kidney sections were incubated with Alexa Fluor-conjugated secondary antibodies. Images were taken with an AxioCam camera and AxioVision software (Zeiss, Sliedrecht, the Netherlands).

Table 6 Primer Sequenced Used for RT-PCR Analysis.

Gene Forward Primer Reverse Primer

Parvalbumin 5’-CGCTGAGGACATCAAGAAGG-3’ 5’-AGCTTTCAGCCACCAGAGTG-3’

Ncc 5’-CTTCGGCCACTGGCATTCTG-3’ 5’-GATGGCAAGGTAGGAGATGG-3’

Trpm6 5’-AAAGCCATGCGAGTTATCAGC-3’ 5’-CTTCACAATGAAAACCTGCCC-3’

Egf 5’-GAGTTGCCCTGACTCTACCG-3’ 5’-CCACCATTGAGGCAGTATCC-3’

Kcna1 5’-CTGTGACAATTGGAGGCAAGATC-3’ 5’-GAGCAACTGAGCCTGCTCTTC-3’

Kcnj10 5’-CCGCGATTTATCAGAGC-3’ 5’-AGATCCTTGAGGTAGAGGAA-3’

Fxyd2 5’-TCAGCCTTTCTTGTGACTGG-3’ 5’-GGTCTTCCTGTGGCCTCTACT-3’

Hnf1b 5’-CATTGCACAGAGCCTCAACACC-3’ 5’-GTTGAGAGAACTGGACGGGCTG-3’

Cnnm2 5’-GGAGGATACGAACGACGTG-3’ 5’-TTGATGTTCTGCCCGTACAC-3’

Slc41a3 5’-TGAAGGGAAACCTGGAAATG-3’ 5’-GGTTGCTGCTGATGATTTTG-3’

Pcbd1 5’-TGGACATGGCCGGCAAGGC-3’ 5’-CCCACAGCCCTCAGGTTTG-3’

Tbc1d4 5’-CTCGAGCCAAGCTGGTAATC-3’ 5’-ACCCGTTCAAAGATGTCAGC-3’

Umod 5’-TGCAGGGTAGATGAAGATTGC-3’ 5’-GGCACTTTCTGAGGGACATC-3’

Gapdh 5’-TAACATCAAATGGGGTGAGG-3’ 5’-GGTTCACACCCATCACAAAC-3’


Statistical AnalysisFor RT-PCR experiments statistical significance was determined using an unpaired Student’s t test. In all experiments, data is expressed as mean ± SEM. Differences with P < 0.05 were regarded as statistically significant.

66 | Chapter 2

References1. Adalat S, Woolf AS, Johnstone KA, Wirsing A, Harries LW, Long DA, Hennekam RC, Ledermann SE,

Rees L, van’t Hoff W, Marks SD, Trompeter RS, Tullus K, Winyard PJ, Cansick J, Mushtaq I, Dhillon HK, Bingham C, Edghill EL, Shroff R, Stanescu H, Ryffel GU, Ellard S, and Bockenhauer D. HNF1B mutations associate with hypomagnesemia and renal magnesium wasting. Journal of the American Society of Nephrology: JASN 20: 1123-1131, 2009.

2. Alves DS, Farr GA, Seo-Mayer P, and Caplan MJ. AS160 associates with the Na+,K+-ATPase and mediates the adenosine monophosphate-stimulated protein kinase-dependent regulation of sodium pump surface expression. Molecular biology of the cell 21: 4400-4408, 2010.

3. Belge H, Gailly P, Schwaller B, Loffing J, Debaix H, Riveira-Munoz E, Beauwens R, Devogelaer JP, Hoenderop JG, Bindels RJ, and Devuyst O. Renal expression of parvalbumin is critical for NaCl handling and response to diuretics. Proceedings of the National Academy of Sciences of the United States of America 104: 14849-14854, 2007.

4. Bockenhauer D, Feather S, Stanescu HC, Bandulik S, Zdebik AA, Reichold M, Tobin J, Lieberer E, Sterner C, Landoure G, Arora R, Sirimanna T, Thompson D, Cross JH, van’t Hoff W, Al Masri O, Tullus K, Yeung S, Anikster Y, Klootwijk E, Hubank M, Dillon MJ, Heitzmann D, Arcos-Burgos M, Knepper MA, Dobbie A, Gahl WA, Warth R, Sheridan E, and Kleta R. Epilepsy, ataxia, sensorineural deafness, tubulopathy, and KCNJ10 mutations. The New England journal of medicine 360: 1960-1970, 2009.

5. Cheval L, Pierrat F, Dossat C, Genete M, Imbert-Teboul M, Duong Van Huyen JP, Poulain J, Wincker P, Weissenbach J, Piquemal D, and Doucet A. Atlas of gene expression in the mouse kidney: new features of glomerular parietal cells. Physiological genomics 43: 161-173, 2011.

6. de Baaij JH, Hoenderop JG, and Bindels RJ. Regulation of magnesium balance: lessons learned from human genetic disease. Clin Kidney J 5: i14-i24, 2012.

7. de Baaij JH, Stuiver M, Meij IC, Lainez S, Kopplin K, Venselaar H, Muller D, Bindels RJ, and Hoenderop JG. Membrane topology and intracellular processing of cyclin M2 (CNNM2). The Journal of biological chemistry 287: 13644-13655, 2012.

8. Devuyst O, Dahan K, and Pirson Y. Tamm-Horsfall protein or uromodulin: new ideas about an old molecule. Nephrology, dialysis, transplantation : official publication of the European Dialysis and Transplant Association - European Renal Association 20: 1290-1294, 2005.

9. Dorup J. Ultrastructure of distal nephron cells in rat renal cortex. Journal of ultrastructure research 92: 101-118, 1985.10. Ferre S, Hoenderop JG, and Bindels RJ. Sensing mechanisms involved in Ca2+ and Mg2+ homeostasis.

Kidney international 82: 1157-1166, 2012.11. Ferre S, Veenstra GJ, Bouwmeester R, Hoenderop JG, and Bindels RJ. HNF-1B specifically regulates the

transcription of the gammaa-subunit of the Na+/K+-ATPase. Biochemical and biophysical research communications 404: 284-290, 2011.

12. Geraghty KM, Chen S, Harthill JE, Ibrahim AF, Toth R, Morrice NA, Vandermoere F, Moorhead GB, Hardie DG, and MacKintosh C. Regulation of multisite phosphorylation and 14-3-3 binding of AS160 in response to IGF-1, EGF, PMA and AICAR. The Biochemical journal 407: 231-241, 2007.

13. Gkika D, Mahieu F, Nilius B, Hoenderop JG, and Bindels RJ. 80K-H as a new Ca2+ sensor regulating the activity of the epithelial Ca2+ channel transient receptor potential cation channel V5 (TRPV5). The Journal of biological chemistry 279: 26351-26357, 2004.

14. Glaudemans B, van der Wijst J, Scola RH, Lorenzoni PJ, Heister A, van der Kemp AW, Knoers NV, Hoenderop JG, and Bindels RJ. A missense mutation in the Kv1.1 voltage-gated potassium channel-encod-ing gene KCNA1 is linked to human autosomal dominant hypomagnesemia. The Journal of clinical investigation 119: 936-942, 2009.




17. Johnen G, and Kaufman S. Studies on the enzymatic and transcriptional activity of the dimerization cofactor for hepatocyte nuclear factor 1. Proceedings of the National Academy of Sciences of the United States of America 94: 13469-13474, 1997.

18. Kim HY, Choi HJ, Lim JS, Park EJ, Jung HJ, Lee YJ, Kim SY, and Kwon TH. Emerging role of Akt substrate protein AS160 in the regulation of AQP2 translocation. American journal of physiology Renal physiology 301: F151-161, 2011.

19. Kolisek M, Launay P, Beck A, Sponder G, Serafini N, Brenkus M, Froschauer EM, Martens H, Fleig A, and Schweigel M. SLC41A1 is a novel mammalian Mg2+ carrier. The Journal of biological chemistry 283: 16235-16247, 2008.

20. Kolisek M, Nestler A, Vormann J, and Schweigel-Rontgen M. Human gene SLC41A1 encodes for the Na+/Mg(2)+ exchanger. American journal of physiology Cell physiology 302: C318-326, 2012.

21. Lameris AL, Monnens LA, Bindels RJ, and Hoenderop JG. Drug-induced alterations in Mg2+ homoeostasis. Clin Sci (Lond) 123: 1-14, 2012.

22. Liang X, Butterworth MB, Peters KW, and Frizzell RA. AS160 modulates aldosterone-stimulated epithelial sodium channel forward trafficking. Molecular biology of the cell 21: 2024-2033, 2010.

23. Limaye CS, Londhey VA, Nadkart MY, and Borges NE. Hypomagnesemia in critically ill medical patients. The Journal of the Association of Physicians of India 59: 19-22, 2011.

24. Mandt T, Song Y, Scharenberg AM, and Sahni J. SLC41A1 Mg(2+) transport is regulated via Mg(2+)- dependent endosomal recycling through its N-terminal cytoplasmic domain. The Biochemical journal 439: 129-139, 2011.

25. Margaritis T, Lijnzaad P, van Leenen D, Bouwmeester D, Kemmeren P, van Hooff SR, and Holstege FC. Adaptable gene-specific dye bias correction for two-channel DNA microarrays. Molecular systems biology 5: 266, 2009.

26. Markadieu N, San-Cristobal P, Nair AV, Verkaart S, Lenssen E, Tudpor K, van Zeeland F, Loffing J, Bindels RJ, and Hoenderop JG. A primary culture of distal convoluted tubules expressing functional thia-zide-sensitive NaCl transport. American journal of physiology Renal physiology 303: F886-892, 2012.

27. Meij IC, Koenderink JB, van Bokhoven H, Assink KF, Groenestege WT, de Pont JJ, Bindels RJ, Monnens LA, van den Heuvel LP, and Knoers NV. Dominant isolated renal magnesium loss is caused by misrouting of the Na(+),K(+)-ATPase gamma-subunit. Nature genetics 26: 265-266, 2000.

28. Mendel DB, Khavari PA, Conley PB, Graves MK, Hansen LP, Admon A, and Crabtree GR. Characterization of a cofactor that regulates dimerization of a mammalian homeodomain protein. Science 254: 1762-1767, 1991.

29. Meyer AH, Katona I, Blatow M, Rozov A, and Monyer H. In vivo labeling of parvalbumin-positive interneurons and analysis of electrical coupling in identified neurons. The Journal of neuroscience : the official journal of the Society for Neuroscience 22: 7055-7064, 2002.

30. Miinea CP, Sano H, Kane S, Sano E, Fukuda M, Peranen J, Lane WS, and Lienhard GE. AS160, the Akt substrate regulating GLUT4 translocation, has a functional Rab GTPase-activating protein domain. The Biochemical journal 391: 87-93, 2005.

31. Mutig K, Kahl T, Saritas T, Godes M, Persson P, Bates J, Raffi H, Rampoldi L, Uchida S, Hille C, Dosche C, Kumar S, Castaneda-Bueno M, Gamba G, and Bachmann S. Activation of the bumetanide-sensitive Na+,K+,2Cl- cotransporter (NKCC2) is facilitated by Tamm-Horsfall protein in a chloride-sensitive manner. The Journal of biological chemistry 286: 30200-30210, 2011.

32. Nijenhuis T, Hoenderop JG, Loffing J, van der Kemp AW, van Os CH, and Bindels RJ. Thiazide-induced hypocalciuria is accompanied by a decreased expression of Ca2+ transport proteins in kidney. Kidney international 64: 555-564, 2003.

33. Pradervand S, Zuber Mercier A, Centeno G, Bonny O, and Firsov D. A comprehensive analysis of gene expression profiles in distal parts of the mouse renal tubule. Pflugers Archiv : European journal of physiology 460: 925-952, 2010.

34. Quamme GA. Molecular identification of ancient and modern mammalian magnesium transporters. American journal of physiology Cell physiology 298: C407-429, 2010.

35. Renkema KY, Nijenhuis T, van der Eerden BC, van der Kemp AW, Weinans H, van Leeuwen JP, Bindels RJ, and Hoenderop JG. Hypervitaminosis D mediates compensatory Ca2+ hyperabsorption in TRPV5 knockout mice. Journal of the American Society of Nephrology : JASN 16: 3188-3195, 2005.

68 | Chapter 2

36. Riveira-Munoz E, Chang Q, Godefroid N, Hoenderop JG, Bindels RJ, Dahan K, and Devuyst O. Tran-scriptional and functional analyses of SLC12A3 mutations: new clues for the pathogenesis of Gitelman syndrome. Journal of the American Society of Nephrology : JASN 18: 1271-1283, 2007.

37. Roepman P, de Koning E, van Leenen D, de Weger RA, Kummer JA, Slootweg PJ, and Holstege FC. Dissection of a metastatic gene expression signature into distinct components. Genome biology 7: R117, 2006.

38. Rude RK, and Gruber HE. Magnesium deficiency and osteoporosis: animal and human observations. The Journal of nutritional biochemistry 15: 710-716, 2004.


40. Sedlacek M, Schoolwerth AC, and Remillard BD. Electrolyte disturbances in the intensive care unit. Seminars in dialysis 19: 496-501, 2006.

41. Sikri KL, Foster CL, MacHugh N, and Marshall RD. Localization of Tamm-Horsfall glycoprotein in the human kidney using immuno-fluorescence and immuno-electron microscopical techniques. Journal of anatomy 132: 597-605, 1981.

42. Sourdive DJ, Transy C, Garbay S, and Yaniv M. The bifunctional DCOH protein binds to HNF1 independently of its 4-alpha-carbinolamine dehydratase activity. Nucleic acids research 25: 1476-1484, 1997.

43. Stuiver M, Lainez S, Will C, Terryn S, Gunzel D, Debaix H, Sommer K, Kopplin K, Thumfart J, Kampik NB, Querfeld U, Willnow TE, Nemec V, Wagner CA, Hoenderop JG, Devuyst O, Knoers NV, Bindels RJ, Meij IC, and Muller D. CNNM2, encoding a basolateral protein required for renal Mg2+ handling, is mutated in dominant hypomagnesemia. American journal of human genetics 88: 333-343, 2011.


45. van de Peppel J, Kemmeren P, van Bakel H, Radonjic M, van Leenen D, and Holstege FC. Monitoring global messenger RNA changes in externally controlled microarray experiments. EMBO reports 4: 387-393, 2003.

46. Vyletal P, Bleyer AJ, and Kmoch S. Uromodulin biology and pathophysiology--an update. Kidney & blood pressure research 33: 456-475, 2010.


48. Woudenberg-Vrenken TE, Sukinta A, van der Kemp AW, Bindels RJ, and Hoenderop JG. Transient receptor potential melastatin 6 knockout mice are lethal whereas heterozygous deletion results in mild hypomagnesemia. Nephron Physiology 117: p11-19, 2011.

49. Wu H, Kerr MK, Cui X, and Churchill GA. MAANOVA: a software package for the analysis of spotted cDNA microarray experiments. In: The analysis of gene expression data: methods and softwareSpringer, 2012, p. 313-342.

50. Yang YH, Dudoit S, Luu P, Lin DM, Peng V, Ngai J, and Speed TP. Normalization for cDNA microarray data: a robust composite method addressing single and multiple slide systematic variation. Nucleic acids research 30: e15, 2002.

72 | Chapter 3

Abstract

Mutations in PCBD1 are causative for transient neonatal hyperphenylalaninemia and pri-mapterinuria (HPABH4D). Until now HPABH4D has been regarded as a transient and benign neonatal syndrome without complications in adulthood. In our study, two adult patients out of three individuals with homozygous mutations in the PCBD1 gene were diagnosed with hypomagnesemia and renal Mg2+ loss. Two patients also developed diabetes with characteristics of maturity onset diabetes of the young (MODY) regardless of the serum Mg2+ levels. Our results suggest that these clinical findings are related to the function of PCBD1 as dimerization cofactor for the transcription factor HNF1B. Mutations in the HNF1B gene have previously been shown to cause renal malformations, hypomagnesemia and MODY. Gene expression studies in combination with immunohistochemical analysis in the kidney showed that PCBD1 is expressed in the distal convoluted tubule (DCT) where Pcbd1 transcript levels are upregulated by a low Mg2+-containing diet. Overexpression in a human kidney cell line demonstrated that wild-type PCBD1 binds HNF1B to co-stimulate the FXYD2-promoter, whose activity is instrumental in Mg2+ reabsorption in DCT. Five out of seven PCBD1 mutations previously reported in HPABH4D patients caused proteolytic instability leading to a reduced FXYD2- promoter activity. Furthermore, HNF1B mutations may disturb the nuclear localisation of PCBD1, since PCBD1 showed an increased cytosolic localization when co-expressed with HNF1B mutants. Overall, our findings establish PCBD1 as an important co-activator of the HNF1B- mediated transcription necessary for fine-tuning of FXYD2 transcription in DCT. Thus, patients with HPABH4D should be monitored for previously unrecognised late complications, such as hypomagnesemia and MODY diabetes.

Keywords: HNF1B, PCBD1/DCOH, HPABH4D, MODY, Diabetes, Tetrahydrobiopterin

PCBD1 and Hypomagnesemia | 73

Introduction

Hypomagnesemia is a common clinical manifestation in patients with mutations in the transcription factor hepatocyte nuclear factor 1 homeobox B (HNF1B, OMIM #189907)(1). Mutations in HNF1B are associated with an autosomal dominant syndrome characterized by renal malformations with or without cysts, liver and genital tract abnormalities, gout, and maturity-onset diabetes of the young type 5 (MODY5; renal cysts and diabetes syndrome, OMIM #137920)(1, 13). Hypomagnesemia (plasma Mg2+ levels <0.7 mmol/L) with hypermagnesuria affects up to 50 % of the HNF1B patients (1, 15). In adult kidney HNF1B is expressed in epithelial cells along all segments of the nephron. The role of HNF1B in renal Mg2+ handling was, however, pinpointed to the distal convoluted tubule (DCT), where the final urinary Mg2+ excretion is determined (1, 18). In DCT, the Na+/K+-ATPase provides the necessary driving force for active Mg2+ reabsorption from the pro-urine into the blood (18). Heterozygous mutations in the FXYD2 gene, encoding the γ-subunit of the Na+/K+-ATPase, result in an autosomal dominant renal hypomagnesemia with hypocalciuria (IDH, OMIM #154020)(29). More recently, functional HNF1B binding sites were identified in the promoter region of FXYD2 suggesting that impaired transcription of FXYD2 by HNF1B results in renal Mg2+ wasting (1, 16). Additional HNF1B target genes in kidney include renal cystic genes (19-21) as well as genes involved in tubular electrolyte transport (23, 24). HNF1B forms heterotetrameric complexes with the protein pterin-4 alpha-carbinolamine dehydratase / dimerization cofactor of hepatocyte nuclear factor 1 alpha (PCBD1 / DCOH, OMIM #126090)(30). PCBD1 is a protein of 12 kDa with two distinct biological functions: transcriptional co-activator of HNF1A-mediated transcription within the nucleus, and pterin- 4α-carbinolamine dehydratase (EC 4.2.1.96) in the cell cytosol (10, 30). The enzymatic activity of PCBD1, together with dihydropteridine reductase, regenerates tetrahydrobiopterin (BH4), which is the cofactor for phenylalanine hydroxylase (PAH) and other aromatic amino acid hydrolases (42). The crystal structure of PCBD1 revealed that the protein forms a tetramer of identical subunits comprising two saddle-like shaped dimers (14, 17). HNF1 binding sites are located at the same surface that mediates interaction of the PCBD1 homodimers, on the opposite side of the catalytic domain (34). PCBD1 knockout mice display hyperphenylalaninemia, predisposition to cataracts and mild glucose-intolerance (4). Homozygous or compound heterozygous PCBD1 mutations in humans are associated with transient neonatal hyper-phenyalaninemia and high urinary levels of primapterin (HPABH4D, or primapterinuria, OMIM #264070)(11, 38, 39). To date there have been no reports of late complications, or possible phenotypic consequences of impaired stimulation of the HNF1 transcription factors. In our study, the occurrence of hypomagnesemia and MODY diabetes was investigated in three patients carrying PCBD1 mutations. We evaluated whether PCBD1 plays a role in renal Mg2+ reabsorption by directly affecting HNF1B-regulated FXYD2 transcription, in order to gain new insight into the molecular basis of the PCBD1-HNF1B interaction.

74 | Chapter 3

Results

Homozygous PCBD1 Mutations Cause Hypomagnesemia and Renal Mg2+ Wasting We diagnosed hypomagnesemia and hypermagnesuria in two patients carrying mutations on both alleles in the PCBD1 gene (Table 1). In patient 1, hypomagnesemia was partially corrected with oral Mg2+ supplements at a dose of 500 mg/day (0.64 mmol/L to 0.76 mmol/L at first measurement, 0.66 mmol/L to 0.69 mmol/L at second measurement, N 0.7-1.1 mmol/L), though at the expense of increased magnesuria (FEMg 4.6 % to 7.8 %, N <4 %). He had non-specific symptoms that might be related to hypomagnesemia including fatigue, muscular pain, weakness and cramps in arms, numbness, difficulty with memory, chest pains, and blurred vision, with some improvement after Mg2+ supplementation. An abdominal ultrasound showed slightly increased echogenicity of both liver and kidney of uncertain cause; renal size was normal, with no cysts present (Figure 1A-B). Renal function was normal (GFR 128 mL/min per 1.73 m2). Laboratory investigations of patient 2 revealed a relatively high 24h urinary Mg2+ excretion (5.25 mmol/24 hrs, N 2-8; Table 1) in the presence of hypomagnesemia (0.65 mmol/L), with no secondary symptoms. Serum and 24h urinary Ca2+ excretion were within the normal range as well as creatinine clearance (126 mL/min, N 89-143). Ultrasound examinations excluded the presence of renal hypoplasia or cysts (Figure 1C). Patient 3 showed borderline serum Mg2+ levels (0.74 mmol/L), but displayed normal urinary Mg2+ excretion (FEMg 2.5 %).

Maturity Onset Diabetes of the Young (MODY) in Two Patients with PCBD1 MutationsIn addition to hypomagnesemia, patient 1 was diagnosed with diabetes. Type 1 autoimmune diabetes was unlikely, since the patient lacked islet-cell antibodies and showed normal serum C-peptide levels (0.69 nmol/L, N 0.3-1.32 nmol/L). Since MODY patients are generally highly sensitive to sulphonylureas (37), he was treated with Gliclazide 80 mg/bid to which he responded well, allowing his previous insulin treatment of 20-30 units/day to be discontinued. Additional extrarenal manifestations in HNF1B disease include liver test abnormalities (6, 7). Liver function tests in patient 1 revealed that the plasma levels of high sensitivity C-reactive protein (hs-CRP) were significantly low at <0.1 mg/L (N <8 mg/L) (Table 2). IgG was slightly low at 5.66 g/L (N 6.94-16.18 g/L), whereas the remaining liver function tests were all within the normal range. Based on his glycosylated haemoglobin levels, we concluded that patient 2 did not develop diabetes (HbA1c 4.95 %, N 4.3-6.1 %; Table 1). Abdominal ultrasound analysis showed that pancreas and liver were normal (Figure 1D-E). Patient 3 was also diagnosed with diabetes of no autoimmune origin due to the absence of islet-cell antibodies. HbA1c levels were 6.5 % (N 4.3-6.1 %) and glucose was 6.4 mmol/L (N 4.4-6.1 mmol/L). MODY type 1, 2 and 3 due to mutations in HNF4A, GCK, and HNF1A, respectively, were excluded by DNA analysis. Presently the patient is not receiving medications nor insulin treatment.


Pcbd1 Expression in DCT is Modulated by Dietary Mg2+ ContentWe examined Pcbd1 mRNA expression levels in a mouse tissue panel using real-time RT-PCR. Highest expression was measured in kidney and liver (Figure 2A). Furthermore, immunohistochemical analysis of mouse pancreas sections revealed that PCBD1 is expressed in pancreatic cells (Figure 2B). Mouse kidney sections were stained for PCBD1 to evaluate whether PCBD1 locates to the sites of renal Mg2+ reabsorption (Figure 2C-G). PCBD1 staining co-localized with NCC in DCT, and in part with Tamm Horsfall and calbindin-D28K expression in the cortical thick ascending limb of Henle’s loop (TAL) and connecting tubule (CNT), respectively. No co-localization of PCBD1 was detected with markers of the proximal tubule (PT) or collecting duct (CD), BCRP and AQP2, respectively. The expression of Pcbd1 in DCT was confirmed in isolated DCT fragments. Pcbd1 expression

was significantly higher in DCT in comparison with whole kidney (Figure 2H). Hnf1b transcript was not enriched in the DCT fraction. Interestingly, Pcbd1 expression in the DCT was significantly upregulated when mice were fed a low Mg2+-containing diet compared to a high Mg2+-containing diet (Figure 2I). Mice on a Mg2+-deficient diet displayed a significantly lower 24hrs Mg2+ excretion (Figure 3B) in response to the hypomagnesemia (1.1 mmol/L versus 2.2 mmol/L, N 1.2-1.5 mmol/L (9), Figure 3A). Differences were not observed in the serum and urinary levels of phenylalanine between the experimental groups (Figure 3C-D).

Figure 1 Abdominal Ultrasound Examination of Patient 1 and 2

In patient 1, size of the right (A) and left (B) kidney with normal with no cysts. Ultrasound analysis of

kidney (C), pancreas (D) and liver (E) in patient 2 showed normal organ morphology.

Patient 2 (BIODEF 329)

Patient 1 (BIODEF 272)

A

C

B

D E

76 | Chapter 3

Table 1 Pertinent Laboratory Investigations for Three Patients with PCBD1 Mutations

Parameter Patient 1(BIODEF 272)

Patient 2(BIODEF 329)

Patient 3(BIODEF 319)

Reference range

Baseline On 500 mg /day Mg2+

Baseline Baseline

Serum indices

Na+ (mmol/L) 141 — 138 139 135-145

K+ (mmol/L) 4.0 — 4.5 4.0 3.5-5.0

Mg2+ (mmol/L) 0.64* 0.76 0.65* 0.74 0.7-1.1

Ca2+ (mmol/L) 2.41 2.55 2.25 2.43 2.20-2.65

Pi (mmol/L) 1.13 1.16 — 1.15 0.8-1.4

Creatinine (mmol/L) 0.069 0.066 0.062 0.056 0.045-0.110

HbA1c (%) 7.2* — 4.95 6.5* 4.3-6.1

Uric acid ((μmol/L) 310 — — — 135-510

Urinary indices

Mg2+ (mmol/L) 6.16 3.96 — 2.6 —

Mg2+ (mmol/24h) — — 5.25 — 2-8

FeMg (%) 6.6* 11.1* — 3.5 <4

Ca2+ (mmol/L) 4.47 3.04 — 2.99 —

Ca2+ (mmol/24h) — — 5.61 — <7.5

FeCa (%) 0.9 1.8 — 0.86 >1

Pi (mmol/L) 40.29 13.61 — 18.2 —

FePi (%) 17 17.6 — — 5-20

Creatinine (mmol/L) 14.29 4.40 — 8.0 —

Creatinine (mmol/24h) — — 14 — 9-18

GFR (mL/min per 1.73 m2) 128 135 — 124 ≥90

CCr (mL/min) — — 126 — 89-143

HbA1c: glycosylated haemoglobin; FEMg: fractional excretion of Mg2+. The FEMg was calculated

using the following formula: FEMg = (UMg x PCr) / [(0.7 x PMg) x UCr x 100]; FeCa: fractional excretion

of Ca2+; FEPi: fractional excretion of phosphate (Pi); GFR: glomerular filtration rate by Modification of

Diet in Renal Disease (MDRD) formula; CCr: creatinine clearance.


PCBD1 Enhances FXYD2 and PKHD1 Promoter Activation by HNF1BIn order to investigate whether the PCBD1 p.Glu26*, p.Arg87Gln, p.Glu96Lys and p.Gln97* mutations can lead to an impairment of the interaction with HNF1B, we generated a structural homology model of the PCBD1–HNF1B dimerization domain (HNF1B-D) complex using the structure of the PCBD1–HNF1A dimerization domain tetramer (Figure 4A and B). The p.Glu26* mutation leads to a major protein truncation and complete loss of the interaction domain with HNF1B (Figure 4B). Although p.Gln97* does not directly affect the HNF1-binding domain of PCBD1, the mutation results in a truncation of the central α-helix of the protein. Consequently, the interaction domain might be destabilized explaining the PCBD1 dysfunction. Similarly, the negatively charged p.Glu96 residue could be important for the stabilization of the interaction domain, which may be hampered by the p.Glu96Lys mutation. To test the effects of the mutations on PCBD1 function, we studied all previously described patient mutations in their ability to co-activate FXYD2 transcription in a luciferase assay (Figure 4C)(11, 38, 39). Expression of wild-type PCBD1 did not change the luciferase activity compared to mock-transfected cells, while HNF1B significantly enhanced the FXYD2 promoter activity (Figure 4D). Interestingly, co-expression of PCBD1 with HNF1B

Table 2 Liver Function Tests in Patient 1 (BIODEF 272)

Parameter Patient 1(BIODEF 272)

Reference range

Albumin (g/L) 41 38-50

Prealbumin (g/L) 0.381 0.1-0.4

hs-CRP (mg/L) <0.1* <8

α-1 antitrypsin (g/L) 1.4 0.9-2.6

C3 (g/L) 1.17 0.8-2.1

C4 (g/L) 0.18 0.15-0.5

IgG (g/L) 5.66* 6.94-16.18

IgM (g/L) 0.75 0.6-3.0

IgA (g/L) 1.99 0.7-4.0

ALT (U/L) 20* 21-72

AST (U/L) 26 15-46

ALP (U/L) 108 30-130

hs-CRP: high-sensitivity C reactive protein; C3: complement component 3; C4: complement component 4;

IgG: immunoglobulin G; IgM: immunoglobulin M; IgA: immunoglobulin A; ALT: alanine transaminase;

AST: aspartate transaminase; ALP: alkaline phosphatase.

* indicates value outside of reference range

78 | Chapter 3

Figure 2 Pcbd1 is Expressed in the DCT of the Kidney

A, Tissue expression pattern of the Pcbd1 transcript. Pcbd1 mRNA expression level was measured in a

panel of mouse tissues by quantitative RT-PCR and normalized for Gapdh expression. Data represent

the mean of three individual experiments ±SEM and are expressed as the percentage of the total

tissue expression. B, Immunohistochemical analysis of PCBD1 in mouse pancreas tissue. Scale bar,

20 µm. C–G, Mouse kidney sections were costained for PCBD1 (green) and (C) BCRP (red), (D) TH (red),

(E) NCC (red), (F) 28K (red), or (G) AQP2 (red). Nuclei are shown by 4’,6-diamidino-2-phenylindole

staining (DAPI, blue). Scale bar, 20 mm. H, Kidney expression pattern of Pcbd1 shows the highest

expression in DCT. The mRNA expression levels of Pcbd1 and Hnf1b in (black bars) COPAS-selected

mouse DCT and (white bars) control (nonselected) kidneys were measured by quantitative RT-PCR

and normalized for Gapdh expression. Data represent the mean of three individual experiments

±SEM and are expressed as fold difference compared with the expression in nonselected tubules.

*P < 0.05 versus total kidney. I, DCT expression of Pcbd1 is regulated by dietary Mg2+ intake. The mRNA

expression levels of Pcbd1 and Hnf1b in COPAS-selected mouse DCT kidney tubules from mice fed

with (white bars) low and (black bars) high Mg2+-containing diets were measured by realtime RT-

PCR and normalized for Gapdh expression. Data represent the mean of four individual experiments

±SEM and are expressed as fold difference compared with the expression in high Mg2+-containing

diets. *P < 0.05 versus high Mg2+.

PCBD1: pterin-4 alpha-carbinolamine dehydratase; AQP2, aquaporin 2; BCRP, breast cancer resistance

protein; TH, Tamm Horsfall; NCC, Na+-Cl--cotransporter; 28K, calbindin-D28K.

20

15

10

5

0

30

35

40

Kidney

Early Duodenum

Late Duodenum

JejunumIle

um

Early Colon

Late ColonCecum

BrainHeart

LungLiver

SpleenTestis

Muscle

25

1.0

0.5

0

1.5

2.0

Rela

tive

mRN

A e

xpre

ssio

n(F

old

of w

hole

kid

ney)

Pcbd1 Hnf1b

*

1.5

0.5

0

2.0

2.5

Rela

tive

mRN

A e

xpre

ssio

n(F

old

of h

igh

Mg2+

)

Pcbd1 Hnf1b

1.0

*

Non-selected tubulesDCT

Low Mg2+

High Mg2+

Pcbd1

Pcbd1

Pcbd1

NCC

28K

Aqp2

Merge

Merge

Merge

Pcbd1 Bcrp Merge

Pcbd1

Pcbd

1 m

RNA

exp

ress

ion

(% o

f tot

al)

Pcbd1 MergeTH

A

C

B


Figure 2 Continued

20

15

10

5

0

30

35

40

Kidney

Early Duodenum

Late Duodenum

JejunumIle

um

Early Colon

Late ColonCecum

BrainHeart

LungLiver

SpleenTestis

Muscle

25

1.0

0.5

0

1.5

2.0

Rela

tive

mRN

A e

xpre

ssio

n(F

old

of w

hole

kid

ney)

Pcbd1 Hnf1b

*

1.5

0.5

0

2.0

2.5

Rela

tive

mRN

A e

xpre

ssio

n(F

old

of h

igh

Mg2+

)

Pcbd1 Hnf1b

1.0

*

Non-selected tubulesDCT

Low Mg2+

High Mg2+

Pcbd1

Pcbd1

Pcbd1

NCC

28K

Aqp2

Merge

Merge

Merge

Pcbd1 Bcrp Merge

Pcbd1

Pcbd

1 m

RNA

exp

ress

ion

(% o

f tot

al)

Pcbd1 MergeTHD

E

F

G

H I

80 | Chapter 3

further increased FXYD2 promoter activation by ±1.5 fold (Figure 4D). Of all PCBD1 mutants, only PCBD1 p.Arg87Gln and p.Cys81Arg maintained their co-activator properties (Figure 4D). The transcription of PKHD1, another established target gene of HNF1B in the kidney (21), was assessed in the presence of PCBD1. PKHD1 promoter activity showed a ~1.5 fold increase expression levels when HNF1B and PCBD1 were co-expressed (Figure 4E). PCBD1 p.Arg87Gln, but not p.Cys81Arg, was the only PCBD1 mutant that retained its co-activator activity (Figure 4E).

Mutations Detected in HPABH4D Patients Cause Protein Degradation of PCBD1To explain why the PCBD1 mutants are not capable of enhancing HNF1B-induced transcription, we examined their subcellular localization and their capacity to bind HNF1B. Immunostaining for PCBD1 in transiently transfected HEK293 cells revealed that wild-type PCBD1 translocates to the nucleus upon co-expression with HNF1B compared to mock

Figure 3 Effect of Dietary Mg2+ on Serum and Urinary Mg2+ and Phenylalanine Levels

C57Bl/6 mice were fed low or high Mg2+-containing diets for 15 days. Before sacrifice, serum and

24 hrs urine samples were collected for Mg2+ (A-B) and phenylalanine (C-D) levels determination.

Results are depicted as mean ±SEM, * P < 0.05 versus low Mg2+ (n=10).

Mag

nesi

um e

xcre

tion

(µm

ol/

24h)

*

H igh Mg 2+Low Mg 2+

60

50

40

30

20

10

0

H igh Mg2 +Low Mg2+

40

30

20

10

0

Phen

ylal

anin

e ex

cret

ion

(nm

ol/

24h)

Seru

m M

agne

sium

(mM

)

*

H igh Mg 2+Low Mg 2+

2.0

1.0

0.5

0

1.5

2.5

Seru

m P

hen

ylal

anin

e (µ

M)

H igh Mg2 +Low Mg2+

80

60

40

20

0

A

C

B

D


Figure 4 PCBD1 Coactivates HNF1B-induced FXYD2 and PKHD1 Promoter Activity

A, Homology model of the PCBD1–HNF1B dimerization domain (HNF1B–D) tetramer modeled using

the structure of the PCBD1–HNF1A dimerization domain (HNF1A–D) complex (Protein Data Bank ID

code 1F93). (Light blue and grey) The PCBD1 dimer binds the (orange and grey) HNF1B dimer through

helix sequences. The HNF1A–D monomer is shown in yellow. Residues in the PCBD1 protein that were

found mutates in patients affected by hyperphenylalaninemia are depicted in red. B, Homology

model of the interaction site within the PCBD1–HNF1B dimerization domain (HNF1A–D) complex.

(Orange) The bound HNF1B monomer forms a helix bundle with the (light blue) PCBD1 monomer.

The HNF1A–D monomer is shown in yellow. The residues that differ between HNF1B–D and HNF1A–D

are visualized in grey. C, Linear representation of the secondary structure elements of the human

PCBD1 protein. Red arrowheads indicate the positions of the patient mutations described in the

literature. Green balls indicate the histidine residues involved in the dehydratase active site (p.His61,

p.His62, and p.His79). D-E, A luciferase assay was performed in HEK293 cells transiently cotransfected

with a (D) firefly luciferase FXYD2 and (E) PKHD1 promoter construct and HNF1B or mock DNA in the

presence of wild-type or mutant PCBD1. A Renilla luciferase construct was cotransfected to correct

for transfection efficiency. Firefly/renilla luciferase ratios were determined as a measure of promoter

activity. Results are depicted as percentage compared with HNF1B-Mock transfected cells. *P < 0.05

versus HNF1B/Mock (n=0).

Mock, mock DNA; WT, wild type; 26, p.Glu26*; 78, p.Thr78lle; 81, p.Cys81Arg; 86, p.Glu86*; 87, Arg87Gln; 96,

p.Glu96Lys; 97, p.Gln97*

10 20 30 40 50 60 70 80 90 100

α1 β1 β2 α2 β3 β4 α3

HNF1Bbinding site

NH2 COOH

p.G

lu26

*

p.Th

r78I

lep.

Cys8

1Arg

p.G

lu86

*p.

Arg

87G

ln

p.G

lu96

Lys

p.G

ln97

*

HNF1B-D

PCBD1

C

N

p.Glu26*

p.Thr78Ilep.Cys81Arg

p.Glu86*p.Arg87Gln

p.Glu96Lysp.Gln97*

N

HNF1B-D

PCBD1

Leu5 Val21

Asn44 Glu58

Gln10

Ser7

Ser14 Ser18

HNF1B

PCBD1

+Mock

+WT

+26

+78

+81

+86

+87

+96

+97

Mock

WTMock

Mock

012345

50

100

150

200

** *

Fold

indu

ctio

n co

mpa

red

to

HN

F1B/

Moc

k (%

)

0

5

10

15

2050

100

150

200

Fold

indu

ctio

n co

mpa

red

toH

NF1

β/M

ock

(%)

HNF1B

PCBD1

+Mock

+WT

+26

+78

+81

+86

+87

+96

+97

Mock

WTMock

Mock

* *

A

C

B

82 | Chapter 3

DNA (Figure 5A). Furthermore, PCBD1 p.Glu26*, p.Glu86*, p.Glu96Lys and p.Gln97* were not expressed, whereas p.Thr78Ile and p.Cys81Arg were detected significantly less than the wild-type protein. PCBD1 p.Arg87Gln was the only mutant showing a comparable expression level to wild-type PCBD1 (Figure 5A). Co-immunoprecipitation studies confirmed that only PCBD1 p.Arg87Gln, p.Thr78Ile and p.Cys81Arg were expressed and able to bind HNF1B (Figure 5B, upper and lower panel). Importantly HNF1B was equally expressed in all conditions (Figure 5B, middle panel). To examine whether mutated PCBD1 proteins are degraded by the proteasomal pathway for misfolded proteins, PCBD1- expressing HEK293 cells were treated for 24hrs with 10 nM of the proteasome inhibitor MG-132. Protein expression was restored for all of the PCBD1 mutants, with the only exception of p.Glu26* (Figure 5C).

HNF1B Mutations Affect the Subcellular Localization of PCBD1

We evaluated five HNF1B mutations (p.Lys156Glu, p.Gln253Pro, p.Arg276Gly, p.His324-Ser325fsdelCA, p.Tyr352fsinsA) for their ability to bind and functionally respond to PCBD1 (Figure 6A)(1, 15). All HNF1B mutants, except HNF1B Δ2-30, bound PCBD1 in co-immuno-precipitation studies in transiently transfected HEK293 cells (Figure 6B, upper panel). PCBD1 and HNF1B were expressed in all conditions tested (Figure 6B, middle and lower

Figure 4 Continued

10 20 30 40 50 60 70 80 90 100

α1 β1 β2 α2 β3 β4 α3

HNF1Bbinding site

NH2 COOH

p.G

lu26

*

p.Th

r78I

lep.

Cys8

1Arg

p.G

lu86

*p.

Arg

87G

ln

p.G

lu96

Lys

p.G

ln97

*

HNF1B-D

PCBD1

C

N

p.Glu26*

p.Thr78Ilep.Cys81Arg

p.Glu86*p.Arg87Gln

p.Glu96Lysp.Gln97*

N

HNF1B-D

PCBD1

Leu5 Val21

Asn44 Glu58

Gln10

Ser7

Ser14 Ser18

HNF1B

PCBD1

+Mock

+WT

+26

+78

+81

+86

+87

+96

+97

Mock

WTMock

Mock

012345

50

100

150

200

** *

Fold

indu

ctio

n co

mpa

red

to

HN

F1B/

Moc

k (%

)

0

5

10

15

2050

100

150

200

Fold

indu

ctio

n co

mpa

red

toH

NF1

β/M

ock

(%)

HNF1B

PCBD1

+Mock

+WT

+26

+78

+81

+86

+87

+96

+97

Mock

WTMock

Mock

* *

D

E


Figure 5 Several PCBD1 Mutations Lead to Protein Degradation HEK293 Cells A, Immunocytochemistry analysis of the subcellular localization of HA-tagged PCDB1 wild type or

HA-tagged PCDB1 mutants when coexpressed in a 1:1 ratio with FLAG-tagged HNF1B or mock DNA in

HEK293 cells. Red signal represents immunodetected HA epitopes. Nuclei stained with 4’,6-diamidino- 2-

phenylindole (DAPI) are shown in blue. Scale bar: 10 µm. Representation immunocytochemical images

are shown. B, HA-tagged PCDB1 wild-type, PCDB1 mutant, or mock DNA were transiently expressed

in HEK293 cells with or without FLAG-tagged HNF1B. Immunoprecipitations on nuclear extracts using

an anti-FLAG antibody were separated by SDS-PAGE, and Western blots were probed with (top) anti-HA

and (middle) anti-FLAG antibodies. (Bottom) HAPCDB1 input (25 %) expression was also included in the

analysis. The immunoblots shown are representative of three independent experiments. C, Western

blot analysis of HA-tagged PCDB1 mutants expressed in HEK293 cells treated with (+) or without (2)

10 nM MG-132 for 24 hrs. A representative immunoblot is shown.

IP, immunoprecipitation; Mock, mock DNA; WB, Western blot;W T, wild-type; 26, p.Glu26*; 78, p.Thr78lle; 81,

p.Cys81Arg; 86, p.Glu86*; 87, Arg87Gln; 96, p.Glu96Lys; 97, p.Gln97*.

MG-132

12

kDa

PCBD126

- +

78

- +

81

- +

86

- +

87

- +

96

- +

97

- +

HA-PCBD1

Flag-HNF1BHA-PCBD1

+ + + + + + + + +M

ockW

T26 78 81 86 87 96 97

kDa

IP: Flag-tagWB: Flag-tag 64

InputWB: HA-tag 12

IP: Flag-tagWB: HA-tag 12

WT + Mock WT + HNF1B 26 + HNF1B

78 + HNF1B 81 + HNF1B 86 + HNF1B

87 + HNF1B 96 + HNF1B 97 + HNF1B

A

B

C

84 | Chapter 3

Figure 6 HNF1B Mutations Result in Cytosolic Localization of PCBD1

A, Linear representation of the human HNF1B protein. Red arrowheads indicate patient mutations

that were tested in this study. B, HA-tagged HNF1B wild-type (WT), HNF1B mutants, or HNF1B lacking

the extracts using an anti-FLAG antibody were separated by SDS-PAGE, and Western blots (WBs)

were probed with (top) anti-HA or (middle) anti-FLAG antibodies. (Lower) HA-HNF1B input (25 %)

expression was also included in the analysis. The immunoblots shown are representative for three

independent experiments. C, A luciferase assay was performed in HEK293 cells expressing a firefly

luciferase FXYD2 promoter construct and each of the HNF1B variants (black bars) with and (white

bars) without PCDB1. Results are depicted as percentage compared with HNF1B/Mock transfected

cells (±SEM). *P < 0.05 compared with the HNF1B/Mock condition (n=9). D, Immunocytochemistry

analysis of FLAG-tagged PCDB1 when coexpressed HNF1B WTs, HNF1B mutants, or mock DNA. Red

signal represents immunodetected FLAG epitopes. Scale bar: 20 µm. The immunocytochemical

images shown are representative for three independent experiments. E, Quantification of the nuclear

versus cytosolic localization of PCDB1 when co-expressed with mock DNA (n=24), HNF1B D1–32

(n=33), WT (n=41), 156 (n=38), 253 (n=35), 276 (n=33), 324_325 (n=37), or 352 (n=36) (mean ±SEM).

*P < 0.05 compared with Mock. #P < 0.05 compared with WT.

WT

∆ 1

-32

156

253

276

324_

325

352

05

10152050

100

150

200

Fold

indu

ctio

n co

mp

ared

toH

NF1

B W

T/ M

ock

(%) *

* *

DNA Binding Transactivation

N C

1 32 88 178 229-235 313 557

D NLS POU

HSPOU

p.Lys15

6Glu

p.Gln253Pro

p.Arg

276Gly

p.His3

24Ser325fsd

elCA

p.Tyr352fsi

nsA

IP: Flag-tagWB: HA-tag

IP: Flag-tagWB: Flag-tag

InputWB: HA-tag

HA-HNF1B

-

WT

+

∆ 1

-32

Flag-PCBD1+ +

WT

+ +

156

+ +

253

+ +

276

+ +

324_325

+ +

352

12

kDa

64

36

64

36

0

1

2

3*

*#

#

PCBD

1 lo

caliz

atio

n(n

ucle

ar/c

ytos

olic

ratio

)

∆ 1

-32

Moc

k

WT

156

253

276

324

_325 352

+ WT + 156PCBD1 PCBD1

+ 253 + 276PCBD1 PCBD1

+ 352+ 324_325PCBD1 PCBD1

+ ∆ 1-32PCBD1 + Mock PCBD1

PCBD1 (-)

PCBD1 (+)

A

C

E

D

B


panel). FXYD2 promoter-luciferase assays showed that only HNF1B p.His324Ser325fsdelCA and p.Tyr352fsinsA, that retained partial transcriptional activity, respond to the co-activation by PCBD1 to the same extent as HNF1B wild-type (±1.5 fold, Figure 6C). Importantly, immuno-cytochemical analysis revealed that co-expression of PCBD1 with the HNF1B mutants p.Gln253Pro and p.His324Ser325fsdelCA causes a predominant cytosolic localization of PCBD1 compared to the nuclear translocation observed upon co-expression with HNF1B wild-type (Figure 6D-E).

Discussion

Mutations in PCBD1 have been shown to cause a transient and benign form of neonatal hyperphenylalaninemia (HPABH4D)(11, 38, 39). Here, we present the first follow-up study of HPABH4D patients reporting the onset of late complications linked to the deficient activity of PCBD1 as transcriptional co-activator of HNF1B. Our results suggest that PCBD1 acts as an important transcriptional regulator of FXYD2 contributing to renal Mg2+ reabsorption in DCT. Our observations are based on the following results: i) hypo-magnesemia with renal Mg2+ wasting was reported in two out of three patients carrying mutations in the PCBD1 gene; ii) two patients were diagnosed with MODY; iii) PCBD1 is present in pancreas and kidney, predominantly in DCT, where its expression is sensitive to dietary Mg2+ content; iv) in vitro data demonstrated that PCBD1 binds HNF1B to co-stimulate the FXYD2-promoter, whose activity contributes to Mg2+ reabsorption in DCT; v) PCBD1 mutations reported in HPABH4D patients caused proteolytic instability leading to degradation via the proteasomal pathway. To our knowledge, we are the first to report that PCBD1 mutations associate with hypomagnesemia due to renal Mg2+ wasting as well as MODY. In kidney, the key sites for Mg2+ reabsorption are TAL and DCT. While defects in the molecular pathway for Mg2+ handling in TAL lead to a concomitant waste of Ca2+, shortcomings in DCT cause hyper-magnesuria associated with hypo- or normocalciuria. Based on the serum Ca2+ levels and urinary Ca2+ excretion values, it is likely that in our patients the DCT is primarily affected. Fluorescence-based sorting of DCT-eGFP tubules using a COPAS apparatus coupled to real-time PCR analysis confirmed an enrichment of Pcbd1 expression in DCT tubules compared to other nephron segments. Pcbd1 expression in DCT was increased in mice fed with a low Mg2+ diet, suggesting that PCBD1 is important for renal Mg2+ reabsorption in

D, dimerization domain; NLS, nuclear localization signal; POUH, atypical POU homeodomain; POUS,

POU-specific domain; IP, immunoprecipitation; Mock, mock DNA; D1–32, HNF1B lacking the dimerization

domain; 156, p.Lys156Glu; 253, p.Gln253Pro; 276, p.Arg276Gly; 324_325, p.His324Ser325fsdelCA; 352,

p.Tyr352fsinsA.

86 | Chapter 3

DCT. Serum and urinary phenylalanine levels were stable in the mice, thus did not modulate PCBD1 expression. Immunohistochemical analysis showed that PCBD1 expression is not limited to DCT, but partially extended to cortical TAL and CNT. Overall, these findings confirm previous immunohistochemical studies showing PCBD1 expression in the cortex of the kidney (33). Since PCBD1 was present in the cytosol of renal cells, we hypothesized that the relative abundance of PCBD1 and HNF1B in the kidney may favor the cytosolic localization. Nevertheless, a nuclear localization of PCBD1 in the kidney could occur according to tissue-specific dynamics of the PCBD1-HNF1B complex. Our results demonstrated that PCBD1 enhances the FXYD2 promoter activation by HNF1B in vitro. The relevance of FXYD2 activity in Mg2+ handling in DCT has been suggested previously, since both patients with FXYD2 mutations and patients carrying HNF1B mutations may present with hypomagnesemia (1, 29). It was demonstrated that HNF1B binds the FXYD2 promoter to specifically regulate the transcription of the γ-subunit of the Na+/K+-ATPase isoform α (1, 16). γα-subunit is mainly expressed in PT and medullary TAL, but also in DCT (Figure 7)(2, 16), where PCBD1 is expressed. To date, the exact molecular mechanism by which the γ-subunit regulates Mg2+ handling in DCT remains elusive (18). In kidney, HNF1B is ubiquitously expressed where it regulates the transcription of several cystic genes, like PKHD1 (20). Mutations in PKHD1 are causative for autosomal recessive polycystic kidney disease (ARPKD, OMIM #263200)(21). Similar to the FXYD2

promoter, a PKHD1 reporter construct showed increased expression levels when HNF1B and PCBD1 were co-transfected in HEK293 cells. However, the renal expression of PKHD1 in vivo is restricted to TAL and CD, where PCBD1 expression is negligible (41). Thus, under physiological conditions, renal PKHD1 gene transcription seems not affected by PCBD1. This finding is supported by the absence of kidney abnormalities in patients with PCBD1 mutations. Further evidence for an impaired HNF1-mediated transcription in HPABH4D patients was provided by the diagnosis of MODY in patients 1 and 3. MODY is a monogenic form of autosomal dominant type II diabetes characterized by age of onset often below 25 years and negative pancreatic autoantibodies. Heterozygous mutations in HNF1B or its homolog HNF1A associate with MODY type 5 and type 3, respectively (26). We demonstrated that PCBD1 is localized in the nuclei of pancreatic cells. Knowing that PCBD1 acts as transcriptional co-activator of both HNF1B and HNF1A, a dysregulation of HNF1B and/or HNF1A is potentially responsible for the MODY diagnosed in patients 1 and 3. Interestingly, the low plasma hs-CRP levels in patient 1 are in line with two recent studies showing lower hs-CRP levels in MODY3 patients than individuals with other forms of diabetes or nondiabetic controls (28, 32). This evidence favors the diagnosis of MODY3-like diabetes in patient 1. Patient 2 was not diagnosed with diabetes, but he will be monitored for later onset. In this study, we showed that the HPABH4D patient mutations reported in literature lead to protein degradation of PCBD1 via the proteasome pathway. Our data together


with previous studies on proteolytic instability for the same mutants in both mammalian and bacterial expression systems support the hypothesis that this degradation process may also occur in HPABH4D patients (22, 38, 39). Considering the inheritance of the disease, HNF1-mediated transcription seems to be sensitive to changes in PCBD1 quantity only when both PCBD1 alleles are affected, suggesting that PCBD1 probably belongs to an ancillary regulatory mechanism to which other HNF1B partners may participate (12). In vitro data in HEK293 cells revealed that PCBD1 p.Arg87Gln was the only mutant showing an expression level comparable to the wild-type protein. Nevertheless, in patient 2 p.Arg87Gln is homozygously present on both alleles with a p.Glu26* mutation that leads to a significant decrease in the cellular content of PCBD1 (39). PCBD1 p.Glu26* degradation could not be rescued by proteasome inhibition, suggesting that its transcript is degraded by mRNA surveillance mechanisms (3, 5). PCBD1 p.Thr78Ile and p.Cys81Arg were significantly less expressed than the wild-type protein. Both mutants showed binding to HNF1B, but only PCBD1 p.Cys81Arg co-activated the FXYD2 promoter. PCBD1 p.Cys81Arg did not co-activate the PKHD1 promoter suggesting insufficient expression to enhance the transcription of PKHD1. In the near future, it would be of interest to screen patients with PCBD1 p.Thr78Ile and p.Cys81Arg mutations for complications related to the HNF1B disease. PCBD1 monomers are small molecules that can passively diffuse from the cytosol into the nucleus (36). It was suggested that, by assembling via the same interface, PCBD1 homotetramer and PCBD1–HNF1 complexes are mutually exclusive (34). In our immuno-cytochemical analysis, the HNF1B mutants p.Gln253Pro and p.His324Ser325fsdelCA significantly stimulated a cytosolic localization of PCBD1 compared to the nuclear PCBD1 localization observed in the presence of wild-type HNF1B. This suggests that HNF1B mutations may disturb the stability of the PCBD1–HNF1 complexes in the nucleus and therefore favour the formation of PCBD1 homotetramers in the cytosol of the cell (1, 15). The reduced nuclear localization of PCBD1 will indirectly result in a decreased co-activation of HNF1B and could contribute to the hypomagnesemia observed in some HNF1B patients. Since the presentation and development of HNF1B disease is diverse, variations

Figure 7 Schematic Diagram of Gene Expression in the Kidney

GPT TAL DCT CNT CD

MarkersBCRP TH NCC 28K AQP2

PCBD1 HNF1B FXYD2

PKHD1HNF1B target genes

88 | Chapter 3

in HNF1B interacting proteins may be responsible for the phenotypic heterogeneity. Screening of HNF1B patients for polymorphisms in PCBD1 should, therefore, be considered. In conclusion, we identified PCBD1 as a new molecular player in renal Mg2+ handling. Our results suggest that PCBD1 regulates the HNF1B-mediated FXYD2 transcription, influencing active renal Mg2+ reabsorption in DCT. So far, HPABH4D due to PCBD1 mutations has been considered a transient, benign condition, primarily related to impaired BH4 regeneration. To date, 23 patients with PCBD1 mutations linked to HPABH4D are listed in the International Database of Tetrahydrobiopterin Deficiencies (BIODEF database, Opladen T, Blau N., http://www.biopku.org/biodef/)(8). Here, we suggest that patients affected by HPABH4D should be monitored for late complications related to the interactions with HNF1 transcription factors, including hypomagnesemia and MODY.

AcknowledgementsThe authors are grateful to the patients for their participation in this study. We appreciate the kind help of N. Blau and B. Thöny in the recruitment of the patients and for providing the PCBD1 antibody. We also thank Lonneke Duijkers and Annelies van Angelen for their excellent technical support. This work was supported by grants from the Netherlands Organization for Scientific Research (ZonMw 9120.8026, NWO ALW 818.02.001), a European Young Investigator award (EURYI) 2006 and Vici Grant (NWO- ZonMw 016.130.668) for J.G.J. Hoenderop and EURenOmics funding from the European Union seventh Framework Programme (FP7/2007-2013, agreement n° 305608).

Patients and Methods

PatientsThe three patients reported in this study were ascertained by contacting authors of papers related to hyperphenylalaninemia, tetrahydrobiopterin-deficient, due to pter-in-4-alpha-carbinolamine dehydratase deficiency (HPABH4D, OMIM #264070)(11, 38, 39). Out of the 23 patients listed in the International Database of Tetrahydrobiopterin Deficiencies (BIODEF database, Opladen T, Blau N., http://www.biopku.org/biodef/)(8), BIODEF 272, BIODEF 329 and BIODEF 319 were assessed by Dr. Ferreira (Canada), Dr. Germann (Germany) and Dr. de Klerk (The Netherlands), respectively. The results are included in this study. Informed consent to participate in this study was obtained and the procedures followed were in accordance with the standards of the medical ethics committee of each participating institution. Patients were not treated with any medication that could affect serum levels of Mg2+ (e.g. diuretics, calcineurin inhibitors, corticosteroids).

Patient 1 (BIODEF 272) was reported in detail previously (38). In summary, he was found to have borderline hyperphenylalaninemia on newborn screening, but this markedly


increased to a peak of 2589 µmol/L at 3.5 weeks. The diagnosis of HPABH4D was suspected because of primapterinuria (7-biopterin), as well as a marked response to BH4. There was no parental consanguinity; molecular analysis confirmed the diagnosis showing that he was homozygous for a c.312C>T (p.Gln97*) mutation in the PCBD1 gene. He was treated with phenylalanine restriction and BH4 until 4 months of age, at which time his phenylalanine levels normalised without further treatment, on a normal diet. Intermittent follow-up into adolescence revealed normal health, growth and cognitive development. He was re-contacted for this study at age of 19 years; at that time it was noticed that he had become an insulin-dependent diabetic about 6 months previously.

Patient 2 (BIODEF 329) Initial neonatal screening had shown hyperphenylalaninemia with high urinary levels of primapterin (7-biopterin)(38, 39). This resolved after daily treatment with BH4. There was parental consanguinity, and molecular studies showed that he was homozygote for two separate mutations in the PCBD1 gene: c.99G>T (p.Glu26*), and 283G>A (p.Arg87Gln). He was followed by paediatricians at the Klinik für Kinder- und Jugendmedizin (Karlsruhe, Germany). Patient 3 (BIODEF 319) is the first child of non-consanguineous parents. A previous sibling of the patient died neonatally, while a younger brother was born healthy. The patient was diagnosed with hyperphenylalaninemia and primapterinuria at the age of one month (39). Molecular analysis revealed compound heterozygous c.309G>A/c.312C>T (p.Glu96Lys/p.Gln97*) mutations in the PCBD1 gene. She needed cofactor BH4 replacement therapy, on a normal diet, to maintain phenylalanine levels within the reference range. At the moment of recruitment for this study, she was 17 years old. At that time she had stopped taking BH4 around a year earlier and had slightly elevated phenylalanine levels 120 μmol/L (N <60 μmol/L). It was also noticed that, just before turning 16 years old, she was diagnosed with diabetes. MODY diabetes type 1, 2 and 3 were excluded by DNA analysis. The patient is presently healthy and developing normally.

Calculation of FEMgThe FEMg was calculated using the following formula: FEMg = (UMg x PCr) / [(0.7 x PMg) x UCr x 100]. U and P refer to the urine and serum concentrations of Mg2+(Mg) and creatinine (Cr). Serum Mg2+ concentration was multiplied by 0.7 since only approximately 70 % of the circulating Mg2+ was unbound by albumin and therefore able to be filtered across the glomerulus.

Animal StudyAll the experimental procedures are in compliance with the animal ethics board of the Radboud University Nijmegen. The transgenic parvalbumin-eGFP mice were a kind gift from Dr. Monyer (University of Heidelberg, Germany)(31). In the Mg2+ diet experiment, the

90 | Chapter 3

mice were fed low (0.02 % (w/w)) or high (0.48 % (w/w)) Mg2+-containing diets for 15 days (SSNIFF spezialdiäten GmbH, Soest, Germany). During the last 48hrs of the experiment the mice were housed in metabolic cages for urine collection (24hrs adaptation, 24hrs sampling). Blood samples were taken at the start of the experiment and just before the sacrifice. Pv-eGFP positive tubules were isolated as described previously (27). In short, mice aged from 4 to 6 weeks were anesthetized and perfused transcardially with ice-cold KREBS buffer (in mmol/L: 145 NaCl, 5 KCl, 1 NaH2PO4, 2.5 CaCl2, 1.8 MgSO4, 10 glucose, 10 HEPES/NaOH pH: 7.4). Kidneys were harvested and digested in KREBS buffer containing 1 mg/mL collagenase (Worthington, Lakewood, NJ, USA) and 2,000 units/mL hyaluronidase (Sigma, Houten, the Netherlands) for three cycles of maximal 15 min each at 37 °C. Subsequently, the kidney tubules sized between 40-100 μm were collected by filtration. Tubules collected from the three digestions were ice-cooled and sorted by the Complex Object Parameric Analyzer and Sorter (COPAS, Union Biometrica, Holliston, MA, USA). Sorted tubules were directly collected in 1 % (v/v) β-mercaptoethanol containing RLT buffer that was supplied by the RNeasy RNA extraction kit (Qiagen, Venlo, the Netherlands). Per mouse, 4,000 eGFP-fluorescent tubules were collected. 4,000 tubules were pooled on a micro column for RNA extraction according to the manufacturer’s protocol. Subsequently, reverse transcription of the RNA by M-MLV reverse transcriptase (Invitrogen) was performed 1 hr at 37 °C. Gene expression levels were determined by quantitative real-time PCR on a BioRad Analyzer and normalized for Gapdh expression levels. Real-time PCR primers (Table 3) were designed using the online computer program NCBI/Primer-BLAST software.

Phenylalanine MeasurementsPhenylalanine in plasma and urine samples was measured by LC-MS/MS by a standardized method, in which the MS was operated in positive mode. For these MS measurements, a Waters Premier triple quadrupole mass spectrometer (tandem MS) interfaced with an electrospray ionization (ESI) source and equipped with an Alliance UPLC (Waters, Etten-Leur, the Netherlands) was used. Briefly, to 10 µL plasma or urine sample, 13C6-labeled phenylalanine was added as an internal control to correct for possible ion-suppression. Samples were deproteinized with methanol, diluted with water and injected on a RP C18 column (Waters Atlantis T3, 3 µm, 2,1 x 100 mm). Samples were eluted in 17.5 % methanol / 0.1 mol/L formic acid. Positively charged [M-H]+ phenylalanine (m/z 166) and 13C6-phenylalanine (m/z172) were selected as parent ions. After collision induced dissociation (CID), the loss of –NH3 and –COOH groups were chosen as quantifier ion (m/z 120 and 126, respectively) and the loss of –NH3 , –COOH and –OH2 groups (m/z 103 and 109, respectively) as qualifier ions. In Multiple Reaction Monitoring (MRM) mode, the transitions m/z 166 120and m/z 166 103 (for phenylalanine) and m/z 172 126 and m/z 172 109 (for 13C6-phenylalanine) were measured. Phenylalanine concentrations were calculated using a calibration curve.


DNA ConstructsHuman HNF1B wild-type and mutants were cloned into the pCINeo HA IRES GFP vector as described previously (16). HNF1B was Flag-tagged at the NH2-terminal by Phusion PCR using NheI and AgeI restriction sites. To obtain a HNF1B lacking the dimerization domain spanning residues 2-30 (Δ2-30), HNF1B was amplified using a Phusion polymerase (Finnzymes, Vantaa, Finland) with specific primers covering from residue p.Glu31. The HNF1B-Δ2-30 was ligated into pCINeo IRES GFP using AscI/AgeI restriction sites. The open reading frame of human PCBD1 was amplified using Phusion polymerase from PCBD1 pCMV-SPORT6 (Genbank BC006324, ImaGenes) and subcloned into the pCINeo HA IRES GFP vector using AgeI/EcoRI restriction sites. Wild-type PCBD1 was Flag-tagged at the NH2-terminal by PCR using NheI/XhoI restriction sites. PCBD1 mutations were inserted in the construct using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) according to the manufacturer’s protocol. The luciferase reporter plasmid containing the FXYD2 promoter linked to the coding region of firefly luciferase was produced as previously described (16). Briefly, the human FXYD2 promoter region that controls transcription of the γ-subunit isoform alpha (-3229/+91 bp from the transcription start site) was amplified from genomic DNA using Phusion polymerase (Finnzymes, Vantaa, Finland), and cloned into pGL3-Basic (Promega) using KpnI/BglII restriction sites. The human PKHD1 promoter region extending from exon 1 to 1.5 kb upstream to the transcription start site was amplified from genomic DNA and cloned into pGL3-Basic using KpnI/HindIII sites. The pRL-CMV vector encoding Renilla luciferase under control of a CMV promoter was commercially available (Promega, Fitchburg, USA). All constructs were verified by sequence analysis.

Cell Culture

Human Embryonic Kidney cells (HEK293) were grown in DMEM (Bio Whittaker-Europe, Verviers, Belgium) containing 10 % (v/v) FCS (Thermo Fisher HyClone), 10 μL/mL non - essential amino acids and 2 mmol/L L-glutamine at 37 °C in a humidity-controlled incubator with 5 % (v/v) CO2. The cells were transiently transfected with the respective

Table 3 Primer sequences used for real-time PCR analysis

Gene product

Forward Reverse

Pcbd1 5’-TGGACATGGCCGGCAAGGC-3’ 5’-CCCACAGCCCTCAGGTTTG-3’

Hnf1b 5’-CAAGATGTCAGGAGTGCGCTAC-3’ 5’-CTGGTCACCATGGCACTGTTAC-3’


Pcbd1: pterin-4-alpha-carbinolamine dehydratase; Hnf1b: hepatocyte nuclear factor 1b; Gapdh:

glyceraldehyde 3-phospgate dehydrogenase

92 | Chapter 3

constructs using polyethylenimine cationic polymer (PEI, Polysciences Inc.) at 1:6 DNA:PEI ratio for 48 hrs unless otherwise stated.

Western BlottingHEK293 cells were transfected for 24 hrs with HA-PCBD1 mutants and treated at the same time with 10 mmol/L MG-132 (Company). Protein lysates were denatured in Laemmli containing 100 mmol/L DTT for 30 min at 37 °C and subsequently subjected to SDS-PAGE. Then, immunoblots were incubated with a mouse anti-HA (Roche, high affinity 3F10, 1:5,000) primary antibody and peroxidase conjugated sheep anti-mouse secondary antibodies (Jackson Immunoresearch, 1:10,000).

ImmunocytochemistryHEK293 cells were seeded in 12-well plates on glass cover slips and co-transfected with 400 ng PCBD1 constructs and 400 ng HNF1B constructs or empty pCINeo IRES GFP vector (mock DNA). After 48 hrs, HEK293 cells were fixed with 4 % (w/v) paraformaldehyde (PFA) for 30 min at 4 °C, followed by the subsequent steps at room temperature: permeabilization for 15 min with 0.3 % (v/v) Triton X-100 in PBS, incubation for 15 min with 50 mmol/L NH4Cl, and finally incubation in blocking buffer (16 % (v/v) goat serum, 0.3 % (v/v) Triton X-100 and 0.3 mol/L NaCl in PBS). After incubation overnight at 4 °C with a rabbit anti-Flag M2 (Sigma F7425, 1:100) or a mouse anti-HA (Cell signaling technology, 6E2, 1:100), cells were washed three times with Tris-buffered NaCl Tween-20 (TNT; 150 mmol/L NaCl, 0.1 mol/L Tris/HCl, pH 7.5, 0.05 % (v/v) Tween-20) and subsequently incubated with a secondary goat anti-rabbit antibody (Sigma A4914, 1:300) or a sheep anti-mouse (Jackson Immunoresearch, 1:300), coupled to AlexaFluor 594, for 45 min at room temperature. After incubation with 4’,6-diamidino-2-phenylindole (DAPI) for 30 min at room temperature, cells were washed three times with TNT and finally mount with Fluoromount-G (SouthernBiotech). Photographs were taken using a Zeiss Axio Imager 1 microscope (Oberkochen, Germany) equipped with a HXP120 Kubler Codix fluorescence lamp and a Zeiss Axiocam MRm digital camera. Images were analysed by use of the software ImageJ (35).

ImmunohistochemistryStaining was performed on 5 μm sections of periodate-lysine-paraformaldehyde (PLP) fixed frozen mouse kidney or pancreas samples. Subsequently, sections were washed three times with TN buffer (0.15 mol/L NaCl, 0.1 mol/L Tris/HCl, pH 7.6). Antigen retrieval was done with 10 mmol/L sodium citrate pH 6.0 and non-specific binding was blocked by incubation in blocking buffer for 1 hr. Sections were stained overnight at 4 °C with a polyclonal rabbit anti-PCBD1 antibody (F3862, 1:5000, kind gift by Prof. Thöny)(33). The following day, sections were washed and incubated with a goat anti-rabbit secondary antibody coupled to Alexa Fluor 488 (1:300; Invitrogen, A11008) for 1 hr at room temperature. Kidney sections were costained for the breast cancer resistance protein (BCRP), Tamm


Horsfall (TH), Na+/Cl- cotransporter (NCC), calbindin-D28k (D28K) or aquaporin-2 (AQP2). Briefly, sections were washed and incubated for 2 hrs at room temperature with rat anti-BCRP (Clone BXP-9, Kamya Biomedical Company MC-980, 1:200), sheep anti-TH (AbD serotec 8595-0054, 1:1500), guinea-pig anti-NCC (1:50, kind gift by Prof. Jan Loffing), mouse anti-28K (1:1500, Sigma C-9848) or guinea-pig anti-AQP2 (1:1000, kind gift by Prof. Peter Deen). Secondary antibodies were coupled with Alexa Fluor 495 (1:300; Invitrogen) and incubated for 45 min at room temperature. Subsequently, sections were washed, incubated for 10 min with DAPI and mounted with Mowiol. Photographs were taken using a Zeiss Axio Imager 1 microscope (Oberkochen, Germany) equipped with a HXP120 Kubler Codix fluorescence lamp and a Zeiss Axiocam MRm digital camera.

Co-ImmunoprecipitationHEK293 cells were seeded on 55 mm petri dishes and co-transfected with 5 μg PCBD1 constructs and 5 μg of HNF1B constructs or a empty pCINeo IRES GFP vector (mock DNA). 48hrs after transfection, nuclear and cytosolic fractions were prepared using the NE-PER Nuclear Protein Extraction Kit (Pierce). The next incubation steps were all done under rotary agitation at 4 °C. 35 μL of protein A-agarose beads (Santa Cruz Biotechnology) were previously incubated overnight at 4 °C with 2.5 μg rabbit anti-Flag antibody (Sigma F7425) and washed with IPP500 (500 mmol/L NaCl, 10 mmol/L Tris/HCl pH 8.0, 0.1 % (v/v) NP-40, 0.1 % (v/v) Tween-20, 0.1 % (w/v) BSA and protein inhibitors) four times. After sampling 60 μL as input control, the remaining 180 μL of the lysate samples was added to the antibody-beads mixture overnight at 4 °C. Then, the beads were collected by centrifugation at 2000 rpm for 2 min at 4 °C and washed four times with lysis buffer. The proteins were separated from the beads by incubation for 30 min at 37 °C in 1x Laemmli sample buffer supplemented with 100 mmol/L DTT and detected by immunoblotting using a mouse anti-HA (Roche, high affinity 3F10, 1:5,000) or a mouse anti-Flag M2 (Sigma F3165, 1:5,000) primary antibodies, and peroxidase conjugated sheep anti-mouse secondary antibodies (Jackson Immunoresearch, 1:10,000).

Luciferase Reporter AssayHEK293 cells were seeded on 12-well plates and transfected with the following DNA amounts: 700 ng of the FXYD2 promoter-luciferase construct, 50 ng PCBD1 constructs, 50 ng HNF1B constructs or empty pCINeo IRES GFP vector (mock DNA). To correct for transfection efficiency, 10 ng of pRL-CMV was used as a reference. Firefly and Renilla luciferase activities were measured by use of a Dual-Luciferase Reporter Assay (Promega) 48hrs after transfection.

Homology ModellingA homology model was built using the modelling script in the WHAT IF & YASARA Twinset with standard parameters (25, 40). The structure of the PCBD1 dimer in complex with the

94 | Chapter 3

HNF1A dimerization domain dimer was used as a template for modelling of HNF1B (PDB file: 1f93). Our model contains only the dimerization domain (31 amino acids) of HNF1B and this has 68 % sequence identity with the dimerization domain of HNF1A.

Statistical AnalysisAll results are depicted as mean ± standard error of the mean (SEM). Statistical analyses were conducted by unpaired student’s t-test when comparing two experimental conditions, and one-way ANOVA with Bonferroni test when comparing more conditions, P values less than 0.05 were considered significant.


References1. Adalat S, Woolf AS, Johnstone KA, Wirsing A, Harries LW, Long DA, Hennekam RC, Ledermann SE,

Rees L, van’t Hoff W, Marks SD, Trompeter RS, Tullus K, Winyard PJ, Cansick J, Mushtaq I, Dhillon HK, Bingham C, Edghill EL, Shroff R, Stanescu H, Ryffel GU, Ellard S, and Bockenhauer D. HNF1B mutations associate with hypomagnesemia and renal magnesium wasting. J Am Soc Nephrol 20: 1123-1131, 2009.

2. Arystarkhova E, Wetzel RK, and Sweadner KJ. Distribution and oligomeric association of splice forms of Na(+)-K(+)-ATPase regulatory gamma-subunit in rat kidney. Am J Physiol Renal Physiol 282: F393-407, 2002.

3. Baker KE, and Parker R. Nonsense-mediated mRNA decay: terminating erroneous gene expression. Curr Opin Cell Biol 16: 293-299, 2004.

4. Bayle JH, Randazzo F, Johnen G, Kaufman S, Nagy A, Rossant J, and Crabtree GR. Hyperphenylalaninemia and impaired glucose tolerance in mice lacking the bifunctional DCoH gene. J Biol Chem 277: 28884-28891, 2002.

5. Behm-Ansmant I, and Izaurralde E. Quality control of gene expression: a stepwise assembly pathway for the surveillance complex that triggers nonsense-mediated mRNA decay. Genes Dev 20: 391-398, 2006.

6. Bellanne-Chantelot C, Chauveau D, Gautier JF, Dubois-Laforgue D, Clauin S, Beaufils S, Wilhelm JM, Boitard C, Noel LH, Velho G, and Timsit J. Clinical spectrum associated with hepatocyte nuclear factor-1beta mutations. Ann Intern Med 140: 510-517, 2004.

7. Bingham C, and Hattersley AT. Renal cysts and diabetes syndrome resulting from mutations in hepatocyte nuclear factor-1beta. Nephrol Dial Transplant 19: 2703-2708, 2004.

8. Blau N, Barnes I, and Dhondt JL. International database of tetrahydrobiopterin deficiencies. J Inherit Metab Dis 19: 8-14, 1996.

9. Chollet D, Franken P, Raffin Y, Malafosse A, Widmer J, and Tafti M. Blood and brain magnesium in inbred mice and their correlation with sleep quality. American journal of physiology Regulatory, integrative and comparative physiology 279: R2173-2178, 2000.

10. Citron BA, Davis MD, Milstien S, Gutierrez J, Mendel DB, Crabtree GR, and Kaufman S. Identity of 4a-carbinolamine dehydratase, a component of the phenylalanine hydroxylation system, and DCoH, a transregulator of homeodomain proteins. Proc Natl Acad Sci USA 89: 11891-11894, 1992.

11. Citron BA, Kaufman S, Milstien S, Naylor EW, Greene CL, and Davis MD. Mutation in the 4a-carbinol-amine dehydratase gene leads to mild hyperphenylalaninemia with defective cofactor metabolism. Am J Hum Genet 53: 768-774, 1993.

12. Dudziak K, Mottalebi N, Senkel S, Edghill EL, Rosengarten S, Roose M, Bingham C, Ellard S, and Ryffel GU. Transcription factor HNF1beta and novel partners affect nephrogenesis. Kidney Int 74: 210-217, 2008.

13. Edghill EL, Bingham C, Ellard S, and Hattersley AT. Mutations in hepatocyte nuclear factor-1beta and their related phenotypes. J Med Genet 43: 84-90, 2006.

14. Endrizzi JA, Cronk JD, Wang W, Crabtree GR, and Alber T. Crystal structure of DCoH, a bifunctional, pro-tein-binding transcriptional coactivator. Science 268: 556-559, 1995.

15. Faguer S, Decramer S, Chassaing N, Bellanne-Chantelot C, Calvas P, Beaufils S, Bessenay L, Lengele JP, Dahan K, Ronco P, Devuyst O, and Chauveau D. Diagnosis, management, and prognosis of HNF1B nephropathy in adulthood. Kidney Int 80: 768-776, 2011.

16. Ferre S, Veenstra GJ, Bouwmeester R, Hoenderop JG, and Bindels RJ. HNF-1B specifically regulates the transcription of the gammaa-subunit of the Na+/K+-ATPase. Biochem Biophys Res Commun 404: 284-290, 2011.

17. Ficner R, Sauer UH, Stier G, and Suck D. Three-dimensional structure of the bifunctional protein PCD/DCoH, a cytoplasmic enzyme interacting with transcription factor HNF1. EMBO J 14: 2034-2042, 1995.

18. Glaudemans B, Knoers NV, Hoenderop JG, and Bindels RJ. New molecular players facilitating Mg(2+) reabsorption in the distal convoluted tubule. Kidney Int 77: 17-22, 2010.

19. Gong Y, Ma Z, Patel V, Fischer E, Hiesberger T, Pontoglio M, and Igarashi P. HNF-1beta regulates transcription of the PKD modifier gene Kif12. J Am Soc Nephrol 20: 41-47, 2009.

20. Gresh L, Fischer E, Reimann A, Tanguy M, Garbay S, Shao X, Hiesberger T, Fiette L, Igarashi P, Yaniv M, and Pontoglio M. A transcriptional network in polycystic kidney disease. EMBO J 23: 1657-1668, 2004.

21. Hiesberger T, Bai Y, Shao X, McNally BT, Sinclair AM, Tian X, Somlo S, and Igarashi P. Mutation of hepatocyte nuclear factor-1beta inhibits Pkhd1 gene expression and produces renal cysts in mice. J Clin Invest 113: 814-825, 2004.

96 | Chapter 3

22. Johnen G, Kowlessur D, Citron BA, and Kaufman S. Characterization of the wild-type form of 4a-carbinol-amine dehydratase and two naturally occurring mutants associated with hyperphenylalaninemia. Proc Natl Acad Sci USA 92: 12384-12388, 1995.

23. Kikuchi R, Kusuhara H, Hattori N, Kim I, Shiota K, Gonzalez FJ, and Sugiyama Y. Regulation of tissue-spe-cific expression of the human and mouse urate transporter 1 gene by hepatocyte nuclear factor 1 alpha/beta and DNA methylation. Mol Pharmacol 72: 1619-1625, 2007.

24. Kikuchi R, Kusuhara H, Hattori N, Shiota K, Kim I, Gonzalez FJ, and Sugiyama Y. Regulation of the expression of human organic anion transporter 3 by hepatocyte nuclear factor 1alpha/beta and DNA methylation. Mol Pharmacol 70: 887-896, 2006.

25. Krieger E, Koraimann G, and Vriend G. Increasing the precision of comparative models with YASARA NOVA--a self-parameterizing force field. Proteins 47: 393-402, 2002.

26. Maestro MA, Cardalda C, Boj SF, Luco RF, Servitja JM, and Ferrer J. Distinct roles of HNF1beta, HNF1alpha, and HNF4alpha in regulating pancreas development, beta-cell function and growth. Endocr Dev 12: 33-45, 2007.

27. Markadieu N, San-Cristobal P, Nair AV, Verkaart S, Lenssen E, Tudpor K, van Zeeland F, Loffing J, Bindels RJ, and Hoenderop JG. A primary culture of distal convoluted tubules expressing functional thia-zide-sensitive NaCl transport. Am J Physiol Renal Physiol 303: F886-892, 2012.

28. McDonald TJ, Shields BM, Lawry J, Owen KR, Gloyn AL, Ellard S, and Hattersley AT. High-sensitivity CRP discriminates HNF1A-MODY from other subtypes of diabetes. Diabetes Care 34: 1860-1862, 2011.

29. Meij IC, Koenderink JB, van Bokhoven H, Assink KF, Groenestege WT, de Pont JJ, Bindels RJ, Monnens LA, van den Heuvel LP, and Knoers NV. Dominant isolated renal magnesium loss is caused by misrouting of the Na(+),K(+)-ATPase gamma-subunit. Nat Genet 26: 265-266, 2000.

30. Mendel DB, Khavari PA, Conley PB, Graves MK, Hansen LP, Admon A, and Crabtree GR. Characterization of a cofactor that regulates dimerization of a mammalian homeodomain protein. Science 254: 1762-1767, 1991.

31. Meyer AH, Katona I, Blatow M, Rozov A, and Monyer H. In vivo labeling of parvalbumin-positive interneurons and analysis of electrical coupling in identified neurons. J Neurosci 22: 7055-7064, 2002.

32. Owen KR, Thanabalasingham G, James TJ, Karpe F, Farmer AJ, McCarthy MI, and Gloyn AL. Assessment of high-sensitivity C-reactive protein levels as diagnostic discriminator of maturity-onset diabetes of the young due to HNF1A mutations. Diabetes Care 33: 1919-1924, 2010.

33. Resibois A, Cuvelier L, Svoboda M, Heizmann CW, and Thony B. Immunohistochemical localisation of pterin-4alpha-carbinolamine dehydratase in rat peripheral organs. Histochem Cell Biol 111: 381-390, 1999.

34. Rose RB, Bayle JH, Endrizzi JA, Cronk JD, Crabtree GR, and Alber T. Structural basis of dimerization, coactivator recognition and MODY3 mutations in HNF-1alpha. Nat Struct Biol 7: 744-748, 2000.

35. Schneider CA, Rasband WS, and Eliceiri KW. NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9: 671-675, 2012.

36. Sourdive DJ, Transy C, Garbay S, and Yaniv M. The bifunctional DCOH protein binds to HNF1 independently of its 4-alpha-carbinolamine dehydratase activity. Nucleic Acids Res 25: 1476-1484, 1997.

37. Thanabalasingham G, and Owen KR. Diagnosis and management of maturity onset diabetes of the young (MODY). BMJ 343: d6044, 2011.

38. Thöny B, Neuheiser F, Kierat L, Blaskovics M, Arn PH, Ferreira P, Rebrin I, Ayling J, and Blau N. Hyper-phenylalaninemia with high levels of 7-biopterin is associated with mutations in the PCBD gene encoding the bifunctional protein pterin-4a-carbinolamine dehydratase and transcriptional coactivator (DCoH). The American Journal of Human Genetics 62: 1302-1311, 1998.

39. Thony B, Neuheiser F, Kierat L, Rolland MO, Guibaud P, Schluter T, Germann R, Heidenreich RA, Duran M, de Klerk JB, Ayling JE, and Blau N. Mutations in the pterin-4alpha-carbinolamine dehydratase (PCBD) gene cause a benign form of hyperphenylalaninemia. Hum Genet 103: 162-167, 1998.

40. Vriend G. WHAT IF: a molecular modeling and drug design program. Journal of molecular graphics 8: 52-56, 29, 1990.

41. Ward CJ, Yuan D, Masyuk TV, Wang X, Punyashthiti R, Whelan S, Bacallao R, Torra R, LaRusso NF, Torres VE, and Harris PC. Cellular and subcellular localization of the ARPKD protein; fibrocystin is expressed on primary cilia. Hum Mol Genet 12: 2703-2710, 2003.

42. Werner ER, Blau N, and Thony B. Tetrahydrobiopterin: biochemistry and pathophysiology. Biochem J 438: 397-414, 2011.

100 | Chapter 4

Abstract

Magnesium (Mg2+) is an essential ion for cell growth, neuroplasticity and muscle contraction. Blood Mg2+ levels below 0.7 mmol/L may cause a heterogenous clinical phenotype, including muscle cramps and epilepsy and disturbances in K+ and Ca2+ homeostasis. Over the last decade, the genetic origin of several familial forms of hypomagnesemia has been found. In 2000, mutations in FXYD2, encoding the γ-subunit of the Na+-K+-ATPase, were identified to cause isolated dominant hypomagnesemia (IDH) in a large Dutch family suffering from hypomagnesemia, hypocalcuria and chondrocalcinosis. However, no additional patients were identified since then. Here, we report a p.Gly41Arg FXYD2 mutation in two families with hypomagnesemia and hypocalciuria. Interestingly, this is the same mutation as was described in the original study. Therefore, the patients were clinically and genetically characterized. As in the initial family, several patients suffered from muscle cramps, chondrocalcinosis and epilepsy. Haplotype analysis revealed an overlapping haplotype in all families, suggesting a founder effect. In conclusion, the recurrent p.Gly41Arg FXYD2 mutation in two new families with isolated dominant hypomagnesemia confirms that FXYD2 mutation causes hypomagnesemia. Until now, no other FXYD2 mutations have been reported which could indicate that other FXYD2 mutations will not cause hypomagnesemia.

Keywords: Na+-K+-ATPase, Magnesium, Kidney, Distal Convoluted Tubule

FXYD2 Mutation Causes Hypomagnesemia | 101

Introduction

Hypomagnesemia is a common electrolyte imbalance resulting in muscle cramps, muscle weakness and cardiac arrhytmias (11). The use of certain types of drugs including calcineurin inhibitors, proton-pump inhibitors and diuretics may cause low serum magnesium (Mg2+) levels (10). In a small percentage of patients the Mg2+ disturbance is of genetic origin (5). Hypomagnesemia-causing mutations often affect Mg2+ transport processes operating in the renal distal convoluted tubule (DCT). The final urinary Mg2+ excretion is determined in the DCT, since Mg2+ reabsorption does not take place beyond that nephron segment (5). As a consequence, patients with reduced Mg2+ uptake in DCT have renal Mg2+ wasting. In 2000, we identified a c.115G>A (p.Gly41Arg) mutation in the FXYD domain containing

ion transport regulator 2 gene (FXYD2) causative for isolated dominant hypomagnesemia (IDH, OMIM #154020) in a large Dutch family (12-14). Although originally described as two families, haplotype analysis revealed a 10.5 cM overlapping region suggesting a founder effect (14). Patients in this family had normal urinary Mg2+ values, but showed lowered urinary Ca2+ excretion and suffered from episodes of convulsions (8). Some patients developed symptoms of chondrocalcinosis, related to chronic hypomagnesemia (16). FXYD2 encodes the γ–subunit of the Na+-K+-ATPase and is involved in stabilization of the α-subunit of that complex (15). Moreover, the γ–subunit decreases the affinity of the Na+-K+-ATPase for Na+ and K+ and increases the affinity for ATP (2). The p.Gly41Arg mutation causes a trafficking defect preventing the γ–subunit to reach the basolateral membrane (4, 13). In the kidney, three splice variants of FXYD2 are expressed. FXYD2a is expressed strongly in the thick ascending limb (TAL) and proximal tubule and only discretely in DCT (3). In contrast, FXYD2b expression is restricted to the basolateral membrane of the DCT and connecting tubule (CNT). Additionally, HNF1β can activate FXYD2a transcription and mutations in the HNF1β transcription factor gene (HNF1B) cause hypomagnesemia (1, 6, 7). Given that each FXYD2 splice variant differentially modifies Na+-K+-ATPase activity, it has been hypothesized that the ratio between FXYD2a and FXYD2b expression may determine Na+-K+-ATPase activity. However, the mechanism by which changes in basolateral FXYD2 expression affects renal Mg2+ reabsorption remains to be elucidated. Since the report of the original family in 2000, new families with FXYD2 mutations have not been described. As a result the relevance of FXYD2 mutations for hypomagnesemia has been questioned over the years. For the first time since the initial report, we now present two new families harboring the same p.Glu41Arg mutation in FXYD2. To provide further insight into the role of this mutation in hypomagnesemia, full molecular and genealogical analyses were performed. Furthermore, we aimed to increase the current phenotypic knowledge and describe the clinical presentations and treatment of patients with FXYD2 mutations.

102 | Chapter 4

Results

Recurrent FXYD2 Mutation in Patients with HypomagnesemiaIn two families with hypomagnesemia a c.115G>A mutation in the FXYD2 gene was identified by mutation analysis. The mutation results in a p.Gly41Arg change at amino acid level. Interestingly, the c.115G>A mutation has previously been reported in a large Dutch family in 2000 and no other FXYD2 mutations have been found since (13).

FXYD2 Mutation in a Dutch Family The first family is a Dutch family with 3 affected family members (Figure 1). The proband (Figure 1, NL II.1) was discovered suffering from hypokalemia and hypomagnesemia during admission for lung embolism at the age of 34 years (Table 1). He had a chronic history of muscle cramps and fatigue and reported a spacious fluid intake. He is an only child and his parents are deceased. He reported no relevant symptoms of his father (Figure 1, NL I.1) besides a spacious fluid intake and recurrent miscarriages of his mother (Figure 1, NL I.2). The proband was suspected of having Gitelman syndrome and he was treated with Mg2+ and K+ supplements.

Hereafter, his two children were admitted to the outpatient clinic for evaluation because of muscle cramps. They both showed hypomagnesemia. The daughter (Figure 1, NL III.1), 9 years old, reported muscle cramps and uncertainty about keeping balance, without falling. His son (Figure 1, NL III.2), 7 years old, reported an increased fluid intake

Figure 1 Family with Isolated Hypomagnesemia from the Netherlands

A, Pedigree of the Dutch family with hypomagnesemia. Black-filled symbols denote affected and

genetically confirmed family members, grey symbols denote potentially affected family members.

B, Mutation analysis chromatogram of the proband (NL II.1). The mutation is indicated by an arrow.

Nucleotide changes and resulting effect at the amino acid level are shown.

?I.

II.

III.

1 2

1 2

1 2

NL

A B

N A T C G T G G G C T C C T C

I V G/R L L39 40 41 42 43


and nightly muscle cramps and is known with an attention deficit disorder. Both children had a normal growth pattern, normal blood pressure, no dysmorphic features and unremarkable renal ultrasound and X-ray of the hand. Laboratory evaluation revealed isolated hypomagnesemia with hypermagnesuria and hypocalciuria (with normal serum creatinine) (Table 1). Because the dominant inheritance of hypomagnesemia in this family was not compatible with Gitelman syndrome, genetic analysis was performed for diagnostic purposes. No mutations were found in the HNF1B and SLC12A3 genes. A heterozygous missense mutation in the FXYD2 gene (c.121G>A (p.(Gly41Arg)) was found in all 3 affected individuals. The children are free of symptoms with Mg2+ supplementation 3 times a day, achieving serum Mg2+ concentrations in the low normal range.

FXYD2 Mutation in a Belgian Family The second family originates from Belgium. The proband is a 67-year old man admitted for a work-up of hypokalemia and hypomagnesemia (Figure 2, B II.1). Hypomagnesemia was first discovered at age 44, during a blood electrolyte analysis following an episode of tetanic cramps. Magnesium supplements were then initiated, with variable compliance. The patient reported chronic fatigue, with general weakness, dysesthesia of the face and hands, and frequent cramps of the lower limbs, which generated difficulties in walking. He complained about continuous thirst and nocturia. Blood pressure was 180/85 mmHg

Table 1 Laboratory Investigations of Affected Individuals

NL II.1 NL III.1 NL III.2 B II.1 B III.2 B IV.1

Serum Mg2+

(mmol/L, N 0.7-0.95)0.38 0.45 0.45 0.56 0.35 0.50

Serum K+

(mmol/L, N 3.5-5.13.3 4.2 3.8 4.0 3.0 3.6

Serum HCO3-

(mmol/L, N 21-27)29.6 24 22 26 27 31

eGFR (mL/1.73 mL/min, N > 90)

123 133 124 43 125 85

Urinary Mg2+ excretion / 24 hrs(mmoL/day, N 3.0-5.0)

8.9 8.1 10.6 8.4

Fractional Mg2+ excretion (%, nl < 4 %)

11.9 6

Urinary Ca2+ excretion / 24 hrs(mmoL/day, N 1.5-7.5)

1.3 0.8 1.5 0.3

Urinary Ca2+/creat(mmol/mmol, N <0.7)

0.04 0.05

1 mEq Mg2+ = 0.5 mmol Mg2+ = 12.3 mg Mg2+.

1 mEq Ca2+ = 0.5 mmol Ca2+ = 20.5 mg Ca2+.

104 | Chapter 4

(supine) and 150/90 mmHg (standing). The clinical examination was otherwise unremarkable. The patient had chondrocalcinosis evidenced by X-ray of the knees. Blood and urine analyses revealed renal failure (plasma creatinine 1.62 mg/dL, eGFR 43 mL/min/m2), with hypomagnesemia (all serum electrolytes within normal range) hy-permagnesuria and hypocalciuria (Table 1). Facing the chronic history of hypomagnesemia with inappropriate urinary Mg2+ loss and hypocalciuria, Gitelman syndrome was suspected. Genetic testing of SLC12A3, CLCNKB and HNF1B (sequencing of all exons, exon-intron boundaries plus MLPA) was negative. The patient reported that his mother (Figure 2, B I.2, deceased at age 62) was known for Mg2+ problems. She suffered from chronic fatigue and articulation problems. Additionally, she also took Mg2+ supplements, as well as the probands daughter (B III.2) and granddaughter (B IV.1). The daughter of the proband (Figure 2, B III.2), aged 41 years, complained of fatigue since childhood, with limited physical activity. She had cramps and dysesthesia of the face and hands. She was diagnosed with hypomagnesemia as a young adult and has taking Mg2+ supplements since then. Plasma analyses revealed persistent hypomagnesemia and hypokalemia, with normal HCO3

- and normal renal function. The urinary Mg2+ loss was inappropriately high (Table 1). The granddaughter of the proband (B IV.1), age 16 years, experienced two epileptic crises at 5 and 15 years of age and complained of chronic fatigue. The neurological work-up was negative but hypomagnesemia and hypokalemia were noticed, with inappropriate urinary Mg2+ loss and hypocalciuria (Table 1). Renal function was normal. Over the years, plasma Mg2+ remained low despite supplementation.

Figure 2 Family with Isolated Hypomagnesemia from Belgium

A, Pedigree of the Belgian family with hypomagnesemia. Blackened symbols denote affected and

genetically confirmed family members, grey symbols denote potentially affected family members.

B, Mutation analysis chromatogram of the proband (B II.1). The mutation is indicated by an arrow and

the nucleotide changes and resulting effect at the amino acid level are shown.

?I.

II.

III.

IV.

1 2

1 2 3

41 2 3 5

1

A BB

N A T C G T G G G C T C C T C

I V G/R L L39 40 41 42 43


Common Haplotype Bearing the FXYD2 MutationTo examine whether the newly identified families share the same haplotype as the original family, marker analysis was initiated. Five markers encompassing the FXYD2 gene were selected: D11S4092, D11S4127, D11S939, D11S1356, D11S4195 (Figure 3). For this analysis, relatives from the original family were included. Indeed, patients from all three families share the same haplotype, suggesting that the families are related through a common ancestor. Genealogical analysis did not result in the identification of this common ancestor. Although the Belgian family was shown to originate from the same geographical region (surroundings of Liège, Belgium) as the family described in the original paper from 2000, no common ancestor was found in 9-12 generations back.

Discussion

In this study, a c.115G>A (p.Gly41Arg) mutation in FXYD2 was identified in two families with hereditary hypomagnesemia. Importantly, these are the first new patients reported since 2000 confirming that FXYD2 mutations cause hypomagnesemia. In both patient families the same c.115G>A mutation was detected that was previously described in a large Dutch family. All three families shared the same haplotype, suggesting a founder effect. Although the genetic cause was only found in 2000 (14), the first patients with mutations in the FXYD2 gene were clinically evaluated in 1987 (9, 17). Twenty-two individuals harboring FXYD2 mutations showed isolated dominant hypomagnesemia, hypocalciuria and occasionally also hypomagnesemia-associated chondrocalcinosis was detected. Since the first identification of the FXYD2 p.Gly41Arg mutation in 2000 (6), no other FXYD2 mutations have been reported in literature or detected in our diagnostic testing facility.

Figure 3 Haplotype Analysis of Patients with FXYD2 Mutations

STS marker analysis of patients with FXYD2 mutations with markers from the chromosome 11q23

(Chr11:117,250,000-118,000,000, hg38). All families share the same haplotype.

202

93

243

202

272

xx

204

85

245

202

272

Gly41Arg

202

93

243

202

272

xx

D11S4092

D11S4127

D11S939

D11S1356

D11S4195

FXYD2

190

93

238

200

272

xx

204

85

245

202

272

Gly41Arg

190

93

238

192

272

xx

204

85

245

202

272

Gly41Arg

204

87

242

200

279

xx

204

85

245

202

272

Gly41Arg

196

96

242

200

272

xx

204

85

245

202

272

Gly41Arg

117.25 117.5 117.75 118chr11 (cM)

D11S4092 D11S4127 D11S939 D11S1356 D11S4195

FXYD2

NL III.1 NL III.2 NL II.1 B III.2 B IV.1

202

93

240

202

272

xx

204

85

245

202

272

Gly41Arg

Meij et al. 2000

106 | Chapter 4

Therefore, the role of FXYD2 in hypomagnesemia has been questioned. The identification of the new Dutch and Belgian families with FXYD2 mutations confirms its importance in renal Mg2+ handling. Moreover, several regulatory factors of FXYD2 have additionally been implicated in Mg2+ homeostasis. The transcription of FXYD2 is induced by HNF1β (7) and patients with HNF1B mutations also develop hypomagnesemia (1). Recently, pterin- 4-alpha-carbinolamine dehydratase (encoded by PCBD1) was identified as additional transcriptional regulator of FXYD2 and again patients with PCBD1 mutations showed hypomagnesemia (6). Although the exact molecular mechanism by which the PCBD1-HNF1B-FXYD2 axis regulates renal Mg2+ reabsorption is still unclear, the effects of FXYD2-encoded γ–subunit on Na+-K+-ATPase activity have been well established. The γ–subunit increases the affinity of the Na+-K+-ATPase for ATP and decreases the affinity for Na+ and K+ (2). The p.Gly41 residue is located central in the alpha-helix that forms the γ–subunit (PDB: 2mkv). Mutation of the small glycine residue in the larger arginine residue may disrupt the structure of the γ–subunit. To date other FXYD2 mutations have not been identified, suggesting that other FXYD2 mutations may not cause hypomagnesemia. Alternativity, the importance of γ–subunit for Na+-K+-ATPase activity could suggest that more severe mutations in FXYD2 render a dysfunctional Na+-K+-ATPase and therefore may be embryonic lethal. In the new families from the Netherlands and Belgium, both hypomagnesemia and hypocalciuria could be confirmed in all patients. Of note, hypomagnesemia was associated with moderate hypokalemia in the two patients with lowest serum Mg2+ values. Hypokalemia is often secondary to hypomagnesemia (13). Hypomagnesemia results in decreased intracellular Mg2+ levels in the distal part of the nephron, possibly due to the fact the Mg2+ normally inhibits the renal ROMK K+ channel minimizing renal K+ secretion. Other clinical manifestations of the patients harboring FXYD2 mutations include renal failure (CKD stage 3)(B II.1), but additional factors in the development of renal failure cannot be excluded (e.g. analgesics and NSAID for chronic pain due to chondrocalcinosis). All affected family members reported muscle cramps. Additionally, one patient suffered from episodes of epilepsy (B IV.1). Moreover, chrondrocalcinosis was detected in the proband of the Belgian family (B II.1). Both epilepsy and chondrocalcinosis were observed in the other patients from the original family (1, 7), and are classical complications of hypomagnesemia. In the Dutch family, daily supplementation using Mg(OH)2 achieved plasma Mg2+ levels in the low normal range. Genealogical analysis, going back to 1700 of all three patients families with the similar FXYD2 mutation did not result in the identification of a common ancestor. Interestingly, the ancestry of two families could be traced back to the same geographical area near Liège in Belgium. If indeed the common ancestor lived before 1700, the dominant inheritance of IDH suggests that more, still unidentified, descendants of this common ancestor could live in the Netherlands and Belgium. However, given the variety of this phenotype and the aspecificity of the symptoms these patients often remain undetected.


Increasing the awareness of this syndrome may help identifying more patients with FXYD2 mutations and allow proper treatment by Mg2+ supplementation. In conclusion, this study reports two new families with isolated dominant hypo-magnesemia caused by FXYD2 mutations. Further insight in the clinical spectrum associated with genetic Mg2+ disorders can provide useful information for clinicians to make an early differential diagnosis. FXYD2 mutations should be considered in patients with hypo-magnesemia and hypocalciuria, especially when chondrocalcinosis or epilepsy are observed.

AcknowledgementsThis work was supported by grants from the Netherlands Organization for Scientific Research (ZonMw 9120.8026, NWO ALW 818.02.001) and the EURenOmics project from the European Union seventh Framework Programme (FP7/2007–2013, agreement nu 305608). Action de Recherche Concertée (ARC10/15-029, Communauté Française de Belgique); the FNRS and FRSM; Inter-University Attraction Pole (IUAP, Belgium Federal Government); the NCCR Kidney.CH program (Swiss National Science Foundation); the Gebert Rüf Stiftung (Project GRS-038/12); and the Swiss National Science Foundation 310030-146490.


PatientsAll patients in this study were diagnosed with hypomagnesemia and were screened by the DNA diagnostics department of the Radboudumc Nijmegen for hypomagnesemia causing mutations. Informed consent for participation in research was obtained in accordance with Institutional Review Board guidelines. Serum and urine electrolytes were determined by general laboratory screenings. Laboratory findings of all patients are presented in Table 1.

Mutation AnalysisExtraction of DNA from whole blood was performed using standard protocols. FXYD2 mutation screening was performed using polymerase chain reaction (PCR) primers designed on the coding sequence of the human FXYD2 gene (NM_001680.4, NM_021603.3) including exon/intron boundaries (13). Amplified sequences were separated on agarose gel by electrophoresis and directly Sanger sequenced according to standard methods on a 3730 Sequence Analyzer (Applied Biosystems). Mutation nomenclature is according to HGVS using NM_001680.4 as a reference sequence.

Haplotype AnalysisMicrosatellite markers D11S4092, D11S4127, D11S939, D11S1356 and D11S4195 encompassing the FXYD2 gene on chromosome 11q23 were amplified by PCR using fluorescently labelled

108 | Chapter 4

primers. PCR products are denatured and analyzed on a 3730 Sequence Analyzer (Applied Biosystems). Genealogy StudyIn-depth genealogical analysis was performed to identify common ancestors of FXYD2 patients. Lists of descendants from index patients were compiled and pedigrees were generated using Dutch and Belgian civil registers and church books.


References1. Adalat S, Woolf AS, Johnstone KA, Wirsing A, Harries LW, Long DA, Hennekam RC, Ledermann SE, Rees

L, van’t Hoff W, Marks SD, Trompeter RS, Tullus K, Winyard PJ, Cansick J, Mushtaq I, Dhillon HK, Bingham C, Edghill EL, Shroff R, Stanescu H, Ryffel GU, Ellard S, Bockenhauer D. HNF1B mutations associate with hypomagnesemia and renal magnesium wasting. J. Am. Soc. Nephrol. 20: 1123–1131, 2009.

2. Arystarkhova E, Sweadner KJ. Splice variants of the gamma subunit (FXYD2) and their significance in regulation of the Na, K-ATPase in kidney. J. Bioenerg. Biomembr. 37: 381–386, 2005.

3. Arystarkhova E, Wetzel RK, Sweadner KJ. Distribution and oligomeric association of splice forms of Na(+)-K(+)-ATPase regulatory gamma-subunit in rat kidney. Am. J. Physiol. Renal Physiol. 282: F393–407, 2002.

4. Cairo ER, Friedrich T, Swarts HGP, Knoers NV, Bindels RJM, Monnens LA, Willems PHGM, De Pont JJHHM, Koenderink JB. Impaired routing of wild type FXYD2 after oligomerisation with FXYD2-G41R might explain the dominant nature of renal hypomagnesemia. Biochim. Biophys. Acta 1778: 398–404, 2008.

5. de Baaij JHF, Hoenderop JGJ, Bindels RJM. Regulation of magnesium balance: lessons learned from human genetic disease. Clin kidney j 5: i15–i24, 2012.

6. Ferrè S, de Baaij JHF, Ferreira P, Germann R, de Klerk JBC, Lavrijsen M, van Zeeland F, Venselaar H, Kluijtmans LAJ, Hoenderop JGJ, Bindels RJM. Mutations in PCBD1 cause hypomagnesemia and renal magnesium wasting. J. Am. Soc. Nephrol. 25: 574–586, 2014.

7. Ferrè S, Veenstra GJC, Bouwmeester R, Hoenderop JGJ, Bindels RJM. HNF-1B specifically regulates the transcription of the γa-subunit of the Na+/K+-ATPase. Biochem. Biophys. Res. Commun. 404: 284–290, 2011.

8. Geven WB, Monnens LA, Willems HL, Buijs WC. Renal magnesium wasting in two families with autosomal dominant inheritance. Kidney international, 1987.

9. Huang C-L, Kuo E. Mechanism of hypokalemia in magnesium deficiency. J. Am. Soc. Nephrol. 18: 2649–2652, 2007.

10. Lameris AL, Monnens LA, Bindels RJ, Hoenderop JGJ. Drug-induced alterations in Mg2+ homoeostasis. Clin. Sci. 123: 1–14, 2012.

11. Martin KJ, González EA, Slatopolsky E. Clinical consequences and management of hypomagnesemia. J. Am. Soc. Nephrol. 20: 2291–2295, 2009.

12. Meij IC, Koenderink JB, De Jong JC, De Pont JJHHM, Monnens LAH, Van Den Heuvel LPWJ, Knoers NVAM. Dominant isolated renal magnesium loss is caused by misrouting of the Na+,K+-ATPase gamma-subunit. Ann. N. Y. Acad. Sci. 986: 437–443, 2003.

13. Meij IC, Koenderink JB, van Bokhoven H, Assink KF, Groenestege WT, de Pont JJ, Bindels RJ, Monnens LA, van den Heuvel LP, Knoers NV. Dominant isolated renal magnesium loss is caused by misrouting of the Na(+),K(+)-ATPase gamma-subunit. Nat. Genet. 26: 265–266, 2000.

14. Meij IC, Saar K, van den Heuvel L. Hereditary isolated renal magnesium loss maps to chromosome 11q23. The American Journal of … (1999). doi: 10.1086/302199.

15. Mishra NK, Peleg Y, Cirri E, Belogus T, Lifshitz Y, Voelker DR, Apell H-J, Garty H, Karlish SJD. FXYD proteins stabilize Na,K-ATPase: amplification of specific phosphatidylserine-protein interactions. J. Biol. Chem. 286: 9699–9712, 2011.

16. Richette P, Ayoub G, Lahalle S, Vicaut E, Badran A-M, Joly F, Messing B, Bardin T. Hypomagnesemia associated with chondrocalcinosis: a cross-sectional study. Arthritis Rheum. 57: 1496–1501, 2007.

17. Yang L, Frindt G, Palmer LG. Magnesium modulates ROMK channel-mediated potassium secretion. J. Am. Soc. Nephrol. 21: 2109–2116, 2010.

112 | Chapter 5

Abstract

Hypomagnesemia is a common clinical cause of muscle cramps, epilepsy and cardiac arrhythmias. Regulation of the body magnesium (Mg2+) balance is of critical importance and is largely regulated by the kidney and the intestine. In the distal convoluted tubule (DCT) of the kidney, a transcellular reabsorption process determines the final urinary Mg2+ excretion. The basolateral Mg2+ extrusion mechanism in DCT is still unknown, but recent findings suggest that proteins of the SLC41 family may contribute to cellular Mg2+ extrusion. The aim of this study was, therefore, to characterize the role of SLC41A3 in Mg2+ homeostasis using the Slc41a3 knockout mouse. To this end, a tissue expression screening was performed by RT-PCR, showing that Slc41a3 is the only SLC41 isoform with enriched expression in DCT compared to other segments in the kidney. Interestingly, serum and urinary electrolyte determinations demonstrated that Slc41a3 knockout mice suffer from hypomagnesemia with renal Mg2+ wasting. Serum and urinary sodium, potassium and calcium levels were not affected. To determine the effect of SLC41A3 on intestinal Mg2+ absorption, the Mg2+ absorption capacity was measured using the stable 25Mg2+ isotope. 25Mg2+ uptake was similar in wild type and knockout mouse, although Slc41a3 knockout animals exhibited increased intestinal expression of Mg2+ transporters Trpm6 and Slc41a1. Remarkably, 10% of the Slc41a3 knockout mice developed severe unilateral hydronephrosis, as demonstrated by the presence of transitional epithelium lining the fluid cavity. Feeding the Slc41a3 knockout mice a low Mg2+ diet may have instigated the formation of hydronephrosis. In conclusion, SLC41A3 was established as a new important factor for renal Mg2+ handling. In the future, SLC41A3 mutations should be considered in patients with unilateral hydronephrosis and/or hypomagnesemia.

Keywords: Hypomagnesemia, Kidney, Hydronephrosis, Distal Convoluted Tubule

Hypomagnesemia in SLC41A3 KO Mice | 113

Introduction

The distal convoluted tubule (DCT) is essential for magnesium (Mg2+) homeostasis (4). Although only 10 % of the filtered Mg2+ is reabsorbed in this segment of the kidney, it determines the final urinary Mg2+ excretion since no reabsorption takes place beyond this segment. In the DCT, Mg2+ enters the cell via the Transient Receptor Potential Melastatin type 6 (TRPM6) divalent cation channel (31), while the basolateral Mg2+ extrusion mechanism remains to be identified. Disturbances in this latter process result in hypomagnesemia, which is characterized by a variety of clinical symptoms including cardiac arrhythmias, muscle cramps and fatigue (4). Additionally, drugs affecting the DCT such as epidermal growth factor receptor inhibitors, calcineurin inhibitors and diuretics may reduce blood Mg2+ levels (15). Therefore, understanding the molecular mechanism underlying Mg2+ reabsorption in the DCT is of major importance for the treatment of patients with hypomagnesemia. In a recent transcriptome screening study, Solute carrier family 41 member 3 (Slc41a3) was identified as highly regulated by dietary Mg2+ intake (3). In this study, mice were fed with various Mg2+-containing diets after which DCT segments were isolated. Using a quantitative gene expression microarray, the Mg2+-sensitive genes in the DCT were identified. Slc41a3 was among the genes with increased expression in response to a Mg2+-deficient diet. SLC41A3 was originally described by Quamme and colleagues as part of the solute carrier family 41 of putative Mg2+ transporters (22). Although SLC41A3 has never been studied in detail, few studies have addressed the structure, regulation and function of its close homologue SLC41A1 (52 % identity at amino acid level)(12, 13, 17). There is controversy about the structure of SLC41A1; some groups support a 10 transmembrane domain structure, while others suggest 11 transmembrane domains with an extracellular C-terminus (17, 28). On the functional level, initial experiments in Xenopus laevis oocytes demonstrated Mg2+ currents for SLC41A1 and SLC41A3 using physiological Mg2+ concentrations, proposing a channel-like function (5, 22). Indeed, SLC41 proteins posses conserved pore regions with the MgtE bacterial Mg2+ channel (9, 17, 32). In contrast, recent experiments using Mg2+-sensitive fluorescent probes showed Na+-dependent Mg2+ transport, suggesting that SLC41A1 may be the long-sought Na+/Mg2+-exchanger (13, 14). Interestingly, an exon-skipping mutation in SLC41A1 resulted in a nephronophthisis-like phenotype in a patient eventually requiring renal transplantation (10). Whether SLC41A3 may have a similar function as SLC41A1 has never been examined. However, in contrast to Slc41a3, Mg2+-sensitive regulation of Slc41a1 expression was not observed in the DCT transcriptome study (3). The aim of the present study was to characterize the role of SLC41A3 in renal and intestinal Mg2+ (re)absorption. Slc41a3 knockout mice (Slc41a3-/-) were analyzed for ion homeostasis and kidney development. Furthermore, by challenging the mice with low

114 | Chapter 5

Mg2+ diets the compensatory mechanisms in intestine, kidney and brain were examined in detail. Using the 25Mg isotope, intestinal Mg2+ uptake studies were performed to determine the role of SLC41A3 in the intestine.

Results

Expression Profile of Slc41 IsoformsTo examine the role of the SLC41 protein family in DCT Mg2+ transport, a tissue expression screening for Slc41a1, Slc41a2 and Slc41a3 was performed using RT-PCR (Figure 1). All three isoforms showed a ubiquitous expression pattern. High Slc41a1 expression was detected in brain, heart and lung, Slc41a2 was mostly expressed in the early intestine and Slc41a3 expression was highest in heart, lung and small intestine. However, in RT-PCR analysis of isolated DCT tubules Slc41a3 transcript levels showed an impressive 10-fold enrichment compared to total kidney mRNA. Slc41a1 and Slc41a2 expression was not enriched in DCT compared to other segments; the latter was even significantly decreased, suggesting that SLC41A3 is the most relevant SLC41 family member for Mg2+ transport in DCT.

Slc41a3 Mouse BreedingTo examine the function of SLC41A3 in Mg2+ homeostasis, Slc41a3-/- mice were generated. Breeding of Slc41a3+/- mice resulted in a normal Mendelian inheritance pattern in the offspring. Of a total of 181 mice 32 % was genotyped Slc41a3+/+, 46 % Slc41a3+/- and 22 % Slc41a3-/-. Since Shirpa screening by the Mouse Genetics Project reported abnormal locomotor coordination of Slc41a3-/- mice fed with a high fat diet (MGI: 1918949)(35), special attention to behavioral observations was given during the breeding procedure. However, no abnormalities in behavior of the mice including ataxia and locomotor behavior were observed. By visual inspection, it was not possible to distinguish between Slc41a3+/+, Slc41a3+/- and Slc41a3-/- mice based on behavior or phenotype. All offspring was genotyped for the insertion of the KO cassette and presence of the wild type Slc41a3 allele (Figure 2B). To confirm KO of Slc41a3 β-galactose stainings were performed, taking advantage of the insertion of the LacZ cassette in the Slc41a3 gene in the Slc41a3-/- mice. Indeed, LacZ staining was only observed in Slc41a3-/- mice (Figure 2C).

Hypomagnesemia in Slc41a3-/- MiceTo investigate the role of SLC41A3 in Mg2+ homeostasis, mice were subjected to normal or low Mg2+-containing diets for 14 days. Blood, urine and feces were collected at day 0 and day 14 of the experiment using metabolic cages (Figure 3A). At the end of the experiment the mice were sacrificed and tissues were collected for further analysis. No significant differences were observed between the body weights of Slc41a3+/+ mice and Slc41a3+/- and Slc41a3-/- littermates (Table 1). Food and water intake, urinary volume and fecal excretion


were comparable among all mice on the same diet (Table 1). On the normal diet, Slc41a3-/- mice serum Mg2+ concentrations were significantly decreased by 29 %(±2 %) compared to Slc41a3+/+ mice (Figure 3B). 24hrs urinary Mg2+ excretion was not significantly different, suggesting a renal Mg2+ leak in Slc41a3-/- mice (Figure 3C). Interestingly, both serum and urine Ca2+ levels were not significantly altered compared to Slc41a3+/+ mice, underlining

Figure 1 Slc41a3 Expression is Enriched in the Distal Convoluted Tubule (DCT)

A-F, mRNA expression levels of Slc41a1 (A-B), Slc41a2 (C-D) and Slc41a3 (E-F) in a panel of mouse

tissues (A,C,E) and in COPAS-sorted DCT cells (B,D.F) were measured by quantitative RT-PCR and

normalized for Gapdh expression. Data represent the mean of three individual experiments ± SEM

and are expressed as the percentage of the total tissue expression (A,C,E) or enriched compared to

total kidney expression (B,D,F). *P < 0.05 indicates a significant difference from total kidney expression.

Kidney

Early duodenum

Late duodenum

Ileum

Jejunum

Early co

lon

Late co

lon

Cecum

BrainHeart

Lung

Liver

Spleen

Muscle

Kidney

Early duodenum

Late duodenum

Ileum

Jejunum

Early co

lon

Late co

lon

Cecum

BrainHeart

Lung

Liver

Spleen

Muscle

Kidney

Early duodenum

Late duodenum

Ileum

Jejunum

Early co

lon

Late co

lon

Cecum

BrainHeart

Lung

Liver

Spleen

Muscle

0

10

20

30

40

Slc4

1a1

mRN

A e

xpre

ssio

n(%

of T

otal

)

0

10

20

30

40

Slc4

1a2

mRN

A e

xpre

ssio

n(%

of T

otal

)

0

10

20

30

40

Slc4

1a3

mRN

A e

xpre

ssio

n(%

of T

otal

)

Total K

idneyDCT

0

5

10

15

Slc4

1a1

mRN

A e

xpre

ssio

n(R

elat

ive

to to

tal k

idne

y, fo

ld c

hang

e)

Total K

idneyDCT

0

5

10

15

Slc4

1a2

mRN

A e

xpre

ssio

n(R

elat

ive

to to

tal k

idne

y, fo

ld c

hang

e)

Total K

idneyDCT

0

5

10

15

Slc4

1a3

mRN

A e

xpre

ssio

n(R

elat

ive

to to

tal k

idne

y, fo

ld c

hang

e)

A

C

E

B

D

F *

*

116 | Chapter 5

the specificity of the hypomagnesemia in these Slc41a3-/- mice (Figure 3D-E). Slc41a3+/+ mice fed a Mg2+-deficient diet for two weeks, displayed hypomagnesemia (serum Mg2+ levels of 0.43 ±0.04 mmol/L, Figure 3B). Although the serum Mg2+ levels of Slc41a3-/- mice on a low Mg2+ diet were even lower (0.32 ±0.02 mmol/L), they did not reach a significant difference compared to Slc41a3+/+ mice (p=0.14). On the low Mg2+ diet, no differences in urinary Mg2+ and Ca2+ excretion or serum Ca2+ concentrations were measured among the groups (Figure 3C-E).

Hydronephrosis in a Subset of Slc41a3-/- Mice Interestingly, in several male Slc41a3-/- mice on the low Mg2+ diet a severely increased kidney size was observed in the left kidney caused by a hydronephrosis (Figure 4A). The kidney volume was 6-8 fold higher than the other kidney of the same animal and caused a serious organ rearrangement in the peritoneal cavity. The hydronephrotic kidney was unilateral and was observed in 10 % of the Slc41a3-/- mice in the low Mg2+ group and was never detected in Slc41a3-/- mice fed the normal Mg2+ diet. To further assess the morphology of the hydronephrosis, the kidney tissue was stained using standard hematoxylin and eosin (H&E) stainings (Figure 4B, left image). The presence of transitional epithelium around the dilated tissue and the absence of dilated ureters suggest that the origin of the hydronephrosis is located in the renal calyx or renal pelvis. Indeed, umbrella

Figure 2 Characteristics of the Slc41a3-/- Mouse

A, Targeted insertion of the knockout (KO) cassette. Top: Slc41a3 locus on chromosome 6. Bottom:

targeted allele in which the KO cassette is inserted before exon 5. Grey boxes indicate exons; black

triangles depict LoxP sites; white triangles depict Flp sites; arrows depict genotype primers (A–C).

SA: splice acceptor, IRES: interinal ribosome entry site, lacZ: β-galactosidase, pA: polyA, hBactP:

promoter, neo: neomycin resistance gene. B, Identification of the mouse genotype by PCR analysis

of ear-derived DNA. The PCR product size ± 530 bp shows the presence of the wild-type allele (+/+)

using primers A and C; the PCR product sized ± 800 bp shows the KO allele (–/–) using primers B and C.

Both alleles are detected in heterozygous animals (+/–). C, β-galactosidase staining of Slc41a3-/- mice.

3 4 5 6 7

B C

A

SA IRES lacZ pA hBactP neo pA exon 5

A B C

5’arm 3’arm

Slc41a3+/+

Slc41a3+/-

Slc41a3-/-

805

524

bp


cells were detected to further confirm the urothelial origin of the tissue (Figure 4B, middle image). However, major parts of the tissue lining the fluid-filled cavity were not covered with transitional epithelium, but existed of fibrous connective tissue. The ureter was filled with large cells that possibly obstructed the flow (Figure 4B, right image). Subsequently, the presence of Ca2+ deposits was examined to exclude urolithiasis as cause for the hydronephrosis. By alizarin red stainings, Ca2+ deposits were not detected in the ureter or

Figure 3 Slc41a3-/- Mice Suffer from Isolated Hypomagnesemia

A, Slc41a3+/+, Slc41a3+/-, Slc41a3-/- mice were randomly assigned to the low or normal Mg2+ group

(n=10). Subsequently, mice were fed with the Mg2+ diets for 14 days of which the animals were

housed in metabolic cages during the last 48 hrs for urine and feces sampling (24 hrs adaptation,

24 hrs sampling). At the end of the experiments, the animals were sacrificed and blood and or-

gans were taken for further analysis. B-E, Serum Mg2+ (B) and Ca2+ (D) concentrations at day 14

of Slc41a3+/+ (black bars), Slc41a3+/- (grey bars) and Slc41a3-/- (white bars) mice fed with a low or

normal Mg2+-containing diet for 14 days. 24 hrs urinary Mg2+ (C) and Ca2+ (E) excretion at day 14 of

Slc41a3+/+ (black bars), Slc41a3+/- (grey bars) and Slc41a3-/- (white bars) mice fed with a low or normal

Mg2+-containing diet for 14 days. Values are presented as means ± SEM (n=10). *P < 0.05 is consid-

ered statistically significant compared to Slc41a3+/+ mice fed the same diet.

Normal M

g2+

Low M

g2+

0. 0

0. 5

1. 0

1. 5

Seru

m M

g2+ (m

M)

Normal M

g2+

Low M

g2+

0. 0

0. 5

1. 0

1. 5

2. 0

2. 5

Seru

m C

a2+ (m

M)

Normal M

g2+

Low M

g2+

0

20

40

60

Mg2+

exc

retio

n (µ

mol

/24h

rs)

Ca2+

exc

retio

n (µ

mol

/24h

rs)

Normal M

g2+

Low M

g2+

0

2

4

6

8

B

D

C

E

-2 2 4 60 12 14108

MC MC

Blood Blood

Diets : Normal vs. Low Mg 2+-containing diets

A

**

118 | Chapter 5

Tabl

e 1

Met

abol

ic P

aram

eter

s of

Slc

41a3

-/-

mic

e

Slc4

1a3+

/+, S

lc41

a3+

/- a

nd S

lc41

a3-/

- mic

e w

ere

kept

at n

orm

al d

iets

or M

g2+

-defi

cien

t (<

0.02

% (w

/w))

diet

s for

14

days

. Dur

ing

the

last

48

hrs t

he m

ice

wer

e ke

pt

in m

etab

olic

cag

es to

col

lect

urin

e an

d fe

ces.

Valu

es re

pres

ent t

he m

easu

rem

ents

of t

he la

st 2

4 hr

s.

Nor

mal

Mg2+

die

tLo

w M

g2+ d

iet

Slc4

1a3+/

+Sl

c41a

3+/-

Slc4

1a3-/

-Sl

c41a

3+/+

Slc4

1a3+/

-Sl

c41a

3-/-

Wei

ght –

day

0 (g

)18

.0 ±

2.1

18.4

± 1

.617

.5 ±

2.2

18.4

± 2

.118

.7 ±

2.0

17.7

± 3

.2

Wei

ght –

day

14

(g)

20.5

± 2

.120

.5 ±

1.9

20.2

± 2

.519

.8 ±

2.6

20.3

± 2

.419

.1 ±

3.3

Food

inta

ke (g

)3.

97 ±

0.5

04.

26 ±

0.2

34.

43 ±

0.2

83.

46 ±

0.5

23.

56 ±

0.4

23.

76 ±

0.5

6

Wat

er in

take

(mL)

4.95

± 1

.23

4.98

± 1

.13

4.77

± 0

.88

4.00

± 0

.82

4.65

± 1

.12

4.03

± 0

.61

Fece

s w

eigh

t (g)

1.86

± 0

.38

1.94

± 0

.39

2.09

± 0

.22

0.34

± 0

.12

0.38

± 0

.08

0.34

± 0

.13

Urin

e vo

lum

e (m

L)1.

25 ±

0.3

11.

12 ±

0.3

71.

22 ±

0.2

91.

53 ±

0.6

61.

61 ±

0.5

41.

46 ±

0.4

8

Seru

m [N

a+] (

mm

ol/L

)15

2 ±

115

0 ±

115

3 ±

115

2 ±

015

2 ±

015

3 ±

0

Seru

m [K

+] (

mm

ol/L

)4.

45 ±

0.0

84.

59 ±

0.0

84.

54 ±

0.1

04.

15 ±

0.1

54.

43 ±

0.0

84.

76 ±

0.0

9

Urin

e N

a+ (µ

mol

/24h

rs)

185

± 1

318

4 ±

20

214

± 1

120

4 ±

13

169

± 1

717

6 ±

26

Urin

e K+

(µm

ol/2

4hrs

)53

9 ±

26

538

± 3

956

2 ±

25

559

± 3

946

0 ±

46

502

± 6

9


Figure 4 Slc41a3-/- Mice Develop Hydronephrosis on Low Mg2+ Diets

A, Images of hydronephrotic kidneys found in 2 out of 20 of Slc41a3-/- mice fed with low Mg2+ diets.

B, Hematoxylin and eosin stain of the hydronephrosis kidney detected in Slc41a3-/- mice showing

transitional epithelium lining the hydronephrosis. The left image gives an overview of the total

kidney (bar: 1 mm). The middle image shows the transitional epithelium with a black arrow indi-

cating the umbrella cells (bar: 20 µm). The right image indicates that the ureter is filled with large

cells, which potentially cause obstruction (bar: 20 µm). C, Alizarin red staining of the hydronephrosis

kidney did not show Ca2+ deposits in ureter, only minor Ca2+ stains in the connective tissue sur-

rounding the hydronephrosis (bar: 200 µm). D, Hematoxylin and eosin stain of normal kidney tissue

from Slc41a3-/- mice fed with normal Mg2+ demonstrating venal en tubular dilations (left image bar:

100µm, right image bar: 20 µm). E, Quantification of dilated surface in Slc41a3+/+ and Slc41a3-/- mice.

Values are presented as means ± SEM (n=10).

B

A

D E

0

1

2

3

4

5

Surf

ace

of c

aviti

es (m

m2 )

C

Slc41a 3+/+ Slc41a 3–/–

120 | Chapter 5

remnant kidney of the Slc41a3-/- mouse with hydronephrosis, only small deposits were present in the connective tissue lining the cavity (Figure 4C). To assess whether more initial stages of the development of the hydronephrosis could be detected, kidneys from Slc41a3-/- mice fed with the normal Mg2+ diet without apparent abnormalities at the exterior of the kidney were stained using a standard hematoxylin and eosin stain (Figure 4D). Small tubular and venal dilations were observed in the cortex and medulla of Slc41a3+/+ and Slc41A3-/- mice. Quantification of the surface size of these dilations did not show differences between kidneys from Slc41a3+/+ and Slc41A3-/- mice, suggesting that these dilations are non-pathogenic (Figure 4E).

Increased Colonic Expression of Mg2+ Transporters in Slc41a3-/- AnimalsTo examine the compensatory mechanisms for the renal Mg2+ wasting in Slc41a3-/- mice, the expression of renal Mg2+ transporters was analyzed using RT-PCR (Figure 5). Interestingly, the renal transcript levels of Trpm6, Slc41a1, Cnnm2 and parvalbumin were not significantly different between Slc41a3+/+ and Slc41a3-/- mice (Figure 5A-D). Renal Slc41a1 expression was significantly increased in the low Mg2+ diet fed mice compared to mice in the normal Mg2+ fed group for all genotypes (Figure 5B). Furthermore, the renal mRNA levels of Egf, Ncc, Cldn16 and Cldn19 were not significantly altered in Slc41a3-/- mice in comparison with their wild type littermates (Figure 5E-H). Subsequently, the expression of Mg2+ transporters in the colon was examined by RT-PCR. In particular in the low Mg2+ groups, gene expression levels of Slc41a1, Cnnm4 and Trpm7 were significantly increased in the colon of Slc41a3-/- animals compared to colon of their wild-type littermates (Figure 6). In contrast, no difference in colonic Trpm6 expression was detected between Slc41a3+/+ and Slc41a3-/- mice. Since Slc41a3 was also expressed in brain (Figure 1) and SLC41A1 is associated with Parkinson’s disease (14, 25, 34), expression levels of Trpm7 and Slc41a1 in the brain were measured by RT-PCR. No significant changes in brain mRNA expression levels of Trpm7 and Slc41a1 were observed among the genotypes (Figure 7). However, brain Trpm7 and Slc41a1 transcript levels were significantly increased in the low Mg2+ diet groups compared to mice on the normal Mg2+ diet.

Intestinal Absorption is the Similar in Slc41a3+/+ and Slc41a3-/- MiceTo further establish the intestinal function in Slc41a3-/- mice, the intestinal Mg2+ absorption capacity was determined using the stable 25Mg2+ isotope. The mice were subjected to 10 days of low Mg2+ diets prior to the Mg2+ absorption analysis. At the day of the experiment, the mice were administrated 25Mg2+ by oral gavage and subsequently blood was taken from the tail up to 60 min after the administration. The natural abundance of 25Mg2+ in blood is 10 %, which is enriched by more than 100 % during 60 min of 25Mg2+ uptake to more than 20 % (Figure 8A). However, no significant differences in Mg2+ absorption were detected between Slc41a3+/+ and Slc41a3-/- mice (Figure 8A). Determination of the mRNA


Figure 5 Compensatory Mechanisms for the Loss of Slc41a3 Function in the Kidney

A-H, The mRNA expression levels of Trpm6 (A), Slc41a1 (B), Cnnm2 (C), Parvalbumin (D), Egf (E), Ncc

(F), Cldn16 (G) and Cldn19 (H) in kidney of Slc41a3+/+ (black bars), Slc41a3+/- (striped bars) and Slc41a3-/-

(white bars) mice fed with a low or normal Mg2+-containing diet for 14 days were measured by

quantitative RT-PCR and normalized for Gapdh expression. Data represent means (n=10) ± SEM and

are expressed fold difference when compared to the expression in normal diet fed Slc41a3+/+ mice.

*P < 0.05 indicates a statistically significance compared to Slc41a3+/+ mice fed the same diet.

Normal M

g2+

Low M

g2+

Normal M

g2+

Low M

g2+

Normal M

g2+

Low M

g2+

Normal M

g2+

Low M

g2+

Normal M

g2+

Low M

g2+

Normal M

g2+

Low M

g2+

Normal M

g2+

Low M

g2+

Normal M

g2+

Low M

g2+

0

0. 5

1. 0

1. 5

Kidn

ey T

rpm

6 m

RNA

exp

ress

ion

(fold

cha

nge

com

par

ed to

+/+

)

0

0. 5

1. 0

1. 5

2. 0

Kidn

ey C

nnm

2 m

RNA

exp

ress

ion

(fold

cha

nge

com

par

ed to

+/+

)

0

1

2

3

4

5

Kidn

ey S

lc41

a1 m

RNA

exp

ress

ion

(fold

cha

nge

com

pat

ed to

+/+

)0

0. 5

1. 0

1. 5

Kidn

ey P

arv

mRN

A e

xpre

ssio

n(fo

ld c

hang

e co

mp

ared

to +

/+)

A

C

B

D

FE

0. 0

0. 5

1. 0

1. 5

2. 0

Kidn

ey N

cc m

RNA

exp

ress

ion

(fold

cha

nge

com

par

ed to

+/+

)

0. 0

0. 5

1. 0

1. 5

2. 0

Kidn

ey C

ldn1

6 m

RNA

exp

ress

ion

(fold

cha

nge

com

par

ed to

+/+

)

0. 0

0. 5

1. 0

1. 5

Kidn

ey E

gf m

RNA

exp

ress

ion

(fold

cha

nge

com

par

ed to

+/+

)

0. 0

0. 5

1. 0

1. 5

2. 0

2. 5

Kidn

ey C

ldn1

9 m

RNA

exp

ress

ion

(fold

cha

nge

com

par

ed to

+/+

)HG

122 | Chapter 5

Figure 6 Compensatory Mechanisms for the Loss of Slc41a3 Function in the Intestine

A-D, The mRNA expression levels of Trpm6 (A), Slc41a1 (B), Cnnm4 (C) and Trpm7 (D) in colon of

Slc41a3+/+ (black bars), Slc41a3+/- (striped bars) and Slc41a3-/- (white bars) mice fed with a low or

normal Mg2+-containing diet for 14 days were measured by quantitative RT-PCR and normalized

for Gapdh expression. Data represent means (n=10) ± SEM and are expressed fold difference when

compared to the expression in normal diet fed Slc41a3+/+ mice. *P < 0.05 indicates a statistically

significance compared to Slc41a3+/+ mice fed the same diet.

Figure 7 Brain Expression of Mg2+ Transporters

A-B, The mRNA expression levels of Trpm7 (A) and Slc41a1 (B) in brain of Slc41a3+/+ (black bars),

Slc41a3+/- (striped bars) and Slc41a3-/- (white bars) mice fed with a low or normal Mg2+-containing

diet for 14 days were measured by quantitative RT-PCR and normalized for Gapdh expression. Data

0. 0

0. 5

1. 0

1. 5C

olon

Trp

m6

mRN

A e

xpre

ssio

n(fo

ld c

hang

e co

mpa

red

to +

/+)

0

1

2

3

4

5

Col

on C

nnm

4 m

RNA

exp

ress

ion

(fold

cha

nge

com

pare

d to

+/+

)

0

1

2

3

4

5

Col

on S

lc41

a1 m

RNA

exp

ress

ion

(fold

cha

nge

com

pare

d to

+/+

)

0

1

2

3

Col

on T

rpm

7 m

RNA

exp

ress

ion

(fold

cha

nge

com

pare

d to

+/+

)

*

A

C

B

D* *

*

Normal M

g2+

Low M

g2+

Normal M

g2+

Low M

g2+

Normal M

g2+

Low M

g2+

Normal M

g2+

Low M

g2+

BA

0

1

2

3

4

Trpm

7 m

RNA

exp

ress

ion

0

1

2

3

Slc4

1a1

mRN

A e

xpre

ssio

n

p=0.06

Normal M

g2+

Low M

g2+

Normal M

g2+

Low M

g2+


Figure 8 Increased Expression of Intestinal Mg2+ Transporters Compensate for Slc41a3 KO

A, 60 min intestinal 25Mg2+ absorption in Slc41a3+/+ (solid line) and Slc41a3-/- (dashed line) mice after

10 days on low Mg2+ diets, B-E, The mRNA expression levels of Trpm6 (B,D) and Slc41a1 (C,E) in du-

odenum (B-C) or colon (D-E) of Slc41a3+/+ and Slc41a3-/- mice fed with a low Mg2+-containing diet

for 10 days were measured by quantitative RT-PCR and normalized for Gapdh expression. Values

are presented as means ± SEM (n=10). *P < 0.05 is considered statistically significant compared to

Slc41a3+/+ mice.

A

0 10 20 30 40 50 60

Time (min)

8

10

12

14

16

18

20

22

24

25M

g2+ u

ptak

e (%

of

Tota

l Mg2+

)

Slc41a

3+/+

0

1

2

3

4

5

Duo

denu

m T

rpm

6 m

RNA

exp

ress

ion

(fold

cha

nge

com

par

ed to

SLC

41A

3+/+

)

Slc41a

3–/–

0

1

2

3

4

Col

on T

rpm

6 m

RNA

exp

ress

ion

(fold

cha

nge

com

par

ed to

SLC

41A

3+/+

)

Slc41a

3+/+

Slc41a

3–/–

0

1

2

3

4

Duo

denu

m S

lc41

a1 m

RNA

exp

ress

ion

(fold

cha

nge

com

par

ed to

SLC

41A

3+/+

)

Slc41a

3+/+

Slc41a

3–/–

0

1

2

3

4

5

Col

on S

lc41

a1 m

RNA

exp

ress

ion

(fold

cha

nge

com

par

ed to

SLC

41A

3+/+

)

Slc41a

3+/+

Slc41a

3–/–

B

D

C

E

* *

* *

represent means (n=10) ± SEM and are expressed fold difference when compared to the expres-

sion in normal diet fed Slc41a3+/+ mice. *P < 0.05 indicates a statistically significance compared to

Slc41a3+/+ mice fed the same diet.

124 | Chapter 5

expression levels of Trpm6 and Slc41a1 to examine the role of other Mg2+ transporters in intestinal Mg2+ uptake showed that the expression of these genes was significantly increased in both colon and duodenum of Slc41a3-/- mice (Figure 8B-E).

Discussion

This study identified SLC41A3 as a novel and essential player in Mg2+ homeostasis in general and in particular in renal Mg2+ transport. This conclusion is based on the following results: i) Slc41a3 is expressed in the kidney and intestine where Mg2+ is (re)absorbed; ii) Slc41a3-/- mice suffer from hypomagnesemia and normomagnesiuria indicating a renal Mg2+ leak; iii) Intestinal Mg2+ absorption is not altered in Slc41a3-/- mice; iv) Upregulation of Mg2+ transporters including Trpm6 and Slc41a1 in the intestine of Slc41a3-/- mice compensates for loss of SLC41A3 function. The urine electrolyte levels in Slc41a3-/- mice point to a specific renal Mg2+ leak and copies the phenotype of patients with renal Mg2+ wasting (7, 26, 33), namely low serum Mg2+ levels accompanied by normal urinary Mg2+ excretion. Under normal physiological circumstances, renal Mg2+ excretion is diminished to compensate reduced blood Mg2+ levels. However, the Slc41a3-/- mice failed to counteract their urinary Mg2+ excretion. Additionally, the intestinal 25Mg2+ absorption after dietary Mg2+ deficiency was normal in Slc41a3-/- mice, suggesting that the hypomagnesemia in Slc41a3-/- mice is indeed due to renal Mg2+ wasting. The renal Mg2+ wasting in Slc41a3-/- mice can presumably be explained by impaired DCT function. In kidney, Slc41a3 was, in contrast to its close homologue

Slc41a1, highly enriched in DCT. Likewise, the expression of Slc41a3, but not Slc41a1, in DCT is highly dependent on dietary Mg2+ intake (3). These results are comparable to the established findings concerning the Mg2+ channels TRPM6 and TRPM7. TRPM6 provides the specific apical Mg2+ uptake mechanism in intestine and kidney (6, 30, 31). Hence, the expression of TRPM6 is localized to the colon and the DCT and highly regulated by dietary Mg2+ availability (6). In contrast, TRPM7 is ubiquitously expressed and is involved in basic cellular Mg2+ handling (23, 27). Its expression is therefore insensitive to dietary Mg2+ changes (6). A comparable mechanism could apply to SLC41 proteins, in which SLC41A3 would be specific for epithelial Mg2+ uptake in colon and DCT and SLC41A1 would serve as ubiquitously expressed general Mg2+ transporter. The molecular function of SLC41A3 in DCT remains elusive. SLC41A3 activity has only been examined in Xenopus laevis oocytes by voltage-clamp, showing Mg2+-evoked currents with a Km within the physiological range (22). However, when overexpressed in HEK293 cells Mg2+ currents could not be detected (unpublished data from our lab). The function of the close homologue SLC41A1 has been examined in more detail. As SLC41A3, SLC41A1 mediates Mg2+-evoked currents in Xenopus laevis oocytes (5). Moreover, its Mg2+ transport capacity was further established in the TRPM7-deficient DT40 cell line, where


SLC41A1 can restore cell growth (24). Importantly, recent data suggest that SLC41A1 acts as a Na+/Mg2+-exchanger (13). If SLC41 proteins indeed function as basolateral Mg2+ exchangers, knockout of Slc41a3 in the DCT region would seriously reduce the extrusion of Mg2+ across the basolateral membrane. As a consequence, intracellular Mg2+ concentrations will increase, preventing transcriptional activation of magnesiotropic genes. This could explain why the expression of DCT transcripts such as Trpm6, Egf and Parvalbumin were not altered in Slc41a3-/- mice. Moreover, these genes are mainly involved in apical uptake of Mg2+ and will, therefore, not be able to rescue the basolateral extrusion of Mg2+. Although Slc41a3 is expressed in the small intestine, Slc41a3-/- mice exhibited normal intestinal Mg2+ absorption compared to their wild type littermates. However, the expression of Mg2+ transporters Slc41a1 and Trpm6 was increased in duodenum of Slc41a3-/- mice, suggesting that loss of SLC41A3 function induces a compensatory mechanism to facilitate normal Mg2+ uptake. Specifically, the upregulation of Slc41a1 is of interest because the structure of SLC41A1 is largely similar to SLC41A3 (17). Importantly, the pore region of SLC41A1 and SLC41A3 proteins is conserved from MgtE bacterial Mg2+ channels and essential for their function (9, 17, 32). If the increased expression of Slc41a1 indeed compensates for defects in intestinal Mg2+ absorption Slc41a3-/- mice, this would suggest that SLC41A1 and SLC41A3 are functionally redundant. Future in vitro studies should substantiate this hypothesis. The development of hydronephrosis in Slc41a3-/- mice is one of the striking findings of our study. H&E stainings showed transitional epithelia including umbrella cells lining the hydronephrotic region, excluding a cystic origin of the kidney malformation (1). However important parts of the lining tissue of the hydronephrosis were not covered with transitional epithelium, but with a layer of fibrous connective tissue that normally originates from the renal capsule. A similar phenotype of perinephric pseudocysts, in which fluid accumulates in a fibrous sac surrounding the kidney, has been observed previously in humans, mice and cats (2, 20, 21). In a previously described C57BL/6J mouse, extensive histological analysis showed that unilateral perinephric pseudocyst can be formed from an initial hydronephrosis that at some point ruptures when the integrity of the lining wall is compromised (20). The urine may then leak into the subcapsular space between the renal capsule and the remnant kidney. In concordance with these findings, histological analysis of the Slc41a3-/- mice demonstrated both transitional epithelium and connective tissue lining the cavity, suggesting that an initial hydronephrosis may have ruptured resulting in a perinephric pseudocyst. However, the absence of transitional epithelium may also be explained by atrophy due to the pressure of the hydronephrosis. Future extensive histological studies should further address this issue. Hydronephrosis is normally the consequence of obstruction of the ureter resulting in fluid retention in the renal calyx and pelvis (19). The cause of the obstruction in Slc41a3-/- mice could not be identified. Importantly, only a subset of the Slc41a3-/- mice developed hydronephrosis, suggesting that Slc41a3-/- mice are more sensitive to the development of

126 | Chapter 5

hydronephrosis, but that knockout of SLC41A3 is not causative of hydronephrosis per se. Speculatively, the dietary Mg2+ availability could have contributed to the development of the hydronephrosis, since hydronephrosis was only detected in mice fed a Mg2+-deficient diet. It is widely acknowledged that Mg2+ can prevent urolithiasis by reducing the formation of calcium oxalate (CaC2O4) and calcium phosphate (Ca(H2PO4)2) stones and deposits (8, 11, 29). Urolithiasis can cause obstruction of the ureter and, therefore, result in hydronephrosis (16). However, alizarin red stainings did not show Ca2+ deposits in the ureter of Slc41a3-/- mice on the low Mg2+ diet despite their extremely low urinary Mg2+ excretion. H&E stainings demonstrate the presence of large cells in the ureter that might obstruct the flow of urine. Future studies should address the origin of these cells and whether these cells are causing hydronephrosis in Slc41a3-/- mice. Interestingly, a mutation of SLC41A1 was recently shown to be causative for a nephro-nophthisis-like (NPHP-like) phenotype in an Italian family (10). The kidneys of the patients showed irregular echogenicity when examined by kidney ultrasonography (10), suggesting kidney abnormalities such as renal cysts or hydronephrosis. However, hydronephrosis could be excluded by subsequent histological analysis, which showed periglomerular fibrosis, tubular ectasia, tubular basement membrane disruption and tubulointerstitial infiltrations (10). The aforementioned signs of inflammation and fibrosis were absent in the remnant kidney tissue of Slc41a3-/- mice. Moreover, in contrast to the NPHP-like phenotype in SLC41A1 patients, the kidney size was markedly increased in the Slc41a3-/- mice that suffered from hydronephrosis. More SLC41A1 patients should be identified and closely examined for hydronephrosis to allow final conclusions on the kidney phenotype of these patients. In conclusion, SLC41A3 is novel player in renal and intestinal Mg2+ (re)absorption and a new factor in the formation of hydronephrosis. Consequently, SLC41A3 should be included in genetic screenings for hypomagnesemic patients. Future studies should further investigate the interaction between Mg2+ homeostasis and the formation of hydronephrosis.

AcknowledgementsThe authors acknowledge the technical contributions of Karin de Haas-Cremers, Maikel School, Hans Meijer, Caro Bos, Anke Hoefnagels, Stijn Elbers, Cas van der Made and Julia van Tuijl. We thank Dr. Francisco Arjona-Madueño for stimulating discussions. This work was supported by grants from the Netherlands Organization for Scientific Research (ZonMw 9120.8026, NWO ALW 818.02.001, VICI 016.130.668), the EURenOmics project from the European Union seventh Framework Programme (FP7/2007–2013, agreement nu 305608).


Methods

Expression AnalysisThree C57BL/6 mice were sacrificed; kidney, duodenum, ileum, jejunum, cecum, colon, brain, lung, liver, spleen, muscle, and heart tissues were collected. For the collection of DCT material, transgenic parvalbumin-eGFP mice were used as described previously (kind gift from Dr. Monyer, University of Heidelberg, Germany)(18). In short, mice were anesthetized by a mixture injection of domitor (0.01 mg/g of body weight) and ketamine (0.1 mg/g of body weight). Subsequently, the mice were perfused with 10 mL of Krebs buffer (in mmol/L: 145 NaCl, 5 KCl, 10 HEPES/NaOH pH 7.4, 1 NaH2PO4, 2.5 CaCl2, 1.8 MgSO4, 5 glucose) through the heart. The kidneys were removed, minced, and digested in collagenase (1 mg/mL collagenase A (Worthington, Lakewood, NJ, USA), 0.6 mg/mL hyaluronidase) in Krebs buffer. The digested tubules sized between 40 and 100 µm were sorted based on GFP fluorescence by COPAS (Complex Object Parametric Analysis and Sorting, Union Biometrica, Holliston, MA, USA). Per mouse, 4,000 eGFP-positive fluorescent DCT tubules were collected, and an additional 4,000 control tubules were sorted from the same kidney sample without selection for eGFP-positive cells.

RNA IsolationTotal RNA was isolated using TRIzol total RNA isolation agent (Invitrogen, Bleiswijk, the Netherlands) according to the manufacturer’s protocol. Obtained RNA was treated with DNase (Promega, Fitchburg, WI, USA) to remove genomic DNA. Subsequently, reverse transcription of the mRNA by M-MLV reverse transcriptase (Invitrogen, Bleiswijk, the Netherlands) was performed for 1 hr at 37 °C.

Real Time PCRGene expression levels were determined by quantitative real-time PCR on a BioRad (Hercules, CA, USA) analyzer using sybrgreen and normalized for Gapdh expression levels. Primer sequences are provided in Table 2.

AnimalsAll experiments were performed in compliance with the animal ethics board of the Radboud University Nijmegen. Heterozygous male and female (Slc41a3+/–) mice of the Sl-c41a3tm1a(KOMP)Wtsi strain were purchased from Knock Out Mouse Project repository (KOMP, Davis, CA, USA MGI: 1918949) and crossbred to C57Bl/6N wild-type mice. The heterozygous offspring was used to generate Slc41a3–/– mice. Littermates were housed in a temperature- and light-controlled room with standard pellet chow and deionized drinking water available ad libitum.

128 | Chapter 5

Diet study20 Slc41a3+/+, 20 Slc41a3+/- and 20 Slc41a3-/- mice aged between 8-12 weeks were randomly selected for this experiment (50 % male, 50 % female). The animals were housed in metabolic cages for 48 hrs (24 hrs adaptation, 24 hrs sampling) prior to collect urine and feces. Subsequently, the mice were randomly divided to a group and fed with normal (0.19 % (wt/wt) Mg2+, SSNIFF Spezialitäten GmbH, Soest, Germany) and low Mg2+ diets (0.02 % (wt/wt) Mg2+, SSNIFF) (n=10 per group per genotype) for 14 days. Blood samples were taken before and after the diets via submandibular facial vein puncture. The last 48 hrs of the experiment the animals were housed in the metabolic cages again to collect urine and feces. Then, animals were sacrificed, blood was collected and kidney, brain and colon tissues were sampled and frozen immediately in liquid nitrogen for further analysis.

25Mg2+ Absorption StudyIntestinal absorption of Mg2+ was measured by analyzing serum 25Mg2+ as percentage of total Mg2+. In short, 20 male animals aged 8-10 weeks (10 Slc41a3+/+, 10 Slc41a3-/-) were fasted (food, not water) overnight on wire-mesh raised floors to prevent coprophagia. At time-point 0, mice were administered a solution containing 44 mmol/L 25Mg2+ (MgO, isotopic enrichment of > 98 %, CortectNet, Voisins-Le-Bretonneux, France), 125 mmol/L NaCl, 17 mmol/L Tris/HCl pH 7.5, 1.8 g/L fructose. Animals were administered a volume of 15 uL/g bodyweight via oral gavage. Subsequently, blood was taken at serial time-points via a small tail-cut and collected in Microvette serum tubes (Sarstedt, Etten-Leur, The Netherlands). After serum collection from the coagulated blood samples, sera were

Table 2 Primer Sequences for RT-PCR Analysis

Forward primer Reverse primer


Slc41a1 5’-CATCCCACACGCCTTCCTGC-3’ 5’-CGGCTGGCCTGCACAGCCAC-3’

Slc41a2 5’-TGGCATGGTTTTGGACATAG-3’ 5’-AGCGTCATTTCCAAGTTTCC-3’

Slc41a3 5’-TGAAGGGAAACCTGGAAATG-3’ 5’-GGTTGCTGCTGATGATTTTG-3’


Trpm7 5’-GGTTCCTCCTGTGGTGCCTT-3’ 5’-CCCCATGTCGTCTCTGTCGT-3’

Cnnm2 5’-GGAGGATACGAACGACGTG-3’ 5’-TTGATGTTCTGCCCGTACAC-3’

Cnnm4 5’-TCTGGGCCAGTATGTCTCTG-3’ 5’-CACAGCCATCGAAGGTAGG-3’

Parvalbumin 5’-CGCTGAGGACATCAAGAAGG-3’ 5’-AGCTTTCAGCCACCAGAGTG-3’

Egf 5’-GAGTTGCCCTGACTCTACCG-3’ 5’-CCACCATTGAGGCAGTATCC-3’


Cldn16 5’-GTTGCAGGGACCACATTAC-3’ 5’-GAGGAGCGTTCGACGTAAAC-3’

Cldn19 5’-GGTTCCTTTCTCTGCTGCAC-3’ 5’-CGGGCAACTTAACAACAGG-3’


digested in nitric acid (65 % concentrated, Sigma, Zwijndrecht, The Netherlands) for 1 hr at 70 ºC followed by an overnight incubation at room temperature. Subsequently, samples were diluted in milliQ and subjected to ICP-MS analysis (X1 series, Thermo Fisher Scientific, Breda, The Netherlands).

HistologyAfter the sampling, the tissues specimens were immediately fixed in 4 % PFA (w/v) and embedded in paraffin or frozen in liquid nitrogen. 5 mm sections were cut in embedding media (Tissue-Tek, OCT medium, Sakura, Alphen aan den Rijn, The Netherlands), mounted onto Superfrost Plus slides (Thermo Scientific, Menzel-Glaser, Braunschweig, Germany) and stored at -20 °C. Paraffin sections were deparaffinized and rehydrated and stained with a hematoxylin and eosin (H&E) staining. Slides were put in hematoxillin and differentiated in tapwater. Thereafter the slides were counterstained with eosin Y, dehydrated and mounted. Pictures were made with a Zeiss (Oberkochen, Germany) microscope.

Β-galactosidase Staining Slides were pretreated for immunohistochemistry with 10 mmol/L sodium citrate. Endogen peroxidase was blocked with 0.3 % (v/v) H2O2 and endogen biotin was blocked with avidin-biotin (Vector Laboratories, SP-2001, Burlingame, CA, USA). Rabbit anti-NCC antibody (1:2000;, Millipore, Darmstadt, Germany) was incubated ON in 1 % (w/v) BSA in PBS and labeled with goat anti-rabbit-biotin-SP secondary antibody and coupled to horseradish peroxidase (HRP). NCC was visualized with 3,3’-Diaminobenzidine (DAB). To visualize the LacZ insert in the Slc41a3-/- animals, tissue was rinsed in PBS containing 2 mmol/L MgCl2, thereafter the slides were incubated overnight with staining solution containing 10 mg/mL 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal, in di-methylformamide), 35 mmol/L potassium ferrocyanide, 35 mmol/L potassium ferricyanide, 2 mmol/L MgCl2, 0.01 % (w/v) deoxycholate and 0.02 % (v/v) NP40 in PBS. After incubation slides were rinsed in PBS containing 2 mmol/L MgCl2, and mounted for analysis.

Alizarin Red StainingSlides were pretreated for alizarin red staining with 50 % ethanol. Subsequently, cells were stained with alizarin red (2 % (v/v)) for 5 min. After staining, the slides were rinced with acetone and xylene and mounted for analysis.

Mg2+ and Ca2+ MeasurementsSerum and urine total Mg2+ and Ca2+ concentrations were determined using a colorimetric assay kit according to the manufacturer’s protocol (Roche Diagnostics, Woerden, The Netherlands). Urine volume was measured to calculate 24 hrs excretion.

130 | Chapter 5

Statistical AnalysisData are expressed as mean ± SEM. Statistical comparisons were analyzed by two-way ANOVA with a Tukey’s multiple comparison test or by unpaired student’s t-test. P < 0.05 was considered statistically significant.


References1. Bisceglia M, Galliani CA, Senger C, Stallone C, Sessa A. Renal Cystic Diseases: A REVIEW. Advances in

Anatomic Pathology 13: 26–56, 2006.2. Chew DJ, DiBartola SP, Schenck P. Canine and Feline Nephrology and Urology. Elsevier Health Sciences, 2010.3. de Baaij JHF, Groot Koerkamp MJ, Lavrijsen M, van Zeeland F, Meijer H, Holstege FCP, Bindels RJM,

Hoenderop JGJ. Elucidation of the distal convoluted tubule transcriptome identifies new candidate genes involved in renal Mg(2+) handling. Am. J. Physiol. Renal Physiol. 305: F1563–73, 2013.


5. Goytain A, Quamme GA. Functional characterization of human SLC41A1, a Mg2+ transporter with similarity to prokaryotic MgtE Mg2+ transporters. Physiol. Genomics 21: 337–342, 2005.

6. Groenestege WMT, Hoenderop JG, van den Heuvel L, Knoers N, Bindels RJ. The epithelial Mg2+ channel transient receptor potential melastatin 6 is regulated by dietary Mg2+ content and estrogens. J. Am. Soc. Nephrol. 17: 1035–1043, 2006.

7. Groenestege WMT, Thébault S, van der Wijst J, van den Berg D, Janssen R, Tejpar S, van den Heuvel LP, van Cutsem E, Hoenderop JG, Knoers NV, Bindels RJ. Impaired basolateral sorting of pro-EGF causes isolated recessive renal hypomagnesemia. J Clin Invest 117: 2260–2267, 2007.

8. Gyawali PR, Joshi BR, Gurung CK. Correlation of calcium, phosphorus, uric acid and magnesium level in serum and 24 hours urine of patients with urolithiasis. Kathmandu Univ Med J (KUMJ) 9: 54–56, 2011.

9. Hattori M, Tanaka Y, Fukai S, Ishitani R, Nureki O. Crystal structure of the MgtE Mg2+ transporter. Nature 448: 1072–1075, 2007.

10. Hurd TW, Otto EA, Mishima E, Gee HY, Inoue H, Inazu M, Yamada H, Halbritter J, Seki G, Konishi M, Zhou W, Yamane T, Murakami S, Caridi G, Ghiggeri G, Abe T, Hildebrandt F. Mutation of the Mg2+ Transporter SLC41A1 Results in a Nephronophthisis-Like Phenotype. J. Am. Soc. Nephrol. 24: 967–977, 2013.

11. Kato Y, Yamaguchi S, Yachiku S, Nakazono S, Hori J-I, Wada N, Hou K. Changes in urinary parameters after oral administration of potassium-sodium citrate and magnesium oxide to prevent urolithiasis. Urology 63: 7–11– discussion 11–2, 2004.

12. Kolisek M, Launay P, Beck A, Sponder G, Serafini N, Brenkus M, Froschauer EM, Martens H, Fleig A, Schweigel M. SLC41A1 is a novel mammalian Mg2+ carrier. J. Biol. Chem. 283: 16235–16247, 2008.

13. Kolisek M, Nestler A, Vormann J, Schweigel-Röntgen M. Human gene SLC41A1 encodes for the Na+/Mg2+ exchanger. American Journal of Physiology - Cell Physiology 302: C318–C326, 2012.

14. Kolisek M, Sponder G, Mastrototaro L, Smorodchenko A, Launay P, Vormann J, Schweigel-Röntgen M. Substitution p.A350V in Na+/Mg2+ Exchanger SLC41A1, Potentially Associated with Parkinson’s Disease, Is a Gain-of-Function Mutation. 8: e71096, 2013.

15. Lameris AL, Monnens LA, Bindels RJ, Hoenderop JGJ. Drug-induced alterations in Mg2+ homoeostasis. Clin. Sci. 123: 1–14, 2012.

16. Lin EP, Bhatt S, Dogra VS, Rubens DJ. Sonography of Urolithiasis and Hydronephrosis. Ultrasound Clinics 2: 1–16, 2007.

17. Mandt T, Song Y, Scharenberg AM, Sahni J. SLC41A1 Mg 2+transport is regulated via Mg 2+-dependent endosomal recycling through its N-terminal cytoplasmic domain. Biochem. J. 439: 129–139, 2011.

18. Markadieu N, San-Cristobal P, Nair AV, Verkaart S, Lenssen E, Tudpor K, van Zeeland F, Loffing J, Bindels RJM, Hoenderop JGJ. A primary culture of distal convoluted tubules expressing functional thia-zide-sensitive NaCl transport. Am. J. Physiol. Renal Physiol. 303: F886–92, 2012.

19. McDougal WS, Wein AJ, Kavoussi LR, Novick AC, Partin AW, Peters CA, Ramchandani P. Campbell-Walsh Urology 10th Edition Review. Elsevier Health Sciences, 2011.

20. Meyerholz DK, Hostetter SJ. Unilateral perinephric pseudocyst secondary to hydronephrosis in a C57BL/6J mouse. Vet. Pathol. 42: 496–498, 2005.

21. Meyers MA. Uriniferous perirenal pseudocyst: new observations. Radiology 117: 539–545, 1975.22. Quamme GA. Molecular identification of ancient and modern mammalian magnesium transporters.

American Journal of Physiology - Cell Physiology 298: C407–C429, 2010.

132 | Chapter 5

23. Runnels LW, Yue L, Clapham DE. TRP-PLIK, a bifunctional protein with kinase and ion channel activities. Science 291: 1043–1047, 2001.

24. Sahni J, Scharenberg AM. The SLC41 family of MgtE-like magnesium transporters. Mol. Aspects Med. 34: 620–628, 2013.

25. Satake W, Nakabayashi Y, Mizuta I, Hirota Y, Ito C, Kubo M, Kawaguchi T, Tsunoda T, Watanabe M, Takeda A, Tomiyama H, Nakashima K, Hasegawa K, Obata F, Yoshikawa T, Kawakami H, Sakoda S, Yamamoto M, Hattori N, Murata M, Nakamura Y, Toda T. Genome-wide association study identifies common variants at four loci as genetic risk factors for Parkinson’s disease. Nat. Genet. 41: 1303–1307, 2009.

26. Schlingmann KP, Weber S, Peters M, Niemann Nejsum L, Vitzthum H, Klingel K, Kratz M, Haddad E, Ristoff E, Dinour D, Syrrou M, Nielsen S, Sassen M, Waldegger S, Seyberth HW, Konrad M. Hypomagnesemia with secondary hypocalcemia is caused by mutations in TRPM6, a new member of the TRPM gene family. Nat. Genet. 31: 166–170, 2002.

27. Schmitz C, Perraud A-L, Johnson CO, Inabe K, Smith MK, Penner R, Kurosaki T, Fleig A, Scharenberg AM. Regulation of vertebrate cellular Mg2+ homeostasis by TRPM7. Cell 114: 191–200, 2003.

28. Sponder G, Rutschmann K, Kolisek M. “Inside-in” or ‘inside-out’? The membrane topology of SLC41A1. Magnesium Research 26: 176–181, 2013.

29. Su CJ, Shevock PN, Khan SR, Hackett RL. Effect of magnesium on calcium oxalate urolithiasis. J. Urol. 145: 1092–1095, 1991.

30. van der Wijst J, Hoenderop JGJ, Bindels RJM. Epithelial Mg2+ channel TRPM6: insight into the molecular regulation. Magnesium Research 22: 127–132, 2009.

31. Voets T, Nilius B, Hoefs S, van der Kemp AWCM, Droogmans G, Bindels RJM, Hoenderop JGJ. TRPM6 forms the Mg2+ influx channel involved in intestinal and renal Mg2+ absorption. J. Biol. Chem. 279: 19–25, 2004.

32. Wabakken T, Rian E, Kveine M, Aasheim H-C. The human solute carrier SLC41A1 belongs to a novel eukaryotic subfamily with homology to prokaryotic MgtE Mg2+ transporters. Biochem. Biophys. Res. Commun. 306: 718–724, 2003.

33. Walder RY, Landau D, Meyer P, Shalev H, Tsolia M, Borochowitz Z, Boettger MB, Beck GE, Englehardt RK, Carmi R, Sheffield VC. Mutation of TRPM6 causes familial hypomagnesemia with secondary hypocalcemia. Nat. Genet. 31: 171–174, 2002.

34. Yan Y, Tian J, Mo X, Zhao G, Yin X, Pu J, Zhang B. Genetic Variants in the RAB7L1 and SLC41A1 Genes of the PARK16 Locus in Chinese Parkinson’s Disease Patients. Int J Neurosci 121: 632–636, 2011.

35. The Mouse Genome Database: integration of and access to knowledge about the laboratory mouse. Nucl. Acids Res. 42: D810–7, 2014.

136 | Chapter 6

Abstract

Recently, mutations in the Cyclin M2 (CNNM2) gene were identified to be causative for severe hypomagnesemia. In kidney, CNNM2 is a basolaterally expressed protein with predominant expression in the distal convoluted tubule (DCT). Transcellular magnesium (Mg2+) reabsorption in DCT represents the final step before Mg2+ is excreted into the urine, thus fine-tuning its final excretion via a tightly regulated mechanism. The present study aims to get insight in the structure of CNNM2 and to characterize its post-translational modifications. Here, membrane topology studies using intramolecular epitopes and immunocytochemistry showed that CNNM2 has an extracellular amino (N)-terminus and an intracellular carboxy (C)-terminus. This suggests that one of the predicted transmembrane regions might be reentrant. By homology modeling we demonstrated that the loss-of-function mutation as found in patients disturbs the potential ATP binding by the intracellular cysthationine β-synthase domains. In addition, the cellular processing pathway of CNNM2 was exposed in detail. In the endoplasmic reticulum, the signal peptidase complex cleaves off a large N-terminal signal peptide of about 64 amino acids. Mutagenesis screening showed that CNNM2 is glycosylated at residue p.Asn112 stabilizing CNNM2 on the plasma membrane. Interestingly, co-immuno-precipitation studies evidenced that CNNM2a forms heterodimers with the smaller isoform CNNM2b. These new findings on CNNM2 structure and processing may aid to elucidate the physiological role of CNNM2 in Mg2+ reabsorption in the kidney.

Keywords: CNNM2, Magnesium, Distal Convoluted Tubule, Hypomagnesemia, Kidney

Molecular Characterization of CNNM2 Structure | 137

Introduction

As the second most abundant intracellular cation in humans, magnesium (Mg2+) constitutes an essential co-factor in vital processes such as energy metabolism, DNA transcription and protein synthesis. Balance between intestinal absorption and renal excretion is tightly regulated to keep the plasma Mg2+ concentration in its physiological range (0.7-1.1 mmol/L) (7). Specifically, bulk Mg2+ reabsorption in kidney from the pro-urine is dependent on passive, paracellular transport in the proximal tubule (PT) and the thick ascending limb of Henle’s loop (TAL), whereas fine-tuning is achieved by active, transcellular transport in the distal convoluted tubule (DCT) (7). In the latter segment, tight regulation of Mg2+ transport will determine the final urinary Mg2+ excretion, since no Mg2+ reabsorption takes places beyond the DCT. The TRPM6 ion channel, expressed at the apical side of the DCT, constitutes the gatekeeper in active Mg2+ uptake (37), whereas a basolateral Mg2+ extrusion mechanism remains to be identified. Recently, mutations in the Cyclin M2 (CNNM2) gene were described leading to a dominant form of hypomagnesemia caused by renal Mg2+ wasting (32). Patients suffer from muscle weakness, tremor and headaches accompanied by low Mg2+ serum concentrations (0.3-0.5 mmol/L) (21, 32). Interestingly, no other electrolyte disturbance was detected (32). CNNM2, formerly known as Ancient Conserved Domain Protein 2 (ACDP2), belongs to the CNNM family consisting of four proteins (CNNM1-4) which share homology to cyclins, although no cyclin-related function has been described (40). Two predicted CNNM2 protein isoforms are conserved between man and mouse. Whereas the 875 amino acid CNNM2a is encoded by splice variant 1 (CNNM2v1, NM_017649), the 22 residues shorter isoform b is translated from splice variant 2 (CNNM2v2, NM_199076), which lacks exon 6. CNNM2 expressed in Xenopus laevis oocytes and in the Mg2+-deficient Salmonella enterica strain MM281, has been suggested to be involved in Mg2+ transport (8, 31). However, electro-physiological analysis using mammalian cells expressing CNNM2 showed Mg2+-sensitive Na+ currents instead of Mg2+ currents (32). This last finding could indicate that instead of transporting Mg2+ itself, CNNM2 might be involved in a Mg2+-sensing mechanism which, in turn, could regulate renal Mg2+ uptake. At present, no studies have been reported showing the structure of CNNM2, or any of the other CNNM family members. The aim of this study was to elucidate the membrane topology of CNNM2 and to provide a molecular characterization of the intracellular processing mechanisms.

Results

Expression Profile of the CNNM FamilyTo examine the transcript expression levels for Cnnm1-4 in various tissues, a mouse tissue cDNA panel was constructed and Cnnm mRNA expressions were quantified by real-time

138 | Chapter 6

PCR analysis. Gapdh expression was used to normalize values. Cnnm3v1 and Cnnm3v2

(containing an alternative last exon) show a ubiquitous expression pattern with highest expression in kidney, brain, lung, spleen and heart (Figure 1D-E). Cnnm1 expression is predominantly found in brain and testis (Figure 1A), whereas Cnnm4 shows highest expression along the gastrointestinal tract (Figure 1F). Interestingly, Cnnm2 shows a ubiquitous expression pattern with highest expression in kidney, lung, spleen and testis (Figure 1B-C). CNNM2A and CNNM2B (encoded by Cnnm2v1 and Cnnm2v2, lacking exon 6) share a similar pattern; only minor differences between the tissue expression levels were measured. Since CNNM2 has been described to be causative for hypomagnesemia due to excessive renal Mg2+ wasting (32), its kidney localization was investigated in detail. Using immunohistochemistry, co-expression of CNNM2 with markers of different distal nephron segments was examined: The Na+-K+-Cl--cotransporter (NKCC2, TAL), the thiazide-sensi-tive Na+-Cl--cotransporter (NCC, DCT), Calbindin-D28k (CaBP28K, CNT and cortical collecting duct (CCD)) and Aquaporin-2 (AQP2, collecting duct, CD). CNNM2 was expressed on the basolateral side of the cells (Figure 2A-D, green), opposed to the luminal expression of the marker proteins (Figure 2A-D, red). CNNM2 immunopositive tubules were negative for AQP2 staining, but did co-stain with NCC positive tubules. Only a part of the tubules positive for CaBP28k showed CNNM2 staining. Whereas most of NKCC2 positive tubules are negative for CNNM2, only a few NKCC2 positive tubules show faint CNNM2 staining. These results indicate that CNNM2 is predominantly expressed in DCT. mRNA expression levels measured by real-time PCR on GFP-sorted DCT and CNT tubules showed an equivalent pattern; expression of Cnnm2v1 and Cnnm2v2 was high in DCT and to a lesser extent also in the CNT (Figure 2E). As a control for DCT and CNT specificity of the mRNA, we examined the expression of the transcripts for the marker proteins TRPM6 and TRPV5 respectively (Figure 2E). These and previous results (32) indicate that CNNM2 is predominantly expressed basolaterally in DCT and also, but minorly, present in TAL and CNT (Figure 2F).

CNNM2 Has an Intracellular C-terminus Containing CBS DomainsThe consensus topology prediction for the plasma membrane protein CNNM2 indicates 5 potential transmembrane domains (TM) and an extracellular C-terminus (32), which would locate the cystathionine β-synthase (CBS) domains in an unprecedented, extracellular position. We decided to investigate the topology in detail using an intramolecular epitope strategy by expression of various epitope-tagged CNNM2 proteins (Figure 3A) in COS-7 cells with subsequent immunocytochemistry. A similar approach was used successfully to aid in the topology determination of other plasma membrane transporters like multidrug resistance proteins (17) and an iron transporter (6). Immunocytochemistry of cells overexpressing CNNM2a proteins with HA-epitopes at positions 211 (HA211), 745 (HA745) or at the extreme C-terminus revealed these proteins to be targeted to the plasma membrane of the cells (Figure 3B, upper panels), similar to the results obtained in MDCK-C7


cells (32). Importantly, C-terminally HA-tagged CNNM2b showed a localization that is un-distinguishable from that of CNNM2a, indicating that the absence of the amino acids translated from exon 6 does not influence sorting to the plasma membrane. To determine whether the epitopes are located on the inside or the outside of the cells, formaldehyde fixed cells, both intact and permeabilized, were immunostained for the HA-epitope. The HA-tag at position 211 could be detected on intact cells (Figure 3B, lower panels), indicating extracellular localization. On the contrary, detection of HA745 or

Figure 1 Tissue Expression Pattern of the CNNM Isoform-encoding Transcripts

A-F, The mRNA expression levels of Cnnm1 (A), Cnnm2 splice variant 1 (B), Cnnm2 splice variant 2

(C), Cnnm3 splice variant 1 (D), Cnnm3 splice variant 2 (E) and Cnnm4 (F) in a panel of mouse tissues

were measured by quantitative RT-PCR and normalized for Gapdh expression. Data represent the mean

of 3 individual experiments ± SEM and are expressed as the percentage of the total tissue expression.

A B

D

FE

0

30

Ileum

40

Kidney

Duodenum

Jejunum

Colon

Cecum

Brain

Lung

Liver

Spleen

Testi

s

Muscle

HeartCnnm

3v2

mRN

A Ex

pres

sion

(%

of T

otal

)

10

20

10

0

20

Ileum

30

Kidney

Duodenum

Jejunum

Colon

Cecum

Brain

Lung

Liver

Spleen

Testi

s

Muscle

HeartCnnm

2v1

mRN

A Ex

pres

sion

(%

of T

otal

)

10

0

20

Ileum

30

Kidney

Duodenum

Jejunum

Colon

Cecum

Brain

Lung

Liver

Spleen

Testi

s

Muscle

HeartCnnm

3v1

mRN

A Ex

pres

sion

(%

of T

otal

)

10

0

20

Ileum

30

Kidney

Duodenum

Jejunum

Colon

Cecum

Brain

Lung

Liver

Spleen

Testi

s

Muscle

Heart

Cnnm

4 m

RNA

Expr

essi

on

(% o

f Tot

al)

C

10

0

20

Ileum

30

Kidney

Duodenum

Jejunum

Colon

Cecum

Brain

Lung

Liver

Spleen

Testi

s

Muscle

Heart

Cnnm

2v2

mRN

A Ex

pres

sion

(%

of T

otal

)

30

20

10

0

40

Ileum

50

60

Duodenum

Jejunum

ColonBrai

nLu

ngLiv

er

Spleen

Testi

s

Muscle

Cnnm

1 m

RNA

Expr

essi

on

(% o

f Tot

al)

Heart

Kidney

Cecum

140 | Chapter 6

Figure 2 Kidney Expression Pattern of CNNM2 Shows Highest Expression in DCT

A-D, Double immunofluorescence staining of mouse kidney cortex sections for CNNM2 (in green)

and NKCC2 (A, red), NCC (B, red), Calbindin-D28k (C, red) or Aquaporin-2 (D, red). Bars represent

20 µm. E, The mRNA expression levels of Cnnm2v1 (black bars), Cnnm2v2 (white bars), Trpm6 (red

bars) and Trpv5 (green bars) in COPAS selected mouse DCT, CNT and control (none-selected) kidney

tubules were measured by quantitative RT-PCR and normalized for Gapdh expression. Data represent

the mean of 3 individual experiments ±SEM and are expressed as fold difference compared to the

expression in none-selected tubules. F, A schematic overview of marker protein kidney expression.

PT: Proximal Tubule, DTL: descending thin limb of Henle’s loop, ATL: ascending thin limb of Henle’s loop,

TAL: Thick Ascending Limb, DCT: Distal Convoluted Tubule, CNT: Connecting Tubule, CD: Collecting Duct.

A CNNM2

CNNM2

CNNM2

CNNM2 AQP2

CaBP 28K

NCC

NKCC2 merge

merge

merge

merge

B

CD

F

C

PT DTL ATL TAL DCT CNT CD

NCC

CaBP 28K

AQP2

NKCC2

CNNM2

E

6

4

2

0

8

DCT

12

14

Total Kidney CNT

mRN

A Ex

pres

sion

(Fol

d ov

er to

tal) 10

TRPM6

TRPV5

20 µ m

20 µ m 20 µ m

20 µ m 20 µ m

20 µ m


Figure 3 CNNM2 Topology Determination

A, Linear representation of the CNNM2 protein with domain structures based on Uniprot Q3TWN3.

Predicted TM domains are indicated in dark blue, CBS domains in purple and the exon 6 coding region,

which is absent in CNNM2b, in gray. The position of the epitope tags and the epitope recognized by the

Abcam 111351 antibody are indicated by narrow and wide arrow heads, respectively. B-E, Immuno-

fluorescence images of transiently transfected COS-7 cells. Bars represent 50 µm in each panel. Red signal

represents immunodetected HA-epitopes. Nuclei stained with DAPI are shown in blue. B, Permeabilized

(upper panels) and intact (lower panels) cells expressing, from left to right: CNNM2a with an HA-tag at

positions 211, 745 or at the C-terminus and CNNM2b with a C-terminal HA-tag. C, Cells, expressing CNNM2a

with an HA-tag at position 211, were additionally stained with Ab111351 (in green) under permeabilized

and non-permeabilized conditions (upper and lower panels, respectively). D, Permeabilized (top)

and intact (bottom) cells transfected with C-terminally HA-tagged CNNM4. E, Cells transfected with

C-terminally FLAG-tagged CNNM2a with an intramolecular HA-epitope at position 25. Immuno-

detection of permeabilized cells for the HA-tag (left), FLAG-tag (middle, in green) and the merged

image on the right are indicated.

A

B

C

E

D

142 | Chapter 6

the epitope at the C-terminus required cell permeabilization, suggesting that these latter two are located intracellularly. Similar results were obtained when living cells were incubated with anti-HA antibodies prior to fixation (Figure 4). As an alternative approach to confirm that the C-terminus is located intracellularly, cells that expressed HA211 were immunostained with Abcam antibody 111351, raised against amino acids 590-640, located just after the pair of CBS domains. Also here, the epitope could only be detected after permeabilization (Figure 3C), indicative for an intracellular position of the C-terminus that importantly includes the two CBS domains. To investigate whether the intracellular localization of the C-terminus is shared with other members of the CNNM family, the same permeabilization assay was performed on cells transfected with C-terminally HA-tagged CNNM4 (Figure 3D). Again, the plasma membrane staining was only observed after permeabilization, indicating that also for CNNM4, the C-terminus resides inside the cell. In conclusion, the CNNM2 protein has a membrane topology with its C-terminus inside of the cell.

The CNNM2 N-terminus Contains a Large Signal Peptide and a Glycosylation SiteWe observed that the HA-epitope at the extreme N-terminus or at position 25 of CNNM2a was not detected at the plasma membrane, but rather in distinct perinuclear structures (Figure 5), which suggested that the N-terminus might contain a signal peptide and, therefore, ultimately results in cleavage of the HA-epitope. To exclude incorrect processing of the recombinant protein, a construct was expressed with the HA-epitope at position 25 of CNNM2a and a FLAG-epitope at the C-terminus. We observed that the FLAG-epitope was correctly targeted at the plasma membrane, but the HA-epitope was retained in perinuclear structures (Figure 3E). Colocalization studies with an antibody against Calnexin (Figure 5B) showed that these perinuclear structures are part of the endoplasmic reticulum (ER), which is in line with the presence of a signal peptide. Signal peptide prediction software (SignalP, (3)) predicts a long N-terminal signal peptide of 64 amino acids. Examination of the N-terminally HA-tagged CNNM2 construct by immunoblotting confirmed that the CNNM2 N-terminus is cleaved (Figure 6A, upper panel), since the HA-tag was undetectable. Mutation of the predicted cleavage region

Figure 3 Continued

A

B

C

E

D


(p.Gly62/p.Cys63/p.Thr64/p.Ala65) to hydrophobic residues (p.Leu62/p.Leu63/p.Leu64/ p.Val65) marred this cleavage event, evidenced by detection of a HA-positive band in the mutant (Figure 6A, upper panel, right). To identify the exact cleavage site, constructs were generated in which the p.Cys63/p.Ala65 and the p.Gly62/p.Thr64 positions were mutated to hydrophobic amino acids. However, none of these two mutations were able to impair the cleavage of CNNM2 (Figure 6A, upper panel). To confirm that the signal peptidase complex (SPC, a protein complex expressed on the ER-membrane known to be involved in signal peptide cleavage) facilitates cleavage, an in vitro protein translation assay in presence of SPC inhibitor AAPV-CMK was performed. SPC inhibition by AAPV-CMK prevented signal peptide cleavage, as shown by a higher molecular weight on gel (MW, Figure 6B). Together, we conclude that SPC is responsible for CNNM2 signal peptide cleavage. In eukaryotic cells, trafficking of membrane proteins to the cell surface is often regulated by glycosylation of asparagine residues present in extracellular domains. To determine the CNNM2 glycosylation profile, four potential candidate asparagine residues were mutated to alanine; namely p.Asn112, p.Asn327, p.Asn527 and p.Asn591 (based on prediction software NetNGlyc 1.0, http://www.cbs.dtu.dk/services/NetNGlyc/). Subsequently, the presence of N-linked glycans in the mutants was discerned by immunoblotting the proteins after treatment with PNGase F, an enzyme causing N-glycan cleavage. The glyco -

Figure 4 Epitope Labelling of Living Cells Confirms Results on Fixed Cells

COS7 cells transfected with CNNM2a expression constructs with a HA-tag at positions 211 (HA211),

745 (HA745) or at the C-terminus (C-HA) showed correct targeting to the plasma membrane as

demonstrated by immunostaining (in red) after formaldehyde fixation and permeabilization (upper

panels). Immunostaining of living COS7 cells for the HA-epitope before fixation resulted in detection

of HA211 only (lower panels). Nuclei stained with DAPI are shown in blue, size bar represents 50 µm

in each panel.

intact (labeling of living cells)

permeabilized

144 | Chapter 6

sylated wild type CNNM2 runs at approximately 105 kDa, but PNGase F treatment reduced its MW to ±96 kDa (Figure 7A). Of all the candidates, only residue p.Asn112 was identified as a glycosylation target in CNNM2, since the p.Asn112A mutation resulted in a MW of 96 kDa (Figure 7A). PNGase F treatment did not cause a further reduction of the MW indicating that no N-glycan is present in this mutant. To determine the effect of the N-glycan at position 112 on membrane expression of the CNNM2 protein, cell surface biotinylation studies of the p.Asn112Ala mutant were performed (Figure 7B, left panel). A reduction of

Figure 5 The CNNM2 N-terminus is Retained in the Endoplasmic Reticulum

A, COS7 cells transfected with CNNM2a expression constructs with an HA-tag at the N-terminus

(N-HA) or at position 25 without (HA25) or with (HA25-FLAG) an additional C-terminal FLAG-tag

were permeabilized and co-immunostained with anti-HA (in red) and anti-Calnexin (CNX, in green).

Merged images on the right show colocalization (in yellow) of the HA-tag with perinuclear parts

of the ER. B, The identical experiment as shown in the lower panel of (A), except for the omission of the

primary antibody anti-CNX, excluding cross-staining of the anti-HA antibody. Nuclei stained with

DAPI are shown in blue. Size bars represent 25 µm in each panel.

A

B


90 % in plasma membrane expression of the CNNM2-N112A mutant was observed when compared to the wild type CNNM2 protein (Figure 7B, right panel), suggesting that p.Asn112 glycosylation is necessary for CNNM2 membrane stability. Taken together, the CNNM2 extracellular N-terminus provides important sites for post-translational modifications necessary for proper plasma membrane expression.

The C-terminal CBS Domains are Disrupted by the p.Thr568Ile Mutation One of the mutations recently described to be causative for hypomagnesemia is located in the CBS domains within the C-terminus (32). Therefore, emphasis was placed on determining the structure of the intracellular CBS domains (Figure 3A) that have been associated amongst others, with ATP binding (2). Here, we provide a homology model of the CNNM2 CBS domains based on the Bordetella Parapertussis CorC Mg2+/Co2+ efflux protein (Figure 8A). Analysis of this model showed conservation of the potential ATP binding site in the CBS dimer of CNNM2 (Figure 8A, ATP in yellow). Interestingly, the p.Thr568Ile mutation, identified in a Czech family to be causative for hypomagnesemia (32), is lining the ATP binding site in the CBS domain (Figure 8B). In our model, mutation of the threonine into the bigger isoleucine residue causes steric bumps with the ATP molecule. Besides that, T568 also forms a hydrogen bond that stabilizes the position of the p.Glu570 and p.Asp571 residues (Figure 8B, hydrogen bonds in yellow). These two residues form

Figure 6 The Signal Peptidase Complex Cleaves the CNNM2 Signal Peptide

A, Cleavage analysis of the CNNM2 protein by immunoblotting of double tagged CNNM2 transfected

HEK293 cells against the N-terminal HA-tag (upper blot). As a control for CNNM2 expression, the

CNNM2 C-terminus was targeted by immunoblotting against the VSV-tag (lower blot). Blot shown is

representative for 5 independent experiments. B, Coupled in vitro transcription/translation protein

synthesis of the CNNM2-HA protein in the presence (+) and absence (-) of SPC-inhibitor MeoSuc-

Ala-Ala-Pro-Val-Chloromethylketone (AAPV-CMK). Gel shown is representative for 3 independent

experiments.

A BAAPV-CMK – +

CNNM2

135

kDa

MU LCLA

MU GLTV

MU LLLV

97

97

Cleavage

Expression

Residues 62-65:

kDa

kDa

116

116

WT GCTA

Mock

100

72

146 | Chapter 6

important hydrogen bonds and ionic interactions to the ATP molecule and residues lining the ATP-binding pocket, respectively. According to the model, the patient’s p.Thr568Ile mutation will also affect the position of the p.Glu570 and p.Asp571 residues and could, therefore, severely affect ATP binding. In conclusion, this model might explain why the patient’s p.Thr568Ile mutation is causative for non-functional CNNM2.

CNNM2a and CNNM2b Form MultimersIn GenBank, two splice variants exist that are conserved between man and mouse, the first being full length, the second lacking exon 6. Interestingly, splice variant 2 was consistently found in conjunction with that of splice variant 1 in all tissues examined, including kidney (Figure 1). Further examination of potential interactions between CNNM2a

Figure 7 Glycosylation on Residue N112 Regulates CNNM2 Membrane Trafficking

A, Immunoblot of C-terminally HA-tagged wild type CNNM2 (WT) and CNNM2 glycosylation mutants

treated with (+) or without (-) PNGase F. B, Cell surface biotinylation of HEK293 cells expressing

HA-tagged wild type CNNM2 or glycosylation mutant p.Asn112Ala. A representative immunoblot

showing that glycosylation at position p.Asn112 is necessary for CNNM2 membrane expression

(upper blot), and a CNNM2 expression control (lower blot). On the right, a quantification by blot

intensities is shown of cell surface expression of CNNM2-WT (n=6) and CNNM2-p.Asn112Ala (n=6)

corrected for total protein expression. Error bars represent SEM; *P < 0.05 versus CNNM2-WT.

A

B

0Biot

inyl

ated

frac

tion

(% o

f CN

NM

2 W

T)

150

50

100

WT

N11

2A

*

WT N591AMock N112A N327A N527A

PNGase F + + + + + +

kDa

CNNM2 WT CNNM2 N112ABiotin co

ntrol

Mock

97

97

Cell Surface Expression

Total Protein Expression

kDa

kDa

116

116

97


Figure 8 The CBS Domains are Potentially Involved in ATP Binding

A, Homology model of the CBS domain pair of CNNM2, modeled using the structure of the CorC

Mg2+ and Co2+ efflux protein from Bordetella Parapertussis (PDB file 3jtf). The two CBS domain

monomers are shown in dark and light blue with the p.Thr568 highlighted in red. ATP is shown

in yellow. B, Detail of the ATP binding region in the CBS domain. ATP is shown in light blue in this

model. The wild type p.Thr568 residue is highlighted in green, the extra side-chain of the mutant

p.Ile568 is shown in red. Hydrogen bonds with the surrounding p.Glu570 and p.Asp571 residues are

demonstrated in yellow.

Figure 9 CNNM2a and CNNM2b Form Homo- and Heterotypic Interactions

A, Western blot analysis of CNNM2 protein showing CNNM2a and CNNM2b monomers at approximately

100 kDa and potential CNNM2 dimers at approximately 200 kDa. B, Co-immunoprecipitation studies

of CNNM proteins in COS-7 cells. C-terminal FLAG-tagged CNNM2a or CNNM2b were co-expressed

with C-terminal HA-tagged CNNM2a, CNNM2b or CNNM4 as indicated in the two top rows. The upper

blot shows the detection of the FLAG-tagged proteins in anti-HA precipitated cell lysates. The lower

two blots show input controls (10 %) of HA-tagged and FLAG-tagged proteins respectively. The results

shown are representative of three individual experiments.

A B

A

B

97

116

200

CN

NM

2a

CN

NM

2b

kDa

Moc

k

100

100

100

kDa

148 | Chapter 6

and CNNM2b was performed by studying the dimerization of CNNM2 isoforms. Interestingly, besides the CNNM2 monomer (with an expected MW of 105 kDa) (40), additional complexes were visualized in the immunoblot at approximately 200 kDa (Figure 9A). This molecular weight matches the mass of a hypothetical CNNM2 dimer. To confirm CNNM2 oligomerization events, co-immunoprecipitation assays of CNNM2 isoforms were performed. CNNM2a-HA and CNNM2b-HA were each able to co-immunoprecipitate both C-terminally FLAG-tagged CNNM2a and CNNM2b. CNNM4-HA only weakly co-immuno-precipitated, even though it was highly expressed, indicating the specificity of these interactions (Figure 9B). These data show that CNNM2a and CNNM2b are able to form specific homo- and hetero multimeric complexes.

Discussion

Mutations in CNNM2 have, recently, been described to be causative for a severe form of hypomagnesemia (32). Initially described as nuclear proteins involved in cell cycle regulation (40), the family of CNNM proteins has now been shown to reside at the plasma membrane (8, 32). Although their physiological role is still poorly understood, all members are likely involved in electrolyte homeostasis. CNNM1 has been identified as a cytosolic copper chaperone, CNNM2 was shown to mediate Mg2+-sensitive Na+ currents in HEK293 cells and CNNM2, CNNM3 and CNNM4 have been linked with serum Mg2+ levels (1, 23, 32). Furthermore, CNNM2 has been associated with coronary artery disease and hypertension (24, 30, 33). Finally, mutations in CNNM4 were shown to be causative for recessive cone-rod dystrophy with amelogenesis imperfecta (28, 29). In the present study, we aimed to elucidate the CNNM2 protein topology and characterize its post-translational modifications. Although Gómez García and colleagues have been working on structural elucidation of the CBS domains of CNNM4 (9), complete structural information for any of the CNNM proteins is presently unknown. Using immunocytochemical methods we examined the membrane topology of CNNM2. Based on our results showing an extracellular N-terminus and an intracellular C-terminus (Figure 3), we propose a structure comparable to that of the glutamate receptor (GluR) ion channels (34), containing 3 full membrane-spanning regions and an additional reentrant loop. In silico analysis of the CNNM2 protein sequence showed that of the 4 hydrophobic regions, the second one is the shortest and the least hydrophobic, indicating that the second hydrophobic region might not be completely membrane-spanning, but instead forms a reentrant loop (Figure 10). Similar to the GluR family, CNNM2 contains an N-terminal signal peptide that is cleaved in the ER. Here, the SPC seems to be the protease complex responsible for CNNM2 cleavage (Figure 6B). The human SPC is a complex of five proteins expressed on the ER membrane and recruited post-translationally to the signal recognition particle (SRP) to perform signal peptide cleavage (27). Our results do not identify the exact position of the


cleavage site. Signal peptide recognition is known to be dependent on the residues at positions -1 and -3 of the actual cleavage site (25). Nevertheless, conversion of the -1 and -3 position of the predicted site (p.Gly62/p.Thr64) to hydrophobic residues did not prevent cleavage. Likewise, the cleavage was also not impaired when the alternative cleavage site (p.Cys63/p.Ala65) was mutated. Only mutation of both sites prevented CNNM2 cleavage, suggesting that the SPC can cleave CNNM2 at the preferential site between p.Thr64 and p.Ala65, but also at an alternate site between p.Ala65 and p.Ala66. Thus, CNNM2 contains a remarkable lengthy signal peptide of approximately 64 amino acids. Long signal peptides have been associated with multiple functions, but might serve as a mechanism to achieve proper membrane insertion of the protein (12). This also suggests that the first predicted transmembrane domain (Figure 3A), actually represents the hydrophobic core of the signal peptide that, after cleavage, will remain at the ER membrane (Figure 10). After cleavage in the ER, CNNM2 is further processed by glycosylation in the Golgi apparatus. N-glycosylation is known to facilitate plasma membrane trafficking for several membrane proteins (35). Here, p.Asn112 was identified as the residue that is glycosylated and implicated in CNNM2 membrane stability (Figure 7A-B). This can be interpreted as an additional argument showing that the N-terminus is located on the extracellular side of

Figure 10 Schematical Model of CNNM2 Structure

Model representing the structure of the CNNM2 protein at the plasma membrane and showing

the signal peptide cleavage in the endoplasmic reticulum. Crosses represent the locations of

the mutations. The glycosylation site at position p.Asn112 is shown in the extracellular N-terminus.

The CBS domains are represented in purple binding ATP in red.

ER: endoplasmic reticulum SP: signal peptide TM: transmembrane helix CBS: cysthationine β-synthase domain.

TM2 TM3

CBS1

CBS2

CBS1TM1

TM2TM3

SPCBS2

ER membrane Plasma membrane

Extracellular

Intracellular

N112

T568II40SfsX15

150 | Chapter 6

the membrane. Interestingly, our immunoblotting data showed a shift of the MW of the CNNM2 protein when the alternative residue N327 was mutated. However, PNGase F treatment still lowers the MW of the p.Asn327Ala mutant, indicating that the protein is not deglycosylated (Figure 7A). Since p.Asn327 is predicted to be located in the second TM domain, we suspect that mutation of this residue instigates an altered protein folding that runs different on gel, explaining the observed shift. Once at the plasma membrane, the functional CNNM2 unit likely represents a multimer. Interestingly, we showed that both CNNM2a and CNNM2b can form homomultimers as well as heteromultimers (Figure 9B). This interaction is specific, as evidenced by the fact that CNNM2a and CNNM2b hardly dimerize with CNNM4, which shares the highest sequence homology with CNNM2 (96.7 % similarity and 81.4 % identity at the protein level) (40). In magnesium research, CNNM2 function is heavily debated. CNNM2 was first reported as a Mg2+ transporter (8, 31), but recent findings questioned the ability of CNNM2 to transport Mg2+ and proposed a Mg2+-sensing function (32). We, therefore, examined whether our topological findings could further elucidate the function of CNNM2. We reasoned that, although CNNM2 might contain a re-entrant region, it is unlikely that this region forms a pore for Mg2+ transport. The re-entrant loop does not include negatively charged residues that could provide Mg2+ specificity. Furthermore, the protein topology of only 3 transmembrane segments would be small in comparison with known eukaryotic Mg2+ transporters such as TRPM6/7 (tetramers of 6 TM proteins) and SLC41A1 (10/11 TM domains) (37, 39). Thus, our topological findings strengthen the previously reported patch clamp data (32), suggesting that CNNM2 might be a Mg2+ sensor indirectly regulating Mg2+ transport. To further substantiate this hypothesis, we focused on the CBS domains during analysis of the CNNM2 structure. CBS domains are found in 100-200 mammalian proteins and play a role in a variety of functions such as adenosine phosphate binding and ionic strength sensing (4, 15). The CBS domains in CNNM2 are highly homologous to those found in the Bordetella Parapertussis Co2+/Mg2+ efflux protein CorC of which the structure has been crystallized recently (PDB 3jtf). As shown by homology modelling based on the CorC structure, the CBS domains in the CNNM2 C-terminus contain a potential ATP-binding domain (Figure 4B). ATP binding in CBS domains has been reported to activate or further inhibit protein function in eukaryotic CBS domain-containing proteins (2). Our model does not allow discrimination between ATP and Mg-ATP binding, but we expect that the CBS domains of CNNM2 are also able to bind Mg-ATP. This theory is strengthened by the recently elucidated crystal structure of the bacterial Mg2+ transporter MgtE in which its CBS domains are involved in Mg2+ binding (PDB 2yvy, (11, 16)). As the majority of intracellular Mg2+ is ATP bound, the intracellular Mg-ATP concentrations are representative for the cellular Mg2+ content. The suggestion that CNNM2 binds Mg-ATP


implies that rather than ATP being an energy source for active transport, the Mg-ATP binding would provide a Mg2+-sensing mechanism. Given that the CNNM2 p.Thr568Ile loss-of-function mutation found in patients (32) is located at the region predicted to form the ATP binding pocket (Figure 8B), the (Mg-)ATP binding is likely of major importance for CNNM2 function. Since the p.Thr568Ile mutation is specifically disturbing the ATP binding pocket, Mg2+ alone will possibly not be able to activate CNNM2. In conclusion, we propose a protein topology of CNNM2 consisting of three membrane- spanning domains and a re-entrant loop (Figure 8). CNNM2 is extensively post-translationally modified by signal peptide cleavage and glycosylation, before being functional in multimers at the plasma membrane. Rather than transporting Mg2+ itself, we hypothesize CNNM2 would sense intracellular Mg2+ concentrations and regulate other Mg2+ transporters. Future research should focus on the identification of CNNM2 protein partners to further elucidate its role in Mg2+ homeostasis.

AcknowledgementsWe thank Femke van Zeeland, AnneMiete van der Kemp, Michelle Damen, Kelly Menting, Evelien Oerlemans and Kerstin Sommer for their technical support. In particular, we would like to thank Eric Jansen for supplying us the materials and his excellent technical suggestions for the in vitro translation experiments. This study was supported by the Netherlands organization for Scientific Research (ZonMw 9120.8026 and EURYI 2006) to J.H. and by grants from the European Community, FP7 (EUNEFRON 201590) to I.C.M. and D.M.

Methods

Expression ProfilingThree C57BL/6 mice were sacrificed; kidney, duodenum, ileum, jejunum, colon, cecum, brain, lung, liver, spleen, testis, muscle and heart tissues were collected. The transgenic parvalbumin-EGFP mice were a gift kind from Dr. Monyer (University of Heidelberg, Germany, (22)) and TRPV5-GFP mice were kindly provided by Dr. Praetorius from the University of Aarhus (14). They were used to isolate the DCT and CNT respectively. Mice were anesthetized by a cocktail injection of ketamine (0.1 mg/g body weight) and xylazine (0.01 mg/g body weight) and perfused with 20 mL PBS (in mmol/L: 137 NaCl, 2.7 KCl, 10 Na2HPO4, 1.76 KH2PO4) through the heart. The kidneys were removed, minced and digested in collagenase (1 mg/mL collagenase A Worthington, Lakewood, NJ, USA, 1 mg/mL hyaluronidase) in KREBS buffer (in mmol/L: 145 NaCl, 5 KCl, 10 HEPES/NaOH pH:7.4, 1 NaH2PO4, 2.5 CaCl2, 1.8 MgSO4, 5 glucose) at 37 °C for 18 min. The collagenase-digested tubules sized between 40 μm and 100 μm were sorted based on GFP fluorescence by COPAS (Complex Object Parametric Analysis and Sorting, Union Biometrica, USA).

152 | Chapter 6

Total RNA was isolated using TRIzol Total RNA Isolation Agent (Invitrogen). Obtained RNA was DNase (Promega) treated to remove genomic DNA. Subsequently, reverse transcription of the RNA by M-MLV reverse transcriptase (Invitrogen) was performed 1 hr at 37 °C. Gene expression levels were determined by quantitative real-time PCR on a BioRad Analyzer and normalized for Gapdh expression levels. Primer sequences are provided in Table 1.

ImmunohistochemistryImmunohistochemistry was performed as previously described (13). In short, costaining for CNNM2 with Na+-K+-Cl- cotransporter (NKCC2), thiazide-sensitive Na+-Cl- cotransporter (NCC), Calbindin-D28k and Aquaporin-2 (AQP2), was performed on 7 μm sections of fixed frozen mouse kidney samples. The sections were incubated for 16 hrs at 4 °C with the following primary antibodies: guinea pig anti-CNNM2 (1:100, (32)), rabbit anti-NKCC2 (1:100, (20)), rabbit anti-NCC (1:100, (26)), rabbit anti-Calbindin-D28k (1:500, (5)) and rabbit anti-AQP2 (1:300, kindly provided by Dr. Deen, Nijmegen, the Netherlands). For detection, kidney sections were incubated with Alexa-conjugated secondary antibodies. Images were taken with an AxioCam camera (Zeiss) and AxioVision software (Zeiss).

DNA ConstructsMouse Cnnm2 was cloned into the pCINeo HA IRES GFP vector as described previously (32). To obtain a C-terminal VSV-epitope, an XbaI restriction site was introduced before the stop codon using the QuikChange site-directed mutagenesis kit (Agilent, Amstelveen, the Netherlands) according to the manufacturer’s protocol. Subsequently, oligos (F: 5’- GAATCGCTTGGGGAAGTAGCTCGAGAATTCCGCCCC-3’ R: 5’- GGGGCGGAATTCTCGAG-CTACTTCCCCAAGCGATTC-3’) encoding the VSV-epitope were hybridized and ligated into the pCINEO HA-CNNM2 IRES GFP vector using the XbaI and XhoI restriction sites. CNNM2

Table 1 Primer Sequences Used for RT-PCR Analysis

Forward Reverse

Cnnm1 5’-ACAGGTCACAGCAAGTCTCG-3’ 5’-CCCATGTTTTCCTCAGAGTC-3’

Cnnm2v1 5’-GTCTCGCACCTTTGTTGTCA-3’ 5’-GTCGCTCCGACTGAGAGAAT-3’

Cnnm2v2 5’-CTCACAGCCTCTCCAGGG-3’ 5’-AGGAAGAGCTGAGCTGGTTG-3’

Cnnm3v1 5’-CCTTAATGCACTCCTGGCTAC-3’ 5’-CTGGGTCTGCTGTTGGTG-3’

Cnnm3v2 5’-CCTTAATGCACTCCTGGCTAC-3’ 5’-AAAGAGGGAAAGGTGGACTG-3’

Cnnm4 5’-TCTGGGCCAGTATGTCTCTG-3’ 5’-CACAGCCATCGAAGGTAGG-3’

Trpm6 5’-GTCTCGCACCTTTGTTGTCA-3’ 5’-GTCGCTCCGACTGAGAGAAT-3’

Trpv5 5’-CCATGACTTCCGCTAGTTGAG-3’ 5’-TGGATGTCACGTGTCCAGTT-3’



mutations were inserted in the construct using the QuikChange site-directed mutagenesis kit according to the manufacturer’s protocol. Human CNNM4 full-length cDNA clone (GenBank accession BC063295) was amplified using Phusion polymerase (Finnzymes, Vantaa, Finland) and primers (Forward: 5’-CGGCTAGCGCCACCATGGCGCCGGTGG-3’, Reverse: 5’-CGACCGGTCTATGCGTAGTCTGGCACGTCGTATGGGTAGATGGCATTCTCGTGGGAG-3’) to introduce an in frame HA-tag before the stop codon and AgeI and NheI restriction sites. The amplicons were cloned into the pCINeo IRES GFP expression vector using the AgeI and NheI restriction sites. All constructs were verified by sequence analysis. Mouse Cnnm2 was cloned into pcDNA3 (Invitrogen) as described previously (32). To obtain splice variant 2 with a 66 nucleotide deletion corresponding to exon 6, site-directed mutagenesis (QuikChange, Agilent) was used, according to the two stage PCR mutagenesis protocol described by Wang and Malcolm (41). The same protocol was used to delete the C-terminal tag and to insert internal HA-tags with an additional serine residue (NH2-YPYD-VPDYAS-COOH) (18) after residues p.Thr24, p.Gly210 or p.Pro744 or to replace the C-terminal HA-tag with a FLAG sequence. Mutagenesis primer sequences are available upon request. To obtain an N-terminal HA-tagged expression clone, the ORF in pFLCI-mCnnm2WT (32) was amplified using Expand polymerase (Roche) using forward primer 5’- ATGGGGTAC-CATGGCTTACCCATATGATGTTCCAGATTACGCTATTGGCTGTGGCGCTTGTG-3’ containing an in frame HA-tag after the Kozak sequence and reverse primer 5’- ATCTTCTAGAGGTCAGAC-CAAGTCCAGGAG-3’ and subsequently cloned in pcDNA3 as described previously (10). The complete ORFs of all expression constructs were sequence verified.

Cell Culture and TransfectionHEK293 cells were grown at 37 °C in DMEM (Bio Whittaker Europe, Vervier, Belgium) supplemented with 10 % (v/v) FCS (PAA, Linz, Austria), non-essential amino acids and 2 mmol/L L-glutamine in a humidified 5 % (v/v) CO2 atmosphere. Few hours before transfection with Lipofectamine 2000 (Invitrogen), cells were seeded in 12-well plates and subsequently transiently transfected with 0.5 μg pCINeo-IRES-GFP constructs encoding HA-tagged wild type or mutated CNNM2 proteins at a 1:2 DNA to lipofectamine ratio. COS-7 cells (ATCC CRL-1651) were grown in DMEM supplemented with 10 % FBS, 100 U/mL penicillin and 100 µg/mL streptomycin (Biochrom, Berlin) in a humidified environment of 5 % (v/v) CO2 at 37 °C.

ImmunocytochemistryCOS-7 cells were seeded on glass cover slips and transfected using Lipofectamine 2000 according to the manufacturer’s protocol with constructs expressing epitope-tagged CNNM2 or CNNM4. After 2 days of growth in medium supplemented with 20 mmol/L MgCl2, the cells were rinsed with PBS and fixed for 10 min with 4 % (w/v) methanol-free formaldehyde solution (Thermo Scientific) in PBS. In a control experiment (Figure 4, lower panels), living cells were incubated with primary antibody rat anti-HA (Roche,

154 | Chapter 6

high affinity 3F10, 1:250) for 60 min at 4 °C before formaldehyde fixation. After rinses in PBS, some of the cells were incubated for 10 min with 0.2 % (v/v) Triton X-100 in PBS for permeabilization. After PBS rinses, the cells were incubated with blocking buffer (5 % (v/v) donkey serum (Sigma) in PBS) for 1 hr and immuno-labeled with the primary antibodies rat anti-HA (1:250), mouse anti-FLAG M2 (Sigma, 1:250), rabbit anti-Calnexin (C5C9, Cell Signaling Technology, 1:50) or rabbit anti-CNNM2 (Abcam, Ab111351, 1:50) in blocking buffer for 90 min. After rinses in PBS, cells were incubated with Alexa Fluor 488 conjugated donkey anti-rabbit or anti-mouse IgG or Alexa Fluor 594 conjugated donkey anti-rat IgG secondary antibodies (Invitrogen, 1:500) and DAPI (2 µg/mL) for 45 min. After PBS and ethanol rinses, the cells were mounted on slides using ProLong Gold antifade reagent (Invitrogen). Fluorescence microscopy was performed with a Leica DMIRE2 inverted microscope, and images taken with Openlab software.

Homology ModelingA homology model was built using the modeling script in the WHATIF & YASARA Twinset with standard parameters (19, 38). We used the structure of a cysthationine B-synthase (CBS) domain pair structure of the Mg2+ and Co2+ efflux protein CorC from Bordetella

Parapertussis (PDB file 3jtf) as a template for modeling.

Cell Surface Biotinylation, PNGase Treatment and ImmunoblottingBiotinylation experiments were performed as previously described (36). In short, HEK293 cells were transfected for 48 hrs and cell surfaces were biotinylated at 4 °C for 1 hr by adding sulfo-NHS-LC-LC-biotin. Subsequently protein lysates were incubated overnight with Neutravidin-agarose beads (Pierce). Protein lysates were denatured in Laemmli containing 100 mmol/L DTT for 30 min at 37 °C and subsequently subjected to SDS-PAGE. Then, immunoblots were incubated with mouse anti-HA (Cell Signaling Technology, Danvers, MA, USA) primary antibodies and peroxidase conjugated sheep anti-mouse secondary antibodies (Sigma). PNGase F (New England Biolabs) was added to the protein lysates in Laemmli-DTT buffer and incubated at 37 °C for 1 hr before loading the protein samples on gel. Co-ImmunoprecipitationCOS-7 cells were cultured and transfected as described above with expression vectors for HA and FLAG-tagged wild type CNNM2 or CNNM4 isoforms. 48 hrs after transfection, cells were scraped from dishes in ice-cold 50 mmol/L Tris/HCl pH 8.0, followed by centrifugation at 5,000 g. The pellets were lysed in lysis buffer (150 mmol/L NaCl; 0,1 % (v/v) Nonidet P-40; 50 mmol/L Tris/HCl pH 7.5 and Complete protease inhibitor cocktail (Roche)) by repeated passage through a 26-gauge needle. Protein concentration measurement was performed using a BCA assay (Pierce). The next incubation steps were all done under rotary agitation at 4 °C. Protein aliquots of 100 µg in lysis buffer were pre-cleared by incubation with


protein G-Sepharose (Sigma-Aldrich) for 2 hrs after which the pre-cleared lysate was incubated for 18 hrs with 2.5 µg anti-HA antibody (Roche, high affinity 3F10). The anti-body-lysate mixture was added to 50 µL fresh protein G-Sepharose beads and incubated for 1 hr. The beads were collected by centrifugation at 1,000 g for 1 min at 4 °C and washed four times with lysis buffer. The proteins were separated from the beads by boiling for 5 min in 1x Laemmli sample buffer and detected by immunoblotting using a mouse monoclonal antibody against FLAG M2 (Sigma-Aldrich, 1:1000).

In Vitro Transcriptiona and TranslationThe cDNA template for in vitro transcription contained the CNNM2-HA sequence downstream of a T7 promoter sequence in a pT7Ts vector. The coupled in vitro transcription/translation reaction was incubated at 30 °C for 90 min. The reaction mixture contained 2 μg of cDNA template, 2 μL reaction buffer, 1 μL T7 RNA polymerase, 1 μL of amino acid mix without methionine, 3 μL of 35S-Met (1 μCi/μl), RNasin and 25 μL of rabbit reticulocyte lysate (Promega). The reaction was performed with or without signal peptidase inhibitor MeoSuc-Ala-Ala-Pro-Val-Chloromethylketone (AAPV-CMK, Sigma). The protein mixture was separated on an 8 % (w/v) SDS-PAGE gel. The gel was fixed in a mixture of acetic acid, methanol and H2O (20:10:70) and incubated in 20 % (w/v) 2,5- diphenyloxazole in DMSO to intensify the radioactive signal. The proteins were visualized using CL-X Posure films (Pierce, Etten-Leur, the Netherlands).

Statistical AnalysisIn all experiments, data are expressed as mean ± standard error of the mean (SEM). Statistical significance was determined using an unpaired Student’s t-test, differences with P < 0.05 were regarded as statistically significant.

156 | Chapter 6

References1. Alderton A, Davies P, Illman K, Brown DR. Ancient conserved domain protein-1 binds copper and modifies

its retention in cells. J. Neurochem. 103: 312–321, 2007.2. Baykov AA, Tuominen HK, Lahti R. The CBS domain: a protein module with an emerging prominent role in

regulation. ACS Chem. Biol. 6: 1156–1163, 2011.3. Bendtsen JD, Nielsen H, Heijne von G, Brunak S. Improved prediction of signal peptides: SignalP 3.0. J. Mol.

Biol. 340: 783–795, 2004.4. Biemans-Oldehinkel E, Mahmood NABN, Poolman B. A sensor for intracellular ionic strength. Proc. Natl.

Acad. Sci. U.S.A. 103: 10624–10629, 2006.5. Bindels RJ, Hartog A, Timmermans J, Van Os CH. Active Ca2+ transport in primary cultures of rabbit kidney

CCD: stimulation by 1,25-dihydroxyvitamin D3 and PTH. Am. J. Physiol. 261: F799–807, 1991.6. Czachorowski M, Lam-Yuk-Tseung S, Cellier M, Gros P. Transmembrane topology of the mammalian

Slc11a2 iron transporter. Biochemistry 48: 8422–8434, 2009.7. Glaudemans B, Knoers NVAM, Hoenderop JGJ, Bindels RJM. New molecular players facilitating Mg(2+)

reabsorption in the distal convoluted tubule. Kidney Int. 77: 17–22, 2010.8. Goytain A, Quamme GA. Functional characterization of ACDP2 (ancient conserved domain protein), a

divalent metal transporter. Physiol. Genomics 22: 382–389, 2005.9. Gómez García I, Oyenarte I, Martínez-Cruz LA. Purification, crystallization and preliminary crystallographic

analysis of the CBS pair of the human metal transporter CNNM4. Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 67: 349–353, 2011.

10. Günzel D, Stuiver M, Kausalya PJ, Haisch L, Krug SM, Rosenthal R, Meij IC, Hunziker W, Fromm M, Müller D. Claudin-10 exists in six alternatively spliced isoforms that exhibit distinct localization and function. J. Cell. Sci. 122: 1507–1517, 2009.


12. Hiss JA, Schneider G. Architecture, function and prediction of long signal peptides. Brief. Bioinformatics 10: 569–578, 2009.

13. Hoenderop JGJ, Dardenne O, Van Abel M, van der Kemp AWCM, Van Os CH, St Arnaud R, Bindels RJM. Modulation of renal Ca2+ transport protein genes by dietary Ca2+ and 1,25-dihydroxyvitamin D3 in 25-hydroxyvitamin D3-1alpha-hydroxylase knockout mice. FASEB J. 16: 1398–1406, 2002.

14. Hofmeister MV, Fenton RA, Praetorius J. Fluorescence isolation of mouse late distal convoluted tubules and connecting tubules: effects of vasopressin and vitamin D3 on Ca2+ signaling. Am. J. Physiol. Renal Physiol. 296: F194–203, 2009.

15. Ignoul S, Eggermont J. CBS domains: structure, function, and pathology in human proteins. American Journal of Physiology - Cell Physiology 289: C1369–78, 2005.

16. Ishitani R, Sugita Y, Dohmae N, Furuya N, Hattori M, Nureki O. Mg2+-sensing mechanism of Mg2+ transporter MgtE probed by molecular dynamics study. Proc. Natl. Acad. Sci. U.S.A. 105: 15393–15398, 2008.

17. Kast C, Canfield V, Levenson R, Gros P. Membrane topology of P-glycoprotein as determined by epitope insertion: transmembrane organization of the N-terminal domain of mdr3. Biochemistry 34: 4402–4411, 1995.

18. Kast C, Gros P. Topology mapping of the amino-terminal half of multidrug resistance-associated protein by epitope insertion and immunofluorescence. J. Biol. Chem. 272: 26479–26487, 1997.

19. Krieger E, Joo K, Lee J, Lee J, Raman S, Thompson J, Tyka M, Baker D, Karplus K. Improving physical realism, stereochemistry, and side-chain accuracy in homology modeling: Four approaches that performed well in CASP8. Proteins 77 Suppl 9: 114–122, 2009.

20. Loffing J, Vallon V, Loffing-Cueni D, Aregger F, Richter K, Pietri L, Bloch-Faure M, Hoenderop JGJ, Shull GE, Meneton P, Kaissling B. Altered renal distal tubule structure and renal Na(+) and Ca(2+) handling in a mouse model for Gitelman’s syndrome. J. Am. Soc. Nephrol. 15: 2276–2288, 2004.

21. Meij IC, Van Den Heuvel LPWJ, Hemmes S, van der Vliet WA, Willems JL, Monnens LAH, Knoers NVAM. Exclusion of mutations in FXYD2, CLDN16 and SLC12A3 in two families with primary renal Mg2+ loss. Nephrol. Dial. Transplant. 18: 512–516, 2003.


22. Meyer AH, Katona I, Blatow M, Rozov A, Monyer H. In vivo labeling of parvalbumin-positive interneurons and analysis of electrical coupling in identified neurons. J. Neurosci. 22: 7055–7064, 2002.

23. Meyer TE, Verwoert GC, Hwang S-J, Glazer NL, Smith AV, van Rooij FJA, Ehret GB, Boerwinkle E, Felix JF, Leak TS, Harris TB, Yang Q, Dehghan A, Aspelund T, Katz R, Homuth G, Kocher T, Rettig R, Ried JS, Gieger C, Prucha H, Pfeufer A, Meitinger T, Coresh J, Hofman A, Sarnak MJ, Chen Y-DI, Uitterlinden AG, Chakravarti A, Psaty BM, van Duijn CM, Kao WHL, Witteman JCM, Gudnason V, Siscovick DS, Fox CS, Köttgen A, Genetic Factors for Osteoporosis Consortium, Meta Analysis of Glucose and Insulin Related Traits Consortium. Genome-wide association studies of serum magnesium, potassium, and sodium concentrations identify six Loci influencing serum magnesium levels. PLoS Genet 6: e1001045, 2010.

24. Newton-Cheh C, Johnson T, Gateva V, Tobin MD, Bochud M, Coin L, Najjar SS, Zhao JH, Heath SC, Eyheramendy S, Papadakis K, Voight BF, Scott LJ, Zhang F, Farrall M, Tanaka T, Wallace C, Chambers JC, Khaw K-T, Nilsson P, van der Harst P, Polidoro S, Grobbee DE, Onland-Moret NC, Bots ML, Wain LV, Elliott KS, Teumer A, Luan J, Lucas G, Kuusisto J, Burton PR, Hadley D, McArdle WL, Wellcome Trust Case Control Consortium, Brown M, Dominiczak A, Newhouse SJ, Samani NJ, Webster J, Zeggini E, Beckmann JS, Bergmann S, Lim N, Song K, Vollenweider P, Waeber G, Waterworth DM, Yuan X, Groop L, Orho-Melander M, Allione A, Di Gregorio A, Guarrera S, Panico S, Ricceri F, Romanazzi V, Sacerdote C, Vineis P, Barroso I, Sandhu MS, Luben RN, Crawford GJ, Jousilahti P, Perola M, Boehnke M, Bonnycastle LL, Collins FS, Jackson AU, Mohlke KL, Stringham HM, Valle TT, Willer CJ, Bergman RN, Morken MA, Döring A, Gieger C, Illig T, Meitinger T, Org E, Pfeufer A, Wichmann H-E, Kathiresan S, Marrugat J, O’Donnell CJ, Schwartz SM, Siscovick DS, Subirana I, Freimer NB, Hartikainen A-L, McCarthy MI, O’Reilly PF, Peltonen L, Pouta A, de Jong PE, Snieder H, van Gilst WH, Clarke R, Goel A, Hamsten A, Peden JF, Seedorf U, Syvänen A-C, Tognoni G, Lakatta EG, Sanna S, Scheet P, Schlessinger D, Scuteri A, Dörr M, Ernst F, Felix SB, Homuth G, Lorbeer R, Reffelmann T, Rettig R, Völker U, Galan P, Gut IG, Hercberg S, Lathrop GM, Zelenika D, Deloukas P, Soranzo N, Williams FM, Zhai G, Salomaa V, Laakso M, Elosua R, Forouhi NG, Völzke H, Uiterwaal CS, van der Schouw YT, Numans ME, Matullo G, Navis G, Berglund G, Bingham SA, Kooner JS, Connell JM, Bandinelli S, Ferrucci L, Watkins H, Spector TD, Tuomilehto J, Altshuler D, Strachan DP, Laan M, Meneton P, Wareham NJ, Uda M, Jarvelin M-R, Mooser V, Melander O, Loos RJF, Elliott P, Abecasis GR, Caulfield M, Munroe PB. Genome-wide association study identifies eight loci associated with blood pressure. Nat. Genet. 41: 666–676, 2009.

25. Nielsen H, Engelbrecht J, Brunak S, Heijne von G. Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng. 10: 1–6, 1997.

26. Nijenhuis T, Hoenderop JGJ, Loffing J, van der Kemp AWCM, Van Os CH, Bindels RJM. Thiazide-induced hypocalciuria is accompanied by a decreased expression of Ca2+ transport proteins in kidney. Kidney Int. 64: 555–564, 2003.

27. Paetzel M, Karla A, Strynadka NCJ, Dalbey RE. Signal peptidases. Chem. Rev. 102: 4549–4580, 2002.28. Parry DA, Mighell AJ, El-Sayed W, Shore RC, Jalili IK, Dollfus H, Bloch-Zupan A, Carlos R, Carr IM,

Downey LM, Blain KM, Mansfield DC, Shahrabi M, Heidari M, Aref P, Abbasi M, Michaelides M, Moore AT, Kirkham J, Inglehearn CF. Mutations in CNNM4 cause Jalili syndrome, consisting of autosomal-recessive cone-rod dystrophy and amelogenesis imperfecta. Am. J. Hum. Genet. 84: 266–273, 2009.

29. Polok B, Escher P, Ambresin A, Chouery E, Bolay S, Meunier I, Nan F, Hamel C, Munier FL, Thilo B, Mégarbané A, Schorderet DF. Mutations in CNNM4 cause recessive cone-rod dystrophy with amelogenesis imperfecta. Am. J. Hum. Genet. 84: 259–265, 2009.

30. Schunkert H, König IR, Kathiresan S, Reilly MP, Assimes TL, Holm H, Preuss M, Stewart AFR, Barbalic M, Gieger C, Absher D, Aherrahrou Z, Allayee H, Altshuler D, Anand SS, Andersen K, Anderson JL, Ardissino D, Ball SG, Balmforth AJ, Barnes TA, Becker DM, Becker LC, Berger K, Bis JC, Boekholdt SM, Boerwinkle E, Braund PS, Brown MJ, Burnett MS, Buysschaert I, Cardiogenics, Carlquist JF, Chen L, Cichon S, Codd V, Davies RW, Dedoussis G, Dehghan A, Demissie S, Devaney JM, Diemert P, Do R, Doering A, Eifert S, Mokhtari NEE, Ellis SG, Elosua R, Engert JC, Epstein SE, de Faire U, Fischer M, Folsom AR, Freyer J, Gigante B, Girelli D, Gretarsdottir S, Gudnason V, Gulcher JR, Halperin E, Hammond N, Hazen SL, Hofman A, Horne BD, Illig T, Iribarren C, Jones GT, Jukema JW, Kaiser MA, Kaplan LM, Kastelein JJP, Khaw K-T, Knowles JW, Kolovou G, Kong A, Laaksonen R, Lambrechts D, Leander K, Lettre G, Li M, Lieb W, Loley C, Lotery AJ, Mannucci PM, Maouche S, Martinelli N, McKeown PP,

158 | Chapter 6

Meisinger C, Meitinger T, Melander O, Merlini PA, Mooser V, Morgan T, Mühleisen TW, Muhlestein JB, Münzel T, Musunuru K, Nahrstaedt J, Nelson CP, Nöthen MM, Olivieri O, Patel RS, Patterson CC, Peters A, Peyvandi F, Qu L, Quyyumi AA, Rader DJ, Rallidis LS, Rice C, Rosendaal FR, Rubin D, Salomaa V, Sampietro ML, Sandhu MS, Schadt E, Schäfer A, Schillert A, Schreiber S, Schrezenmeir J, Schwartz SM, Siscovick DS, Sivananthan M, Sivapalaratnam S, Smith A, Smith TB, Snoep JD, Soranzo N, Spertus JA, Stark K, Stirrups K, Stoll M, Tang WHW, Tennstedt S, Thorgeirsson G, Thorleifsson G, Tomaszewski M, Uitterlinden AG, van Rij AM, Voight BF, Wareham NJ, Wells GA, Wichmann H-E, Wild PS, Willenborg C, Witteman JCM, Wright BJ, Ye S, Zeller T, Ziegler A, Cambien F, Goodall AH, Cupples LA, Quertermous T, März W, Hengstenberg C, Blankenberg S, Ouwehand WH, Hall AS, Deloukas P, Thompson JR, Stefansson K, Roberts R, Thorsteinsdottir U, O’Donnell CJ, McPherson R, Erdmann J, CARDIoGRAM Consortium, Samani NJ. Large-scale association analysis identifies 13 new susceptibility loci for coronary artery disease. Nat. Genet. 43: 333–338, 2011.

31. Sponder G, Svidova S, Schweigel M, Vormann J, Kolisek M. Splice-variant 1 of the ancient domain protein 2 (ACDP2) complements the magnesium-deficient growth phenotype of Salmonella enterica sv. typhimurium strain MM281. Magnes Res 23: 105–114, 2010.

32. Stuiver M, Lainez S, Will C, Terryn S, Günzel D, Debaix H, Sommer K, Kopplin K, Thumfart J, Kampik NB, Querfeld U, Willnow TE, Němec V, Wagner CA, Hoenderop JG, Devuyst O, Knoers NVAM, Bindels RJ, Meij IC, Müller D. CNNM2, encoding a basolateral protein required for renal Mg2+ handling, is mutated in dominant hypomagnesemia. Am. J. Hum. Genet. 88: 333–343, 2011.

33. Takeuchi F, Isono M, Katsuya T, Yamamoto K, Yokota M, Sugiyama T, Nabika T, Fujioka A, Ohnaka K, Asano H, Yamori Y, Yamaguchi S, Kobayashi S, Takayanagi R, Ogihara T, Kato N. Blood pressure and hypertension are associated with 7 loci in the Japanese population. Circulation 121: 2302–2309, 2010.

34. Traynelis SF, Wollmuth LP, McBain CJ, Menniti FS, Vance KM, Ogden KK, Hansen KB, Yuan H, Myers SJ, Dingledine R. Glutamate receptor ion channels: structure, regulation, and function. Pharmacol. Rev. 62: 405–496, 2010.

35. Vagin O, Kraut JA, Sachs G. Role of N-glycosylation in trafficking of apical membrane proteins in epithelia. Am. J. Physiol. Renal Physiol. 296: F459–69, 2009.

36. van de Graaf SFJ, Hoenderop JGJ, Gkika D, Lamers D, Prenen J, Rescher U, Gerke V, Staub O, Nilius B, Bindels RJM. Functional expression of the epithelial Ca(2+) channels (TRPV5 and TRPV6) requires association of the S100A10-annexin 2 complex. EMBO J. 22: 1478–1487, 2003.


38. Vriend G. WHAT IF: a molecular modeling and drug design program. J Mol Graph 8: 52–6– 29, 1990.39. Wabakken T, Rian E, Kveine M, Aasheim H-C. The human solute carrier SLC41A1 belongs to a novel

eukaryotic subfamily with homology to prokaryotic MgtE Mg2+ transporters. Biochem. Biophys. Res. Commun. 306: 718–724, 2003.

40. Wang C-Y, Shi J-D, Yang P, Kumar PG, Li Q-Z, Run Q-G, Su Y-C, Scott HS, Kao K-J, She J-X. Molecular cloning and characterization of a novel gene family of four ancient conserved domain proteins (ACDP). Gene 306: 37–44, 2003.

41. Wang W, Malcolm BA. Two-stage PCR protocol allowing introduction of multiple mutations, deletions and insertions using QuikChange Site-Directed Mutagenesis. BioTechniques 26: 680–682, 1999.

162 | Chapter 7

Abstract

Intellectual disability and seizures are frequently associated with hypomagnesemia and have an important genetic component. However, to find the genetic origin of intellectual disability and seizures often remains challenging because of considerable genetic heterogeneity and clinical variability. In this study, we have identified new mutations in the gene CNNM2 in five families suffering from mental retardation, seizures, and hypomagnesemia. For the first time, a recessive mode of inheritance of CNNM2 mutations was observed. Importantly, patients with recessive CNNM2 mutations suffer from severe brain malformations and severe intellectual disability. Additionally, three patients with moderate mental disability were shown to carry de novo heterozygous missense mutations in the CNNM2 gene. To elucidate the physiological role of CNNM2 and explain the pathomechanisms of disease, we studied CNNM2 function combining in vitro activity assays and the zebrafish knockdown model system. Using stable Mg2+ isotopes, we demonstrated that CNNM2 increases cellular Mg2+ uptake in HEK293 cells and that this process occurs through regulation of the Mg2+-permeable cation channel TRPM7. In contrast, cells expressing mutated CNNM2 proteins did not show increased Mg2+ uptake. Knockdown of cnnm2 isoforms in zebrafish resulted in disturbed brain development including neurodevelopmental impairments such as increased embryonic spontaneous contractions and weak touch-evoked escape behaviour, and reduced body Mg content, indicative of impaired renal Mg2+ absorption. These phenotypes were rescued by injection of mammalian wild-type Cnnm2 cRNA, whereas mammalian mutant Cnnm2 cRNA did not improve the zebrafish knockdown phenotypes. We therefore concluded that CNNM2 is fundamental for brain development, neurological functioning and Mg2+ homeostasis. By establishing the loss-of-function zebrafish model for CNNM2 genetic disease, we provide a unique system for testing therapeutic drugs targeting CNNM2 and for monitoring their effects on the brain and kidney phenotype.

Keywords: Cyclin M2, Mental Retardation, Magnesium, Distal Convoluted Tubule

CNNM2 Mutations Impair Brain and Kidney Function | 163

Introduction

Brain defects including seizures, migraine, depression and intellectual disability are frequently associated with hypomagnesemia (7). Indeed, low Mg2+ concentrations may cause epileptiform activity during development (25). Specifically, the Mg2+ channel transient receptor potential melastatin 7 (TRPM7) is essential for brain function and development (18). Interestingly, patients with genetic defects in TRPM6, a close homologue of TRPM7, may have neurological complications (34). Although TRPM6 and TRPM7 share similar Mg2+ transporting properties, they are differentially expressed and regulated (27). TRPM7 is a ubiquitously expressed protein regulating intracellular Mg2+ levels in a broad range of cells, whereas TRPM6 is localized in the luminal membrane of renal and intestinal epithelia involved in Mg2+ absorption (7, 16, 32, 36). Recently, we have identified mutations in the gene encoding cyclin M2 (CNNM2) in two unrelated families with dominant isolated hypomagnesemia (CNNM2, OMIM #607803) (31). Patients suffered from symptoms associated with low serum Mg2+ levels (0.3-0.5 mmol/L) such as tremors, headaches and muscle weakness. The role of CNNM2 in the kidney for the maintenance of serum Mg2+ levels can be traced to the distal convoluted tubule (DCT), where also TRPM6 is expressed. Here, CNNM2 is present in the basolateral membrane of DCT cells and its expression is regulated by dietary Mg2+ availability (5, 31). Although CNNM2 has been proposed as a Mg2+ transporter in overexpression studies in Xenopus laevis oocytes (12), Mg2+ transport could not be directly measured in mammalian cells using patch clamp analysis (31). On the other hand, modelling of the CNNM2 cystathionine β-synthase (CBS) domains resulted in the identification of an Mg2+-ATP binding site, suggesting a role in Mg2+ sensing within the cell (6). Consequently, the molecular mechanism explaining the role of CNNM2 in DCT-mediated Mg2+ transport remains to be elucidated. The CNNM2 gene is ubiquitously expressed in mammalian tissues, most prominently in kidney, brain and lung (6, 38). Although the role of CNNM2 beyond the kidney has never been studied, genome wide association studies have related the CNNM2 locus to blood pressure, coronary artery disease and schizophrenia, suggesting an important role of CNNM2 in the cardiovascular system and brain (4, 26). CNNM2 is widely conserved among species. In Danio rerio, a frequently used model for ion homeostasis and human genetic diseases in general (17, 22), the cnnm2 gene is duplicated and two paralogues, cnnm2a and cnnm2b, are described (1). Both paralogues share a high conservation with human CNNM2 (79 % amino acid identity). In detail, transcripts are abundantly expressed in zebrafish brain and in ionregulatory organs such as kidney and gills, which act as a pseudokidney in fish (1). Consistent with the regulation of CNNM2 transcripts in mammals (12), the expression of cnnm2a and cnnm2b is regulated by Mg2+ in vivo (1). In the present study, we aim to elucidate the function of CNNM2 in brain and kidney. Hence, we can demonstrate the genetic origin of symptoms in five unrelated families

164 | Chapter 7

suffering from a distinct phenotype of mental retardation, seizures and hypomagnesemia, where we have identified novel mutations in the CNNM2 gene. By combining functional analyses and a loss-of-function approach in the zebrafish model, we provide evidence for a key role of CNNM2 in brain development, neurological activity and renal Mg2+ handling.

Results

PatientsPatients F1.1 and F1.2 presented in the neonatal period with cerebral convulsions. Serum Mg2+ levels at manifestation were found to be 0.5 mmol/L in both patients (Table 1). Convulsions were refractory to conventional antiepileptic medications. Intravenous Mg2+ supplementation with ±1 mmol/kg body weight/day was initiated after oral Mg2+ failed to correct serum Mg2+ levels. However, seizure activity continued even in face of normo-magnesemia. An extensive analysis for infectious causes or inborn errors of metabolism did not yield any positive results. Ultrasound examination of the kidneys did not reveal nephrocalcinosis, whereas basal ganglia calcifications were noted in early central nervous system (CNS) sonographies. During follow-up, severe developmental delay was noted accompanied by microcephaly (head circumference below third percentile for age and sex in both patients). A magnetic resonance imaging (MRI) at 5.5 years of age in patient F1.1 showed wide supratentorial outer cerebrospinal liquor spaces with failure of oper-cularization together with a significantly reduced myelinization of the white matter tract (Figure 1C-D). The severe degree of intellectual disability, which became apparent with increasing age comprised major deficits in cognitive function, the inability to verbally communicate, and severely limited motor skills. Both children are not able to perform main activities of daily living and require full-time care by an attendant. Seizure activity is sufficiently controlled in the brother by valproate and lamotrigine, electroencephalo-graphy (EEGs) merely shows generalized slowing, but no epileptic activity. In contrast, the younger sister suffers from ongoing generalized, myoclonic seizures despite antiepileptic treatment with valproate and levetiracetame. Laboratory investigations during follow-up demonstrated persistent hypomagnesemia of ±0.6 mmol/L despite oral Mg2+ supplementation. Patients F2.1, F3.1, and F4.1 presented with seizures during infancy (between 4 and 12 months of age). Laboratory evaluation yielded isolated hypomagnesemia of ±0.5 mmol/L (Table 1). Urine analyses demonstrated inappropriate fractional excretion for Mg2+ in face of persistent hypomagnesemia. In addition, the renal Mg2+ leak was verified by Mg2+ loading tests in patients F2.1 and F4.1 as described before (37). Urinary calcium excretion rates were normal, renal ultrasound excluded the presence of nephrocalcinosis. After acute therapy with intravenous Mg2+, the patients received a continuous oral Mg2+ supplementation of 0.5 to 1 mmol/kg body weight/day of elemental Mg2+. This oral therapy however failed to correct the hypomagnesemia, serum Mg2+ remained in the subnormal range in all three


children. Because of recurrent cerebral seizures, patients F2.1 to F4.1 received diverse antiepileptic medications. Currently only patient F4.1 is still treated with clobazam. In all three patients (F2.1 to F4.1), a significant degree of intellectual disability was already noted in early childhood with delayed speech development, but also impaired motor as well as cognitive skills. In addition, patient F4.1 was noted to exhibit disturbed social interaction, abnormal verbal and non-verbal communication, as well as stereotyped behaviour and finally received the formal diagnosis of early onset autism. All three patients F2.1 to F4.1 were not able to attend regular schools. Standardized intelligence testing in patients F2.1 and F3.1 revealed a significant degree of mental retardation (Table 1). While patients F2.1 and F3.1 are currently living with their parents, patient F4.1 is placed in a home for children with mental illness because of episodes of violence and destructive behaviour. The parents of all three children (F2.1-F4.1) had normal serum Mg2+ levels and no signs of intellectual disability. Finally, patient F5.1 presented with muscle spasms and dysesthesia in adolescence. Serum Mg2+ levels were found to be low (±0.6 mmol/L). Because of concomitant borderline hypokalemia, she was suspected to have Gitelman syndrome (OMIM #263800) and received oral Mg2+ and K+ supplements. Also this patient exhibited a mild degree of intellectual disability. Unfortunately, she was not available for further examination.

CNNM2 Mutations in Patients with Mental RetardationCommon genetic causes of mental retardation were excluded in patients F1.1 and F2.1 by array CGH (comparative genomic hybridization). The presence of two affected siblings together with the suspected parental consanguinity in family F1 suggested an auto somal-recessive pattern of inheritance. Therefore, we subjected patients F1.1 and F1.2 to homozygosity mapping which, at a cut-off size of >1.7 megabases (Mb), yielded eleven critical intervals on autosomes with a cumulative size of 62 Mb. The gene list generated from these loci included 322 RefSeq genes and putative transcripts. CNNM2 in a critical interval of 7.1 Mb on chromosome 10 emerged as the most promising candidate gene because of its known role in Mg2+ metabolism (6, 12, 30, 31). Conventional Sanger sequencing of the complete coding region of the CNNM2 gene revealed a homozygous mutation, c.364G>A, leading to a non-conservative amino acid substitution of glutamate to lysine at position 122 of the CNNM2 protein (p.Glu122Lys, Figure 1A-B). The mutation was present in heterozygous state in both parents. After discovery of this homozygous mutation in patients F1.1 and F1.2, a larger cohort (n=34) of patients with Mg2+ deficiency of unknown origin was screened for mutations in the CNNM2 gene. Mutations in heterozygous state were discovered in patients F2.1 to F5.1 (Table 1). However, sequencing of the complete coding region and adjacent exon-intron boundaries did not reveal a second pathogenic allele. Next, we examined the CNNM2 gene in parents and unaffected siblings of families F2 to F4. The mutations previously identified in our patients were not detected in either of the parents pointing to de novo mutational events. Interestingly,

166 | Chapter 7

patients F2.1 and F4.1 exhibited the same mutation, p.Glu357Lys (c.1069G>A), affecting a highly conserved amino acid residue in the 2nd membrane-spanning domain of the CNNM2 protein. Also the p.Ser269Trp (c.806C>G) mutation detected in patient F3.1 affects a highly conserved residue located in the 1st transmembrane domain. All three mutations were ranked “probably damaging” by Polyphen-2 when tested for functional consequences of the mutations (p.Glu122Lys, p.Ser269Trp and p.Glu357Lys with scores of 0.981, 1.000 and 1.000, respectively). Finally, in patient F5.1 with a late manifestation and putatively milder phenotype, the variant p.Leu330Phe (c.988C>T) was identified in heterozygous state. This variant affects an amino acid residue conserved among mammals, however a phenylalanine appears at this position in certain fish species. The variant is predicted to be possibly damaging by Polyphen-2 with a score of 0.711. None of the identified variants was detected in 204 controls or present in publically available exome data.

Table 1 Clinical and Biochemical Data of the Patients

Patient F1.1 F1.2 F2.1 F3.1 F4.1 F5.1

Gender Male Female Female Female Male Female

Ethnicity Serbian Serbian German German German Polish

Age at manifestation 1 day 6 days 7 months 1 years 4 months 16 years

Follow-up 12 years 8 years 12 years 20 years 12 years None

Symptoms at manifestation Seizures Seizures Seizures SeizuresParesthesia

Seizures MyoclonusParesthesia

Treatment ValproateLamotrigine

ValproateLevetiracetame

Phenobarbital Valproate Clobazam Unknown

Neuroimaging Myelinization defectsOpercularization defectWidened outer cerebrospinal liquor spaces

Normal Normal Normal Unknown

Mental retardation Severe Severe Moderate Moderate Moderate Mild

Cognitive function IQ 55-57 IQ 55-59 Autism Unknown

Speech/ Communication No verbal speechLimited communication skills

No verbal speechLimited communication skills

Expressive language disorder


Limited speech and vocabulary

Unknown

Additional symptoms Very limited motor skills Very limited motor skills Impaired motor skills, severe obesity

Impaired motor skills, severe obesity

Impaired motor skills Unknown

Initial serum Mg2+ (mmol/L)

0.5 0.5 0.56 0.44 0.5 0.66

Follow-up serum Mg2+ (mmol/L) 0.66 0.54 0.56 0.53 0.68 -

Mutation (DNA level)

c.364G>A c.364G>A c.1069G>A c.806C>G c.1069G>A c.988C>T

Mutation(Protein level)

p.Glu122Lys p.Glu122Lys p.Glu357Lys p.Ser269Trp p.Glu357Lys p.Leu330Phe

Zygosity Homozygous Homozygous Heterozygous Heterozygous Heterozygous Heterozygous


CNNM2 Increases Mg2+ Transport To clarify the function of CNNM2, Human Embryonic Kidney (HEK293) cells were transiently transfected with mouse Cnnm2 or mock constructs and examined for Mg2+ transport capacity using the stable 25Mg2+ isotope. At baseline, approximately 10 % of the total intracellular Mg2+ content consists of 25Mg2+, which is the natural abundance of 25Mg2+

(39). By incubating the cells in a physiological buffer containing pure 25Mg2+, the intracellular 25Mg2+ concentration increases over time. Interestingly, Cnnm2 expressing cells displayed a higher 25Mg2+ uptake compared to mock cells (Figure 2A). After 5 min, Cnnm2-expressing cells had approximately 2 times more 25Mg2+ uptake than mock-trans-fected cells (Figure 2B). All further experiments were performed at the 5 min time point to cover the exponential phase of the uptake. To reduce the background in 25Mg2+ uptake, inhibitors of known Mg2+ channels and transporters were added during the uptake

Table 1 Clinical and Biochemical Data of the Patients

Patient F1.1 F1.2 F2.1 F3.1 F4.1 F5.1

Gender Male Female Female Female Male Female

Ethnicity Serbian Serbian German German German Polish

Age at manifestation 1 day 6 days 7 months 1 years 4 months 16 years

Follow-up 12 years 8 years 12 years 20 years 12 years None

Symptoms at manifestation Seizures Seizures Seizures SeizuresParesthesia

Seizures MyoclonusParesthesia

Treatment ValproateLamotrigine

ValproateLevetiracetame

Phenobarbital Valproate Clobazam Unknown

Neuroimaging Myelinization defectsOpercularization defectWidened outer cerebrospinal liquor spaces

Normal Normal Normal Unknown

Mental retardation Severe Severe Moderate Moderate Moderate Mild

Cognitive function IQ 55-57 IQ 55-59 Autism Unknown

Speech/ Communication No verbal speechLimited communication skills

No verbal speechLimited communication skills



Limited speech and vocabulary

Unknown

Additional symptoms Very limited motor skills Very limited motor skills Impaired motor skills, severe obesity

Impaired motor skills, severe obesity

Impaired motor skills Unknown

Initial serum Mg2+ (mmol/L)

0.5 0.5 0.56 0.44 0.5 0.66

Follow-up serum Mg2+ (mmol/L) 0.66 0.54 0.56 0.53 0.68 -

Mutation (DNA level)

c.364G>A c.364G>A c.1069G>A c.806C>G c.1069G>A c.988C>T

Mutation(Protein level)

p.Glu122Lys p.Glu122Lys p.Glu357Lys p.Ser269Trp p.Glu357Lys p.Leu330Phe

Zygosity Homozygous Homozygous Heterozygous Heterozygous Heterozygous Heterozygous

168 | Chapter 7

Figure 1 Pedigrees and Magnetic Resonance Imaging (MRI) Studies of Families with Primary Hypomagnesemia

A, Pedigrees of families F1-F5. Filled symbols represent affected individuals, mutant alleles are

indicated by a minus (-) and plus (+) sign, respectively. B, Localization of the mutations in the CNNM2

protein structure (Uniprot Q9H8M5). CNNM2 contains a long signal peptide (64 amino acids) that is

cleaved at the membrane of the endoplasmic reticulum. The remaining part of the CNNM2 protein

is trafficked to the plasma membrane, where it becomes functionally active. White dots show the

locations of the mutations. C-D, MRI of the brain of patient F1.1 (C, T2 weighed images) and patient

F2.1 (D, T2 weighed images). Left: Coronal images demonstrating a defect in myelinization of

U-fibers (arrows) in patient F1.1 in contrast to a normal myelin pattern in patient F2.1. Center: Coronal

T2 weighted images showing widened outer cerebrospinal liquor spaces (dashed arrows) and lack

of opercularization (solid arrows) in patient F1.1, whereas a regular brain volume and insular lobe is

observed in patient F2.1. Right: Absence of cerebellar structural abnormalities in patients F1.1 and

F2.1 on axial T2 weighted images at the level of the trigeminal nerve.

F1

F1.1 F1.2

p.Glu122Lys

+ / - + / -

+ / + + / +

F2

F2.1

- / - - / -

+ / - - / -

p.Glu357Lys

F4.1

F4

p.Glu357Lys

- / - - / -

+ / - - / -

F3

F3.1

p.Ser269Trp

- / - - / -

+ / - - / -

F5.1

F5

p.Leu330Phe

+ / -

A

C

D

ER Membrane Plasma Membrane

p.Glu122Lys

p.Ser269Trp

p.Glu357Lys

p.Leu330Phe

B


process; 2-Aminoethoxydiphenyl borate (2-APB) to inhibit TRPM7 (3), Ouabain to block the Na+-K+-ATPase (40), Quinidin for SLC41A1 (20) and Nitrendipin (13) for silencing MagT1 activity (Figure 2C). Only 2-APB was capable of significantly inhibiting 25Mg2+ uptake in HEK293 cells. Moreover, 2-APB inhibition also abolished the CNNM2-dependent increase in 25Mg2+ uptake. Dose-response experiments confirmed that the IC50 of 2-APB inhibition is 22 μmol/L (Figure 2D). CNNM2-dependent 25Mg2+ uptake was found to be independent of Na+ and Cl- availability, when uptakes were performed in N-methyl-d-glucamine (NMDG) or Gluconate buffers (Figure 2E). Interestingly, the highest CNNM2-dependent 25Mg2+ uptake was measured between 1-2 mmol/L, suggesting a Km in the physiological range of approximately 0.5 mmol/L (Figure 2F). At high Mg2+ concentrations (5 mmol/L), 25Mg2+ uptake was inhibited. When subjected to 24 hours 25Mg2+ loading, Cnnm2- expressing cells showed a significantly higher 25Mg2+ content baseline. Subsequently, 15 min extrusion of Cnnm2-expressing cells demonstrated no difference in Mg2+ extrusion rate compared to mock-transfected cells (Figure 2G).

Mutations Impair CNNM2-dependent Mg2+ UptakeTo characterize the effect of the CNNM2 mutations identified in our hypomagnesemic patients, 25Mg2+ uptake was determined in HEK293 cells expressing mutant CNNM2 proteins. Of all missense mutations that are identified to date, only p.Leu330Phe was capable of increasing 25Mg2+ uptake to a similar extent as wild-type CNNM2 (Figure 3A). All other CNNM2 mutants exhibited severely decreased 25Mg2+ uptake or had lost their ability to increase 25Mg2+ uptake completely. To examine whether CNNM2 dysfunction can be explained by a reduced plasma membrane expression, all mutants were subjected to cell surface biotinylation analysis. Indeed, p.Glu122Lys CNNM2 membrane expression was significantly reduced compared with wild-type CNNM2 (66 % decrease, P < 0.05) and p.Ser269Trp CNNM2 showed a trend towards reduction (46 % decrease, Figure 3B).

Figure 1 Continued

F1

F1.1 F1.2

p.Glu122Lys

+ / - + / -

+ / + + / +

F2

F2.1

- / - - / -

+ / - - / -

p.Glu357Lys

F4.1

F4

p.Glu357Lys

- / - - / -

+ / - - / -

F3

F3.1

p.Ser269Trp

- / - - / -

+ / - - / -

F5.1

F5

p.Leu330Phe

+ / -

A

C

D

ER Membrane Plasma Membrane

p.Glu122Lys

p.Ser269Trp

p.Glu357Lys

p.Leu330Phe

B

170 | Chapter 7

Figure 2 CNNM2 Increases Mg2+ Uptake in HEK293 Cells

A, Time curve of 25Mg2+ uptake in mock (circles) and CNNM2 (squares) transfected cells. B, Representation

of the normalized Mg2+ uptake after 5 min. C, 25Mg2+ uptake in the presence of inhibitors of ion

transporters, black bars represent mock cells and white bars represent CNNM2-transfected cells.

D, Dose-response curve of 25Mg2+ transport inhibition by 2-APB in mock (circles) and CNNM2 (squares)

transfected cells. E, The effect of Na+ and Cl- availability on 25Mg2+ uptake in mock (black bars)

and CNNM2 (white bars) transfected cells. F, 25Mg2+ uptake as a function of extracellular 25Mg2+

availability in mock (circles) and CNNM2 (squares) transfected cells. G, 25Mg2+ extrusion in mock

(circles) and CNNM2 (squares) transfected cells. Each data point represent the mean of 3 independent

experiments ± SEM. * indicates significant differences compared to mock (P < 0.05).

0 2 4 6 8 10 12 14 16

10

15

20

25

30

Time (min)

*

*

*

*

*

* **

**

*

*

A B

DC

FE

G

70

75

80

85

90

95

Time (min)

Intr

acel

lula

r25M

g2+

(% o

f tot

al M

g2+

)

25M

g2+

upt

ake

(% o

f moc

k)

Intr

acel

lula

r25M

g2+

(% o

f tot

al M

g2+

)

Mock

CNNM2

0

50

100

150

200

250

NaCl

NMDGCl

NaGluc

0

50

100

150

200

25M

g2+

upt

ake

(% o

f moc

k)

NT2-A

PB

Ouabain

Quinidin

Nitrendipin

0

50

100

150

25M

g2+

upt

ake

(% o

f moc

k) **

**

0

50

100

150

200

[25Mg2+] (mM)

25M

g2+

upt

ake

(% o

f moc

k)10 -7 10 -6 10 -5 10 -4 10 -3

0

50

100

150

200

25M

g2+

upt

ake

(% o

f moc

k)[2-APB] (M)

**

* * *

0 1 2 3 4 5

0 1 2 3 4 5


Figure 3 CNNM2 Mutations Impair Mg2+ Uptake in HEK293 Cells

A, Time curve of 25Mg2+ uptake in mock, wild-type CNNM2 and mutant CNNM2 transfected

cells. Symbols indicate cells transfected with the vector empty ( mock) or containing CNNM2

sequences encoding for wild-type or mutant CNNM2 proteins ( CNNM2, CNNM2-p.Glu122Lys,

CNNM2-p.Ser269Trp, CNNM2-p.Leu330Phe, CNNM2-p.Glu357Lys, CNNM2-p.Thr568Ile).

Each data point represent the mean of 3 independent experiments ± SEM. * indicates significant

differences compared to mock (P < 0.05). B, Representative immunoblots showing that p.Glu122Lys

and p.Ser269Trp mutations reduce CNNM2 membrane expression (upper blot) and a CNNM2

expression control (lower blot). Quantification of cell surface expression of wild-type (WT) and

mutant CNNM2 proteins corrected for total protein expression. Results are the mean ± SEM of 3

independent experiments. * indicate significant differences compared to WT CNNM2 transfected

cells (P < 0.05).

0 5 10 15

0

50

100

150

200

250

Time (min)

25M

g up

take

(% o

f moc

k)

mock

CNNM2

CNNM2-p.Glu122Lys

CNNM2-p.Ser269Trp

CNNM2-p.Leu330Phe

CNNM2-p.Glu357Lys

CNNM2-p.Thr568Ile

*

**

*

A

B

116

97

116

97

–

CNNM2p.Glu122Lys

CNNM2p.Ser269Trp

CNNM2p.Leu330Phe

CNNM2p.Glu357Lys

CNNM2p.Thr568Ile

CNNM2WT

+ + + + + + + + + + + + +

mock

Biotin

Total proteinfraction

Cell surfacefraction

Biot

inyl

ated

Fra

ctio

n (%

of W

T)

kDa

WT

p.Glu12

2Lys

p.Ser269Trp

p.Leu330Phe

p.Glu357Ly

s

p.Thr568Ile

0

50

100

150

172 | Chapter 7

Disturbed Mg2+ Homeostasis and Brain Abnormalities in cnnm2 Morphant Zebrafish LarvaePatients with mutations in CNNM2 suffer from hypomagnesemia. Therefore, zebrafish cnnm2 morphants were tested for disruptions of their Mg2+ homeostasis. Extraction of serum from zebrafish embryos is technically not feasible. Thus, total body Mg contents of controls and morphant larvae were examined at 5 days post-fertilization (dpf). During these 5 days of zebrafish development, intestinal absorption of Mg2+ does not take place since larvae do not eat and drink. For that reason, Mg2+ homeostasis is the result of the balance between Mg2+ excretion, passive Mg2+ uptake from the yolk, Mg2+ reabsorption in the kidney, and Mg2+ uptake in the integument, where ionocytes are analogous to renal tubular cells in terms of function and transporter and channel expression (17). Therefore, when knocking down a gene involved in active epithelial Mg2+ uptake, disturbances in total body Mg content reliably represent disturbances in active Mg2+ reabsorption and/or uptake, through pronephric (renal) tubular cells and/or their analogous in the skin, respectively. The cnnm2a gene, one of the two zebrafish cnnm2 paralogues, is expressed during early development (Figure 4A). Injection in embryos of higher doses than 2 ng of morpholino (MO) blocking cnnm2a translation resulted in a significantly reduced survival compared to controls at 5 dpf (Figure 4B). At non-lethal doses of MO (when mortality caused by the cnnm2a-MO does not differ significantly from mortality in controls), knockdown of cnnm2a resulted in morphological phenotypes characterized by enlarged pericardial cavities and notochord defects (Figure 4C-D). The biochemical equivalency between mammalian CNNM2 and its zebrafish orthologue Cnnm2a was demonstrated by the fact that co-injection of cnnm2a-MO with mouse wild-type Cnnm2 cRNA induced a rescue of all phenotypes observed (Fig. 4E). Conversely, co-injection with mouse mutant Cnnm2 cRNA did not result in any rescue. In line with the symptom of hypomagnesemia in patients with mutated CNNM2, cnnm2a morphants exhibited significantly reduced levels of Mg compared to controls when increasing doses of MO were injected (Figure 4F). Total Mg content in cnnm2a morphants was restored to control levels when cnnm2a-MO was co-injected with cRNA encoding for mouse wild-type CNNM2 and not with mutant Cnnm2 (Figure 4G). This demonstrated that the defects observed in morphants were indeed caused by dysfunctional cnnm2a and not by toxic off-target effects. Zebrafish cnnm2b is also expressed during early development (Figure 5A). Survival in cnnm2b morphants was not affected by the knockdown (Figure 5B). The cnnm2b morphants were characterized by enlarged pericardial cavities, kidney cysts and, in agreement with the morphological brain abnormalities observed in the F1.1 patient, by accumulation of cerebrospinal fluid in the cerebrum (Figure 5C-D). Interestingly, most cnnm2b morphants were morphologically normal at the dose of 2 ng MO/embryo (Figure 5D). All morphological phenotypes were rescued by co-injection of cnnm2b-MO with mouse wild-type Cnnm2 (Figure 5E). As for cnnm2a, cnnm2b was demonstrated to reduce Mg levels when knocked


Figure 4 Knockdown of cnnm2a Results in Mg Wasting in Zebrafish Larvae

A, mRNA expression of cnnm2a in developing zebrafish. Expression patterns were analysed by

RT-qPCR (n=6). B, Survival curve at 5 dpf (n=3). The dose of zero represents injection with control-MO.

C, Morphological phenotypes in zebrafish larvae (5 dpf) in cnnm2a knockdown experiments.

D, Distribution of morphological phenotypes in zebrafish larvae (5 dpf) untreated (wild-type) or

injected with different doses of cnnm2a-MO or control-MO. Numbers on top of the bars indicate the

number of animals in each experimental condition. E, Distribution of morphological phenotypes

in zebrafish larvae at 5 dpf in rescue experiments. The wild-type phenotype (class I) was restored

in morphants by co-injection of cnnm2a-MO (2 ng MO/embryo) with wild-type CNNM2 cRNA

(50 pg cRNA/embryo), but not with mutant (p.Glu357Lys) CNNM2 cRNA (50 pg cRNA/embryo).

F, Magnesium content in zebrafish injected with different doses of cnnm2a-MO, the dose of zero

represents injection with control-MO (n=10 except in 8 ng MO-injected zebrafish where n=5).

G, Rescue of Mg wasting in morphant zebrafish by co-injection of cnnm2a-MO (2 ng MO/embryo)

with cRNA encoding for wild-type (WT) CNNM2 (50 pg cRNA/embryo). Co-injection with cRNA

encoding for mutant (MT, p.Glu357Lys) CNNM2 (50 pg cRNA/embryo) did not restore Mg levels

(n = 10 per experimental condition). Data are presented as mean ± SEM. Different letters indicate

significant differences between mean values in experimental groups (P < 0.05).

cnnm2a -MO (ng/embryo)0 2 4 6 8

Surv

ival

at 5

dpf

(%)

0

20

40

60

80

100

120

a a

b

c


Mg

(µg

Mg/

mg

prot

ein)

0

2

4

6

8

10

a

bb b

Control

MO

MO + W

T CNNM2

MO + M

T CNNM2

Mg

(µg

Mg/

mg

prot

ein)

0

2

4

6

8

10

a

bb

a

Class I

Class II Class III

Class IV

Class V

Wild

-type

Control

2 ng MO/e

mbryo

4 ng MO/e

mbryo

8 ng MO/e

mbryo

Phen

otyp

e (%

)

020406080

100120

Class IClass IIClass IIIClass IVClass VDead

93 100 94 94 97

Control

MO

MO + W

T CNNM2

MO + M

T CNNM2

Phen

otyp

e (%

)

020406080

100120


117 119 110 100

Time (hours post-fertilization)

0 20 40 60 80 100 120

cnnm

2a

mRN

A e

xpre

ssio

nin

wild

-typ

e ze

brafi

sh (f

old

chan

ge)

0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.4Passive diffusion of Mg2+ from the yolk

Epithelial (integument) absorption of Mg2+

Pronephric (re)absorption of Mg2+

A

C

F

B

D

E

G

174 | Chapter 7

Figure 4 Continued


Surv

ival

at 5

dpf

(%)

0

20

40

60

80

100

120

a a

b

c


Mg

(µg

Mg/

mg

prot

ein)

0

2

4

6

8

10

a

bb b

Control

MO

MO + W

T CNNM2

MO + M

T CNNM2

Mg

(µg

Mg/

mg

prot

ein)

0

2

4

6

8

10

a

bb

a

Class I

Class II Class III

Class IV

Class V

Wild

-type

Control

2 ng MO/e

mbryo

4 ng MO/e

mbryo

8 ng MO/e

mbryo

Phen

otyp

e (%

)

020406080

100120


93 100 94 94 97

Control

MO

MO + W

T CNNM2

MO + M

T CNNM2

Phen

otyp

e (%

)

020406080

100120


117 119 110 100


0 20 40 60 80 100 120

cnnm

2a

mRN

A e

xpre

ssio

nin

wild

-typ

e ze

brafi

sh (f

old

chan

ge)

0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.4Passive diffusion of Mg2+ from the yolk



A

C

F

B

D

E

G

Figure 5 Knockdown of cnnm2b Results in Mg Wasting and Brain Malformations in Zebrafish Larvae

A, mRNA expression of cnnm2b in developing zebrafish. Expression patterns were analysed by RT-

qPCR (n=6 per time point). B, Survival curve at 5 dpf (n=3). The dose of zero represents injection

with control-MO. C, Morphological phenotypes in zebrafish larvae (5 dpf) in cnnm2b knockdown

experiments. D, Distribution of morphological phenotypes in zebrafish larvae (5 dpf) untreated

(wild-type) or injected with different doses of cnnm2b-MO or control-MO. Brain malformations

(widened cerebrospinal fluid spaces, class IV phenotype) are prominent in morphants injected

with 4-8 ng MO/embryo. Numbers on top of the bars indicate the number of animals in each

experimental condition. E, Distribution of morphological phenotypes in zebrafish larvae at 5 dpf in

rescue experiments. The wild-type phenotype (class I) was restored in morphants by co-injection

of cnnm2b-MO (8 ng MO/embryo) with wild-type CNNM2 cRNA (50 pg cRNA/embryo), but not

with mutant (p.Glu357Lys) CNNM2 cRNA (50 pg cRNA/embryo). F, Magnesium content in zebrafish

injected with different doses of cnnm2b-MO. The dose of zero represents injection with control-MO

(n=10). G, Rescue of Mg wasting in morphant zebrafish by co-injection of cnnm2b-MO (8 ng MO/

embryo) with cRNA encoding for wild-type (WT) CNNM2 (50 pg cRNA/embryo). Co-injection with

cRNA encoding for mutant (MT, p.Glu357Lys) CNNM2 (50 pg cRNA/embryo) did not restore Mg levels

(n=10). Data are presented as mean ± SEM. Different letters indicate significant differences between

mean values in experimental groups (P < 0.05).

cnnm2b -MO (ng/embryo)0 2 4 6 8

Surv

ival

at 5

dpf

(%)

0

20

40

60

80

100

120

a a a a


Mg

(µg

Mg/

mg

prot

ein)

0

2

4

6

8

10a

b

cc

Control

MO

MO + W

T CNNM2

MO + M

T CNNM2

Phen

otyp

e (%

)

020406080

100120

Class IClass IIClass IIIClass IVDead

107 106 100 116

Class I

Class II Class III

Class IV

Control

MO

MO + W

T CNNM2

MO + M

T CNNM2

Mg

(µg

Mg/

mg

prot

ein)

0

2

4

6

8

10a

bc

a


0 20 40 60 80 100 120

cnnm

2b

mRN

A e

xpre

ssio

nin

wild

-typ

e ze

brafi

sh (f

old

chan

ge)

05

1015202530354045

Passive diffusion of Mg2+ from the yolk



Wild

-type

Control

2 ng MO/e

mbryo

4 ng MO/e

mbryo

8 ng MO/e

mbryo

Phen

otyp

e (%

)

020406080

100120


105 102 101 104 104

A

C

F

B

D

E

G


down (Figure 5F) and to be functionally equivalent to mammalian CNNM2 in cRNA rescue experiments (Figure 5G). Phenotype rescue with mouse wild-type Cnnm2 demonstrated the absence of toxic off-target effects and the specificity of the cnnm2b-MO to produce defects attributable to impaired CNNM2 function.

Brain Abnormalities and Increased Spontaneous Contractions in cnnm2 Morphant Zebrafish EmbryosPatients with CNNM2 mutations suffer from mental retardation and seizures. As the severe neurological phenotype in patients F1.1 and F1.2 was diagnosed early after birth (Table 1), we hypothesized that the deleterious effects of mutant CNNM2 could result from early developmental defects in brain primordia. In zebrafish, the segmental organization of the brain rudiment, and morphologically visible boundaries and primordia are established at 25 hours post-fertilization (hpf). At this stage, maldevelopment of the midbrain hindbrain boundary (MHB) is observed in cnnm2a morphant embryos (Figure 6A-B). Interestingly,

Figure 5 Continued


Surv

ival

at 5

dpf

(%)

0

20

40

60

80

100

120

a a a a


Mg

(µg

Mg/

mg

prot

ein)

0

2

4

6

8

10a

b

cc

Control

MO

MO + W

T CNNM2

MO + M

T CNNM2

Phen

otyp

e (%

)

020406080

100120


107 106 100 116

Class I

Class II Class III

Class IV

Control

MO

MO + W

T CNNM2

MO + M

T CNNM2

Mg

(µg

Mg/

mg

prot

ein)

0

2

4

6

8

10a

bc

a


0 20 40 60 80 100 120

cnnm

2b

mRN

A e

xpre

ssio

nin

wild

-typ

e ze

brafi

sh (f

old

chan

ge)

05

1015202530354045

Passive diffusion of Mg2+ from the yolk



Wild

-type

Control

2 ng MO/e

mbryo

4 ng MO/e

mbryo

8 ng MO/e

mbryo

Phen

otyp

e (%

)

020406080

100120


105 102 101 104 104

A

C

F

B

D

E

G

176 | Chapter 7

Figure 6 Dysfunctional cnnm2a Causes Brain Abnormalities and Increased Spontaneous Contractions in Zebrafish Embryos

A, Phenotypes in zebrafish embryos untreated (wild-type, WT) or following treatment with (2 ng MO/

embryo) cnnm2a-MO or control-MO. M, midbrain; T, tectum; MHB, midbrain-hindbrain boundary;

FV, fourth ventricle; and H, hindbrain. B-C, Distribution of (B) phenotypes and (C) Mg content in

zebrafish embryos WT or injected with cnnm2a-MO or control-MO and exposed to a medium with

a concentration of Mg2+ of 0.33 or 25 mmol/L. Numbers on top of the bars indicate the number

of animals. D, Restoration of normal brain development by co-injection of cnnm2a-MO with cRNA

encoding for WT CNNM2, and not by co-injection with cRNA encoding for mutant (MT, p.Glu357Lys)

CNNM2. E, Spontaneous contractions in zebrafish embryos WT or injected with cnnm2a-MO

or control-MO and exposed to a medium with a concentration of Mg2+ of 0.33 or 25 mmol/L.

F, Restoration of normal spontaneous contraction activity by co-injection of cnnm2a-MO with cRNA

encoding for WT CNNM2, and not by co-injection with cRNA encoding for MT CNNM2. Data are

presented as mean ± SEM. *P < 0.05 versus WT and control. #P < 0.05 versus Mg2+-normal (0.33 mmol/L

Mg2+) medium. Data are presented as mean ± SEM. Letters indicate significant differences between

experimental groups (P < 0.05).

Control

MO

MO + W

T CNNM2

MO + M

T CNNM2

Phen

otyp

e (%

)

020406080

100120

Class IClass IIDead

109 116 108 106

Class I

Class II

MHB

T

M

FV

H

Wild

-type

Control

MO

Wild

-type

Control

MO

Phen

otyp

e (%

)

020406080

100120

Class IClass IIDead

99 111 111 106 104 109

0.33 mM Mg2+ 25 mM Mg2+

Wild

-type

Control

MO

Wild

-type

Control

MOM

g (µ

g M

g/m

g pr

otei

n)

0

5

10

15

200.33 mM Mg2+ 25 mM Mg2+

# ##

Wild

-type

Control

MO

Wild

-type

Control

MO

Seiz

ures

(con

trac

tions

/30

sec)

02468

1012 0.33 mM Mg2+ 25 mM Mg2+

**

Control

MO

MO + W

T CNNM2

MO + M

T CNNM2

Seiz

ures

(con

trac

tions

/30

sec)

02468

1012

a

b

a

c

A

C

F

B

D

E


these phenotypes could not be rescued by exposure to media with high Mg2+ concentrations (Figure 6B), even though these media significantly increased the Mg content of morphant embryos (Figure 6C). More importantly, phenotypes were rescued by co-injection with the mouse orthologue cRNA and not by co-injection with the mutant transcript (Figure 6D). In addition to brain developmental defects, the frequency of spontaneous embryonic contractions was increased in cnnm2a morphants compared to controls (Figure 6E), which could indicate that (motor) neurons are hyperexcitable (24). This phenotype was not rescued by exposure to high Mg2+ concentrations in the medium (Figure 6E). In contrast, co-injection of the cnnm2a-MO with mouse wild-type Cnnm2 cRNA did result in a rescue of the neurological functioning (Figure 6F). Conspicuously, co-injection with the mutant Cnnm2 cRNA even worsened this motor neuronal phenotype by increasing the number of spontaneous contractions significantly compared to embryos injected only with cnnm2a-MO (Figure 6F). In the case of cnnm2b morphants, enlarged tectums were also present in a 30 % of morphants in addition to the defects in the MHB, phenotypes that were not rescued by exposure to high Mg2+ concentrations (Figure 7A-C) but by co-injection of cnnm2b-MO with mouse wild-type Cnnm2 cRNA (Figure 7D). Spontaneous contraction frequency was increased in cnnm2b morphants (Figure 7E), restored to control levels with overexpression of mouse wild-type Cnnm2 (Figure 7F), and 4-fold increased with overexpression of mouse mutant Cnnm2 compared to cnnm2b morphants injected solely with cnnm2b-MO (Figure 7F).

Weaker Touch-evoked Escape Behaviour in cnnm2 Morphant Zebrafish LarvaeAs our in vitro data pointed to a putative interaction between CNNM2 and TRPM7 and zebrafish morphants presented brain developmental defects, the touch-evoked escape behaviour in zebrafish was evaluated, a parameter largely dependent on TRPM7 activity in sensory neurons and/or brain development (10, 23, 28). Indeed, in cnnm2a and cnnm2b morphants (at 5 dpf), touch-evoked escape behaviour was significantly weaker than that in controls (Figures 8-9). Additionally, this phenotype was rescued by co-injection of the MO with wild-type Cnnm2 cRNA and not by mutant Cnnm2 cRNA. As for the other phenotypes, cRNA rescues proved the causality between the weak touch-evoked escape behaviour in morphants and dysfunctional cnnm2 paralogues.

178 | Chapter 7

Figure 7 Dysfunctional cnnm2b Causes Brain Abnormalities and Increased Spontaneous Contractions in Zebrafish Embryos

A, Phenotypes in zebrafish embryos untreated (wild-type, WT) or following treatment with cnnm2b-

MO (8 ng MO/embryo) or control-MO. See Figure 6 for an explanation of the abbreviations shown.

B-C, Distribution of (B) phenotypes and (C) Mg content in zebrafish embryos WT or injected with

cnnm2b-MO or control-MO and exposed to a medium with a concentration of Mg2+ of 0.33 or 25

mmol/L. Numbers on top of the bars indicate the number of animals in each experimental condition.

D, Restoration of normal brain development by co-injection of cnnm2b-MO with cRNA encoding for

WT CNNM2 and not by co-injection with cRNA encoding for mutant (MT, p.Glu357Lys) CNNM2. E,

Spontaneous contractions in zebrafish embryos WT or injected with cnnm2b-MO or control-MO

and exposed to a medium with a concentration of Mg2+ of 0.33 or 25 mmol/L. F, Restoration of

normal spontaneous contraction activity by co-injection of cnnm2b-MO with cRNA encoding for

WT CNNM2 and not by co-injection with cRNA encoding for MT CNNM2. Data are presented as

mean ± SEM. *P < 0.05 versus wild-type and control. #P < 0.05 versus Mg2+-normal (0.33 mmol/L

Mg2+) medium. Data are presented as mean ± SEM. Different letters indicate significant differences

between mean values in experimental groups (P < 0.05).

Class I

Class II

Class III

MHB H

FVT

M

Wild

-type

Control

MO

Wild

-type

Control

MO

Phen

otyp

e (%

)

020406080

100120

Class IClass IIClass IIIDead

107 112 125 100 101 106

0.33 mM Mg2+ 25 mM Mg2+

Control

MO

MO + W

T CNNM2

MO + M

T CNNM2

Phen

otyp

e (%

)

020406080

100120

Class IClass IIClass IIIDead

124 115 124 112

Wild

-type

Control

MO

Wild

-type

Control

MOM

g (µ

g M

g/m

g pr

otei

n)

0

5

10

15

200.33 mM Mg2+ 25 mM Mg2+

# ##

Wild

-type

Control

MO

Wild

-type

Control

MO

Seiz

ures

(con

trac

tions

/30

sec)

0

5

10

15

20 0.33 mM Mg2+ 25 mM Mg2+

**

Control

MO

MO + W

T CNNM2

MO + M

T CNNM2

Seiz

ures

(con

trac

tions

/30

sec)

0

5

10

15

20

ab a

c

A

C

F

B

D

E


Figure 8 Touch-evoked Escape Behaviour in cnnm2a Morphant Zebrafish

Touch-evoked escape behaviour score in zebrafish cnnm2a morphants at 5 dpf after injection

of 2 ng control-MO/embryo, 2 ng cnnm2a-MO/embryo, 2 ng cnnm2a-MO/embryo + 50 pg wild-

type (WT) CNNM2 cRNA/embryo, or 2 ng cnnm2a-MO/embryo + 50 pg mutant (MT, p.Glu357Lys)

CNNM2 cRNA/embryo. Three categories were distinguished, responders, late responders and non-

responders, to which the following scores were given: 3 points for responders: fish quickly react

(swimming or flicking the tail) to the stimuli after 1 or 2 twitches; 2 points for late responders:

fish react (swimming or flicking the tail) to the stimuli after 3, 4 or 5 twitches; and 1 point for non-

responders: fish do not react to the stimuli after more than 5 twitches. The upper part of the

figure shows frames of videos showing touch-evoked escape contractions at 5 dpf of control

and morphant zebrafish larvae. Time of each video frame is indicated in centiseconds (cs). Data

are shown as mean ± SEM (n = 30). Different letters indicate significant differences between mean

values in experimental groups (P < 0.05).

Control

MO

MO + W

T CNNM2

MO + M

T CNNM2

Touc

h-ev

oked

es

cap

e b

ehav

iour

sco

re

1

2

3a

b b

a

Control

0 cs 110 cs 164 cs 173 cs 191 cs

0 cs 110 cs 119 cs 121 cs 126 cs

Morphant

180 | Chapter 7

Discussion

In the present study, a severe brain phenotype consisting of cerebral seizures, mental retardation and brain malformations in patients with hypomagnesemia was shown to be caused by mutations in CNNM2. Our experiments established CNNM2 as a new essential gene in brain development, neurological functioning and Mg2+ homeostasis. This notion

Figure 9 Touch-evoked Escape Behaviour in cnnm2b Morphant Zebrafish

Touch-evoked escape behaviour score in zebrafish cnnm2b morphants at 5 dpf after injection

of 8 ng control-MO/embryo, 8 ng cnnm2b-MO/embryo, 8 ng cnnm2b-MO/embryo + 50 pg wild-

type (WT) CNNM2 cRNA/embryo, or 2 ng cnnm2b-MO/embryo + 50 pg mutant (MT, p.Glu357Lys)

CNNM2 cRNA/embryo. Three categories were distinguished, responders, late responders and non-

responders, to which the following scores were given: 3 points for responders: fish quickly react

(swimming or flicking the tail) to the stimuli after 1 or 2 twitches; 2 points for late responders: fish

react (swimming or flicking the tail) to the stimuli after 3, 4 or 5 twitches; and 1 point for non-

responders: fish do not react to the stimuli after more than 5 twitches. The upper part of the

figure shows frames of videos showing touch-evoked escape contractions at 5 dpf of control

and morphant zebrafish larvae. Time of each video frame is indicated in centiseconds (cs). Data

are shown as mean ± SEM (n = 30). Different letters indicate significant differences between mean

values in experimental groups (P < 0.05).

Control

MO

MO + W

T CNNM2

MO + M

T CNNM2

Touc

h-ev

oked

esca

pe b

ehav

iour

sco

re

1

2

3a

bb

a

0 cs 169 cs 271 cs 275 cs 278 cs

Control

0 cs 262 cs 292 cs 312 cs 324 cs

Morphant


is supported by the following observations; i) hypomagnesemic patients with CNNM2 mutations suffer from seizures, mental disability, and if mutations are present in recessive state, brain malformations are observed in addition; ii) Mg2+ supplementation does not improve the neurological phenotype of the patients; iii) CNNM2 increases Mg2+ uptake in HEK293 cells, whereas mutant CNNM2 does not; iv) knockdown of CNNM2 orthologues in zebrafish results in impaired development of the brain, abnormal neurodevelopmental phenotypes manifested as altered locomotor and touch-evoke escape behaviours, and Mg wasting; v) the zebrafish phenotype can be rescued by injection of mouse Cnnm2 cRNA. In addition to the previously reported dominant mode of inheritance (31), the genetic findings in our patients support heterogenous patterns of inheritance. In family F1, a recessive mode of CNNM2 inheritance was observed. The homozygous CNNM2 p.Glu122Lys mutation in this family resulted in the manifestation of a neonatal onset and a considerably more severe cerebral involvement than in the remaining patients. Yet, a CNS phenotype with seizures and intellectual disability, which was not reported previously, represented the cardinal clinical symptom in all of our patients. Seizures constituted the major symptom at manifestation coinciding with hypomagnesemia, but were also seen during follow-up despite Mg2+ supplementation. Pronounced Mg2+ deficiency reflected by severely low serum Mg2+ levels clearly represents a promotive element in the development of seizures. However, the persistence of seizure activity despite Mg2+ supplementation might point to a genuine disturbance in brain function caused by defective CNNM2. Accordingly, the extent of hypomagnesemia found in the two siblings with the recessive mutation, F1.1 and F1.2, was identical to other patients (F2.1-F5.1) with heterozygous CNNM2 mutations and a milder neurological phenotype. Continuous oral Mg2+ supplementation stabilized serum Mg2+ levels in the subnormal range, however a complete normalization of Mg2+ metabolism could not be achieved in any of the patients. In three out of five families (F2, F3 and F4), the mutation of the patient was not present in the parents. This finding supports the recent advancements evidencing that de novo mutations provide an important mechanism in the development of mental disability disorders (35). Remarkably, the same de novo p.Glu357Lys mutation was identified in two unrelated individuals. Although the mutation rate along the human genome varies significantly (15), the chance to observe an identical de novo base pair change in two individuals is extremely small, supporting causality of this mutation. The clinical and genetic findings observed in patient F5.1 should be interpreted with caution. Though the p.Leu330Phe variant was not present in controls or exome variant databases, the presence of an innocuous polymorphism cannot be completely excluded. The clinical phenotype with a milder degree of intellectual disability and a later manifestation with hypomagnesemic symptoms during adolescence support a partial loss of CNNM2 function caused by the p.Leu330Phe variant. Unfortunately, the patient was not available for clinical re-evaluation.

182 | Chapter 7

Over the recent years, the function of CNNM2 in the context of Mg2+ handling has been heavily debated (6, 12, 30, 31, 38). Therefore, an important question is how CNNM2 mutations cause impaired Mg2+ metabolism and lead to CNS dysfunction. Functional studies in HEK293 cells demonstrated a putative role in cellular Mg2+ transport. Overexpression of CNNM2 increased cellular Mg2+ uptake, which was abrogated by introduction of the CNNM2 mutants identified in our patients. The p.Ser269Trp and p.Glu357Lys mutants as well as the previously published p.Thr568Ile mutant (31), all identified in heterozygous state, failed to enhance the cellular Mg2+ uptake, indicating a loss-of-function in mutated CNNM2. The recessively inherited p.Glu122Lys mutant identified in patients F1.1 and F1.2 displayed a small but significant residual function, while Mg2+ uptake was almost completely retained for mutant p.Leu330Phe. Biotinylation experiments demonstrated a trafficking defect of p.Glu122Lys and p.Ser269Trp mutants supporting a loss-of-function nature of CNNM2 mutations. Together, these findings argue for distinct degrees of severity of the disease depending on the number of affected alleles. Furthermore, a small residual function of p.Glu122Lys is in line with the lack of a clinical phenotype in the parents of family F1. The parents, however, declined a thorough evaluation of their Mg2+ status. To further analyze the relevance of CNNM2 for brain and Mg2+ metabolism deduced from the human disease model, the translation of orthologues of CNNM2 (cnnm2a and cnnm2b) was knocked down in zebrafish. In line with the human disease, the concentration of total body Mg was decreased in zebrafish cnnm2a and cnnm2b morphants when compared to controls. The decrease in total body Mg content is interpreted as a decrease in the renal absorption and/or skin uptake (through ionocytes analogous to renal tubular cells) of the ionic fraction, Mg2+, since only Mg2+ is transported transcellularly and no intestinal Mg2+ uptake takes place in zebrafish larvae. Additionally, Mg losses observed in morphant larvae were rescued by expression of wild-type Cnnm2, but not by expression of mutant Cnnm2. This demonstrates the specificity of our MO antisense oligos, as well as the functional equivalence between mammalian CNNM2 and its zebrafish orthologues. Consistent with the human pathology, knockdown of cnnm2a or cnnm2b induced brain malformations. Specifically, the brain phenotype observed in cnnm2b morphants resembles that found in patient F1.1 showing enlarged outer cerebrospinal liquor spaces. This provides further consistency to link CNNM2 dysfunction with the brain morphological defects found in this homozygous patient. The absence of outer cerebrospinal liquor spaces in the cerebrum of cnnm2a morphants shows that cnnm2 paralogues in zebrafish are a case of subfunctionalization at the level of the cerebrum. CNS malformations were rescued in morphants by co-injection with mouse wild-type Cnnm2. In homozygous patients, the neurological defects became evident early after birth. In line with a developmental role for CNNM2 within the CNS, gene expression of zebrafish cnnm2a and cnnm2b peaked within the first 24 hpf. In addition, in situ hybridization located cnnm2a expression specifically in the MHB (33), an organizing center in the neural tube


that determines neural fate and differentiation in the CNS during development (8, 29). Indeed, the most striking brain developmental defect in our study is maldevelopment of the MHB. These defects were rescued with Cnnm2 cRNA. Interestingly, the brain phenotypes observed in both zebrafish and patients were independent of Mg2+, as Mg2+ supplementation was unsuccessful to rescue the phenotypes. Thus, our findings suggest that a brain-specific CNNM2 function is crucial for the development of constitutive regions of the CNS, which in the zebrafish model is illustrated by defects in the MHB. At 25 hpf, a time point in which the locomotor behaviour is unaffected by the brain and only depends on signals from the spinal cord (28), zebrafish morphant embryos displayed an increased frequency of spontaneous contractions, especially when the MOs were co-injected with mutant Cnnm2. This hyperexcitability of motor neurons suggests a function of zebrafish Cnnm2 proteins in the regulation of the activity of the neurological network in the spinal cord or in the synaptic junctions with muscle fibbers. Consistent with these findings, patients with mutations in CNNM2 presented impaired motor skills, which were severe in the case of homozygous patients. In the CNS, TRPM7 is essential during early development (19), as it modulates neuro-transmitter release in sensory neurons (2, 21). Specifically, when using 2-APB, an inhibitor of TRPM7 (3), CNNM2-dependent Mg2+ transport was abolished in HEK293 cells. Remarkably, in a similar fashion to knockdown of trpm7 in zebrafish (10, 23), cnnm2a or cnnm2b morphants showed weaker touch-evoked escape behaviour compared to controls. In 5 dpf larvae, and unlike in 25 hpf embryos, locomotor behaviours elicited by touch require the involvement of high brain structures (28). Therefore, it is reasoned that CNNM2 conditions locomotor behaviour with an etiology that can be related to lack of excitation of sensory neurons via TRPM7 and/or to the defects in early brain development observed in zebrafish morphant embryos. In kidney, where CNNM2 is expressed at the basolateral membrane in DCT, specific regulation of TRPM7 Mg2+ reabsorption is unlikely, since TRPM6 is the main Mg2+ transporter in this segment. TRPM7 is a ubiquitously expressed gene regulating cellular Mg2+ metabolism, which is for instance involved in regulation of brain Mg2+ levels (16). Therefore, one could hypothesize that CNNM2 may regulate other proteins in addition to TRPM7 in kidney for the control of Mg2+ reabsorption, which remain to be identified. In conclusion, our findings of CNNM2 mutations in patients with hypomagnesemia and severe neurological impairment widen the clinical spectrum of CNNM2-related disease. By establishing a zebrafish CNNM2 loss-of-function model of the genetic disease, we provide a unique model for the testing of novel therapeutic drugs targeting CNNM2.

AcknowledgementsThe authors are grateful to the patients for their participation in this study. We thank Lonneke Duijkers, Jelle Eygensteyn, Margo Dona, Sami Mohammed and Andreas Kompatscher for excellent technical support. We thank W. Schwindt, Department of

184 | Chapter 7

Clinical Radiology, and Heymut Omran, Department of General Pediatrics, University Hospital Münster for help with the interpretation of neuroimaging studies. This work was supported by grants from the Netherlands Organization for Scientific Research (ZonMw 9120.8026, NWO ALW 818.02.001), a Dutch Kidney Foundation Innovation Grant (IP11.46), the EURenOmics project from the European Union seventh Framework Programme (FP7/2007–2013, agreement n° 305608) and NWO Vici Grant to JGJH (016.130.668). This work was further supported by the Hans-Joachim-Bodlee-Stifung and by the Peter-Stiftung.


Ethics StatementAll genetic studies were approved by the local ethics committee. Patients or their parents provided written informed consent in accordance to the Declaration of Helsinki. All animal experiments were performed in agreement with European, National and Institutional regulations.

Patients We studied a cohort of six patients from five families with hypomagnesemia and mental retardation. Patients F1.1 to F4.1 are followed in secondary or tertiary care neuropediatric centres. Neuroimaging was performed in F1.1, F2.1, F3.1, and F4.1 by cranial MRI (magnetic resonance imaging). Psychological diagnostic evaluation in patients F2.1 and F3.1 was performed using Snijders Oomen Non-Verbal (SON) Intelligence Test (revised) 5.5-17 years. Copy number variations (CNVs) associated with neurodevelopmental delay and intellectual disability were excluded in patients F1.1 and F2.1 by array CGH (comparative genomic hybridization) using the Sureprint G3 Human CGH Microarray kit (Agilent Technologies, Boeblingen, Germany) in patient F1.1 and using the Affymetrix Cytogenetics Whole- Genome 2.7 Array in patient F2.1.

Homozygosity Mapping and CNNM2 Mutational AnalysisGenomic DNA of affected individuals and available family members was extracted from whole blood using standard methods. A genome scan for shared homozygous regions was performed in the two affected children F1.1 and F1.2 with suspected parental consanguinity. Samples were genotyped on an Illumina human 660W Quad beadchip SNP array (Illumina, Eindhoven, The Netherlands). Merlin 1.1.2 (University of Michigan, Ann Arbor, MI, USA) was used to determine homozygous regions by linkage analysis. As exact information on pedigree structure was missing, we used a 1.7 Mb threshold for regions identical by descent that is very rarely crossed by non-consanguineous samples, but allows to identify most of the true homozygosity regions if parental consanguinity is present (14). A list of candidate genes within the identified homozygous intervals was


generated including known Refseq genes as well as novel transcripts using Ensembl Genome assembly GRCh37 via biomart (www.ensembl.org). At a cut-off size of >1.7 Mb, eleven critical intervals were yielded on autosomes with a cumulative size of 62 Mb. The gene list generated from these loci included 322 RefSeq genes and putative transcripts, including CNNM2 in a critical interval of 7.1 Mb on chromosome 10. The entire coding region and splice-sites of the most promising candidate gene CNNM2 were sequenced from both strands (Genbank: NM_017649.4, Uniprot: Q9H8M5). After discovery of a homozygous mutation in the index family F1, the mutational screening was extended to patients with hypomagnesemia without mutations in known genes involved in hereditary magnesium wasting. The presence of newly identified CNNM2 sequence variations was tested in at least 204 ethnically matched control alleles and compared to publically available exome data (www.1000genomes.org; evs.gs.washington.edu). Additionally, all identified mutations were ranked for potential damage on protein function using Polyphen-2 (genetics.bwh.harvard.edu/cgi-bin/ggi/ggi2.cgi).

DNA ConstructsMouse wild-type Cnnm2 construct was cloned into the pCINeo HA IRES GFP vector as described previously (6). Cnnm2 mutations were inserted in the construct using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) according to the manufacturer’s protocol. All constructs were verified by sequence analysis. Primer sequences used for cloning or mutagenesis PCR are reported in Table 2.

Cell Culture HEK293 cells were grown in Dulbecco’s modified eagle’s medium (DMEM, Bio Whittaker- Europe, Verviers, Belgium) containing 10 % (v/v) fetal calf serum (PAA, Liz, Austria), 2 mmol/L L-glutamine and 10 μg/mL non-essential amino acids, at 37 °C in a humidity-controlled incubator with 5 % (v/v) CO2. The cells were transiently transfected with the

Table 2 Primer Sequences for Mutagenesis PCR

Mutation Sequence

E122K GGTCCCGCATCGCCTTCACTAAGCACGAGCGGCGCCGGCAC F

GTGCCGGCGCCGCTCGTGCTTAGTGAAGGCGATGCGGGACC R

S269W CATCTCGCTGCTGCTGTGCCTGTGGGGCATGTTCAGCGGCCTCAAC F

GTTGAGGCCGCTGAACATGCCCCACAGGCACAGCAGCAGCGAGATG R

L330F GTACTGGTCAACACCACGTTCACCATCCTGCTGGACGAC F

GTCGTCCAGCAGGATGGTGAACGTGGTGTTGACCAGTAC R

E357K GGCATCGTCATCTTCGGAAAAATCGTGCCCCAAGCCATC F

GATGGCTTGGGGCACGATTTTTCCGAAGATGACGATGCC R

186 | Chapter 7

respective DNA constructs using Lipofectamin 2000 (Invitrogen, Breda, The Netherlands) at 1:2 DNA:Lipofectamin ratio for 48 hrs unless otherwise stated.

Cell Surface BiotinylationHEK293 cells were transfected with wild-type and mutant CNNM2 constructs for 48 hrs. Subsequently, cell surface proteins were biotinylated as described previously (11). Briefly, cell surface proteins were biotinylated for 30 min at 4 °C in 0.5 mg/mL sulfo-NHS-LC-LC-biotin (Pierce, Rockford, IL, USA). Cells were washed and lysed in lysis buffer (150 mmol/L NaCl, 5 mmol/L EGTA, Triton 1 % (v/v), 1 µg/mL pepstatin, 1 mmol/L PMSF, 5 µg/mL leupeptin, 5 µg/mL aproptin, 50 mmol/L Tris/HCl pH 7.5). 10 % (v/v) of the sample was taken as input control and the rest of the protein lysates were incubated overnight with NeutrAvidin-agarose beads (Pierce, Rockford, IL, USA) at 4 °C. The next day, unbound protein was discarded by washing the beads 5 times with lysis buffer. The remaining protein lysates were denatured in Laemmli containing 100 mmol/L DTT for 30 min at 37 °C and subsequently subjected to SDS-PAGE. Then, immunoblots were incubated with mouse anti-HA 1:5,000 primary antibodies (Cell Signaling Technology, Danvers, MA, USA) and peroxidase conjugated sheep anti-mouse secondary antibodies 1:10,000 (Jackson Immunoresearch, Suffolk, UK).

Magnesium Transport AssaysHEK293 cells were transfected with wild-type and mutant CNNM2 constructs for 48 hrs and seeded on poly-L-lysine (Sigma, St Louis, MO, USA) coated 12-well plates. Mg2+ uptake was determined using a stable 25Mg2+ isotope (Cortecnet, Voisins Le Bretonneux, France), which has a natural abundance of ±10 %. Cells were washed with basic uptake buffer (in mmol/L: 125 NaCl, 5 KCl, 0.5 CaCl2, 0.5 Na2HPO4 0.5 Na2SO4, 15 HEPES/NaOH pH 7.5) and subsequently placed in basic uptake buffer containing 1 mmol/L 25Mg2+ (purity ±98 %) for 5 min unless stated differently. After washing three times with ice-cold PBS, the cells were lysed in HNO3 (≥65 %, Sigma) and subjected to ICP-MS (inductively coupled plasma mass spectrometry) analysis. For extrusion experiments, cells were transfected with wild-type or mutant CNNM2 constructs for 24 hrs. After 24 hrs, cells were placed in culture medium containing 1 mmol/L 25Mg2+ (purity ±98 %) for an additional 48 hrs. Before the start of the experiment, the cells were briefly washed in basic uptake buffer and subsequently placed in basic uptake buffer containing 0.5 mmol/L Mg2+ (containing ±10 % 25Mg2+) for 5 min. After washing three times with ice-cold PBS, the cells were lysed in nitric acid and subjected to ICP-MS analysis.

Morpholino Knockdown and Rescue ExperimentsWild-type Tupfel long-fin zebrafish were bred and raised under standard conditions (28.5 °C and 14 hrs of light: 10 hrs of dark cycle) in accordance with international and institutional guidelines. Zebrafish eggs were obtained from natural spawning. The following antisense


oligonucleotides (MOs) were raised against the translational start site of cnnm2a and cnnm2b, along with the standard mismatch control MO (Gene Tools, Philomath, OR, USA): cnnm2a, 5’-GCGGTCCATTGCTCTGCCATGTTGA-3’; cnnm2b, 5’-ACCGACGGTTCTGCCATGTT-GATAA-3’; and the negative control (standard mismatch MO), directed against a human β-globin intron mutation, 5’-CCTCTTACCTCAGTTACAATTTATA. The underlined areas indicate the complementary sequences to the initial methionines of cnnm2a and cnnm2b. MOs were diluted in deionized, sterile water supplemented with 0.5 % (w/v) phenol red and injected in a volume of 1 nL into the yolk of one- to two-cell stage embryos using a Pneumatic PicoPump pv280 (World Precision Instruments, Sarasota, FL, USA). Wild-type (uninjected) embryos were also included in the experiments to control for the effects of the injection procedure per se. To determine the most effective dose of the cnnm2a- and cnnm2b-MO, 2, 4 and 8 ng were injected. In these experiments, control embryos were injected with 8 ng of the standard mismatch control MO (the highest dose). After injection, embryos from the same experimental condition were placed in 3 Petri dishes (at a maximum density of 45 embryos/dish, allowing statistical comparisons between survivals in the different experimental conditions) and cultured at 28.5 °C in E3 embryo medium (in mmol/L: 5 NaCl, 0.17 KCl, 0.33 CaCl2, 0.33 MgSO4), which was refreshed daily. As criteria for subsequent experiments, the dose of MO that caused major effects and induced a percentage of mortality non-significantly different from controls was injected (2 ng for cnnm2a-MO and 8 ng for cnnm2b-MO). In experiments that implied exposure to high Mg2+ concentrations, the high Mg2+ medium had a composition of 5 mmol/L NaCl, 0.17 mmol/L KCl, 0.33 mmol/L CaCl2 and 25 mmol/L MgSO4. In order to control for the specificity of the MOs blocking the translation of cnnm2a and cnnm2b, as well as for toxic off-target effects, in vivo cRNA rescue experiments were performed (9). For these experiments, mouse wild-type CNNM2 and mutant (p.Glu357Lys) CNNM2 cRNAs were prepared using the mMESSAGE mMACHINE Kit (Ambion, Austin, TX, USA) according to the manufacturer’s instructions. The cRNAs, in an amount of 50 pg, as based on other studies (24), were (co)injected together with MOs or alone as described above. Zebrafish embryos and larvae were phenotyped at 25 hpf or 5 dpf, respectively.

Analysis of Phenotypes in Zebrafish Embryos and LarvaeFor the analyses of brain phenotypes, the brain rudiment of zebrafish embryos at 25 hpf was observed for morphological changes under a Leica MZFLIII microscope (Leica Microsystems Ltd, Heerburgg, Germany). Morphological phenotypes, which also included the brain, were also analysed in larvae at 5 dpf. Embryos or larvae were classified into different classes of phenotypes on the basis of comparisons with stage-matched control embryos of the same clutch. In cnnm2a morphant embryos (25 hpf), two phenotype classes were distinguished: class I, normal; and class II, embryos with underdeveloped MHB. In cnnm2a morphant larvae (5 dpf), the following classes were distinguished: class I, normal; class II, normal with non-inflated swim bladder; class III, larvae with enlarged

188 | Chapter 7

pericardial cavity (edema) and non-inflated swim bladder; class IV, larvae with notochord defects, enlarged pericardial cavity and non-inflated swim bladder; and class V, larvae with severely enlarged pericardial cavity, notochord defects and non-inflated swim bladder. In cnnm2b morphant embryos (25 hpf), three different phenotypes were distinguished: class I, normal; class II, embryos with underdeveloped MHB; and class III, embryos with underdeveloped MHB and enlarged tectum. In cnnm2b morphant larvae (5 dpf), the number of different phenotypes distinguished were four: class I, normal; class II, normal with non-inflated swim bladder; class III, larvae with enlarged pericardial cavity (edema) and non-inflated swim bladder; and class IV, larvae with widened outer cerebrospinal fluid spaces, kidney cysts, severely enlarged pericardial cavity and non-inflated swim bladder. Representative images were obtained with a DFC450C camera (Leica Microsystems Ltd) after anaesthetising embryos or larvae with tricaine/Tris pH 7.0 solution. Prior to anaesthesia and image acquisition, zebrafish embryos were manually dechorionated.

Mg2+ Determinations in Embryos and LarvaeZebrafish embryos or larvae were anesthetized with tricaine/Tris pH 7.0 solution and 5-7 individuals were pooled as one sample. Samples were then snap frozen in liquid nitrogen and stored at -80°C in order to ensure euthanasia of animals and remained at these storage conditions until the beginning of the analytical procedures.Analytical procedures started by quickly washing the samples with nanopure water in order to avoid contamination of remaining waterborne Mg2+. The washing procedure was repeated twice. Fish were then dried at 65 °C for 1.5 hrs, at which time 2.5 µL of HNO3 (≥65 %, Sigma) was added to each tube. Samples were digested at 65 °C during 1.5 hrs. After, digested samples were diluted 1:10 with 22.5 µL nanopure water. The total Mg content in each sample was determined with a commercial colorimetric assay (Roche Diagnostics, Woerden, The Netherlands) following the manufacturer’s protocol. Blanks (HNO3 diluted 1:10 with nanopure water) were added during assays and values were equal to zero. Within-run precision and accuracy was controlled by means of an internal control Precinorm (Roche Diagnostics). Samples from embryos exposed to 25 mmol/L Mg2+ were further diluted (1:20). Furthermore, samples were normalized by protein content, which was determined in 1:20 (embryos at 25 hpf) or 1:50 (larvae at 5 dpf) diluted samples using the PierceTM BCA protein assay kit (Pierce Biotechnology, Rockford, IL, USA).

Total RNA Isolation, cDNA Synthesis and Real Time PCR AnalysisZebrafish embryos or larvae at specific developmental times (6, 12, 24, 48, 72, 96 and 120 hpf) were anaesthetised with tricaine/Tris pH 7 solution and 10 individuals were pooled as one sample. RNA isolation, cDNA synthesis and quantitative real-time PCR (RT-qPCR) measurements were carried out as previously described using validated cnnm2a and cnnm2b primers (1). Samples were normalized to the expression level of the housekeeping gene elongation factor-1α (elf1α) (1). Relative mRNA expression was analysed using the


Livak method (2−ΔΔCt), where results are expressed relative to the gene expression at 6 hpf (time point chosen as calibrator).

Spontaneous Contraction Analysis and Touch-evoked Escape BehaviourAt 25 hpf, 10 zebrafish embryos per Petri dish (n=30 per experimental condition) were randomly selected. The number of complete body contractions each zebrafish made in 30 s period was counted and was used as indicative of motor neuron activity (28). Representative videos of each experimental condition were taken using Leica Application Suite (Leica Microsystems Ltd) and a Leica MZFLIII microscope (Leica Microsystems Ltd) equipped with a DFC450C camera (Leica Microsystems Ltd). For the analysis of the touch-evoked escape behaviour, 10 zebrafish larvae per Petri dish (n=30 per experimental condition) were randomly selected. Touch-evoked escape behaviours were elicited by touching a larva in the tail up to 6 times with a pair of forceps at 5 dpf. Three categories were distinguished, responders, late responders and non-responders, to which the following scores were given: 3 points for responders: fish quickly react (swimming or flicking the tail) to the stimuli after 1 or 2 twitches; 2 points for late responders: fish react (swimming or flicking the tail) to the stimuli after 3, 4 or 5 twitches; and 1 point for non-responders: fish do not react to the stimuli after more than 5 twitches. Representative videos were recorded with the system described above. Statistical AnalysisAll results are depicted as mean ± standard error of the mean (SEM). Statistical analyses were conducted by one- or two-way (for experiments where zebrafish embryos were exposed to different Mg2+ concentrations, then two factors of variance appear: Mg2+ concentration and treatment) ANOVA. Where appropriate, data were logarithmically transformed to fulfil the requirements for ANOVA, but all data are shown in their decimal values for clarity. When data did not comply with the premises of the parametric ANOVA, data were analyzed using a Kruskal-Wallis ANOVA on ranks. Tukey’s post-test was used to identify significantly different groups. Statistical significance was accepted at P < 0.05.

190 | Chapter 7

References1. Arjona FJ, Chen YX, Flik G, Bindels RJ, and Hoenderop JG. Tissue-specific expression and in vivo regulation

of zebrafish orthologues of mammalian genes related to symptomatic hypomagnesemia. Pflugers Arch 2013.2. Brauchi S, Krapivinsky G, Krapivinsky L, and Clapham DE. TRPM7 facilitates cholinergic vesicle fusion

with the plasma membrane. Proc Natl Acad Sci U S A 105: 8304-8308, 2008.3. Chokshi R, Fruasaha P, and Kozak JA. 2-aminoethyl diphenyl borinate (2-APB) inhibits TRPM7 channels

through an intracellular acidification mechanism. Channels (Austin) 6: 362-369, 2012.4. Consortium SPG-WASG. Genome-wide association study identifies five new schizophrenia loci. Nat Genet

43: 969-976, 2011.5. de Baaij JH, Groot Koerkamp MJ, Lavrijsen M, van Zeeland F, Meijer H, Holstege FC, Bindels RJ, and

Hoenderop JG. Elucidation of the distal convoluted tubule transcriptome identifies new candidate genes involved in renal magnesium handling. Am J Physiol Renal Physiol doi:10.1152/ajprenal.00322.2013: 2013.

6. de Baaij JH, Stuiver M, Meij IC, Lainez S, Kopplin K, Venselaar H, Muller D, Bindels RJ, and Hoenderop JG. Membrane topology and intracellular processing of cyclin M2 (CNNM2). J Biol Chem 287: 13644-13655, 2012.

7. Dimke H, Monnens L, Hoenderop JG, and Bindels RJ. Evaluation of Hypomagnesemia: Lessons From Disorders of Tubular Transport. Am J Kidney Dis 2012.

8. Dworkin S, and Jane SM. Novel mechanisms that pattern and shape the midbrain-hindbrain boundary. Cell Mol Life Sci 2013.

9. Eisen JS, and Smith JC. Controlling morpholino experiments: don’t stop making antisense. Development 135: 1735-1743, 2008.

10. Elizondo MR, Arduini BL, Paulsen J, MacDonald EL, Sabel JL, Henion PD, Cornell RA, and Parichy DM. Defective skeletogenesis with kidney stone formation in dwarf zebrafish mutant for trpm7. Curr Biol 15: 667-671, 2005.

11. Gkika D, Mahieu F, Nilius B, Hoenderop JG, and Bindels RJ. 80K-H as a new Ca2+ sensor regulating the activity of the epithelial Ca2+ channel transient receptor potential cation channel V5 (TRPV5). J Biol Chem 279: 26351-26357, 2004.

12. Goytain A, and Quamme GA. Functional characterization of ACDP2 (ancient conserved domain protein), a divalent metal transporter. Physiol Genomics 22: 382-389, 2005.

13. Goytain A, and Quamme GA. Identification and characterization of a novel mammalian Mg2+ transporter with channel-like properties. BMC Genomics 6: 48, 2005.

14. Hildebrandt F, Heeringa SF, Rüschendorf F, Attanasio M, Nürnberg G, Becker C, Seelow D, Huebner N, Chernin G, Vlangos CN, Zhou W, O’Toole JF, Hoskins BE, Wolf MT, Hinkes BG, Chaib H, Ashraf S, Schoeb DS, Ovunc B, Allen SJ, Vega-Warner V, Wise E, Harville HM, Lyons RH, Washburn J, Macdonald J, Nürnberg P, and Otto EA. A systematic approach to mapping recessive disease genes in individuals from outbred populations. PLOS Genet 5: e10000353, 2009.

15. Hodgkinson A, and Eyre-Walker A. Variation in the mutation rate across mammalian genomes. Nat Rev Genet 12: 756-766, 2011.

16. Hoenderop JG, and Bindels RJ. Calciotropic and magnesiotropic TRP channels. Physiology (Bethesda) 23: 32-40, 2008.

17. Hwang P-P, and Chou M-Y. Zebrafish as an animal model to study ion homeostasis. Pflügers Arch 465: 1233-1247, 2013.

18. Jin J, Wu LJ, Jun J, Cheng X, Xu H, Andrews NC, and Clapham DE. The channel kinase, TRPM7, is required for early embryonic development. Proc Natl Acad Sci USA 109: E225-E233, 2012.

19. Jin J, Wu LJ, Jun J, Cheng X, Xu H, Andrews NC, and Clapham DE. The channel kinase, TRPM7, is required for early embryonic development. Proc Natl Acad Sci U S A 109: E225-233, 2012.

20. Kolisek M, Nestler A, Vormann J, and Schweigel-Rontgen M. Human gene SLC41A1 encodes for the Na+/Mg(2)+ exchanger. Am J Physiol Cell Physiol 302: C318-326, 2012.

21. Krapivinsky G, Mochida S, Krapivinsky L, Cibulsky SM, and Clapham DE. The TRPM7 ion channel functions in cholinergic synaptic vesicles and affects transmitter release. Neuron 52: 485-496, 2006.

22. Lieschke GJ, and Currie PD. Animal models of human disease: zebrafish swim into view. Nature Reviews Genetics 8: 353-367, 2007.


23. Low SE, Amburgey K, Horstick E, Linsley J, Sprague SM, Cui WW, Zhou W, Hirata H, Saint-Amant L, Hume RI, and Kuwada JY. TRPM7 is required within zebrafish sensory neurons for the activation of touch-evoked escape behaviors. J Neurosci 31: 11633-11644, 2011.

24. Mahmood F, Mozere M, Zdebik AA, Stanescu HC, Tobin J, Beales PL, Kleta R, Bockenhauer D, and Russell C. Generation and validation of a zebrafish model of EAST (epilepsy, ataxia, sensorineural deafness and tubulopathy) syndrome. Dis Model Mech 6: 652-660, 2013.

25. Moser J, Kilb W, Werhahn KJ, and Luhmann HJ. Early developmental alterations of low-Mg2+ -induced epileptiform activity in the intact corticohippocampal formation of the newborn mouse in vitro. Brain Res 1077: 170-177, 2006.

26. Newton-Cheh C, Johnson T, Gateva V, Tobin MD, Bochud M, Coin L, Najjar SS, Zhao JH, Heath SC, Eyheramendy S, Papadakis K, Voight BF, Scott LJ, Zhang F, Farrall M, Tanaka T, Wallace C, Chambers JC, Khaw KT, Nilsson P, van der Harst P, Polidoro S, Grobbee DE, Onland-Moret NC, Bots ML, Wain LV, Elliott KS, Teumer A, Luan J, Lucas G, Kuusisto J, Burton PR, Hadley D, McArdle WL, Brown M, Dominiczak A, Newhouse SJ, Samani NJ, Webster J, Zeggini E, Beckmann JS, Bergmann S, Lim N, Song K, Vollenweider P, Waeber G, Waterworth DM, Yuan X, Groop L, Orho-Melander M, Allione A, Di Gregorio A, Guarrera S, Panico S, Ricceri F, Romanazzi V, Sacerdote C, Vineis P, Barroso I, Sandhu MS, Luben RN, Crawford GJ, Jousilahti P, Perola M, Boehnke M, Bonnycastle LL, Collins FS, Jackson AU, Mohlke KL, Stringham HM, Valle TT, Willer CJ, Bergman RN, Morken MA, Doring A, Gieger C, Illig T, Meitinger T, Org E, Pfeufer A, Wichmann HE, Kathiresan S, Marrugat J, O’Donnell CJ, Schwartz SM, Siscovick DS, Subirana I, Freimer NB, Hartikainen AL, McCarthy MI, O’Reilly PF, Peltonen L, Pouta A, de Jong PE, Snieder H, van Gilst WH, Clarke R, Goel A, Hamsten A, Peden JF, Seedorf U, Syvanen AC, Tognoni G, Lakatta EG, Sanna S, Scheet P, Schlessinger D, Scuteri A, Dorr M, Ernst F, Felix SB, Homuth G, Lorbeer R, Reffelmann T, Rettig R, Volker U, Galan P, Gut IG, Hercberg S, Lathrop GM, Zelenika D, Deloukas P, Soranzo N, Williams FM, Zhai G, Salomaa V, Laakso M, Elosua R, Forouhi NG, Volzke H, Uiterwaal CS, van der Schouw YT, Numans ME, Matullo G, Navis G, Berglund G, Bingham SA, Kooner JS, Connell JM, Bandinelli S, Ferrucci L, Watkins H, Spector TD, Tuomilehto J, Altshuler D, Strachan DP, Laan M, Meneton P, Wareham NJ, Uda M, Jarvelin MR, Mooser V, Melander O, Loos RJ, Elliott P, Abecasis GR, Caulfield M, and Munroe PB. Genome-wide association study identifies eight loci associated with blood pressure. Nat Genet 41: 666-676, 2009.

27. Runnels LW. TRPM6 and TRPM7: A Mul-TRP-PLIK-cation of channel functions. Curr Pharm Biotechnol 12: 42-53, 2011.

28. Saint-Amant L, and Drapeau P. Time course of the development of motor behaviors in the zebrafish embryo. Journal of Neurobiology 37: 622-632, 1998.

29. Scholpp S, and Brand M. Neural Patterning: Midbrain–Hindbrain Boundary. In: Encyclopedia of Neuroscience, edited by Editor-in-Chief: Larry RS. Oxford: Academic Press, 2009, p. 205-211.

30. Sponder G, Svidova S, Schweigel M, Vormann J, and Kolisek M. Splice-variant 1 of the ancient domain protein 2 (ACDP2) complements the magnesium-deficient growth phenotype of Salmonella enterica sv. typhimurium strain MM281. Magnes Res 23: 105-114, 2010.

31. Stuiver M, Lainez S, Will C, Terryn S, Gunzel D, Debaix H, Sommer K, Kopplin K, Thumfart J, Kampik NB, Querfeld U, Willnow TE, Nemec V, Wagner CA, Hoenderop JG, Devuyst O, Knoers NV, Bindels RJ, Meij IC, and Muller D. CNNM2, encoding a basolateral protein required for renal Mg2+ handling, is mutated in dominant hypomagnesemia. Am J Hum Genet 88: 333-343, 2011.

32. Thebault S, Alexander RT, Tiel Groenestege WM, Hoenderop JG, and Bindels RJ. EGF increases TRPM6 activity and surface expression. J Am Soc Nephrol 20: 78-85, 2009.

33. Thisse B, and Thisse C. Fast Release Clones: A High Throughput Expression Analysis. ZFIN Direct Dat Submission (http://zfin.org), 2004.

34. van de Graaf SF, Bindels RJ, and Hoenderop JG. Physiology of epithelial Ca2+ and Mg2+ transport. Rev Physiol Biochem Pharmacol 158: 77-160, 2007.

35. Veltman JA, and Brunner HG. De novo mutations in human genetic disease. Nat Rev Genet 13: 565-575, 2012.36. Voets T, Nilius B, Hoefs S, van der Kemp AW, Droogmans G, Bindels RJ, and Hoenderop JG. TRPM6

forms the Mg2+ influx channel involved in intestinal and renal Mg2+ absorption. J Biol Chem 279: 19-25, 2004.

192 | Chapter 7

37. Walder RY, Landau D, Meyer P, Shalev H, Tsolia M, Borochowitz Z, Boettger MB, Beck GE, Englehardt RK, Carmi R, and Sheffield VC. Mutation of TRPM6 causes familial hypomagnesemia with secondary hypocalcemia. Nat Genet 31: 171-174, 2002.

38. Wang CY, Shi JD, Yang P, Kumar PG, Li QZ, Run QG, Su YC, Scott HS, Kao KJ, and She JX. Molecular cloning and characterization of a novel gene family of four ancient conserved domain proteins (ACDP). Gene 306: 37-44, 2003.

39. White JR, and Cameron AE. The Natural Abundance of Isotopes of Stable Elements. Physical Review 74: 991-1000, 1948.

40. Whittam R, and Wheeler KP. The sensitivity of a kidney ATPase to ouabain and to sodium and potassium. Biochim Biophys Acta 51: 622-624, 1961.

196 | Chapter 8

Abstract

The transient receptor potential melastatin type 6 (TRPM6) ion channel regulates the body Mg2+ homeostasis by mediating transcellular Mg2+ absorption in kidney and intestine. Here, the P2X4 receptor was established as a novel regulator of TRPM6 activity. Using RT-qPCR on a mouse tissue panel, P2x4 and P2x6 were shown to be expressed in the epithelium of the colon and of the kidney, two major sites of Mg2+ reabsorption. While P2x4 was highly expressed in the colon, both P2x4 and P2x6 mRNA were prominently expressed in the distal convoluted tubule (DCT) segment of the kidney, a segment with high Trpm6 expression. Using whole-cell patch clamp, an inhibitory role of P2X4 on TRPM6 activity was determined. Expression of P2X6, which does not form functional channels in mammalian cells, did not affect the function of TRPM6. The inhibition was dependent on the activity of P2X4, since a P2X4 mutant with altered ATP sensitivity was not able to inhibit TRPM6. Additionally, P2X4 was unable to inhibit TRPM7, a close homologue of TRPM6, suggesting that the inhibition is specific for TRPM6. To identify the intracellular signaling molecules that mediate the P2X4-dependent inhibition of TRPM6, the cells were treated with inhibitors of PKC, PKA and PI3K. However, none of these inhibitors prevented the inhibition of TRPM6 by P2X4. In conclusion, we propose that P2X4 receptor mediated purinergic signaling is a new regulatory mechanism of TRPM6 Mg2+ channels.

Keywords: Magnesium, Colon, Purinergic Receptor, P2X4, TRPM6

P2X4 Regulates the Activity of TRPM6 | 197

Introduction

Magnesium (Mg2+) plays a key role in bone formation, neuronal excitability and muscular function, which can be explained by its numerous cellular functions such as Ca2+-channel antagonist, inhibitor of Ca2+ signaling, NMDA receptor blocker and cofactor in over 300 enzymatic reactions. Among patients in the intensive care unit more than 50 % present disturbed Mg2+ balance (25). To keep serum Mg2+ levels within a constant range (0.7-1.1 mmol/L), the intestine facilitates uptake of Mg2+, bone serves as the body Mg2+ store and the kidney regulates the excretion of Mg2+ (9). Two separate absorption mechanisms facilitate Mg2+ uptake in the gut and the kidney. First, paracellular uptake allows the passive transport of Mg2+ from the lumen of the small intestine to the blood through the tight junctions between the cells (34). The fine-tuning of Mg2+ absorption is achieved in the colon and in the distal convoluted tubule (DCT) segment of the nephron, where the transient receptor potential melastatin

type 6 (TRPM6) channels function as the gatekeepers of transcellular Mg2+ transport (34, 45). Mutations causing loss of function of TRPM6 are the predominant cause for familial hypomagnesaemia where blood Mg2+ falls below the normal range (9, 35, 46). Knockout (KO) of Trpm6 is lethal in mice, whereas the heterozygous animals display a mild hypomag-nesaemia due to reduced intestinal and renal Mg2+ (re)absorption (52). In the DCT, TRPM6 has been shown to be regulated by a variety of factors, including: epidermal growth factor (EGF)(14, 40), insulin (29), estrogens (13) and acid-base status (30). In addition, various transporters and channels are necessary to maintain a favorable electrochemical gradient for transcellular Mg2+ uptake (reviewed in (9)). In contrast, factors regulating intestinal Mg2+ absorption are largely unknown although it was demonstrated that dietary Mg2+ intake modulates the expression of TRPM6 (13). ATP acts as an autocrine and paracrine modulator of ion transport processes in the kidney and intestine (24, 32). In the intestine, high amounts of ATP (25-500 µmol/L) are released in response to different stimuli, such as flow and neuronal activation (5). Two types of P2 purinergic receptors are expressed at the cell surface of epithelial cells. Whereas P2Y receptors act as G-protein coupled receptors, P2X receptors form ATP-activated ion channels (3, 31). The P2X receptor family consists of seven subtypes (P2X1-7) with distinct expression profiles and biophysical properties (3, 31). P2X receptors assemble in homo- or heterotrimers with large extracellular loops forming one or multiple ATP binding sites (3, 18). Activation of P2X receptors by extracellular ATP leads to the non-selective influx of cations into the cell. P2X receptors are commonly described as inhibitors of ion transport processes (24). In the kidney, P2X receptors negatively modulate water, Mg2+ and Na+ reabsorption (7, 26, 48, 51). Interestingly, a previous study described the P2X-dependent inhibition of Mg2+ influx in mouse DCT cells (7). Although the number of studies on the effects of P2X receptors on transport activity beyond the kidney is limited, recent publications support an inhibitory role in bone and intestine (1, 33).

198 | Chapter 8

In the present study, we aim to clarify the expression and the role of P2X receptors in the regulation of transcellular epithelial Mg2+ transport in the intestine and the kidney. After providing a transcriptional profile of P2X subunits in a mouse tissue panel, the renal expression of P2X4 and P2X6 was examined in detail using immunohistochemistry. With a combination of biochemistry and electrophysiology, a previously unknown inhibitory role of P2X4 on TRPM6 activity was demonstrated, suggesting that purinergic signaling is an important modulator of Mg2+ homeostasis.

Results

Expression Profile of P2X1-7 SubunitsIn order to determine the expression of P2X channels in Mg2+-transporting epithelia, the distribution of P2x1-7 subunits was assessed in a mouse cDNA tissue panel using RT-PCR. A broad range of intestinal tissues were chosen with the aim of pinpointing the expression of the different P2x to the distinct segments of the gut. Notably, P2x4 is the most expressed P2x subunit in the distal intestine, including colon and cecum, which are known for high capacity in transcellular Mg2+ reabsorption via TRPM6 (13). The expression of P2x4 is generally high in tissues with strong ion transporting capacities such as intestines, kidney and lung (Figure 1D). P2x6 mRNA levels are most prominent in the kidney, although it is present in all additionally examined tissues including intestine, lung and heart (Figure 1F). All other P2X receptors showed a distinct expression pattern that is less specific for ion transporting epithelia. Although present in duodenum, P2x1 mRNA levels are highest in spleen and lung (Figure 1A). P2x2 is exclusively expressed in testes (Figure 1B). P2x3 shows a broad expression pattern with presence in all parts of the intestines (Figure 1C). P2x5 is prominently expressed in heart, lung and testes (Figure 1E). P2x7 is present in lung, spleen and testes (Figure 1G). Transcellular Mg2+ reabsorption occurs in the DCT segment of the kidney. The expression of the different P2x isoforms in the DCT was further examined using RT-PCR on COPAS sorted kidney material and immunohistochemistry on kidney slices. Interestingly, the DCT almost exclusively expresses transcripts for P2x4 and P2x6 (Figure 2A). Total kidney samples from the same mice revealed that all P2x subunits are present in kidney tissue, although P2x3 and P2x7 mRNA transcript levels were low (Figure 2B). The localization of P2X4 and P2X6 proteins was further examined using immunohistochemis-try on mouse kidney tissue. Remarkably, a conspicuous co-localization of P2X6 and NCC was found, of which the latter serves as a marker for DCT (Figure 3A). Conversely, immuno-histochemical stainings on mouse kidney did not show co-localization of P2X4 and NCC (Figure 3B).


Figu

re 1

Tis

sue

Dis

trib

utio

n of

P2x

1-7

Subu

nits

A-G

, The

mRN

A ex

pres

sion

leve

ls of

P2x

1 (A

), P2

x2 (B

), P2

x3 (C

), P2

x4 (D

), P2

x5 (E

), P2

x6 (F

) and

P2x

7 (G

) in

a pa

nel o

f mou

se ti

ssue

s w

ere

mea

sure

d by

qua

ntita

tive

RT-P

CR a

nd n

orm

alize

d fo

r Gap

dh e

xpre

ssio

n. D

ata

are

expr

esse

d as

per

cent

age

of to

tal t

issue

exp

ress

ion

and

repr

esen

t the

mea

n of

3 in

divi

dual

exp

erim

ents

± S

EM.

A

Kidney

Duodenum Ileum

Jejunum Colon Cecu

m Brain Heart

Lung Liver

Spleen Teste

s Muscle

0204060

020406080100 Kidney

Duodenum Ileum

Jejunum Colon Cecu

m Brain Heart

Lung Liver Sp

leen Teste

s Muscle

010203040

Kidney

Duodenum Ileum

Jejunum Colon Cecu

m Brain Heart

Lung Liver Sp

leen Teste

s Muscle

010203040

Kidney

Duodenum Ileum

Jejunum Colon Cecu

m Brain Heart

Lung Liv

er Spleen Teste

s Muscle

CB

P2x1 mRNA expression(% of total expression)



E


010203040

Kidney

Duodenum Ileum

Jejunum Colon Cecu

m Brain Heart

Lung Liver Sp

leen Teste

s Muscle

G


0102030

Kidney

Duodenum Ileum

Jejunum Colon Cecu

m Brain Heart

Lung Liver Sp

leen Teste

s Muscle

D


01020304050F


Kidney

Duodenum Ileum

Jejunum Colon Cecu

m Brain Heart

Lung Liver Sp

leen Teste

s Muscle

200 | Chapter 8

Figure 2 P2x4 and P2x6 are Expressed in the DCT Segment of the Kidney

A-B, The mRNA expression levels of P2x1, P2x2, P2x3, P2x4, P2x5, P2x6, and P2x7 were measured from

COPAS-sorted DCT cells (A) or from COPAS-sorted cells from same kidney sample without selection

for EGFP (B). mRNA levels were measured by quantitative RT-PCR and normalized for Gapdh expression.

Data represent the mean of 4 experiments ± SEM.

Figure 3 P2X6 Co-localizes with NCC in the DCT

A, Mouse kidney sections were co-stained for NCC (in green) and P2X6 (in red). B, Mouse kidney

sections were co-stained for P2X4 (in green) and NCC (in red). Bars represent 100 µm (upper panel),

50 µm (middle panel) or 10 µm (bottom panel).

A

DC

T m

RNA

exp

ress

ion

(cop

y nu

mbe

r / G

APD

H X

10-2

)

P2X1P2X2

P2X3P2X4

P2X5P2X6

P2X7

0

0.5

1.0

1.5

2.0

B

P2X1P2X2

P2X3P2X4

P2X5P2X6

P2X7

0

0.2

0.4

0.6

0.8

1.0

Cor

tex

mRN

A e

xpre

ssio

n(c

opy

num

ber /

GA

PDH

X10

-2)

A

B


P2X4 Inhibits the Activity of TRPM6 Given the co-expression of TRPM6 with P2X4 in the colon, protein expression of P2X4 in the rat colonic crypts (38) and previous reports demonstrating P2X4-dependent inhibition of Mg2+ transport in the kidney (7), we investigated whether there is a functional interaction between P2X4 and TRPM6. Constructs of TRPM6 and P2X4 were either expressed alone or together in HEK293 cells and their function was investigated using whole-cell patch clamp. Cells were perfused with a Mg2+-free pipette solution as described previously (45). Voltage ramps evoked slowly-developing outwardly rectifying currents, a signature feature of TRPM6 under our recording conditions (Figure 4A-B, (45)). Measurement of the voltage-evoked current density at +80 mV revealed that co-transfection of P2X4 and TRPM6 led to the constitutive inhibition of TRPM6 activity near endogenous levels (Figure 4A-C), while ATP-evoked current increased from undetectable levels to -304 ± 54 pA/pF at -60 mV (n≥42, data not shown). Non-transfected cells showed an average voltage-evoked current density of 35 ± 5 pA/pF at +80 mV (Figure 4C). Co-transfection of P2X6 subunit together with TRPM6 yielded a current density not significantly different from TRPM6 alone (Figure 4C). In agreement with previous reports (4, 43), ATP-evoked current were absent from cells expressing P2X6 alone (n=9, data not shown). The expression of P2X6 at the membrane was confirmed by cell surface biotinylation (data not shown). In addition, the co-expression of TRPM6 and a P2X4 mutant (p.Tyr315Cys, P2X4mut (37)) with a reduced ATP sensitivity did not lead to the inhibition of TRPM6 (Figure 4C). A plot of TRPM6 current density versus the ATP-evoked current density revealed a dose-dependent inhibition of TRPM6 by P2X4 (Figure 4D). TRPM6 is made of a channel domain and a C-terminal intracellular kinase domain (35, 46). Co-transfection of P2X4 and the kinase-inactive TRPM6 mutant (p.Lys1804Arg, (41)) resulted in a similar inhibition (n≥9, data not shown), therefore excluding a role of the kinase domain of TRPM6. Interestingly, co-expression of P2X4 with TRPM7, a close homolog of TRPM6, did not inhibit TRPM7 (Figure 4E). The average ATP-evoked current in the presence of P2X4 and TRPM7 was 85 ± 16 pA/pF (n=10, data not shown). Cell surface biotinylation showed that TRPM6 membrane availability is not abolished when co-expressed with P2X4 (Figure 4F). These data demonstrates that P2X4 specifically inhibits TRPM6 in a way that requires the ion channel activity of P2X4.

TRPM6 Inhibition Does not Depend on PKC, PKA or PI3KGiven the Ca2+-permeability of P2X4 and the requirement of functional P2X4 channels for the inhibition of TRPM6, we hypothesized that the constitutive activity of P2X4 would lead to an increase in the cytosolic free Ca2+ concentration. Rising intracellular Ca2+ levels will activate Ca2+-dependent kinases such as protein kinase C (PKC). Cells were incubated with the PKC inhibitor Chelerythrine Chloride (≥ 2 hrs, 1 mmol/L). This protocol did not significantly affect basal TRPM6 currents or TRPM6 currents in the presence of P2X4 (Figure 5A, left panel). ATP-evoked currents were also unaffected by this treatment (Figure 5A,

202 | Chapter 8

Figure 4 P2X4 Inhibits the Activity of TRPM6 Channels

A, TRPM6 currents were evoked by a 500 ms voltage ramp from -100 to +100 mV applied every 2 s

(top left inset). The activity of P2X4 channels was assessed by perfusion of 100 mmol/L ATP on cells

held at -60 mV. Typical voltage-evoked traces (left) and ATP-evoked traces (right) obtained with or

without P2X4 co-expression. B, Time course of TRPM6 current development at +80 mV ( , ) and

-80 mV ( , ) . Co-expression of P2X4 strongly reduces the current amplitude of TRPM6 currents

(n=7). C, Co-expression of TRPM6 with P2X4 (n≥39), but not P2X6 (n≥13), reduces the average volt-

age-evoked current density. Non-transfected cells are shown for comparison (NT, n=10). A mutant

with altered sensitivity to ATP (p.Tyr315Cys) does not inhibit TRPM6 currents (n≥10). D, The TRPM6

current density is plotted against the logarithm of the peak ATP-evoked inward current density mea-

sured at -60 mV in the same cells. The star indicates the average current density obtained without

P2X4. A linear fit was performed to evidence a correlation between the activity of TRPM6 and P2X4.

E

A

TRPM6+P2X4

1 nA

50 ms

TRPM6+Mock

0 mV

-100 mV

+100 mV +80 mV

500 pA

ATP

TRPM6+P2X4

TRPM6+Mock

B

20 40 60 80 100

0

100

200

300

0

TRPM6

TRPM6+P2X4

TRPM6

Cur

rent

den

sity

(pA

/pF)

CTR

PM6

curr

ent d

ensi

ty (p

A/p

F)

10 100 10000

50

100

150

200

250

300

P2X4 current density (pA/pF)

Time (s)

F

Moc

k

TRPM

6

TRPM

6

+ P

2X4

+ – + + + + + – + + + +Biotin

200 200

96 96

kDa

Cell surfacefractionanti-HA

Total proteinfractionanti-HA

Moc

k

TRPM

6

TRPM

6

+ P

2X4

P2X4

TRPM6

P2X4

TRPM6

TRPM6

Mock P2X6 P2X4 P2X4mutNT

D

TRPM

6 cu

rren

t den

sity

(pA

/pF)

0

50

100

150

200

250*** **

0

250

500

750

1000

TRPM7

Mock P2X4

TRPM

7 cu

rren

t den

sity

(pA

/pF)


E, TRPM7 currents were compared with or without coexpression of P2X4. P2X4 does not inhibit the

function of TRPM7 channels (n≥11). F, Cell surface biotinylation of HEK293 cells co-expressing HA-

tagged TRPM6 and Mock or HA-tagged P2X4. Representative immunoblots showing that P2X4 ex-

pression does not impair TRPM6 membrane expression (left). Total protein expression was assessed

as control for expression of P2X4 (right).

Figure 5 PKA, PKC and PI3K are not Involved in the Inhibition of TRPM6 by P2X4

A, The PKC inhibitor chelerythrin chloride (CC, ≥ 2 hrs, 1 mmol/L) did not reverse the inhibition of

TRPM6 by P2X4 (n≥9, left panel). ATP evoked currents were unaffected by the treatment with CC

(n=8, right panel). B, The PKA inhibitor H-89 (1 mmol/L, 20 min) did not reverse the inhibition of

TRPM6 by P2X4 (n≥6, left panel). Inhibition of PKA with H-89 increased ATP-evoked currents in cells

co-expressing TRPM6 and P2X4 (n≥15, right panel). C, The PI3K inhibitor Wortmannin (100 nmol/L,

30 min) did not reverse the inhibition of TRPM6 by P2X4 (n≥6, left panel). Wortmannin did not affect

ATP-evoked currents in cells co-expressing TRPM6 and P2X4 (n≥9, right panel).

0

100

200

300

TRPM6

P2X4H-89 H-89

0

200

400

600

Ctrl H-89

**

TRPM6+P2X4

Control C.C.

B

0

50

100

150

200

TRPM6

P2X4

Wort.Wort.

0

250

500

750

TRPM6+P2X4

Ctrl Wortmannin

TRPM6+P2X4

C

A

0

100

200

300

Cur

rent

den

sity

(pA

/pF)

TRPM6P2X4

C.C. C.C.

TRPM6 current density at +80 mV P2X4 current density at -60 mV

Cur

rent

den

sity

(pA

/pF)

Cur

rent

den

sity

(pA

/pF)

Cur

rent

den

sity

(pA

/pF)

Cur

rent

den

sity

(pA

/pF)

Cur

rent

den

sity

(pA

/pF)

0

100

200

300

400

204 | Chapter 8

right panel). Next, to test whether the inhibition is dependent on protein kinase A (PKA), cells were incubated with the PKA inhibitor H-89 (10 mmol/L, 20 min). The treatment with H-89 did not affect the baseline TRPM6 current and current from cells expressing TRPM6 and P2X4 (Figure 5B, left panel). Under these conditions, the ATP-evoked currents were significantly increased compared to the control treatment (Figure 5B, right panel). The activation of PI3K was previously shown to modulate the epithelial Na+ channel function (ENaC) in Xenopus laevis oocytes (50, 51). Cells were incubated with the PI3K inhibitor Wortmannin (30 min, 10 nmol/L). This protocol did not induce any change in current density for TRPM6 alone or TRPM6 together with P2X4 (Figure 5C, left panel). The ATP-evoked currents were unaffected by the treatment with Wortmannin (Figure 5C, right panel).

P2X4 KO Mice Show Normal Mg2+ LevelsTo assess the involvement of P2X4 in the maintenance of Mg2+ levels under normal conditions, the serum Mg2+ levels and urinary Mg2+ excretion of P2X4 KO mice were determined. Average basal serum Mg2+ concentration (Figure 6A), nor the urinary Mg2+ excretion were significantly changed in P2X4 KO mice compared to wild type littermates (Figure 6B).

Figure 6 P2X4 Knockout Mice Exhibit Normal Serum and Urinary Mg2+ Concentrations

A, Serum Mg2+ concentrations of wild type and knockout P2X4 mice. B, 24hr urinary Mg2+ excretion

of wild type and knockout P2X4 mice. Values are presented as means ± SEM (n=6).

0.2

0.4

0.6

0.8

1.0

1.2

P2X4+/+ P2X4–/–0

Seru

m [M

g2+

] (m

M)

10

15

20

30

35

40

P2X4+/+ P2X4–/–0 2

4hrs

Mg

2+ e

xcre

tion

(µm

ol)

25

5

BA


Discussion

Transcellular transport of Mg2+ via TRPM6 is the last step in Mg2+ (re)absorption in the intestine and kidney and is, therefore, an important regulator of blood Mg2+ levels (9). Here, we establish P2X4 as a novel player in the regulation of TRPM6 activity. Although P2X4 was previously suggested to inhibit Mg2+ transport in kidney (7), we are the first to establish its role in the regulation of TRPM6 activity. TRPM6 forms constitutively active Mg2+-permeant ion channels inhibited by physiological concentrations of intracellular Mg2+ (45). A functional TRPM6 channel comprises four subunits, each containing seven transmembrane domains and intracellular COOH and NH2 amino termini. In analogy with the well-described voltage-gated ion channels, a pore and a selectivity filter are formed at the interface between the fifth and sixth transmembrane domains of the four monomers (42). TRPM6 and its close homologue TRPM7 exhibit a peculiar C-terminal kinase domain (35, 46), the function of which is not completely understood. Due to their kinase moiety, TRPM6 and TRPM7 undergo auto-phosphorylation at multiple sites within their intracellular domains (2). P2X channels comprise three subunits, each containing two transmembrane domains separated by a large extracellular loop (18). P2X4 channels are characterized by a rapid activation upon ATP binding, resulting in a slowly desensitizing non-selective influx of mono- and divalent cations such as Ca2+ (3, 10, 31). Here, it is demonstrated for the first time that the P2X4 purinergic receptors inhibit the activity of TRPM6. Our data show that the inhibition of TRPM6 occurs at the membrane since P2X4 did not disrupt the levels of TRPM6 membrane expression in a cell surface biotinylation assay. The inhibition is dependent on the function of the P2X4 receptors since the ATP-insensitive P2X4-p.Tyr315Cys mutant was not able to inhibit TRPM6. This suggests that the inhibition of TRPM6 is dependent on activity-evoked P2X4 signaling. Due to the strong intracellular divalent chelation needed to record TRPM6 currents in whole-cell patch clamp, it is not possible to test the hypothesis that P2X4 receptor activation directly inhibits TRPM6. The scenario in which TRPM6 and P2X4 participate in a macromolecular complex and influence each other’s function via physical interaction cannot be discarded. Such physical interactions between neuronal ligand-gated ion channels, TRPV channels and P2X receptors have been previously demonstrated (19, 36). Until now, P2X4 has been shown to interact with WNT4, MCM2 and CDH5 (12, 47). However, there has been no large-scale P2X4 interaction studies published and there are no reports of interactions with other ion channels. Therefore, it would be of interest to find P2X4 interacting partners to further examine this latter possibility. P2X4 receptors have been previously described as inhibitors of ion transport processes (7, 24, 49). Specifically, P2X4 receptors were shown to modulate the activity of ENaC by promoting retrieval of the channel from the membrane (49, 50). Interestingly, the authors found that among the tested functional P2X receptors, only the slowly-desensitizing

206 | Chapter 8

P2X2 and P2X4 were able to inhibit ENaC (50). Rapidly inactivating P2X channels (P2X1, P2X3) failed to inhibit ENaC, suggesting that the intensity and duration of ion influx dictates the extent of target channel inhibition. In agreement with previous reports, we could not detect ATP-evoked currents from cells expressing P2X6 (16, 22, 43). In contrast to P2X4, P2X6 failed to inhibit TRPM6. It is tempting to speculate that other functional and slowly desensitizing homo- or heterotrimeric P2X receptors (P2X2, P2X5, P2X7, P2X2/X4, P2X2/X5, etc) could alter the function of different ion channels in different tissues, thereby forming a new general mechanism of ion channel regulation. This hypothesis is supported by recent findings in the Thick Ascending Limb of Henle’s loop (TAL) (26), but further investigations are necessary to confirm this proposition. Although P2X receptors have been established as important regulators of ion transport in a broad range of tissues, their exact mechanism of signaling is largely unknown (1, 7, 23, 24, 26, 49). Indeed, our pharmacological screening could not identify which kinases are involved in TRPM6 inhibition. A supporting role of PKA and PKC in the P2X4-dependent TRPM6 inhibition could not be evidenced from our experiments. The PI3K kinase has previously been implicated in P2X4-induced retrieval of ENaC from the membrane (51). Using wortmannin, we demonstrate that PI3K was not involved in such regulation of P2X4-mediated TRPM6 inhibition. Moreover, TRPM6 membrane expression is largely preserved in the presence of P2X4, suggesting that ENaC and TRPM6 are differentially regulated. TRPM6 has multiple predicted phosphorylation sites for numerous protein kinases, with few of them characterized. Future large-scale pharmacological screening and mutagenesis studies should identify the molecular mechanism responsible for the P2X4-dependent TRPM6 inhibition. The expression of P2X receptors was previously demonstrated in tissues and cells from kidney and intestinal origin (1, 7, 15, 38, 39, 44). In our study, we found the protein expression and colocalization of P2X6 with NCC, a marker of the DCT. Unfortunately, despite high mRNA transcript levels in the DCT, we were not able to evidence the protein expression of P2X4 in this segment of the kidney. This is in contradiction to a previous report demonstrating basolateral expression of P2X4 and P2X6 throughout rat kidney, including the DCT (44). The reasons for this discrepancy are not clear. However, given the expression of P2X4 and P2X6 transcripts in the DCT and the tendency of P2X receptors to form heteromultimers, one could speculate that P2X4 participates in protein complexes with P2X6 in such a way that the P2X4 epitope is not accessible for antibody binding. In addition, it is possible that certain metabolic conditions are required to trigger P2X4 protein expression in the DCT. However, future experiments will be needed to clarify this issue. In recent years, an increasing amount of reports from the clinic claim that the use of certain types of drugs dramatically reduces intestinal Mg2+ absorption (17, 21). Nevertheless, our knowledge of the regulation of intestinal Mg2+ absorption is limited. The colon is the most important site of transcellular Mg2+ absorption via TRPM6 in the intestine (20, 45).


Although the regulation of TRPM6 has been widely studied in the kidney (13, 14, 29, 40), this is the first identification of a regulatory mechanism of TRPM6 in the gut. Our results provided evidence that P2X4 is expressed in colon and cecum, which is in line with previous studies (6, 11, 38, 39). Interestingly, the intestines are among the tissues with the highest ATP secreting capacities (5, 23). Physical force applied by the content of the colonic lumen can activate mechanosensors resulting in luminal and basolateral ATP release (5). Luminal ATP serves an autocrine and paracrine regulator of channel and transporter activity at the luminal membrane (23, 27, 53). In addition, the role of P2X4 on TRPM6 activity may extend beyond the intestine, since TRPM6 and P2X4 are also highly expressed in lung (13). In basal conditions, P2X4 KO mice have normal serum Mg2+ levels and urinary Mg2+ excretion. These results suggest that other mechanisms may compensate for the loss of P2X4 function in basal conditions. TRPM6 activity is regulated by growth factors such as EGF and insulin, which may play a compensatory role (14, 29). Therefore, it would be of interest to further challenge the P2X4 KO mouse with low Mg2+ diets. In conclusion, a novel regulatory mechanism of intestinal TRPM6 activity has been identified. ATP release in colon may activate the P2X4 purinergic receptor leading to the inhibition of the activity of TRPM6. Our results are an important next step in understanding the complex regulatory mechanism of intestinal Mg2+ absorption.

AcknowledgementsThis work was supported by grants from the Netherlands Organization for Scientific Research (ZonMw 9120.8026, NWO ALW 818.02.001), a NWO Vici Grant for J.G.J. Hoenderop (016.130.668) and EURenOmics funding from the European Union seventh Framework Program (FP7/2007-2013, agreement n° 305608). The authors want to state their gratitude to AnneMiete van der Kemp, Lonneke Duijkers, Fariza Bouallala and Pauline de Bruijn for their excellent technical support. In particular, we would like to thank Dr. Sjoerd Verkaart for valuable discussions.

Methods

Expression ProfilingThree male C57BL/6 mice were sacrificed; kidney, duodenum, ileum, jejunum, colon, cecum, brain, lung, liver, spleen, testis, muscle, and heart tissues were collected. For the analysis of segment-specific kidney expression we used parvalbumin-EGFP (PV-EGFP) mice, which express the EGFP under the parvalbumin promoter and allow selection of EGFP-positive DCT tubules (kind gift from Dr. Monyer, University of Heidelberg, Germany, (28)). Selection of DCT tubules was performed as described previously (8). In short, mice were perfused with 20 mL of PBS (in mmol/L: 137 NaCl, 2.7 KCl, 10 Na2HPO4, 1.76 KH2PO4) through the heart. The kidneys were removed, minced, and digested in 1 mg/mL

208 | Chapter 8

collagenase A (Worthington, Lakewood, NJ, USA) and 1 mg/mL hyaluronidase (Sigma, Houten, The Netherlands) in Krebs buffer (in mmol/L: 145 NaCl, 5 KCl, 10 HEPES, 1 NaH2PO4, 2.5 CaCl2, 1.8 MgSO4 and 5 glucose) at 37 °C for three cycles of 5-15 min. The collagenase- digested tubules were sorted by COPAS (Complex Object Parametric Analysis and Sorting, Union Biometrica) based on EGFP-fluorescence intensity. Per mouse, 4,000 EGFP-positive fluorescent tubules were collected. To use as a control, an additional 4,000 tubules were sorted from the same kidney sample without selection for EGFP-positive cells. Total RNA was isolated using TRIzol total RNA isolation agent (Invitrogen, Breda, the Netherlands) and treated with DNase (1U/μg RNA, Promega, Leiden, the Netherlands) to remove genomic DNA. Subsequently, reverse transcription of the RNA by M-MLV reverse transcriptase (Invitrogen) was performed for 1 hr at 37 °C. Gene expression levels were determined by quantitative real-time PCR on a Bio-Rad analyzer using iQ Sybr Green (BioRad, Veenendaal, the Netherlands) and normalized for Gapdh expression levels. Primer sequences are listed in Table 1.

ImmunohistochemistryCo-staining for P2X4 and P2X6 with the thiazide-sensitive Na+-Cl- cotransporter (NCC) were performed on 5 μm sections of frozen mouse kidney samples. Sections were heat treated with sodium-citrate and endogenous peroxidase was blocked. Unspecific binding sites were blocked with blocking buffer (TSA fluorescence System, Perkin Elmer). The sections were incubated for 16 hrs at 4 °C with the following primary antibodies: goat anti-P2X6 (1:100, A58sc-15197, Santa Cruz, Heidelberg, Germany), mouse anti-P2X4 (1:100, A58SC-28764, Santa Cruz, Heidelberg, Germany), rabbit anti-NCC (1:100, (8)). P2X4 staining was enhanced using TSA fluorescence System (Perkin Elmer, Groningen, The Netherlands). For detection, kidney sections were incubated with Alexa Fluor-conjugated secondary antibodies. Images were taken with an AxioCam camera and AxioVision software (Zeiss, Sliedrecht, the Netherlands).

Table 1 Primer Sequences

F R

P2x1 5’-CCGAAGCCTTGCTGAGAA-3’ 5’-GGTTTGCAGTGCCGTACAT-3’

P2x2 5’-CACCACCACTCGAACTCTCA-3’ 5’-GGTACGCACCTTGTCGAACT-3’

P2x3 5’-GGTGGCTGCCTTCACTTC-3’ 5’-TCAGCCCCTTTGAGGAAA-3’

P2x4 5’-TTGGCTCTGGCTTGGCGCTC-3’ 5’-TCTCCGGAAAGACCCTGCTCG-3’

P2x5 5’-GAGCGAGTTTTACCGAGACAAG-3’ 5’-GATGAACCCTCTCCAGTGGC-3’

P2x6 5’-CTCCTGGAGGTGGTTCATGTG-3’ 5’-GGCTTTGGCAAGCTTTACTTC-3’

P2x7 5’-GGGGGTTTACCCCTACTGTAA-3’ 5’-GCTCGTCGACAAAGGACAC-3’



DNA ConstructsThe pCINeo TRPM6 IRES GFP expression construct was described previously (45). To obtain P2X4 and P2X6 expression constructs, we used the full-length human P2X4 and P2X6 cDNA clones with Genbank accession numbers BC033826 and BC033488 respectively (Source BioScience LifeSciences, Nottingham, United Kingdom). The coding sequences of P2X4 was amplified using Phusion polymerase (Finnzymes, Vantaa, Finland) and primers F: 5’-ccgctagcgATGGCGGGCTGCTGCGC-3’ and R: 5’-CGCTCGAGTCACTGGTCCAGCTCAC-3’) to introduce NheI and XhoI restriction sites. For P2X6, we introduced NheI and XmaI with primers F; 5’-cggctagcATGGGCTCCCCAGGGGC-3’ and R: 5’-GCCCCGGGCGCAGGCTCCCG-GAATGGG-3’. The amplicons were cloned into the pCINeo-IRES-GFP expression vectors containing an in frame N-terminal HA-tag using the NheI, XmaI and XhoI restriction sites. The P2X4 p.Tyr315Cys mutation was introduced using the QuikChange site-directed mutagenesis kit (Agilent, Amstelveen, The Netherlands). All constructs were verified by sequence analysis. GFP-tagged P2X6 constructs were created by introducing BspEI and EcoRI restriction by RT-PCR (F: 5’-cgtccggaATGGGCTCCCCAGGGGC-3’ and R: 5’-GCGAAT-TCCTACAGGCTCCCGGAATG-3’) and ligation in a pEGFP vector containing an in frame N-terminal GFP. Flag-tag was inserted using Phusion polymerase and primers containing AgeI and XhoI restrictions sites (F: 5’-CAGaccggtcgccaccGACTACAAGGATGACGATGA-CAAGGCGGGCTGCTGCGCCGCG-3’ and R: 5’-CGCTCGAGTCACTGGTCCAGCTCAC-3’). The PCR product was digested and ligated into the pCINeo vector using AgeI and XhoI. The pTracer mTRPM7 construct (kind gift from Dr. David E. Clapham) was transfected using an identical protocol.

Cell Culture and TransfectionHuman embryonic kidney cells (HEK293) were grown at 37 °C in DMEM (Biowhittaker Europe, Vervier, Belgium) supplemented with 10 % (v/v) FCS (PAA Laboratories, Linz, Austria), nonessential amino acids, and 2 mmol/L L-glutamine in a humidified 5 % (v/v) CO2 atmosphere. Cells were seeded in 12-well plates and subsequently transfected with 1-1.25 μg of HA- of FLAG-tagged constructs in the pCINeo-IRES-GFP or pcINeo-IRES-mCherry vectors using Lipofectamine 2000 (Invitrogen) at 1:3 DNA:Lipofectamine ratio. For patch-clamp experiments, cells were seeded two days after transfection on glass coverslips coated with 50 mg/mL of fibronectin (Roche, Mannheim, Germany). Two hrs later, cells were placed in the recording chamber and selected based on the intensity of the fluorescent reporter.

ImmunoblottingHEK293 cells were lysed for 1 hr at 4° C in TNE lysis buffer containing (in mmol/L): 50 Tris/HCl pH 8.0, 150 NaCl, 5 EDTA, 1 % Triton X-100 (v/v) and pepstatin 1 µg/mL, PMSF 1 mmol/L, leupeptin 5 µg/mL and aproptin 5 µg/mL. Protein lysates were denatured in Laemmli containing 100 mM DTT for 30 min at 37 °C and subsequently subjected to SDS-PAGE.

210 | Chapter 8

Immunoblots were then incubated with a mouse anti-HA (Roche, high affinity 3F10, 1:5,000) primary antibody and peroxidase conjugated sheep anti-mouse secondary antibodies (Jackson Immunoresearch, 1:10,000).

Electrophysiology Whole-cell voltage-clamp experiments were carried out using an EPC-9 amplifier (HEKA electronics, Lambrecht, Germany). Data acquisition and analysis were performed using Pulse or Patchmaster software (HEKA). The sampling interval was set to 200 ms for all experiments. Pipettes were pulled from thin-walled borosilicate glass (Harvard Apparatus) and had resistance between 1 and 3 MW, when filled with the pipette solution. Series resistance compensation was set to 50-95 % in all experiments. Measurements of TRPM6 and TRPM7 activity were performed by applying 500 ms voltage ramps from -100 to +100 mV every 2 s from a holding potential of 0 mV. TRPM6-expressing cells displayed a time-dependent increase in outwardly-rectifying currents upon whole-cell break-in. This is partly due to the chelation of intracellular Mg2+, which inhibits TRPM6. Consequently, the reported current values were obtained at +80 mV 100 s after break-in. Consistent with the endogenous expression of TRPM7 in HEK293 cells, non-transfected cells displayed small voltage-evoked currents under these recording conditions (45). The activity of P2X channels was assessed by perfusion of 100 mmol/L ATP on cells held at -60 mV using a fast quartz micromanifold solution applicator (ALA scientific instruments, Farmingdale, NY). The extracellular solution contained (in mmol/L): 150 NaCl, 1 CaCl2, 10 HEPES/NaOH pH 7.4. The pipette solution was made of (in mmol/L): 150 NaCl, 10 Na2EDTA, 10 HEPES/NaOH, pH 7.2.

P2X4 KO MiceP2X4 KO mice were provided by GlaxoSmithKline UK and maintained in a C57BL/6 genetic background. 24 hrs urine collection was performed in mouse metabolic cages for two consecutive days. Blood samples were drawn by cardiac puncture in isoflurane-anesthe-tized mice. Urine measurements were performed on the sample of the second 24 hrs.

Mg2+ AnalysisSerum and urine total Mg2+ concentrations were determined using a colorimetric assay kit according to the manufacturer’s protocol (Roche Diagnostics, Woerden, the Netherlands).

Statistical Analysis All results are depicted as mean ± standard error of the mean (SEM). All statistical analyses were conducted by one-way ANOVA followed by Tukey post hoc test when comparing two treatment groups or experimental conditions. Difference in means with P values < 0.05 were considered statistically significant.


References1. Bourzac JF, L’Eriger K, Larrivee JF, Arguin G, Bilodeau MS, Stankova J, and Gendron FP. Glucose

transporter 2 expression is down regulated following P2X7 activation in enterocytes. Journal of cellular physiology 228: 120-129, 2013.

2. Clark K, Middelbeek J, Morrice NA, Figdor CG, Lasonder E, and van Leeuwen FN. Massive autophos-phorylation of the Ser/Thr-rich domain controls protein kinase activity of TRPM6 and TRPM7. PloS one 3: e1876, 2008.

3. Coddou C, Yan Z, Obsil T, Huidobro-Toro JP, and Stojilkovic SS. Activation and regulation of purinergic P2X receptor channels. Pharmacol Rev 63: 641-683, 2011.

4. Collo G, North RA, Kawashima E, Merlo-Pich E, Neidhart S, Surprenant A, and Buell G. Cloning OF P2X5 and P2X6 receptors and the distribution and properties of an extended family of ATP-gated ion channels. The Journal of neuroscience : the official journal of the Society for Neuroscience 16: 2495-2507, 1996.

5. Cooke HJ, Wunderlich J, and Christofi FL. “The force be with you”: ATP in gut mechanosensory transduction. News in physiological sciences : an international journal of physiology produced jointly by the International Union of Physiological Sciences and the American Physiological Society 18: 43-49, 2003.

6. Coutinho-Silva R, Stahl L, Cheung KK, de Campos NE, de Oliveira Souza C, Ojcius DM, and Burnstock G. P2X and P2Y purinergic receptors on human intestinal epithelial carcinoma cells: effects of extracellular nucleotides on apoptosis and cell proliferation. Am J Physiol Gastrointest Liver Physiol 288: G1024-1035, 2005.

7. Dai LJ, Kang HS, Kerstan D, Ritchie G, and Quamme GA. ATP inhibits Mg(2+) uptake in MDCT cells via P2X purinoceptors. American journal of physiology Renal physiology 281: F833-840, 2001.

8. de Baaij JH, Groot Koerkamp MJ, Lavrijsen M, van Zeeland F, Meijer H, Holstege FC, Bindels RJ, and Hoenderop JG. Elucidation of the distal convoluted tubule transcriptome identifies new candidate genes involved in renal magnesium handling. American journal of physiology Renal physiology 2013.

9. de Baaij JHF, Hoenderop JGJ, and Bindels RJM. Regulation of magnesium balance: lessons learned from human genetic disease. Clinical Kidney Journal 5 (supl 1): i15-i24, 2012.

10. Egan TM, and Khakh BS. Contribution of calcium ions to P2X channel responses. The Journal of neuroscience: the official journal of the Society for Neuroscience 24: 3413-3420, 2004.

11. Garcia-Alcocer G, Padilla K, Rodriguez A, Miledi R, and Berumen LC. Distribution of the purinegic receptors P2X(4) and P2X(6) during rat gut development. Neuroscience letters 509: 92-95, 2012.

12. Glass R, Loesch A, Bodin P, and Burnstock G. P2X4 and P2X6 receptors associate with VE-cadherin in human endothelial cells. Cellular and molecular life sciences : CMLS 59: 870-881, 2002.



15. Groschel-Stewart U, Bardini M, Robson T, and Burnstock G. P2X receptors in the rat duodenal villus. Cell and tissue research 297: 111-117, 1999.

16. Hausmann R, Bodnar M, Woltersdorf R, Wang H, Fuchs M, Messemer N, Qin Y, Gunther J, Riedel T, Grohmann M, Nieber K, Schmalzing G, Rubini P, and Illes P. ATP binding site mutagenesis reveals different subunit stoichiometry of functional P2X2/3 and P2X2/6 receptors. J Biol Chem 287: 13930-13943, 2012.

17. Hess MW, Hoenderop JG, Bindels RJ, and Drenth JP. Systematic review: hypomagnesaemia induced by proton pump inhibition. Alimentary pharmacology & therapeutics 36: 405-413, 2012.

18. Kawate T, Michel JC, Birdsong WT, and Gouaux E. Crystal structure of the ATP-gated P2X(4) ion channel in the closed state. Nature 460: 592-598, 2009.

19. Khakh BS, Zhou X, Sydes J, Galligan JJ, and Lester HA. State-dependent cross-inhibition between trans-mitter-gated cation channels. Nature 406: 405-410, 2000.

20. Lameris AL, Hess MW, van Kruijsbergen I, Hoenderop JG, and Bindels RJ. Omeprazole enhances the colonic expression of the Mg transporter TRPM6. Pflugers Archiv : European journal of physiology 2013.

212 | Chapter 8

21. Lameris AL, Monnens LA, Bindels RJ, and Hoenderop JG. Drug-induced alterations in Mg2+ homoeostasis. Clin Sci (Lond) 123: 1-14, 2012.

22. Le KT, Babinski K, and Seguela P. Central P2X4 and P2X6 channel subunits coassemble into a novel heteromeric ATP receptor. The Journal of neuroscience : the official journal of the Society for Neuroscience 18: 7152-7159, 1998.

23. Leipziger J. Control of epithelial transport via luminal P2 receptors. American journal of physiology Renal physiology 284: F419-432, 2003.

24. Leipziger J. Luminal nucleotides are tonic inhibitors of renal tubular transport. Current opinion in nephrology and hypertension 20: 518-522, 2011.

25. Limaye CS, Londhey VA, Nadkart MY, and Borges NE. Hypomagnesemia in critically ill medical patients. J Assoc Physicians India 59: 19-22, 2011.

26. Marques RD, de Bruijn PI, Sorensen MV, Bleich M, Praetorius HA, and Leipziger J. Basolateral P2X receptors mediate inhibition of NaCl transport in mouse medullary thick ascending limb (mTAL). American journal of physiology Renal physiology 302: F487-494, 2012.

27. Matos JE, Sorensen MV, Geyti CS, Robaye B, Boeynaems JM, and Leipziger J. Distal colonic Na(+) absorption inhibited by luminal P2Y(2) receptors. Pflugers Archiv : European journal of physiology 454: 977-987, 2007.

28. Meyer AH, Katona I, Blatow M, Rozov A, and Monyer H. In vivo labeling of parvalbumin-positive interneurons and analysis of electrical coupling in identified neurons. The Journal of neuroscience : the official journal of the Society for Neuroscience 22: 7055-7064, 2002.


30. Nijenhuis T, Renkema KY, Hoenderop JG, and Bindels RJ. Acid-base status determines the renal expression of Ca2+ and Mg2+ transport proteins. J Am Soc Nephrol 17: 617-626, 2006.

31. North RA, and Surprenant A. Pharmacology of cloned P2X receptors. Annu Rev Pharmacol Toxicol 40: 563-580, 2000.

32. Novak I. Purinergic signalling in epithelial ion transport: regulation of secretion and absorption. Acta Physiol (Oxf) 202: 501-522, 2011.

33. Orriss IR, Key ML, Brandao-Burch A, Patel JJ, Burnstock G, and Arnett TR. The regulation of osteoblast function and bone mineralisation by extracellular nucleotides: The role of p2x receptors. Bone 51: 389-400, 2012.

34. Quamme GA. Recent developments in intestinal magnesium absorption. Current opinion in gastroenterology 24: 230-235, 2008.

35. Schlingmann KP, Weber S, Peters M, Niemann Nejsum L, Vitzthum H, Klingel K, Kratz M, Haddad E, Ristoff E, Dinour D, Syrrou M, Nielsen S, Sassen M, Waldegger S, Seyberth HW, and Konrad M. Hypomagnesemia with secondary hypocalcemia is caused by mutations in TRPM6, a new member of the TRPM gene family. Nat Genet 31: 166-170, 2002.

36. Stanchev D, Blosa M, Milius D, Gerevich Z, Rubini P, Schmalzing G, Eschrich K, Schaefer M, Wirkner K, and Illes P. Cross-inhibition between native and recombinant TRPV1 and P2X(3) receptors. Pain 143: 26-36, 2009.

37. Stokes L, Scurrah K, Ellis JA, Cromer BA, Skarratt KK, Gu BJ, Harrap SB, and Wiley JS. A Loss-of-Function Polymorphism in the Human P2X4 Receptor Is Associated With Increased Pulse Pressure. Hypertension 58: 1086-1092, 2011.

38. Tanaka J, Murate M, Wang CZ, Seino S, and Iwanaga T. Cellular distribution of the P2X4 ATP receptor mRNA in the brain and non-neuronal organs of rats. Archives of histology and cytology 59: 485-490, 1996.

39. Taylor AL, Schwiebert LM, Smith JJ, King C, Jones JR, Sorscher EJ, and Schwiebert EM. Epithelial P2X purinergic receptor channel expression and function. The Journal of clinical investigation 104: 875-884, 1999.

40. Thebault S, Alexander RT, Tiel Groenestege WM, Hoenderop JG, and Bindels RJ. EGF increases TRPM6 activity and surface expression. J Am Soc Nephrol 20: 78-85, 2009.

41. Thebault S, Cao G, Venselaar H, Xi Q, Bindels RJ, and Hoenderop JG. Role of the alpha-kinase domain in transient receptor potential melastatin 6 channel and regulation by intracellular ATP. J Biol Chem 283: 19999-20007, 2008.


42. Topala CN, Groenestege WT, Thebault S, van den Berg D, Nilius B, Hoenderop JG, and Bindels RJ. Molecular determinants of permeation through the cation channel TRPM6. Cell calcium 41: 513-523, 2007.

43. Torres GE, Egan TM, and Voigt MM. Hetero-oligomeric assembly of P2X receptor subunits. Specificities exist with regard to possible partners. J Biol Chem 274: 6653-6659, 1999.

44. Turner CM, Vonend O, Chan C, Burnstock G, and Unwin RJ. The pattern of distribution of selected ATP-sensitive P2 receptor subtypes in normal rat kidney: an immunohistological study. Cells, tissues, organs 175: 105-117, 2003.

45. Voets T, Nilius B, Hoefs S, van der Kemp AW, Droogmans G, Bindels RJ, and Hoenderop JG. TRPM6 forms the Mg2+ influx channel involved in intestinal and renal Mg2+ absorption. J Biol Chem 279: 19-25, 2004.

46. Walder RY, Landau D, Meyer P, Shalev H, Tsolia M, Borochowitz Z, Boettger MB, Beck GE, Englehardt RK, Carmi R, and Sheffield VC. Mutation of TRPM6 causes familial hypomagnesemia with secondary hypocalcemia. Nat Genet 31: 171-174, 2002.

47. Wang J, Huo K, Ma L, Tang L, Li D, Huang X, Yuan Y, Li C, Wang W, Guan W, Chen H, Jin C, Wei J, Zhang W, Yang Y, Liu Q, Zhou Y, Zhang C, Wu Z, Xu W, Zhang Y, Liu T, Yu D, Zhang Y, Chen L, Zhu D, Zhong X, Kang L, Gan X, Yu X, Ma Q, Yan J, Zhou L, Liu Z, Zhu Y, Zhou T, He F, and Yang X. Toward an understanding of the protein interaction network of the human liver. Molecular systems biology 7: 536, 2011.

48. Wildman SS, Boone M, Peppiatt-Wildman CM, Contreras-Sanz A, King BF, Shirley DG, Deen PM, and Unwin RJ. Nucleotides downregulate aquaporin 2 via activation of apical P2 receptors. J Am Soc Nephrol 20: 1480-1490, 2009.

49. Wildman SS, Kang ES, and King BF. ENaC, renal sodium excretion and extracellular ATP. Purinergic signalling 5: 481-489, 2009.

50. Wildman SS, Marks J, Churchill LJ, Peppiatt CM, Chraibi A, Shirley DG, Horisberger JD, King BF, and Unwin RJ. Regulatory interdependence of cloned epithelial Na+ channels and P2X receptors. J Am Soc Nephrol 16: 2586-2597, 2005.

51. Wildman SS, Marks J, Turner CM, Yew-Booth L, Peppiatt-Wildman CM, King BF, Shirley DG, Wang W, and Unwin RJ. Sodium-dependent regulation of renal amiloride-sensitive currents by apical P2 receptors. J Am Soc Nephrol 19: 731-742, 2008.

52. Woudenberg-Vrenken TE, Sukinta A, van der Kemp AW, Bindels RJ, and Hoenderop JG. Transient receptor potential melastatin 6 knockout mice are lethal whereas heterozygous deletion results in mild hypomagnesemia. Nephron Physiol 117: p11-19, 2011.

53. Yamamoto T, and Suzuki Y. Role of luminal ATP in regulating electrogenic Na(+) absorption in guinea pig distal colon. Am J Physiol Gastrointest Liver Physiol 283: G300-308, 2002.

216 | Chapter 9

Abstract

Magnesium (Mg2+) is essential for enzymatic activity, brain function and muscle contraction. Blood Mg2+ concentrations are tightly regulated between 0.7 and 1.1 mmol/L by Mg2+ (re)absorption in kidney and intestine. The apical entry of Mg2+ in (re)absorbing epithelial cells is mediated by the transient receptor potential melastatin type 6 (TRPM6) ion channel. Here, flavaglines are described as a novel class of stimulatory compounds for TRPM6 activity. Flavaglines are a group of natural and synthetic compounds that target the ubiquitously expressed prohibitins and thereby affect cellular signaling. By whole-cell patch clamp analyses, it was demonstrated that nanomolar concentrations of flavaglines increases TRPM6 activity by ±2 fold. The stimulatory effects were dependent on the presence of the alpha-kinase domain of TRPM6, but did not require its phosphotransfer-ase activity. Interestingly, it was observed that two natural occurring TRPM6 mutants with impaired insulin-sensitivity, TRPM6-p.Val1393Ile and TRPM6-p.Lys1584Glu, are not sensitive to flavagline stimulation. To examine the therapeutic potential of flavaglines, mice were injected with a low dose of FL3 for 7 days. Serum concentration and 24 hrs urinary Mg2+ excretion were not changed after treatment. In conclusion, we have identified flavaglines as potent activators of TRPM6 activity. Our results suggest that flavaglines stimulate TRPM6 via the insulin receptor signaling pathway.

Keywords: Magnesium, Kidney, Intestine, Homeostasis, Prohibitin, Flavagline

Flavaglines Stimulate TRPM6 Activity | 217

Introduction

Magnesium (Mg2+) is an essential electrolyte for cell growth, protein synthesis and enzymatic activity. Therefore, physiological mechanisms maintain blood Mg2+ concentrations within a tightly regulated range (0.7-1.1 mmol/L, (11, 12)). The apically expressed Transient Receptor Potential Melastatin type 6 (TRPM6) channels are the gatekeepers of epithelial Mg2+ transport in colon and in the distal convoluted tubule segment (DCT) of the kidney nephron (29). Loss-of-function mutations of TRPM6 cause intestinal Mg2+ malabsorption and renal Mg2+ wasting, as evidenced in patients suffering from hypomagnesemia with secondary hypocalcemia (HSH, OMIM #602014, (20, 30)). TRPM6 channels are thought to form tetramers of subunits comprising six transmembrane segments, with a central divalent-selective pore (Ba2+>Ni2+>Mg2+>Ca2+, (29)). Functional channels are inhibited by intracellular Mg2+ (29, 33) and consequently display a time-dependent increase in currents upon dialysis of cells with a pipette solution containing a strong Mg2+ chelator such as ethylenediaminetetraacetic acid (EDTA). Like its close homolog TRPM7, TRPM6 channels comprise an intrinsic intracellular Ser/Thr kinase domain, which has similarities to proteins of the alpha-kinase family (19). TRPM6 channels undergo autophosphorylation, but the role of the alpha-kinase on channel function and cell physiology is still incompletely understood (5, 21, 24, 28, 33). Over the last decade, the epidermal growth factor (EGF) and insulin were shown to stimulate the activity and membrane expression of TRPM6 (16, 23). Two TRPM6 single nucleotide polymorphisms (SNPs: p.Val1393Ile and p.Lys1584Glu) were recently associated with an increased risk of diabetes development in humans (16, 22). Subsequently, it was shown that these mutations prevent a rapid insulin-evoked increase in channel plasma membrane expression (16). By combined pull down and mass spectrometry studies of the TRPM6 alpha-kinase domain, three interacting proteins have been identified: I) Methionine sulfoxide reductase B1 (MSRB1) which reduces the sensitivity of TRPM6 to oxidative stress (6), II) Guanine nucleotide- binding protein subunit beta-2-like 1 (GNB2L1/RACK1) which inhibits TRPM6 activity in a alpha-kinase-dependent manner (7). III) Prohibitin 2 or Repressor protein of Estrogen receptor Activity (PHB2/REA) which inhibits TRPM6, an effect that is relieved by estrogens (8). Prohibitins (PHB1 and PHB2) are ubiquitously expressed members of the family of stomatin/prohibitin/flotillin and HflK/C (SPFH) domain containing proteins (9). PHBs are found in the nucleus, cytoplasm and plasma membrane, where they play an important role in cellular differentiation, anti-proliferation and mitochondrial morphogenesis (9). PHBs modulate the cell cycle progression, regulate transcription and facilitate cell surface signaling (9). Recently, a family of natural compounds named flavaglines was established as high affinity ligand of PHBs (18). Flavaglines are a family of natural compounds characterized by a cyclopenta[b]

benzofuran structure (14). Natural flavaglines and synthetic analogs have been intensively

218 | Chapter 9

studied, owing to their pleiotropic favorable properties (anti-inflammatory, anticancer, cardioprotective and neuroprotective, (2)). Flavaglines bind PHB1 and PHB2 (with nmol/L affinity) and the CRaf-mediated activation of oncogenic MAPK signaling (18). In addition, the PHB binding properties of flavaglines lead to the induction of apoptosis in apoptosis inducing factor (AIF) and caspase-12-dependent manners (2). Additionally and independently from PHBs, flavaglines inhibit eIF4A-dependent oncogenic protein synthesis (2). The mechanism of flavaglines neuro- and cardioprotection are likely mediated by their PHB- interacting properties, thereby reducing oxidative stress, deleterious growth factor signaling and release of inflammatory mediators (2). Given the previously described inhibitory interaction of PHB2 on TRPM6 and the high affinity binding of flavaglines to PHB1 and PHB2, this study aims to identify and characterize the effect of flavaglines on TRPM6 activity. The molecular effects of flavaglines are studied using patch clamp, while their in vivo properties were assessed in mice injected with a flavagline.

Results

Synthetic Flavaglines Stimulate TRPM6 ActivityHEK293 cells were transfected with the previously described pCINeo-TRPM6-HA-IRES-GFP vector (29). This construct allows the visual identification of cells expressing TRPM6. Cells were then subjected to whole-cell patch clamp analysis, as previously described (29). Briefly, currents were elicited by a series of voltage ramps applied at 0.5 Hz from a holding voltage of 0 mV. Due to the dialysis of the cytoplasm with a pipette solution containing EDTA, time-dependent outwardly rectifying currents were observed in response to this ramp protocol (Figure 1A). In order to assess the effect of flavaglines on TRPM6, cells were first exposed to FL23 (50 nmol/L, (26)), a potent analog of the established PHB2 ligand FL3 (18). This protocol yielded a significant increase in the current density without affecting the characteristic shape of the current-voltage (IV) curve (Figure 1B) or the current time- development characteristics (Figure 1C). The average time-development curves were fitted with a logistic equation (see Methods). This analysis revealed that the time of half-maximal activation (t1/2) was not changed between control and FL23-treated cells (control: 48 ± 2 s, FL23: 43 ± 3 s). The rate of current development (the slope h) was increased with FL23 treatment (control: 1.8 ± 0.1 pApF-1s-1, FL23: 3.0 ± 0.2 pApF-1s-1). Pre-incubation of the cells with concentrations of FL23 ranging from 0.01 to 50 nmol/L revealed a concentration-dependent stimulation of TRPM6 activity with an EC50=1.4 ± 0.2 nmol/L (see Methods, Figure 1D). A similar increase in TRPM6 activity was observed with FL3 (50 nmol/L, Figure 2A-B). Next, cells were pre-incubated with FL2 (50 nmol/L), a flavagline that does not display significant cytotoxicity in cancer cells (25). In contrast to FL3 and FL23, this treatment did not significantly alter the current density of TRPM6-


Figure 1 Flavaglines Stimulate TRPM6 at Nanomolar Concentration

A, TRPM6 currents were evoked by a series of 500 ms voltage ramp from -100 to +100 mV applied

every 2 s (0.5 Hz) from a holding potential of 0 mV (top left inset). A typical set of current-voltage

curves obtained from a single cell is shown. B, Typical current-voltage curves obtained 200 s after

break-in from cells pre-incubated 15 min with vehicle or FL23 (50 nmol/L). C, The average time-course

of TRPM6 current development with (n=19) or without (n=19) FL23 pre-treatment are shown for

current values measured at +80 mV. D, FL23 increases TRPM6 current density in a concentration-

dependent manner (n≥3 per data points). Line represents the fit of data points with a Hill equation

(see Methods). E, Incubation of TRPM6 expressing cells with FL3 (50 nmol/L, n≥10), FL23 (50 nmol/L,

n≥22) or estradiol (17βE) (50 nmol/L, n≥9) significantly increased the average current densities

measured at +80 mV 200 s after break-in. Mock-transfected cells showed a similar increase in current

density (n≥8). TRPM6 currents were not sensitive to FL2 (n≥10). Stars indicate statistically significant

difference between vehicle- (white bar) and compound-treated cells (black bar). F, The chemical

structures of FL2, FL3 and FL23 are shown. A bromide atom at position 4’ is necessary for the high

affinity stimulating effects of FL3 and FL23. G, Cells were pre-incubated with vehicle, FL23 (50

nmol/L) or 17βE (50 nmol/L). Total lysate were subjected to Western blot analysis using an anti-HA

primary antibody. FL23 and 17βE did not significantly affect the expression of TRPM6. Stars indicate

statistically significant difference (P < 0.05) between vehicle and compound-treated cells.

A B

D

C

E

F G

vehicle

FL23

-100 -50 50 100

-50

50

100

150

200

250)Fp/

Ap( ytisned tnerruC

Voltage (mV)-50 50 100

1

2

3

4

)An( tnerru

C

Voltage (mV)

f=0.5Hz

0 s

200 s0 mV

100 mV

-100 mV 250 ms

00

40 80 120 160 200

50

100

150

200

250)Fp/

Ap( ytisned tnerruC

Time (s)

vehicle

FL23

0

100

200

300

400

500

600

)Fp/

Ap( ytisned tnerruC

FL23 FL3 FL2 17 βEFL23

TRPM6Mock

*

*

*

*

0 0.5 1.0 1.5 2.0 10 30 50

100

150

200

250)Fp/

Ap( ytisned tnerruC

[FL23] (nM)

FL23

vehicl

e

vehicl

e17βE

MockTRPM6

200kDa

220 | Chapter 9

expressing cells (Figure 2C-D). As previously reported, estradiol (17βE) significantly stimulated TRPM6 currents (Figure 1E, (8)). On average, 17βE, FL3 and FL23 stimulated TRPM6 activity by 1.5 to 2-fold (Figure 1E). Interestingly, mock-transfected cells demonstrated a similar ±2-fold increase in current density upon FL23 treatment, indicating that TRPM7 is also a likely target of flavaglines action (Figure 1E). As expected from the short pre-incubation period, the expression of TRPM6 was not influenced by FL23 or 17βE (Figure 1G).

The Stimulating Effects of Flavaglines Require the Intrinsic Kinase Domain of TRPM6To assess the involvement of the intrinsic alpha-kinase domain in the flavagline-mediated potentiation of TRPM6 currents, cells were transfected with the previously described kinase-truncated (p.Leu1749*, Δkinase) or kinase-inactive (p.Lys1804Arg, KI) TRPM6 constructs (24). While the first construct produces mutant channels lacking the complete kinase

Figure 2 Analogs of FL23 Show Distinct Effects on TRPM6 Currents

A, Typical current-voltage curves obtained 200 s after break-in are shown for vehicle and FL23 (50

nmol/L) pre-incubated cells. B, The average time-course of TRPM6 current development with (n=8)

or without (n=11) FL23 (50 nmol/L) is shown for current values measured at +80 mV. C, The average

time-course of TRPM6 current development with FL2 (50 nmol/L, n=12), vehicle (n=10) or FL23 (50

nmol/L, n=10) pre-treatment is shown for current values measured at +80 mV. D, FL2 incubation

does not significantly stimulate TRPM6 activity (n≥10). Stars indicate statistically significant difference

(P < 0.05) between vehicle and compound-treated cells.

0

100

200

300

400

500

600)Fp/

Ap( ytisned tnerruC-100 -50 50 1000

200

400

600

800)Fp/

Ap( ytisned tnerruC

Voltage (mV) 0 40 80 120 160 200Time (s)

vehicle

vehicle

FL-3

FL3

A B

C D

0 50 100 150 2000

100

200

300

400

)Fp/

Ap( ytisned tnerruC

Time (s)vehicle FL2 FL23

0

100

200

300

400)Fp/

Ap( ytisned tnerruC

*

FL2

FL23

vehicle


domain, the KI construct form channels without intrinsic alpha-kinase phosphotransfer-ase activity. Both constructs produce functional proteins with apparently normal channel function in the absence of intracellular Mg2+. Using an identical pre-incubation protocol, cells expressing the KI mutant demonstrated a FL23-mediated increase in current densities similar to wild type (Figure 3A and C). In contrast, the Δkinase mutant failed to respond to this treatment (Figure 3B-C).

Flavaglines Act along a Shared Pathway with Insulin The intracellular amino acid residues p.Val1393 and p.Lys1584 have been shown to independently confer sensitivity of TRPM6 channels to insulin stimulation, probably by altering the phosphorylation of the neighboring p.Thr1393 and p.Ser1583 residues, respectively (16). Phosphomimicking mutations of either p.Thr1391Asp or p.Ser1583Asp were shown to be permissive in the insulin-mediated potentiation of TRPM6 (16). To address whether flavaglines act on TRPM6 in a similar way as insulin, cells expressing either of two naturally occurring insulin-insensitive TRPM6 SNPs (p.Val1393Ile or p.Lys1584Glu) were pre-incubated with FL23 (50 nmol/L). These mutants failed to respond to FL23 (Figure 4A-B,E). Following the activation of the insulin receptor, a complex multi-branched signaling cascade is activated. One of these branches involves the activation of Phosphoinositide 3-kinase (PI3K), Akt and Ras-related C3 botulinum toxin substrate 1 (Rac1)(4). Co-expression of TRPM6 together with the constitutively active (p.Gly12Val) or dominant-negative (p.Thr17Asn) mutants of Rac1 have been shown to respectively allow and prevent the increase of TRPM6 membrane expression by insulin (16). Here, cells were co-transfected with TRPM6 and either the p.Thr17Asn or p.Gly12Val Rac1 mutants. Both mutants prevented the stimulation of TRPM6 by FL23 (Figure 4C-D,F).

Flavaglines Do not Affect Akt PhosphorylationGiven the previously described modulation of Akt by PHBs (1)4,5-triphosphate (PIP3, the effects of flavaglines on Akt phosphorylation were examined using the same experimental conditions as were used in the patch clamp experiments. Following 15 min of incubation, phosphorylation of Akt was not induced by FL2 and FL3 (50 nmol/L, Figure 5). It has been previously demonstrated that flavaglines prevent ERK1/2 phosphorylation in a manner that depends on CRaf (18). Here, basal ERK1/2 phosphorylation was not apparent in control condition and no additional phosphorylation was detected upon flavaglines stimulation (Figure 5).

Flavaglines Do not Modulate In Vivo Mg2+ Homeostasis To explore the therapeutic potential of flavaglines, twenty C57/Bl6 mice were injected daily with 0.1 mg/kg FL3 or placebo for 7 days, a dose previously shown to provide cardi-oprotective benefits in mice (3). On days 1, 3 and 7 mice were transferred to metabolic

222 | Chapter 9

cages for 24 hrs to collect urine and feces; blood was collected by submandibular facial vein puncture. No differences were detected in serum Mg2+ concentrations and 24 hrs Mg2+ total excretion between FL3-treated mice and mice receiving placebo (Figure 6A-B). Interestingly, minor, but significant, changes were detected in serum Na+ and Ca2+ values. FL3-treated mice had decreased serum Ca2+ at day 1, but showed elevated serum Ca2+ levels at day 7 (Figure 6C). However, these changes were not reflected in urinary Ca2+ excretion (Figure 6D). Serum Na+ was slightly lower at day 7 in FL3-treated mice (Table 1).Given that Trpm6 mRNA expression is sensitive to changes in Mg2+ homeostasis and reduced Trpm6 expression may compensate for increased Tprm6 activity (11, 13), kidney and colon mRNA was isolated and analyzed. Trpm6 expression in both colon and kidney was not altered by FL3 treatment (Figure 7A-B). Since serum Na+ was slightly reduced in FL3-treated mice, the expression of Na+ transporters was analyzed by RT-PCR. The expression

Figure 3 The Presence of the Intrinsic Alpha-Kinase Domain of the Channel but not its Activity is Required for Flavagline-Mediated Stimulation of TRPM6

A, The average time-course of current development of the kinase-inactive (TRPM6K1804R) with (n=7,

full symbols) or without (n=9, empty symbols) FL23 (50 nmol/L) pre-incubation is shown for current

values measured at +80 mV. B, The average time-course of current development of TRPM6L1749X

(Δkinase) with (n=8, full symbols) or without (n=9, empty symbols) FL23 (50 nmol/L) pre-incubation

is shown for current values measured at +80 mV. C, Pre-incubation of cells with FL23 (50 nmol/L)

stimulated wild type (n≥22), K1804R (n≥9), but not Δkinase (n≥8) channel activity. Right panel shows

current values normalized to each control condition. Stars indicate statistically significant difference

(P < 0.05) between vehicle- (white bar) and compound-treated cells (black bar).

A B

C

Wild type K1804R ∆kinase0

100

200

300

400

)Fp/

Ap( ytisned tnerruC

Wild type K1804R ∆kinase0

0.5

1.0

1.5

2.0

2.5

tnerruc dezilamro

N

*

* * *

0 50 100 150 2000

100

200

300

400

500

)Fp/

Ap( ytisned tnerruC

Time (s)0 50 100 150 200

0

20

40

60

80

100

120

)Fp/

Ap( ytisned tnerruC

Time (s)

K1804R ∆kinase


of the thiazide-sensitive Na+-Cl--co-transporter (Ncc) and the epithelial Na+ channel (Enac) were not affected (Figure 7C-D).

Figure 4 Flavaglines Act upon a Common Pathway with Insulin Receptor Signaling

A-D, The average time-course of current development of cells pre-incubated with (full symbols) or

without (empty symbols) FL23 (50 nmol/L) for: (A) TRPM6V1393I (n≥8), (B) TRPM6K1584E (n≥7), (C) wild

type TRPM6 together with Rac1T17N (n≥6) and (D) wild type TRPM6 together with Rac1G12V (n≥11).

E, FL23 pre-incubation failed to alter currents in cells expressing TRPM6V1391I (n=11), TRPM6K1584E

(n≥8) and cells co-expressing wild type TRPM6 together with Rac1T17N (n=8) and TRPM6 together

with Rac1G12V (n≥14). Right panel shows current values normalized to each control condition. Stars indicate

statistically significant difference (P < 0.05) between vehicle- (white bar) and compound-treated

cells (black bar).

Wild

type

V1393I

K1584E

0

50

100

150

200

250

)Fp/

Ap( ytisned tnerruC

Wild type

Rac1T17N Rac1G12V0

0.5

1.0

1.5

2.0

2.5

tnerruc dezilamro

N

Wild

type

V1393I

K1584E

Wild type

Rac1T17N Rac1G12V

* *

A B

DC

E

0 50 100 150 2000

50

100

150

200

250)Fp/

Ap( ytisned tnerruC

Time (s)

)Fp/

Ap( ytisned tnerruC

0 50 100 150 2000

50

100

150

200

250

300

Time (s)

Rac1-T17N

V1393I K1584E

Rac1-G12V

0 50 100 150 2000

20

40

60

80

100

120 )

Fp/Ap( ytisned tnerru

C

Time (s)0 50 100 150 200

0

50

100

150

200

250

300

)Fp/

Ap( ytisned tnerruC

Time (s)

224 | Chapter 9

Figure 5 Cell Akt and ERK Signaling is Unaffected by FL3

HEK293 cells were incubated with FL2 (50 nmol/L), FL3 (50 nmol/L), PMA (100 nmol/L) or insulin (10

nmol/L) for 15 min. Protein lysates were immediately obtained and immunoblots were performed

to detect pERK1/2 and pAkt.

Figure 6 Serum and Urine Mg2+ and Ca2+ in FL3-Treated Mice

A-D, Serum Mg2+ (A) and Ca2+ (C) concentrations of placebo-treated (white bars) and FL3-treated

(black bars) mice were measured after 1, 3 or 7 days. 24 hrs urinary Mg2+ (B) and Ca2+ (D) excretion of

placebo-treated (black bars) and FL3-treated (white bars) mice was determined after 1, 3 or 7 days (n=10).

Stars indicate statistically significant difference (P < 0.05) between placebo- and FL3-treated mice.

45

kDa

45

FL3

Akt

Akt-pS473

ERK

ERK-pT202

66

66

vehicle FL2Serum PMA Insulin Insulin/FL3

Day 1

Day 3

Day 7

0

0. 5

1. 0

1. 5

2. 0

Seru

m M

g2+

con

cent

ratio

n (m

M)

Day 1

Day 3

Day 7

0

20

40

60

80

Urin

ary

Mg

2+ e

xcre

tion

(µm

ol/2

4hr)

Day 1

Day 3

Day 7

0

1

2

3

Seru

m C

a2+ c

once

ntra

tion

(mM

)

* *

Day 1

Day 3

Day 7

0

2

4

6

8

10

12

Urin

ary

Ca2+

exc

retio

n (µ

mol

/24h

r)

*

A B

C D


Discussion

The present study demonstrates that the activity of the Mg2+-permeant TRPM6 channel is stimulated ±2-fold by the flavaglines compounds FL3 and FL23. This is the first report of an exogenous natural compound that stimulates TRPM6 activity. The activity of TRPM6 and its plasma membrane expression have been shown to be increased upon stimulation with insulin. This effect relied on the PI3K, Akt and Rac1 signaling cascade (Figure 8). Detailed electrophysiological and total internal reflection fluorescence (TIRF) microscopy analyses have revealed a permissive role for TRPM6-p.Val1391 and TRPM6-p.Lys1584 sites in insulin-evoked insertion of channels in the plasma membrane (16). Here, it is proposed that flavaglines stimulate TRPM6 by acting along the same pathway (Figure 8). This hypothesis is based on the following observations: (I) flavaglines increased TRPM6 activity ±1.5-2 fold, which is quantitatively similar to the previously described action of insulin on TRPM6 activity (16); (II) the insulin-insensitive

Figure 7 mRNA Expression of Na+ and Mg2+ Transporters after FL3 Treatment

A-D, The mRNA expression levels of Trpm6 (A-B). Ncc (C) and Enac (D) in kidney (A, C-D) or colon (B)

of placebo- (black bars) or FL3-treated (white bars) mice for 7 days were measured by quantitative

RT-PCR and normalized for Gapdh expression (n=10). Stars indicate statistically significant difference

(P < 0.05) between placebo- and FL3-treated mice.

A B

C D

Placebo FL 30

0. 2

0. 4

0. 6

0. 8

1. 0

1. 2

Kidn

ey T

RPM

6 m

RNA

exp

ress

ion

(fold

cha

nge

com

pare

d to

pla

cebo

)

0

0. 2

0. 4

0. 6

0. 8

1. 0

1. 2

Kidn

ey E

NaC

mRN

A e

xpre

ssio

n (fo

ld c

hang

e co

mpa

red

to p

lace

bo)

0

0. 2

0. 4

0. 6

0. 8

1. 0

1. 2

Kidn

ey N

CC m

RNA

exp

ress

ion

(fo

ld c

hang

e co

mpa

red

to p

lace

bo)

0

0. 5

1. 0

1. 5

Colo

n T

RPM

6 m

RNA

exp

ress

ion

(fold

cha

nge

com

pare

d to

pla

cebo

)

Placebo FL 3

Placebo FL 3 Placebo FL 3

226 | Chapter 9

Tabl

e 1

Met

abol

ic P

aram

eter

s of

Pla

cebo

- and

FL3

-Tre

ated

Mic

e

Day

1D

ay 3

Day

7

Plac

ebo

FL3

Plac

ebo

FL3

Plac

ebo

FL3

Wei

ght (

g)22

.9 ±

0.2

22.7

± 0

.223

.1 ±

0.3

23.2

± 0

.223

.6 ±

0.4

23.3

± 0

.2

Food

con

sum

ptio

n (g

)4.

1 ±

0.1

3.8

± 0

.1*

4.6

± 0

.24.

2 ±

0.2

4.5

± 0

.24.

2 ±

0.2

Wat

er c

onsu

mpt

ion

(ml)

5.3

± 0

.25.

3 ±

0.2

4.6

± 0

.34.

2 ±

0.3

5.8

± 0

.75.

6 ±

0.7

Uri

nary

exc

retio

n (m

l)1.

1 ±

0.1

1.1

± 0

.11.

1 ±

0.1

1.5

± 0

.1*

1.5

± 0

.21.

5 ±

0.1

Feca

l exc

retio

n (g

)2.

1 ±

0.1

1.9

± 0

.12.

1 ±

0.1

2.0

± 0

.12.

2 ±

0.1

1.9

± 0

.1

Seru

m N

a+ (m

mol

/L)

--

--

156

± 1

152

± 1

*

Seru

m K

+ (m

mol

/L)

--

--

4.5

± 0

.14.

4 ±

0.1

Uri

nary

Na+

excr

etio

n (µ

mol

/24

hrs)

223

± 2

922

0 ±

21

264

± 2

331

4 ±

22

307

± 1

828

3 ±

14

Uri

nary

K+

excr

etio

n (µ

mol

/24

hrs)

588

± 6

954

0 ±

46

670

± 4

675

6 ±

44

727

± 4

465

4 ±

37

Mic

e (n

=10)

wer

e in

ject

ed d

aily

with

FL3

(0.1

mg/

kg) o

r pla

ceb

o fo

r 7 d

ays.

Dur

ing

the

exp

erim

ent t

he a

nim

als

wer

e ho

used

in m

etab

olic

cag

es fo

r 24

hrs

on d

ay 1

, day

3 a

nd d

ay 7

to d

eter

min

e m

etab

olic

par

amet

ers.

* in

dica

tes

stat

istic

al s

igni

fican

t diff

eren

ces

com

pare

d to

pla

ceb

o-in

ject

ed m

ice

at th

e sa

me

time

poi

nt,

P <

0.0

5.


(TRPM6-p.Val1391Ile and TRPM6-Lys1584Glu) TRPM6 mutants were not potentiated by flavaglines; (III) flavaglines-induced TRPM6 stimulation was absent when overexpressing TRPM6 together with Rac1 mutants; (IV) in concordance with the mechanism of insulin action on TRPM6, flavaglines stimulated the kinase-inactive (TRPM6-p.Lys1804Arg) mutant. Taken together, it is hypothesized that flavaglines act by triggering or relieving a tonic inhibition on one (or more) of the molecular player(s) involved in insulin signaling, effectively promoting the plasma membrane insertion of wild type TRPM6 channels but not of TRPM6 channels containing insulin-insensitive SNP mutants. Our data suggest that the effects of flavagline-stimulation take place downstream of Akt, since no additional Akt phosphorylation was evident upon treatment with FL3. Further experiments investigating the detailed molecular action of flavaglines on the localization and phosphorylation of the known kinases involved in growth-factor stimulation of TRPM6 (PI3K/Akt/RAC1/CDK5) will be necessary to elucidate the exact molecular targets. Flavaglines have recently been identified as potent interactors of PHBs (9). Interestingly, PHB1 and PHB2 are enriched in detergent resistant (lipid rafts) fractions of the plasma membrane (9). Given the previously described action of PHBs as chaperone of Ras-dependent CRaf

Figure 8 Proposed Model of Flavaglines Action

Flavaglines stimulate TRPM6 activity by stimulating downstream effector(s) of the insulin receptor.

PHB2 and CDK5, proteins which are known to regulate TRPM6 are localized in lipid rafts.

lipid raft

PI3KTRPM6

insulin

Akt

RAC1

CDK5PHB2

CDK5PHB2

?

?

228 | Chapter 9

activation in the plasma membrane (18), a general function of PHBs is to provide spatial constraints necessary for the proper regulation of proteins in specialized regions (eg the lipid rafts) of the plasma membrane. It can be hypothesized that TRPM6 channels transiently or permanently localize together with PHB in the lipid raft fractions of the plasma/vesicular membrane, where channels undergo regulatory phosphorylation. The following facts support this hypothesis: (I) TRPM6 has been shown to establish a inhibitory interaction with PHB2 (8); (II) TRPM6 requires CDK5 phosphorylation for proper insulin- mediated regulation, CDK5 localizing and being activated in the lipid raft fraction of plasma membrane (17); (III) the close homolog TRPM7 has been reported to localize in lipid rafts (32), (IV) TRPM6 requires PIP2 for proper function (31), a lipid that is enriched in lipid rafts. Therefore, it is tempting to speculate that PHBs binding to TRPM6 promotes the formation of a macromolecular regulatory complex in the lipid rafts of the plasma membrane. In this perspective, it is interesting to note that the insulin-induced signaling pathway becomes more active when the insulin receptor is expressed in lipid rafts (10, 15, 27). Altogether, these findings point towards a compartmentalized insulin signaling cascade on/near the lipid rafts in the vesicular/plasma membrane. In this model, expression of TRPM6 and the insulin receptor in the lipid rafts allows for the rapid local regulation of TRPM6 by insulin. Comparison of structure-function activity between active (FL3, FL23) and inactive (FL2) flavaglines analogs revealed a positive correlation between cytostatic/cytotoxic properties of flavaglines in cancer cell lines and their action on TRPM6 (18, 25, 26). While the effects of flavaglines on cellular proliferation and growth factor signaling were evident starting from 2 hours after compound application, the stimulatory effect shown here occurs within 15 minutes. These results suggest that the short-term effects of flavaglines on TRPM6 take place independently from any translational effect (eg eIF4A-dependent). However, the concurrent structure-function relationship of flavaglines in their TRPM6- stimulatory effects and in their cytotoxic properties suggests that both mechanisms are PHB-dependent. It has previously been shown that PHB2 interacts with TRPM6 and that 17βE reduces this inhibitory interaction (8). However, the current results suggest that 17βE and FL23 only share a partly overlapping mechanism of action. Exogenous PHB2 inhibits TRPM6 in an alpha-kinase phosphotransferase-dependent manner (8). In contrast, flavaglines stimulated the kinase-inactive TRPM6-p.Lys1804Arg mutant. Moreover, flavaglines induce an increase in endogenous TRPM7 currents, while TRPM7 currents were insensitive to PHB2-mediated inhibition (8). Further work identifying the major players that are part of the TRPM6-PHB macromolecular complex and its regulation by flavaglines and 17βE are necessary to further understand the stimulatory but slightly distinct effects of these compounds on the activity of TRPM6. Reduced TRPM6 channel activity results in a clinically relevant hypomagnesemia due to renal Mg2+ wasting. Because insulin and EGF stimulate TRPM6 function, patients with diabetes mellitus type 2 or users of EGFR inhibitors are at risk to develop hypomagnesemia


(16, 23). Given that FL3 and FL23 stimulate TRPM6 activity, flavaglines may provide an important therapeutic potential for these patient groups. However, at the dose of 0.1 mg/kg used in this study, FL3 did not significantly alter serum and/or 24 hrs urinary Mg2+ excretion in mice treated over the course of one week. In a recent experiment with a mouse model of cardiotoxicity, FL3 injection caused reduced mortality and demonstrated several cardioprotective effects using the same dose of FL3 as in our experiments (3). Both its cardioprotective role and its effects on TRPM6 are likely PHB-dependent, and therefore a similar dose was used. However, the actual dose of FL3 reaching the DCT cells in the kidney where TRPM6 is located may be much lower and challenging to assess. Future experiments assessing the bioavailability of flavaglines should be performed to allow final conclusions on its putative magnesiotropic effects in vivo. Additionally, given the physiological mechanism of intestinal and/or renal compensation of Mg2+ transport, the effects of flavaglines should be assessed in a murine model of hypomagnesemia. In conclusion, the natural compounds flavaglines stimulate the activity of TRPM6 Mg2+ channels at nanomolar concentrations. The effect is rapid (within 15 min) and probably relies on a near-plasma membrane mechanism that likely involves PHBs. Further in vivo experiments will be needed to validate the putative magnesiotropic properties of these compounds with a plethora of beneficial effects.

AcknowledgementsThis work was supported by grants from the Netherlands Organization for Scientific Research (ZonMw 9120.8026, NWO Vici 016.130.668) and the EURenOmics project from the European Union seventh Framework Programme (FP7/2007–2013, agreement nu 305608). We also thank ANRT and AAREC Filia Research for fellowships to C. Basmadjian and Q. Zhao.

Methods

Cell CultureHuman embryonic kidney cells (HEK293) were grown at 37 °C in DMEM (Biowhittaker Europe, Vervier, Belgium) supplemented with 10 % (v/v) fetal calf serum (PAA Laboratories, Linz, Austria), non-essential amino acids, and 2 mmol/L L-glutamine in a humidified 5 % (v/v) CO2 atmosphere. Cells were seeded in 12-well plates and subsequently transfected with 1 μg of HA-tagged TRPM6 cDNA using Lipofectamine 2000 (Invitrogen) at 1:3 DNA:-Lipofectamine ratio. For patch-clamp experiments, cells were seeded two days after transfection on glass coverslips coated with 50 mL/cm2 of 50 μg/mL fibronectin (Roche, Mannheim, Germany). Two hours later, cells were placed in the recording chamber and selected based on the intensity of the fluorescent reporter.

230 | Chapter 9

ElectrophysiologyAll experiments were undertaken and analyzed using an EPC-9 amplifier and the Patchmaster software (HEKA electronics, Lambrecht, Germany). The sampling interval was set to 200 ms and data was low-pass filtered at 2.9 kHz. Patch clamp pipettes were pulled from thin-walled borosilicate glass (Harvard Apparatus, March-Hugstetten, Germany) and had resistance between 1 and 3 MW when filled with the pipette solution. Series resistance compensation was set to 75-95 % in all experiments. Current densities were obtained by normalizing the current amplitude to the cell capacitance.

Solutions and Compound ApplicationThe extracellular solution contained (in mmol/L): 150 NaCl, 1 CaCl2, 10 HEPES/NaOH pH 7.4. The pipette solution was made of: 150 NaCl, 10 Na2EDTA, 10 HEPES/NaOH pH 7.2 (29). Cells were pre-incubated 15 min at 37 °C in bath solution containing the compound of interest or vehicle (0.1 % (v/v) dimethyl sulfoxide (DMSO)).

ImmunoblottingHEK293 cells were lysed for 1 hr at 4 °C in TNE lysis buffer containing (in mmol/L): 50 Tris/HCl pH 8.0, 150 NaCl, 5 EDTA, 1 % (v/v) Triton X-100 and protease inhibitors (pepstatin 1 µg/mL, PMSF 1 mmol/L, leupeptin 5 µg/mL and aproptin 5 µg/mL). Protein lysates were denatured in Laemmli containing 100 mmol/L dithiothreitol (DTT, 30 min, 37 °C) and subsequently subjected to SDS-PAGE. Immunoblots were incubated with mouse anti-HA (Roche, high affinity 3F10, 1:5,000), rabbit anti-Akt (Cell signaling, 1:1,000) and rabbit anti-ERK1/2 (Cell signaling, 1:1,000) primary antibodies and peroxidase conjugated sheep anti-mouse secondary antibodies (Jackson Immunoresearch, 1:10,000).

Animal ExperimentTwenty male C57BL/6 mice aged between 8-12 weeks were housed in a light and temperature controlled room with ad libitum access to food and water. The animals were randomly divided in two groups and received daily intraperitoneal injections (0.1 mg/kg) of FL3 or placebo (polyethylene glycol 400 (PEG400). FL3 was dissolved in absolute ethanol (2 mg/mL) and diluted 100 fold (v/v) in PEG400 (4 g/10 ml). Blood was collected at day 1, day 3 and day 7 by submandibular facial vein puncture. Mice were housed for 24 hrs in metabolic cages at day 0-1, day 2-3 and day 6-7 to collect feces and urine. At day 7, the animals were sacrificed and kidneys and intestine were taken and immediately frozen in liquid nitrogen. Animal experiments were performed in concordance with national and institutional guidelines and approved by the Radboud University Nijmegen animal ethics board.

Electrolytes MeasurementsSerum concentrations and urinary total Ca2+ and Mg2+ excretions were determined using colorimetric assay kits according to the manufacturer’s protocols (Lancer, St. Louis, MO,


USA and Roche Diagnostics, Woerden, the Netherlands, respectively). Serum and urinary Na+ and K+ were analyzed using a Hitachi automatic analyzer (Hitachi, Laval, Quebec, Canada).

Expression AnalysisTotal RNA was isolated using TRIzol total RNA isolation agent (Invitrogen, Breda, the Netherlands) and treated with DNase (1U/μg RNA, Promega, Leiden, the Netherlands) to remove genomic DNA. Subsequently, reverse transcription of the RNA by M-MLV reverse transcriptase (Invitrogen) was performed for 1 hr at 37 °C. Gene expression levels were determined by quantitative real-time PCR on a Bio-Rad analyzer using iQ Sybr Green (BioRad, Veenendaal, the Netherlands) and normalized for Gapdh expression levels. Primer sequences are listed in Table 2.

Statistical and Data Analysis All results are depicted as mean ± standard error of the mean (SEM). Statistical analysis was conducted by one-way Student’s t-test when comparing two treatment groups or experimental conditions. When comparing multiple groups statistical comparisons were analyzed by two-way ANOVA with a Tukey’s multiple comparison test. Difference in means with P values <0.05 were considered statistically significant and indicated by a star (*). Current time-development curves were fitted with a logistic equation: I=I0+((Imax-I0)/(1+(t/t1/2)-h)s), with I the current density, I0 the baseline current density, t the time, t1/2 the time of half-maximal current density, h the slope and s a parameter. Half-maximal stimulatory concentration (EC50) was obtained by fitting a Hill equation to the data points: I =I0+(Imax – I0) *(([FL23]n)/(IC50

n+[FL23]n)), with I the current density, I0 the baseline current density obtained in control conditions, Imax the maximal current value and n the Hill number.

Table 2 Primer Sequences

Forward primer Reverse primer



Enac 5’-CATGCCTGGAGTCAACAATG-3’ 5’-CCATAAAAGCAGGCTCATCC-3’


232 | Chapter 9

References1. Ande SR, and Mishra S. Prohibitin interacts with phosphatidylinositol 3,4,5-triphosphate (PIP3) and

modulates insulin signaling. Biochemical and biophysical research communications 390: 1023-1028, 2009.2. Basmadjian C, Thuaud F, Ribeiro N, and Desaubry L. Flavaglines: potent anticancer drugs that target

prohibitins and the helicase eIF4A. Future medicinal chemistry 5: 2185-2197, 2013.3. Bernard Y, Ribeiro N, Thuaud F, Turkeri G, Dirr R, Boulberdaa M, Nebigil CG, and Desaubry L. Flavaglines

alleviate doxorubicin cardiotoxicity: implication of Hsp27. PloS one 6: e25302, 2011.4. Bezzerides VJ, Ramsey IS, Kotecha S, Greka A, and Clapham DE. Rapid vesicular translocation and

insertion of TRP channels. Nature cell biology 6: 709-720, 2004.5. Brandao K, Deason-Towne F, Zhao X, Perraud AL, and Schmitz C. TRPM6 kinase activity regulates TRPM7

trafficking and inhibits cellular growth under hypomagnesic conditions. Cellular and molecular life sciences : CMLS 2014.

6. Cao G, Lee KP, van der Wijst J, de Graaf M, van der Kemp A, Bindels RJ, and Hoenderop JG. Methionine sulfoxide reductase B1 (MsrB1) recovers TRPM6 channel activity during oxidative stress. The Journal of biological chemistry 285: 26081-26087, 2010.

7. Cao G, Thebault S, van der Wijst J, van der Kemp A, Lasonder E, Bindels RJ, and Hoenderop JG. RACK1 inhibits TRPM6 activity via phosphorylation of the fused alpha-kinase domain. Current biology : CB 18: 168-176, 2008.

8. Cao G, van der Wijst J, van der Kemp A, van Zeeland F, Bindels RJ, and Hoenderop JG. Regulation of the epithelial Mg2+ channel TRPM6 by estrogen and the associated repressor protein of estrogen receptor activity (REA). The Journal of biological chemistry 284: 14788-14795, 2009.

9. Chowdhury I, Thompson WE, and Thomas K. Prohibitins role in cellular survival through Ras-Raf-MEK-ERK pathway. Journal of cellular physiology 229: 998-1004, 2014.

10. Cohen AW, Razani B, Wang XB, Combs TP, Williams TM, Scherer PE, and Lisanti MP. Caveolin-1-deficient mice show insulin resistance and defective insulin receptor protein expression in adipose tissue. American journal of physiology Cell physiology 285: C222-235, 2003.

11. de Baaij JH, Groot Koerkamp MJ, Lavrijsen M, van Zeeland F, Meijer H, Holstege FC, Bindels RJ, and Hoenderop JG. Elucidation of the distal convoluted tubule transcriptome identifies new candidate genes involved in renal Mg(2+) handling. American journal of physiology Renal physiology 305: F1563-1573, 2013.

12. de Baaij JHF, Hoenderop JGJ, and Bindels RJM. Regulation of magnesium balance: lessons learned from human genetic disease. Clinical kidney journal 5: i15-i24, 2012.


14. Kim S, Salim AA, Swanson SM, and Kinghorn AD. Potential of cyclopenta[b]benzofurans from Aglaia species in cancer chemotherapy. Anti-cancer agents in medicinal chemistry 6: 319-345, 2006.

15. Morino-Koga S, Yano S, Kondo T, Shimauchi Y, Matsuyama S, Okamoto Y, Suico MA, Koga T, Sato T, Shuto T, Arima H, Wada I, Araki E, and Kai H. Insulin receptor activation through its accumulation in lipid rafts by mild electrical stress. Journal of cellular physiology 228: 439-446, 2013.


17. Okada S, Yamada E, Saito T, Ohshima K, Hashimoto K, Yamada M, Uehara Y, Tsuchiya T, Shimizu H, Tatei K, Izumi T, Yamauchi K, Hisanaga S, Pessin JE, and Mori M. CDK5-dependent phosphorylation of the Rho family GTPase TC10(alpha) regulates insulin-stimulated GLUT4 translocation. The Journal of biological chemistry 283: 35455-35463, 2008.

18. Polier G, Neumann J, Thuaud F, Ribeiro N, Gelhaus C, Schmidt H, Giaisi M, Kohler R, Muller WW, Proksch P, Leippe M, Janssen O, Desaubry L, Krammer PH, and Li-Weber M. The natural anticancer compounds rocaglamides inhibit the Raf-MEK-ERK pathway by targeting prohibitin 1 and 2. Chemistry & biology 19: 1093-1104, 2012.


19. Ryazanova LV, Dorovkov MV, Ansari A, and Ryazanov AG. Characterization of the protein kinase activity of TRPM7/ChaK1, a protein kinase fused to the transient receptor potential ion channel. The Journal of biological chemistry 279: 3708-3716, 2004.


21. Schmitz C, Dorovkov MV, Zhao X, Davenport BJ, Ryazanov AG, and Perraud AL. The channel kinases TRPM6 and TRPM7 are functionally nonredundant. The Journal of biological chemistry 280: 37763-37771, 2005.

22. Song Y, Hsu YH, Niu T, Manson JE, Buring JE, and Liu S. Common genetic variants of the ion channel transient receptor potential membrane melastatin 6 and 7 (TRPM6 and TRPM7), magnesium intake, and risk of type 2 diabetes in women. BMC medical genetics 10: 4, 2009.


24. Thebault S, Cao G, Venselaar H, Xi Q, Bindels RJ, and Hoenderop JG. Role of the alpha-kinase domain in transient receptor potential melastatin 6 channel and regulation by intracellular ATP. The Journal of biological chemistry 283: 19999-20007, 2008.

25. Thuaud F, Bernard Y, Türkeri G, Dirr R, Aubert G, Cresteil T, Baguet A, Tomasetto C, Svitkin Y, Sonenberg N, Nebigil CG, and Désaubry L. Synthetic analogue of rocaglaol displays a potent and selective cytotoxicity in cancer cells: involvement of apoptosis inducing factor and caspase-12. Journal of medicinal chemistry 52: 5176-5187, 2009.

26. Thuaud F, Ribeiro N, Gaiddon C, Cresteil T, and Desaubry L. Novel flavaglines displaying improved cytotoxicity. J Med Chem 54: 411-415, 2011.

27. Vainio S, Heino S, Mansson JE, Fredman P, Kuismanen E, Vaarala O, and Ikonen E. Dynamic association of human insulin receptor with lipid rafts in cells lacking caveolae. EMBO reports 3: 95-100, 2002.

28. van der Wijst J, Blanchard MG, Woodroof HI, Macartney TJ, Gourlay R, Hoenderop JG, Bindels RJ, and Alessi DR. Kinase and channel activity of TRPM6 are co-ordinated by a dimerization motif and pocket interaction. The Biochemical journal 460: 165-175, 2014.

29. Voets T, Nilius B, Hoefs S, van der Kemp AW, Droogmans G, Bindels RJ, and Hoenderop JG. TRPM6 forms the Mg2+ influx channel involved in intestinal and renal Mg2+ absorption. The Journal of biological chemistry 279: 19-25, 2004.


31. Xie J, Sun B, Du J, Yang W, Chen HC, Overton JD, Runnels LW, and Yue L. Phosphatidylinositol 4,5-bisphosphate (PIP(2)) controls magnesium gatekeeper TRPM6 activity. Scientific reports 1: 146, 2011.

32. Yogi A, Callera GE, Tostes R, and Touyz RM. Bradykinin regulates calpain and proinflammatory signaling through TRPM7-sensitive pathways in vascular smooth muscle cells. American journal of physiology Regulatory, integrative and comparative physiology 296: R201-207, 2009.

33. Zhang Z, Yu H, Huang J, Faouzi M, Schmitz C, Penner R, and Fleig A. The TRPM6 kinase domain determines the Mg ATP-sensitivity of TRPM7/M6 heteromeric ion channels. The Journal of biological chemistry 2014.

Discussion on the Distal Convoluted Tubule | 237

Magnesium Homeostasis

Magnesium (Mg2+) homeostasis is the balance between intestinal uptake, storage in bone and renal excretion. Animal studies with various Mg2+ diets have demonstrated that the adaptability to differences in Mg2+ intake mainly takes place in the kidney (Chapter 2)(46, 133). Within the kidney, the distal convoluted tubule (DCT) is responsible for reabsorption of about 10 % of the filtered Mg2+ (9). Although the amount of Mg2+ reabsorption in the DCT is much lower than the reabsorption in the proximal tubule (PT, 10-25%) and the thick ascending limb of Henle’s Loop (TAL, 50-70 %), it is the most tightly regulated part of Mg2+ reabsorption in the kidney (23). Mg2+ transport in the DCT determines the final urinary Mg2+ excretion, since no reabsorption takes places beyond this segment. Animal studies using loop diuretics, severely reducing the Mg2+ reabsorption in TAL, did not result in renal Mg2+ wasting (60, 134). Indeed, increased Mg2+ reabsorption in DCT compensated for the reduced TAL reabsorption, suggesting that the DCT is capable to double, triple or even quadruple its reabsorption capacity (60). Several key players in Mg2+ reabsorption in DCT have been described to date, mainly driven by the advances that were made over the last decade elucidating monogenetic Mg2+-related tubulopathies (23). For instance, TRPM6 was identified as the apical cation channel mediating Mg2+ uptake in the DCT cell by linkage-analysis of patients with hypomagnesemia and secondary hypocalcemia (HSH)(111, 140). However, the basolateral extrusion mechanism for Mg2+ remains to be identified. Additionally, the complex regulatory network of Mg2+ reabsorption in the DCT is only partially deciphered. Therefore, this thesis aimed to identify new molecular players in DCT Mg2+ transport.

The Distal Convoluted Tubule

The DCT is the segment of the nephron that is anatomically defined as the convoluted tubule segment that starts from the macula densa and runs until the connecting tubule (CNT)(13). The DCT can be subdivided in two segments: DCT1, which consists entirely of DCT cells and DCT2, where DCT cells are present together with intercalated cells (30). Functionally, DCT2 is responsive to the mineralocorticoid hormone aldosterone, whereas DCT1 cells are not (100). DCT cells have a distinct morphology characterized by extensive invaginations of the basolateral membrane (Figure 1)(61). In the cytoplasm between the lamella-like structures formed by the basolateral membranes, a high amount of mitochondria are located which provide the energy for Na+-K+-ATPase activity. Within the kidney, the DCT cells contain the largest number of mitochondria compared to any other segment. Because of the invaginations, the cell nucleus and endoplasmic reticulum are located near the apical membrane of the cell. The cell nuclei may even have a flattened appearance in histological analyses (100). At the molecular level, DCT cells can by identified

238 | Chapter 10

by the expression of marker proteins such as the thiazide-sensitive Na+-Cl--cotransporter (NCC) and parvalbumin (PV). DCT2 cells also express the Epithelial Na+ Channel (ENaC). As a result, in DCT1 the NCC protein exclusively mediates Na+ transport. In DCT2, Na+ uptake

Figure 1 Overview of Ion Transport in the Distal Convoluted Tubule Cell

Fine-tuning (10 %) of Mg2+ transport takes place transcellular in the distal convoluted tubule (DCT).

At the apical membrane, Na+ and Cl- enter the cell via NCC. TRPM6 mediates Mg2+ uptake from the

pro-urine, which depends on the voltage-gradient set by back leak of K+ via ROMK and Kv1.1 potassium

channels. Mg2+ transport via TRPM6 can be activated by EGF and insulin. Upon activation of the

EGFR and IR an intracellular signaling cascade including PI3K, Akt and Rac1 results in an increased

TRPM6 membrane expression and increased channel activity. Within the cell, Mg2+ is bound by

parvalbumin. At the basolateral membrane, Mg2+ extrusion may be facilitated by SLC41A3, which

may be regulated by CNNM2 acting as Mg2+-sensor. Mg2+ extrusion depends on the Na+ gradient,

set by the Na+-K+-ATPase. The activity of the Na+-K+-ATPase is in turn dependent on K+ recycling

via Kir4.1. FXYD2 transcription encoding the γ-subunit of the Na+-K+-ATPase, is regulated by HNF1β.

ROMK: Renal Outer Medulla K+ channel, ClC-Kb: Chloride channel Kb, Kv1.1: Voltage gated K+ channel

1.1, TRPM6: Transient receptor potential melastatin type 6, NCC: Na+-Cl- co-transporter, CNNM2: Cyclin

M2, SLC41A3: Solute carrier family 41 member 3, FXYD2: FXYD-domain containing 2, HNF1β: Hepatocyte

Nuclear Factor 1β, PCBD1: Pterin-4 alpha-carbinolamine dehydratase, EGF: Epidermal Growth Factor, EGFR:

Epidermal Growth Factor Receptor, IR: Insulin Receptor, PI3K: Phosphoinositide 3-kinase, Rac1: Ras-related

C3 botulinum toxin substrate 1, Cdk5: Cyclin-dependent kinase 5.

-

-

0 mV / -30 mV


via ENaC results in simultaneous K+ secretion via Renal Outer Medullary K+ channels (ROMK)(125). Na+ transport in DCT is important for the development of a voltage gradient across the epithelium, which develops from 0 mV at the early DCT1 segment to -30 mV in DCT2 (Figure 1)(4, 144).

DCT Cell LinesSince the first attempts in the 1980s, the highly differentiated and polarized DCT cells have proven to be extremely difficult to culture in vitro. Initially, intact distal tubules from dogs and rats were, therefore, used to study electrolyte transport in DCT (22, 97). Given the limitations of using intact tubules to examine the cellular and molecular mechanisms of DCT electrolyte transport, several groups have pursued to establish a DCT cell line. In 1991, the group of Friedman reported the isolation and immortalization of murine DCT cells (mDCT) that were subsequently used frequently to study Na+, Ca2+ and Mg2+ influx (37, 94). These cells have been shown to express NCC and to allow thiazide-sensitive 22Na+ uptake, but other DCT genes such as the mineralocorticoid receptor and TRPM6 are poorly expressed. Interestingly, the mDCT cells also express ENaC and can, therefore, be used as a model for DCT2. Although Mg2+ influx in these cells has been measured, this has been proven extremely difficult and sensitive to osmotic changes. Nevertheless, the mDCT cells have been instrumental in the identification of new Mg2+ transporters, including cyclin M2 (CNNM2), solute carrier family 41 member 1 (SLC41A1), nonimprinted in Prader-Willi/Angelman syndrome (NIPA) and membrane Mg2+ transporter (MMgT)(41, 43, 98). Functional evidence for the Mg2+ transport capacity of some of the new genes, such as NIPA and MMgT, is extremely scarce and their role in Mg2+ reabsorption should, therefore, be reconsidered (40, 44). Alternatively, Vandewalle and colleagues have established another DCT cell line from microdissected mouse DCT in 1999, named mpkDCT cells (29). By culturing these cells on collagen-coated permeable membrane filters, the mpkDCT cells will differentiate and form a confluent monolayer with a resistance comparable to primary DCT cultures (26, 29). Generally, the mpkDCT cells are considered to have higher thiazide-sensitive Na+ transport than mDCT cells, although a recent subclone, mDCT15, may provide similar transport rates (64). Just like the mDCT cells, the mpkDCT cells are of DCT2 origin, as shown by the expression of Transient receptor potential vanilloid type 5 (TRPV5), calbindin-D28k and the parathyroid hormone (PTH) receptor (26). Potentially due the DCT2 origin of both cell lines, they provide poor models to study transepithelial Mg2+ transport. Although Mg2+ transport has been measured in mDCT cells, many magnesiotropic DCT proteins are not expressed (unpublished data). Thus, the need for a DCT1 cell line to study transepithelial Mg2+ transport is high.

Primary DCT CellsOver the last 50 years, microdissection using forceps has been the leading technique to obtain primary DCT cells (145). In contrast to the TAL and collecting duct (CD) cells that

240 | Chapter 10

each make up about 20 % of total nephron length, less than 5 % of the nephron consists of DCT cells (147). Therefore, microdissection of DCT cells is highly labor-intensive and results in very little material. In Chapter 2 automated-sorting of primary DCT cells was established to study Mg2+-sensitive gene expression at the whole genome scale using microarrays. Mice expressing the enhanced green fluorescent protein (eGFP) behind a Pv promoter were sacrificed and the fluorescent DCT cells were isolated using the Complex Object Parametric Analyzer and Sorter (COPAS) system (82). In comparison to microdissection, COPAS significantly increases the yield and, therefore, allows large-scale expression studies with pure DCT cells. Previous expression studies only reported mRNA transcript levels of the combined DCT/CNT segments of the kidney (95). Recently, COPAS-sorted DCT cells were shown to exhibit thiazide-sensitive Na+ transport, evidencing NCC activity (82). In Chapter 2, the expression of all DCT-specific genes including Ncc, Trpm6 and Pv was highly enriched compared to non-DCT tubules of the same kidney. The subsequent expression profiling revealed that of all genes implicated in hypomagnesemia-related genetic diseases, only Trpm6, Cnnm2 and Epidermal growth factor (Egf) were regulated by the Mg2+ availability. These results demonstrate that COPAS-sorted DCT cells are the first highly abundant alternative for microdissection and subsequent established DCT cell lines.

· Distal convoluted tubule cells are highly specialized cells characterized by basolateral invaginations and high amounts of mitochondria

· The distal convoluted tubule determines the final urinary Mg2+ excretion· COPAS sorting of distal convoluted tubule cells provides a high efficiency and

high quality alternative for microdissection and distal convoluted tubule cell lines

Apical membrane: Regulation of TRPM6

Mg2+ reabsorption in DCT is mediated by the apical influx of Mg2+ via TRPM6 (Figure 1)(138). TRPM6 is composed of 6 transmembrane domains with the predicted channel pore between the fifth and sixth membrane-spanning domain (Figure 2). In this reentrant loop two glutamate residues, p.Glu1024 and p.Glu1029, determine the pore selectivity for Mg2+ ions (74). Interestingly, the same two residues render the pH-sensitivity of TRPM6 channels. Hence, acidification increases TRPM6 activity (74). TRPM6 forms homotetramers or hetero-tetramers with its closest homologue TRPM7 to become functionally active (75). A unique characteristic of TRPM6 and TRPM7 proteins is that they have an atypical kinase domain fused to their intracellular COOH-terminus (135). The kinase domain is involved in the channel’s autophosphorylation, but its exact function remains to be identified. Recently,


the kinase of TRPM7 was shown to be proteolytically cleaved from the channel (25). TRPM7 kinase fragments could translocate to the nucleus to activate chromatin remodeling (69). It would be of major interest to examine whether the kinase of TRPM6 is also cleaved and to identify which genes are regulated by the kinase fragments in the cell nucleus. The necessity of TRPM7 for the functional activity of TRPM6 has been extensively discussed over the last decade (14, 75, 112). Recent data on the regulation of TRPM6 activity by

Figure 2 Overview of Regulatory Pathways of TRPM6 Mediated Mg2+ Transport

TRPM6 consists of 6 membrane-spanning domains with its predicted channel pore between the

fifth and sixth transmembrane domain. Two lysine residues (p.Lys1024 and p.Lys1029) determine

the pH sensitivity and specificity of the pore for Mg2+ transport. TRPM6 has a kinase domain fused

to its C-terminus, which can be bound by interacting proteins including MSRB1, PHB2 and GNB2L1.

The p.Thr1831 residue is essential for autophosphorylation of the channel and p.Met1755 is sensitive

to oxidative stress. The activity of TRPM6 can be inhibited by extracellular ATP by binding the P2X4

receptor. Insulin and EGF stimulate TRPM6 activity by activation of an intracellular signaling pathway

including PI3K, Akt and Rac1. The p.Val1393 and p.Lys1584 are essential for insulin stimulation.

MSRB1: methionine sulfoxide reductase B1, GNB2L1: guanine nucleotide-binding protein subunit beta-2-like

1, PHB2: prohibitin 2, P2X4: Purinergic receptor X4, EGF: epidermal growth factor, IR: insulin receptor, EGFR:

epidermal growth factor receptor, PI3K: Phosphoinositide 3-kinase, Rac1: Ras-related C3 botulinum toxin

substrate 1, Cdk5: Cyclin-dependent kinase 5.

0 mV / -30 mV

K

MT

1024

1755

1831

V

K

1393

1584

K1029

242 | Chapter 10

intracellular Mg2+ provide new arguments for a significant role of TRPM7. Intracellular Mg2+ acts as a negative feedback mechanism for excessive Mg2+ uptake and, therefore, inhibits TRPM6 and TRPM7. Although initial reports indicated that the IC50 of Mg2+ inhibition on TRPM6 was in the range of 0.5 mmol/L (138), a recent study by Zhang and colleagues reports much lower concentrations of intracellular Mg2+ (IC50: 29 μmol/L)(149). Interestingly, TRPM6-TRPM7 heterotetramers are inhibited at higher concentrations of intracellular Mg2+ (IC50: 466 µmol/L). Since the intracellular Mg2+ concentrations are normally in the range of 0.2-1.0 mmol/L, these results question the physiological activity of homotetrameric TRPM6 channels. Thus, the exact composition of functional TRPM6 channels in the DCT should be examined in future studies. Mutations in TRPM6 lead to hypomagnesemia with secondary hypocalcemia (HSH), caused by intestinal malabsorption and renal wasting of Mg2+ (111, 140). Since TRPM6 is the gatekeeper of Mg2+ reabsorption in DCT, it is the main target of regulation of renal Mg2+ reabsorption. Over the last decade, genetic and molecular studies have identified several regulators of TRPM6 activity and plasma membrane availability, including epidermal growth factor (EGF), insulin, pH and several interacting proteins (Table 1)(10-12, 74, 86, 126). In this thesis, two new regulatory pathways of TRPM6 activity are described, underlining the central role of TRPM6 in Mg2+ homeostasis. In Chapter 8, the role of purinergic receptors in ATP-mediated inhibition of TRPM6 was explained. Chapter 9 reports a new biological compound of the flavagline family that can activate TRPM6 activity.

Endocrine and Paracrine RegulationAfter reports of hypomagnesemia in patients using EGF receptor (EGFR) inhibitors such as cetuximab and in patients with diabetes mellitus type 2 (114, 141), research has focused the last years on the effect of EGF and insulin on TRPM6 activity (86, 126). EGF activates upon binding to the EGFR an intracellular signaling cascade including phosphoinositide 3-kinase (PI3K), Akt and Ras-related C3 botulinum toxin substrate 1 (RAC1) leading to an increased insertion of TRPM6 in the plasma membrane (47, 126) (Figure 2). In patients using cetuximab, EGFR cannot be activated, resulting in lower TRPM6 plasma membrane expression and thus reduced Mg2+ reabsorption in DCT. In a similar fashion, insulin can activate TRPM6 activity and plasma membrane expression (86). Interestingly, patients with diabetes mellitus have an increased incidence of two single nucleotide polymorphisms (SNPs), p.Ile1393Val and p.Lys1584Glu in TRPM6, which impair the insulin-sensitivity of the Mg2+ channel. Although EGF has been shown to be produced locally and may have some paracrine action, EGF and insulin are mainly endocrine factors reaching the DCT cells via the blood. In Chapter 8, a new autocrine and paracrine mode of TRPM6 regulation has been identified. Initial studies to P2X receptors in DCT performed by Dai and colleagues in mDCT cells demonstrate that Mg2+ transport is sensitive to ATP (21). P2X receptors form


ATP-activated ion channels. Each channel consists of homo- or heterotrimers in which the large extra cellular loops provide the ATP-binding sites (15, 89). Upon ATP binding the channel opens, resulting in a non-selective cation entry into the cell. The expression

Table 1 Regulation of TRPM6 in the Kidney

Regulatory Hormones

Factor Effects on activity

Effect on transcription

Residues Ref.

EGF (55, 126)

Insulin p.Val1393, p.Lys1584 (71, 86)

Estrogen (12, 46)

ATP - Chapter 8

Intracellular Factors



Residues Ref.

Mg2+ - (138, 149)

pH - p.Glu1024, p.Glu1029 (74)

H2O2 - (10)

ATP - (127)

Drugs and Compounds



Residues Ref.

2APB - (75)

FL3/FL23 - Chapter 9

Thiazide - (87)

CNIs - (54)

PPIs (70)

Rapamycin (57)

EGFR blockers (27)

Interacting proteins



Residues Ref.

MSRB1 - p.Met1755 (10)

PHB2 - (12)

GNB2L1 - p.Thr1851 (11)

This table lists all regulating factors of TRPM6 activity and TRPM6 transcription. Activity is measured

by whole-cell patch clamp analysis and can therefore be defined as the total of open pore probability,

channel conductance and plasma membrane expression.

244 | Chapter 10

pattern of P2x1-7 in the DCT was determined using COPAS-sorted DCT cells. Within the DCT, P2x4 and P2x6 were the only P2X isoforms with high expression levels in DCT cells. However, co-localization of P2X4 and NCC was not detected when staining for P2X4 on mouse kidney sections. In contrast, P2X6 is exclusively expressed in DCT. By patch clamp analysis P2X4 was shown to inhibit TRPM6 activity when co-expressed in human embryonic kidney cells (HEK293). Since both channels are expressed in the colon, a role of P2X4 in the intestinal regulation of Mg2+ absorption was suggested. The secretion of ATP in the lumen of intestine and the kidney tubule is regulated by flow (16). This suggests that luminal ATP release could provide an important paracrine feedback mechanism to correct for variations in flow in the tubule (72). Interestingly, ENaC has also been shown to be inhibited by P2X4 receptors (142), suggesting that ATP-induced inhibition of ion channels provides a general regulatory mechanism in response to flow changes. Given that in patch clamp analysis P2X4 activation reduced TRPM6 currents and P2X6 had no effect on the channel activity, it would be interesting to further clarify the role of P2X6 in the kidney. The unique expression pattern of P2X6, only being present in the DCT suggests a role of P2X6 in the regulation of Na+ and Mg2+ transport mechanisms. However, in our and previous studies it has been reported that P2X6 is not functional on its own but requires P2X2 or P2X4 channels to reach the plasma membrane (73, 131). This kind of mechanism is difficult to study in vitro, since it is challenging to influence and measure the exact composition of heterotrimeric channels. Moreover, overexpression studies are not conclusive since the endogenously expressed P2X receptors will also influence the heteromeric complexes of the overexpressed proteins. Recently, a large consortium developed a P2x6 knockout (KO) mouse (143) and it would be interesting to measure blood and urinary Na+, K+ and Mg2+ values in this strain to determine the physiological role of P2X6.

Interacting ProteinsBy pull down experiments using the atypical kinase domain of TRPM6, several interacting proteins have been identified (10-12). First, methionine sulfoxide reductase B1 (MSRB1) binds the TRPM6 kinase to protect the channel from reactive oxygen species (10). DCT cells are among the cell types with the highest mitochondria content in the body and are, therefore, sensitive to oxidative stress. Notably, free methionine residues are prone to oxidation, which inhibits TRPM6 channel activity (10). MSRB1 is a methionine reductase (62), which by binding TRPM6 can reduce Met1755 after oxidative stress and thus rescue TRPM6 inhibition (10). Second, guanine nucleotide-binding protein subunit beta-2-like 1 (GNB2L1) / receptor for activated C-kinase (RACK1) was identified to bind TRPM6 at positions 1857-1885 and inhibit the channel activity (11). Autophosphorylation of TRPM6 at p.Thr1851 is necessary for this inhibitory effect, although it does not affect GNB2L1 binding (11). Interestingly, this autophosphorylation site is important for the regulation of TRPM6 activity by intracellular Mg2+, which provides a negative feedback mechanism. GNB2L1


binding may thus regulate the Mg2+ sensitivity of TRPM6. Third, prohibitin 2 (PHB2) / repressor of estrogen receptor activity (REA) binds to the TRPM6 kinase domain at the exact same location as RACK1 (12). PHB2 inhibits TRPM6 activity in kinase activity dependent manner. Interestingly, estrogen prevents the binding of PHB2 to TRPM6 and, thereby, stimulates channel activity. In Chapter 9, a subgroup of flavaglines was shown to bind PHB2 and, therefore, their functional effects on TRPM6 activity were tested. Flavaglines are cyclopental[b]benzofuran structures that were originally used in traditional Chinese medicine and extracted from the aglaia (Meliaceae) plant (103). Flavagline 23 (FL23) activated TRPM6 in the nanomolar range, making FL23 a potent molecule to increase Mg2+ transport. Patch clamp analysis demonstrated a similar effect of FL23 on mock currents, suggesting that TRPM7 was activated in an analogous manner. If the mechanism of action of FL23 depends on PHB2 binding, this would suggest that PHB2 also binds TRPM7. PHB1 and PHB2 are central players in cell cycle control (128). Several studies have demonstrated the role of TRPM7 in cell growth and differentiation (91). PHB binding to TRPM7 could provide a new regulatory mechanism for TRPM7 activity in cell growth. For future research, it would be interesting to develop and test new flavagline compounds with higher specificity for TRPM6. TRP channels are highly homologous and, therefore, compounds targeting TRP channels show often relatively low specificity (88). For application of flavaglines in vivo or in clinic, the specificity of flavagalines should be improved.

· TRPM6 mediates apical Mg2+ entry in the distal convoluted tubule cell and is regulated by EGF, insulin and pH

· Extracellular ATP inhibits TRPM6 activity by binding P2X4 purinergic receptors· Flavagline compounds provide a new class of TRPM6 activating agents

Nucleus: Transcriptional regulation

In Chapter 2 and in previous studies comparing mice fed with Mg2+-deficient and Mg2+-enriched diets, gene expression in the kidney was shown to be very sensitive to alterations in Mg2+ homeostasis (46, 133). Notably, Trpm6, Cnnm2 and Egf were among the genes that exhibit an increased expression in the low Mg2+ diet fed mice. However, the molecular players involved in transcriptional regulation of these magnesiotropic genes are largely unknown. Pioneering studies by Ikari and colleagues reported that the expression of TRPM6 is increased by EGF stimulation (55, 56). Their findings propose a mechanism in which the extracellular signal-regulated kinases (ERK) signaling pathway is activated upon EGFR binding, eventually resulting in activation of cFos/cJun binding to an Activator Protein-1 (AP-1) binding site in the TRPM6 promoter (56) (Figure 3). An additional

246 | Chapter 10

activators of TRPM6 transcription is estrogen, however the transcriptional mechanism of estrogen is still unknown (46). In Chapter 2 the microarray screening of Mg2+-sensitive mRNA transcription identified two new transcriptional regulators in DCT. First, Sex determining region Y-box 9 (Sox9) was upregulated 5-fold in low Mg2+ diet fed mice compared to littermates given the high Mg2+ diet. SOX9 is a key transcription factor in tissue development. Kidney-specific Sox9 KO mice show impaired kidney development en the formation of ectopic nephrons (99). Although the effect of SOX9 on nephron segmentation is unknown, Sox9 expression is considered very low in adult nephron tissue. Interestingly, in other epithelial cells such as colonic crypts and duodenal cells, SOX9 is used as a marker for proliferation of progenitor cells that are involved in the renewal of the

Figure 3 Overview of Transcriptional Regulation of Mg2+ transport in the DCT

In the DCT cell nucleus, TRPM6 expression is regulated via an EGF signaling pathway resulting in

activation of cFos/cJun proteins binding to an AP1 site in the TRPM6 promoter. FXYD2 transcription

can be activated by binding of HNF1B and its transcriptional coactivator PCBD1. Sox9 expression in

DCT has been shown to be extremely sensitive to dietary Mg2+ availability, but its molecular targets

remain to be identified.

TRPM6: Transient receptor potential melastatin type 6, FXYD2: FXYD-domain containing 2, HNF1β: Hepato-

cyte Nuclear Factor 1β, PCBD1: Pterin-4 alpha-carbinolamine dehydratase, EGF: Epidermal Growth Factor,

AP1: Activator Protein 1, SOX9: SRY (sex determining region Y)-box 9.

0 mV / -30 mV

+3257

GGTAAATATTACCG AATGTTTAATGCC

TGACCAC

-741

FXYD2

J

9

AGAACAATGG

?


epithelial cells (5, 137). Translating these findings to renal epithelia, this suggests that increased SOX9 expression in DCT can be associated with cell regeneration (96). One could speculate that high expression of SOX9 in response to stimuli like a low Mg2+ diet, could result in activation of renal progenitor cells potentially with the purpose to extend the DCT region to increase Mg2+ reabsorption capacity. SOX9 expression is regulated by the magnesiotropic hormone EGF in urothelial cells (77). It would be interesting to identify the gene targets of SOX9 in the kidney by ChIP-Seq analysis. This would allow distinguishing whether SOX9 directly regulates magnesiotropic genes or may be involved in DCT cell regeneration. Second, Pterin-4-alpha-carbinolamine dehydratase (Pcbd1) transcription was identified to be highly Mg2+-sensitive in Chapter 2. PCBD1 encodes the transcriptional co-activator of hepatocyte nuclear factor 1 homeobox A and B (HNF1A/HNF1B) (Figure 3). In Chapter 3, the effect of PCBD1 on HNF1B-induced FXYD domain containing ion transport regulator 2 (FXYD2) transcription was examined with luciferase promoter assays, showing that PCBD1 increased FXYD2 transcription with 50 %. Interestingly, Hnf1B transcription was not altered in response to a low Mg2+ diet, suggesting that PCBD1 is the regulating factor in the transcription of FXYD2. Patients with mutations in PCBD1 suffered from hypomagnesemia, renal Mg2+ wasting and maturity onset diabetes of the young (MODY). This phenotype closely resembled the phenotype of renal cysts and diabetes syndrome (RCAD), which is caused by HNF1B mutation. However, in contrast with RCAD patients, PCBD1 mutations do not cause renal cysts (32). This can be explained by the absence of PCBD1 in the CD, where HNF1B regulates PKHD1 transcription. In RCAD patients PKHD1 expression is disturbed, resulting in renal malformation and cysts (51). The fact that PCBD1 mutations result in a RCAD-like syndrome, suggests that mutations in other interaction partners may also cause hypomagnesemia, MODY or renal malformations. Over the last decade, several interacting proteins of HNF1B have been identified including E4F1 and ZFP36L1 (28). It would be interesting to screen for mutations in the genes encoding for these interacting proteins in patients with RCAD-like phenotypes, which test negative for HNF1B and PCBD1 mutations.

· Low dietary Mg2+ intake regulates renal Mg2+ reabsorption by increasing TRPM6, CNNM2 and EGF gene expression

· PCBD1 was identified to cause hypomagnesemia and MODY-like diabetes in patients with neonatal transient primapterinuria

248 | Chapter 10

Basolateral Membrane: A Quest for Extrusion

During the last years, the mechanisms of apical Mg2+ entry in the DCT have been relatively well explained and many regulatory factors were characterized (23). In contrast, Mg2+ extrusion at the basolateral membrane from the DCT cell remains unexplained, despite the identification of several basolateral magnesiotropic proteins (7, 84, 113, 124). Early studies in the 80’s by Gunther and Vormann already suggested that Na+ as a counter ion can drive the Mg2+ extrusion from the cell (48). Since then, a large body of evidence was gathered by several groups in many different cell types confirming these original findings (106). This mechanism was shown to be electroneutral (2 Na+

in : 1 Mg2+out), amiloride-

sensitive and activated by agents increasing intracellular cAMP levels including, prostaglandin E2 (PGE2), forskolin and norepinephrine (106). The molecular identity of this alleged epithelial Na+/Mg2+ exchanger remains to be identified, although several candidates have been proposed (66, 124). In Chapter 5, 6 and 7, two of these candidates, Solute Carrier Family 41 Member 3 (SLC41A3) and CNNM2 were examined in detail.

SLC41 Family of Mg2+ Carriers SLC41A3 is part of the family of SLC41 carriers, which are related to the bacterial Mg2+ transporter MgtE (81, 108, 139). SLC41A1 is the most investigated isoform of this transporter family and was initially studied in Xenopus laevis oocytes by voltage clamp analysis (41). In these experiments, SLC41A1 mediated Mg2+ currents, but also transported Fe2+, Cu2+, Zn2+ and Cd2+, suggesting a channel function or electrogenic exchanger (41). However, in patch clamp experiments using mammalian HEK293 cells overexpressing SLC41A1 Mg2+ currents were not observed (unpublished results). Publications by Kolisek and colleagues strongly advocate that SLC41A1 functions as a Na+/Mg2+ exchanger as they showed Na+-dependent Mg2+ extrusion using the cytosolic Mg2+-indicator MagFura (66). This finding was further substantiated in a recent study that identified mutations in SLC41A1 to be causative for a nephronophthisis-like phenotype (53). However, given the affinity of MagFura for other cations including Ca2+ and the sensitivity to osmotic changes due to saturation of the probe (unpublished results), these results should be interpreted with caution. Independent techniques such as 22Na+ uptake or 25Mg2+ extrusion assays should confirm these findings. To study SLC41A1 and other Mg2+ transporters in the future, a more specific and reliable Mg2+ probe to measure intracellular Mg2+ concentrations is essential. Although over recent years many new Mg2+ probes have been described based on RNA, protein or chemical structures, none of these have resulted in a specific and dynamic Mg2+ probe sensitive within the physiological range (0.2-1.0 mmol/L) and low affinity for Ca2+ (19, 35, 109). Future initiatives should be directed to develop such a probe, for instance based on the Förster resonance energy transfer (FRET) technique (76). In addition to SLC41A1, both SLC41A2 and SLC41A3 were tested in the Xenopus laevis oocyte voltage-clamp system and mediated similar Mg2+ currents as SLC41A1 (41, 42, 98).


SLC41A2 is mainly located in the intracellular compartments such as the Golgi-system and has been poorly characterized (107, 108). SLC41A3 has never been examined in detail. In mice fed with Mg2+-deficient diets, Slc41a3 expression was significantly upregulated in the DCT (Chapter 2). Therefore, SLC41A3 function was examined in vivo using Slc41a3 knockout (KO) mice in Chapter 5. Interestingly, Slc41a3 KO mice displayed hypomagnesemia due to renal Mg2+ wasting, further establishing the role of SLC41A3 in Mg2+ homeostasis. Slc41a3 KO mice exhibited the same intestinal Mg2+ absorption rate as wild type (WT) littermates. The expression of Slc41a1 was increased in the duodenum of Slc41a3 KO mice, suggesting that Slc41a1 can compensate for the loss of SLC41A3 function and that both proteins are functionally redundant. In contrast, Slc41a1 expression was not increased in the kidney, which may be explained by the fact that SLC41A1 and SLC41A3 are not expressed in the same segments. RT-PCR analysis on COPAS-sorted DCT material showed that Slc41a3 is 10-fold enriched, whereas Slc41a1 is not enriched. Unexpectedly, hydronephrosis was detected in 10% of Slc41a3 KO mice fed with Mg2+-deficient diets. Since a patient with nephronophthisis was reported to carry a SLC41A1 splice site mutation (53), this suggests that SLC41 proteins may play role in renal cyst formation and hydronephrosis. It would be of interest to screen more cystic patients for mutations in SLC41 genes. Moreover, further characterization of hydronephrosis formation in Slc41a3 KO mice is necessary to understand the etiology of hydronephrosis in these mice and to examine the role of Mg2+ in this process.

CNNM Family of Mg2+-binding ProteinsIn 2011, CNNM2 mutations were identified to be causative for hypomagnesemia in two patients suffering from epilepsy, tremor and muscle weakness (124). In Chapter 7, the phenotypical spectrum was further extended by the identification of 5 additional families with CNNM2 mutations. Interestingly, for the first time CNNM2 mutations were associated with mental retardation. Moreover, in the family with the most severe mental disability and brain malformations a recessive mode inheritance was observed. This is in contrast with all other mutations, which were detected in heterozygous state. Importantly, the parents of the patient with the homozygous (recessive) mutation were not affected; suggesting that this mutation does not completely impairs CNNM2 function. CNNM2 is within the kidney expressed in the cortical TAL, DCT and CNT region (124). Given its basolateral localization at the plasma membrane, it has been proposed to be the long-sought Mg2+ extrusion mechanism (124). In Xenopus laevis oocyte voltage clamp experiments, CNNM2-mediated Mg2+ currents were within the physiological range of intracellular Mg2+ concentrations (43). Moreover, CNNM2 expression rescues cell growth in Mg2+-deficient Salmonella enterica (123). However, Mg2+ transport could not be measured in mammalian cells (124). In Chapter 6, the protein structure of CNNM2 was further examined to predict protein function. CNNM2 contains a N-terminal signal peptide, three membrane-spanning domains and potential reentrant region between the second and

250 | Chapter 10

third domain. By homology modeling based on the bacterial CorC protein (148), a protein 3D structure of the cystathionine beta synthase (CBS) domains of CNNM2 was constructed. Interestingly, this model suggested that the CBS domains harbor a Mg-ATP binding site and that this site is disrupted by the p.Thr568Ile mutation identified in the first patient family. Based on these findings, it was proposed that CNNM2 functions as a Mg2+-sensing mechanism rather than as a Mg2+ transporter. In a recent study by Hirata and colleagues, the homology model was confirmed and the binding of Mg-ATP was demonstrated by filter binding assays (52). However, Mg-ATP binds the CNNM2 CBS domains with an apparent affinity of 158 µmol/L, which is far below the physiological range (52). Of note: intracellular Mg-ATP concentrations are considered to range between 2-10 mmol/L. Based on these findings an Mg2+-sensing mechanism should be excluded. However, it would be interesting to repeat the Mg-ATP binding experiments within a more physiological cell system, since other proteins and factors may influence the Mg-ATP binding. In Chapter 7, the effect of CNNM2 on Mg2+ transport was examined using the stable 25Mg2+ isotope. CNNM2-expressing cells showed a higher 25Mg2+ uptake than mock-trans-fected cells. The CNNM2 mutants identified in the patients exhibited a lower 25Mg2+ uptake than wild type CNNM2. Importantly, the CNNM2-induced 25Mg2+ uptake was inhibited by 2-Aminoethoxydiphenyl borate (2-APB), a non-selective inhibitor of TRPM7 Mg2+ channels (75), which are endogenously expressed in HEK293 cells. These findings support the hypothesis that CNNM2 regulates other Mg2+ channels instead of transporting Mg2+ itself. Brain development was impaired and Mg2+ homeostasis was disturbed after knocking down cnnm2 expression in zebrafish using the morpholino approach. Cnnm2 morphants had impaired touch-response behavior, which has been reported before in trpm7 mutant zebrafish (31, 79). Interestingly, in the same zebrafish model it was shown that TRPM7 is essential for the development of dopaminergic neurons (24). CNNM2 has been associated with Parkinson’s disease and schizophrenia (104, 110, 122); both diseases are known to exhibit an abnormal dopamine balance (8, 90). Although it cannot be excluded that CNNM2 plays a role in neurodevelopment intrinsically, the combined in vitro and in vivo findings may lead to the hypothesis that CNNM2 regulates TRPM7 in brain. Therefore, it would be interesting to study the dopamine levels and development of dopaminergic neurons in cnnm2 morphants and compare these to the results obtained in trpm7 mutants. TRPM7 may be expressed at low levels in the DCT, however, it is considered to contribute only to basal cellular Mg2+ homeostasis, not to transcellular Mg2+ transport. Thus, CNNM2-dependent activity of TRPM7 would not explain the renal Mg2+ wasting observed in the patients. Future studies should therefore be directed towards the identification of the interaction partners of CNNM2 in DCT. One could consider examining the effects of CNNM2 on TRPM6 activity by patch clamp analysis. In addition, the SLC41 proteins are also interesting interaction candidates, given that both SLC41 and CNNM2 share homology to the bacterial Mg2+ transporter MgtE (43, 49, 108). The CBS domains of


CNNM2 are highly homologous to the MgtE CBS domains, but the plasma membrane regions do not share any homology (Chapter 6). In contrast, the pore region including all essential residues for Mg2+ transport of SLC41A1, SLC41A2 and SLC41A3 are highly conserved from MgtE Mg2+ channels (81). In evolution, the functional domains of MgtE may have been divided between the CNNM and SLC41 proteins. Given that both CNNM and SLC41 proteins were evidenced to function in complexes (Chapter 6), it would be interesting to examine whether these proteins interact (65). This hypothesis would also explain the difficulties to measure the activity of the proteins individually.

Other Mg2+-related Proteins at the Basolateral MembraneIn 2000, linkage analysis identified a heterozygous p.Gly41Arg mutation in FXYD2 causing dominant hypomagnesemia and renal Mg2+ wasting (83, 84). In Chapter 4, two new families were identified with familial dominant hypomagnesemia. The patients suffer from hypermagnesiuria, hypocalciuria, decline in renal function and epilepsy. Since these are the first patients reported since 2000 and they all origin from the Netherlands and Belgium, genealogy studies and marker analysis were performed. Indeed, marker analysis revealed a common allele suggesting one founder mutation. However, genealogy analysis until 1700 did not find a link between the families, although ancestors of two families could be traced to the same area near Liège, Belgium. FXYD2 encodes for the γ-subunit of the Na+-K+-ATPase that generates an electrochemical gradient across the basolateral membrane driving electrolyte transport. In total seven FXYD proteins have been described to date, each with its own expression pattern and effects on Na+-K+-ATPase function (36). Thus, by changing the expression of FXYD proteins, the Na+-K+-ATPase activity can be altered according to the needs of each tissue or cell. FXYD2 has been implicated in the stabilization of the α-subunit of the Na+-K+-ATPase, it decreases the affinity for Na+ and K+ and increases the affinity for ATP (3, 85). How the γ-subunit of the Na+-K+-ATPase influences the plasma Mg2+ concentrations is not understood. Over the years several hypothesis have been formed: i) the absence of γ-subunit binding to the α- and β-subunit of the Na+-K+-ATPase may reduce its function and thus affects the driving force for Mg2+ uptake via TRPM6 (33); ii) the γ-subunit of the Na+-K+-ATPase may form a functional channel on its own mediating Mg2+ extrusion to the blood (115); iii) FXYD2 may act as a subunit for the still unidentified Na+-Mg2+-exchanger, directly affecting Mg2+ extrusion to the blood. To date, none of the given hypothesis has been convincingly substantiated and the role of FXYD2 remains, therefore, to be determined. Interestingly, FXYD5 was recently shown to increase the paracellular permeability and reduce plasma membrane resistance (80). It has been shown previously that the β-subunit of the Na+-K+-ATPase is important for cell-cell adhesion (116). Therefore, it has been proposed that FXYD5 binding to the β-subunit of the Na+-K+-ATPase affects paracellular permeability (80). Knowing that FXYD2 expression is not restricted to DCT but is also present in TAL, a similar mechanism could be proposed (3). In this hypothesis, FXYD2 increases paracellular permeability in TAL. As a result,

252 | Chapter 10

mutations in FXYD2 would decrease Mg2+ reabsorption in TAL eventually resulting in renal Mg2+ wasting. Patients with mutations in KCNJ10, encoding Kir4.1, present with epilepsy, ataxia, sensorial deafness and a tubulopathy phenotype (EAST/SeSAME syndrome) closely resembling Gitelman’s syndrome (7, 113). In these patients blood analysis showed hypokalemia, hypomagnesemia and metabolic alkalosis. Often these patients have polyuria and hypocalciuria. As in Gitelman’s syndrome the origin of the hypomagnesemia is not completely understood (38, 58). The most common explanation is that K+ efflux at the basolateral membrane is necessary to maintain Na+-K+-ATPase serving as a K+-recycling mechanism (Figure 4). Nonfunctional Kir4.1 would then result in decreased Na+-K+-ATPase activity and thus, reduced driving force for Mg2+ reabsorption. However, an underappre-ciated symptom in patients with Gitelman’s syndrome and EAST/SeSAME syndrome is the presence of metabolic alkalosis (63). Given that Mg2+ reabsorption via TRPM6 is pH dependent and this channel has decreased activity in basic conditions (74), it could be hypothesized that the alkalosis results in reduced TRPM6-mediated Mg2+ transport. It is unclear how the blood pH status is reflected in the local pH of the DCT lumen. Nevertheless, it would be interesting to test whether treatment of the alkalosis can restore the Mg2+ balance in patients with EAST/SeSAME syndrome.

· SLC41A3 is involved in Mg2+ homeostasis and may function as the basolateral Na+/Mg2+-exchanger

· CNNM2 binds Mg2+ in its CBS domains and may regulate other Mg2+ channels, including TRPM7

· The molecular mechanism of basolateral Mg2+ extrusion remains elusive

Clinical Perspectives: Mg2+ Disorders

Hypomagnesemia is a relatively common phenomenon that is sparsely diagnosed in the clinic. Estimations of the incidence of hypomagnesemia range between 3 % and 10 % of the normal population and may rise up to 65 % in patients at the intensive care unit (129). The symptoms of hypomagnesemia are multifold; ranging from muscle cramps to epilepsy and cardiac arrhythmias in severely hypomagnesemic patients. However, patients with only minor deficiencies may experience only general signs of hypomagnesemia such as fatigue, lethargy or depression. Based on these symptoms it is difficult to diagnose hypomagnesemia in a clinical situation, especially because Mg2+ is not routinely determined in blood. Given the impressive advancements that have been made in Mg2+ research during the last decade, the importance of Mg2+ is more frequently appreciated. Firm evidence is now available that the use of certain types of drugs, including proton pump inhibitors,


EGFR antagonists and diuretics may cause hypomagnesemia (45, 50, 92). As a result, clinicians prescribing these drugs are more aware of hypomagnesemia and test patients using these types of drugs more often for Mg2+ disturbances. Still the role of Mg2+ in health and disease needs more attention. Many patient groups, including diabetics or patients with chronic kidney disease, show a worse disease outcome when they suffer from low plasma Mg2+ levels (20). Recently, it was demonstrated in women with gestational diabetes that single nucleotide polymorphisms in TRPM6 are associated with diabetes and hypomagnesemia (86). Nevertheless, Mg2+ levels are still not routinely measured in diabetes patients. A clear example of how patient care can be improved by early detection is presented in Chapter 3 of this thesis. Three babies with neonatal transient primapterinuria were diagnosed at birth after the Guthrie test and were treated with BH4 supplements.

Figure 4 Overview of the Regulation of Basolateral Mg2+ Extrusion in the DCT

At the basolateral membrane of the DCT, Mg2+ is extruded from the cell via a Na+-dependent

mechanism, which may be SLC41A3. Mg2+ extrusion relies, therefore, on Na+-K+-ATPase activity,

which is in turn dependent on K+ transport via Kir4.1. CNNM2 regulates Mg2+ transport via an unknown

mechanism.

ClC-Kb: Chloride channel Kb, Kir4.1: K+ channel Ki4.1, SLC41A3: Solute carrier family 41 member 3, CNNM2:

Cyclin M2.

0 mV / -30 mV

140 mM 15 mM 0.8 mM

5 mM 145 mM 0.8 mM

254 | Chapter 10

However, at this time the fact that PCBD1 mutations cause renal Mg2+ wasting and MODY diabetes was not known. Based on the findings presented in Chapter 3, patients with PCBD1 mutations can now be supplemented with Mg2+ from birth and disease progression may be decreased. Earlier detection of this kind of disorders by including Mg2+ measurements in standard blood electrolyte screens, can significantly improve patient care.

Identification of Genetic Mg2+ DisordersIn a small group of hypomagnesemia patients, the disturbed blood Mg2+ levels could be attributed to a genetic defect. In 1999, CLDN16 mutations were identified to cause Familial Hypomagnesemia with Hypercalciuria and Nephrocalcinosis (FHHNC Type 1)(120) and since then the molecular causes for 15 other hypomagnesemia-related diseases were found. All genetic causes of hypomagnesemia are listed in Table 2. Next to FHHNC Type 1, the most common ones include Familial Hypomagnesemia with Hypercalciuria and Nephrocalcinosis with ocular involvement (FHHNC type 2, CLDN19 mutations)(68), Gitelman syndrome (SLC12A3 mutations)(121), Hypomagnesemia with secondary hypocalcemia (HSH, TRPM6 mutations)(111, 140) and Renal Cysts and Diabetes Syndrome (RCAD, HNF1B mutations)(1). To identify the genetic cause of hypomagnesemia careful phenotyping of the patient is of major importance. A simple blood measurement including Na+, K+, Ca2+, Mg2+ and glucose is already sufficient to distinguish between the most common genetic Mg2+ syndromes. Additional phenotyping is necessary to identify the more rare diseases. The flow chart that is presented in Figure 5 may aid to find the causal gene in patients with a suspected genetic origin of hypomagnesemia. However, it should be noted that patients suffering form hereditary hypomagnesemia are heterogeneous and not every patient will present with all characteristics of a particular syndrome. Therefore, the differential diagnosis should always be confirmed by genetic testing. Given the heterogeneity of hypomagnesemia patients, it is important to extend the knowledge on the known Mg2+ syndromes by extensive phenotyping of newly identified patients. An illustrative example is given in Chapter 6, where 5 new families with CNNM2 mutations are reported and characterized. All patients presented with mental retardation, which was previously not described in CNNM2 patients. Moreover, for the first time a recessive mode of inheritance of CNNM2 patients was observed. In the future, patients with severe hypomagnesemia and mental retardation without Ca2+ and K+ disturbances should be immediately screened for CNNM2 mutations. To improve patient care, it is crucial to continue reporting new patients with mutations in known genes. The treatment regimes of such patients should be further emphasized in these reports, since genetic forms of hypomagnesemia are rare diseases that will never be suitable for clinical trials. In this perspective, the recent widely executed N=1 trials should be initiated for hypomagnesemia patients. An N=1 trial is a crossover study performed within a single patient (59). This allows testing the optimal treatment regimen in an objective manner,


but also provides a basis for the treatment of future patients. N=1 trials could, therefore, be a tool in providing personalized health care for hypomagnesemia patients. Although the cause of hypomagnesemia has been identified in many patients over the last decade, there are still numerous hypomagnesemia patients without known cause, but are suspected to have a genetic origin. Currently, next generation sequencing

Figure 5 Schematic Representation of Clinical Symptoms of Hypomagnesemia to Phenotypically Distinguish Genetic Forms of Hypomagnesemia

Careful phenotyping of the patient is essential to determine the origin of hypomagnesemia in

patients. Simple blood Na+, K+, Ca2+, Mg2+ and glucose measurement allow to distinguish the main

genetic forms of hypomagnesemia. This flow chart may aid to find the causal gene in patients with

a suspected genetic origin of hypomagnesemia. However, it should be noted that patients suffering

form hereditary hypomagnesemia are heterogeneous and not every patient will present with all

characteristics of a particular syndrome. Therefore, the differential diagnosis should always be confirmed

by genetic testing.

Serum [K+] < 3.5 mmol/L

Serum [Ca+]< 2.2 mmol/L

Nephrocalcinosis

Ataxia Myokimia

GitelmanSyndrome

SeSAME/EASTSyndrome

HSH

FHHNC type 1

FHHNC type 2

ADH

IDH

IRH

EpilepsyMental retardation

No neuronalabnormalities

Epilepsy

Serum [Mg2+] < 0.7 mmol/L

Diabetes

Renal Cysts

TransientPrimapterinuria

RCAD

RCAD-like

No other serumelectrolyte disturbances

HSMR

DominantInheritance

RecessiveInheritance

Visual Impairment

NormalVision

256 | Chapter 10

Tabl

e 2

Gen

etic

Cau

ses

of H

ypom

agne

sem

ia

Hum

an G

enet

ic M

g2+ D

isor

ders

in th

e TA

L

Gen

ePr

otei

nD

isea

seO

MIM

Inh.

Segm

ent

Bloo

d M

g2+U

rine

Mg2+

Bloo

d Ca

2+U

rine

Ca2+

Oth

er sy

mpt

oms

Ref.

CLD

N16

Cla

udin

16

FHH

NC

type

124

8250

RTA

L

-

N

ephr

ocal

cino

sis

Rena

l fai

lure

(120

)

CLD

N19

Cla

udin

19

FHH

NC

type

224

8190

RTA

L

-

N

ephr

ocal

cino

sis

Rena

l fai

lure

Visu

al im

pairm

ent

(68)

SLC1

2A1

NKC

C2

Bart

ter t

ype

160

1678

RTA

L

--

N

a+ w

astin

gH

ypok

alem

ic a

lkal

osis

Hig

h Re

nin/

Ald

oste

rone

(118

)

KCN

J1RO

MK

Bart

ter t

ype

224

1200

RTA

L

--

N

a+ w

astin

gH

ypok

alem

ic a

lkal

osis

Hig

h Re

nin/

Ald

oste

rone

(119

)

CLCN

KBC

lC-K

bBa

rtte

r typ

e 3

6073

64R

TAL

-

-

Na+

was

ting

Hyp

okal

emic

alk

alos

isH

igh

Reni

n/A

ldos

tero

ne

(117

)

BSN

DBa

rttin

Bart

ter t

ype

460

2522

RTA

L

--

N

a+ w

astin

gH

ypok

alem

ic a

lkal

osis

Hig

h Re

nin/

Ald

oste

rone

(6)

Hum

an G

enet

ic M

g2+ D

isor

ders

in th

e D

CT

Gen

ePr

otei

nD

isea

seO

MIM

Inh.

Segm

ent

Bloo

d M

g2+U

rine

Mg2+

Bloo

d Ca

2+U

rine

Ca2+

Oth

er sy

mpt

oms

Ref.

TRPM

6TR

PM6

HSH

6020

14R

DC

T

-

-Se

izur

esM

uscl

e sp

asm

sM

enta

l ret

arda

tion

(111

, 140

)

EGF

EGF

IRH

6117

18R

DC

T

-

-Se

izur

esM

enta

l ret

arda

tion

(47)

CNN

M2

CN

NM

2H

SMR

6138

82D

/RD

CT

-

--

Seiz

ures

Men

tal r

etar

datio

n(1

24)

Cha

pter

7

KCN

A1Kv

1.1

AD

H17

6260

DD

CT

-

--

Mus

cle

cram

psTe

tany

Myo

kym

ia

(39)

KCN

J10

Kir4

.1Se

SAM

E /

EAST

6127

80R

DC

T

-

H

ypok

alem

iaM

etab

olic

alk

alos

isSe

nsor

ineu

ral d

eafn

ess

Seiz

ures

Ata

xia

Men

tal r

etar

datio

n

(7, 1

13)

FXYD

2FX

YD2

IDH

1540

20D

DC

T

-

Co

nvul

sion

sM

uscl

e cr

amps

Cho

ndro

calc

inos

is

(84)

Cha

pter

4

HN

F1B

HN

F1β

RCA

D13

7920

DD

CT

-

Rena

l cys

tsM

OD

Y5Re

nal m

alfo

rmat

ions

(1)

PCBD

1PC

BD1

RCA

D-li

ke26

4070

RD

CT

--

Tran

sien

t hyp

erph

enyl

alan

inem

iaM

OD

Y5-li

keC

hapt

er 3

SLC1

2A3

NCC

Gite

lman

syn

-dr

ome

2638

00R

DC

T

-

H

ypok

alem

iaM

etab

olic

alk

alos

isTe

tany

Cho

ndro

calc

inos

is

(121

)

SLC

: Sol

ute

carr

ier,

NKC

C2:

Na+

-K+

-2C

l- co

tran

spor

ter,

TRPM

6: T

rans

ient

Rec

epto

r Pot

entia

l Mel

asta

tin t

ype

6, E

GF:

Epi

derm

al G

row

th F

acto

r, CN

NM

2: C

yclin

M2,

FX

YD2:

FX

YD d

omai

n co

ntai

ning

ion

tran

spor

t re

gula

tor

2, H

NF1

B: H

epat

ocyt

e N

ucle

ar F

acto

r 1B

, PCB

D1:

Pte

rin-4

-alp

ha-c

arbi

nola

min

e de

hydr

atas

e,

NCC

: Na+

-Cl-

cotr

ansp

orte

r, FH

HN

C: F

amili

al H

ypom

agne

sem

ia w

ith H

yper

calc

iuria

and

Nep

hroc

alci

nosi

s, H

SH: H

ypom

agne

sem

ia w

ith S

econ

dary

Hyp

o-

calc

emia

, IRH

: Iso

late

d Re

cess

ive

Hyp

omag

nese

mia

, HSM

R: H

ypom

agne

sem

ia w

ith S

eizu

res

and

Men

tal R

etar

datio

n, A

DH

: Aut

osom

al D

omin

ant

Hyp

o-

mag

nsem

ia, S

eSA

ME:

Sen

sorin

eura

l Dea

fnes

s, Se

izur

es, A

taxi

a, M

enta

l Ret

arda

tion

and

Elec

trol

yte

imba

lanc

e, E

AST

: Epi

leps

y, A

taxi

a, S

enso

rineu

ral D

eafn

ess

and

Tubu

lopa

thy,

IDH

: Iso

late

d D

omin

ant H

ypom

agne

sem

ia, R

CA

D: R

enal

Cys

ts a

nd D

iab

etes

, OM

IM: O

nlin

e M

ende

lian

Inhe

ritan

ce in

Man

, D: D

omin

ant,

R:

Rece

ssiv

e, T

AL:

Thi

ck A

scen

ding

Lim

b of

Hen

le’s

Loop

, DC

T: D

ista

l Con

volu

ted

Tubu

le, M

OD

Y: M

atur

ity O

nset

Dia

bet

es o

f the

You

ng.


Tabl

e 2

Gen

etic

Cau

ses

of H

ypom

agne

sem

ia

Hum

an G

enet

ic M

g2+ D

isor

ders

in th

e TA

L

Gen

ePr

otei

nD

isea

seO

MIM

Inh.

Segm

ent

Bloo

d M

g2+U

rine

Mg2+

Bloo

d Ca

2+U

rine

Ca2+

Oth

er sy

mpt

oms

Ref.

CLD

N16

Cla

udin

16

FHH

NC

type

124

8250

RTA

L

-

N

ephr

ocal

cino

sis

Rena

l fai

lure

(120

)

CLD

N19

Cla

udin

19

FHH

NC

type

224

8190

RTA

L

-

N

ephr

ocal

cino

sis

Rena

l fai

lure

Visu

al im

pairm

ent

(68)

SLC1

2A1

NKC

C2

Bart

ter t

ype

160

1678

RTA

L

--

N

a+ w

astin

gH

ypok

alem

ic a

lkal

osis

Hig

h Re

nin/

Ald

oste

rone

(118

)

KCN

J1RO

MK

Bart

ter t

ype

224

1200

RTA

L

--

N

a+ w

astin

gH

ypok

alem

ic a

lkal

osis

Hig

h Re

nin/

Ald

oste

rone

(119

)

CLCN

KBC

lC-K

bBa

rtte

r typ

e 3

6073

64R

TAL

-

-

Na+

was

ting

Hyp

okal

emic

alk

alos

isH

igh

Reni

n/A

ldos

tero

ne

(117

)

BSN

DBa

rttin

Bart

ter t

ype

460

2522

RTA

L

--

N

a+ w

astin

gH

ypok

alem

ic a

lkal

osis

Hig

h Re

nin/

Ald

oste

rone

(6)

Hum

an G

enet

ic M

g2+ D

isor

ders

in th

e D

CT

Gen

ePr

otei

nD

isea

seO

MIM

Inh.

Segm

ent

Bloo

d M

g2+U

rine

Mg2+

Bloo

d Ca

2+U

rine

Ca2+

Oth

er sy

mpt

oms

Ref.

TRPM

6TR

PM6

HSH

6020

14R

DC

T

-

-Se

izur

esM

uscl

e sp

asm

sM

enta

l ret

arda

tion

(111

, 140

)

EGF

EGF

IRH

6117

18R

DC

T

-

-Se

izur

esM

enta

l ret

arda

tion

(47)

CNN

M2

CN

NM

2H

SMR

6138

82D

/RD

CT

-

--

Seiz

ures

Men

tal r

etar

datio

n(1

24)

Cha

pter

7

KCN

A1Kv

1.1

AD

H17

6260

DD

CT

-

--

Mus

cle

cram

psTe

tany

Myo

kym

ia

(39)

KCN

J10

Kir4

.1Se

SAM

E /

EAST

6127

80R

DC

T

-

H

ypok

alem

iaM

etab

olic

alk

alos

isSe

nsor

ineu

ral d

eafn

ess

Seiz

ures

Ata

xia

Men

tal r

etar

datio

n

(7, 1

13)

FXYD

2FX

YD2

IDH

1540

20D

DC

T

-

Co

nvul

sion

sM

uscl

e cr

amps

Cho

ndro

calc

inos

is

(84)

Cha

pter

4

HN

F1B

HN

F1β

RCA

D13

7920

DD

CT

-

Rena

l cys

tsM

OD

Y5Re

nal m

alfo

rmat

ions

(1)

PCBD

1PC

BD1

RCA

D-li

ke26

4070

RD

CT

--

Tran

sien

t hyp

erph

enyl

alan

inem

iaM

OD

Y5-li

keC

hapt

er 3

SLC1

2A3

NCC

Gite

lman

syn

-dr

ome

2638

00R

DC

T

-

H

ypok

alem

iaM

etab

olic

alk

alos

isTe

tany

Cho

ndro

calc

inos

is

(121

)

SLC

: Sol

ute

carr

ier,

NKC

C2:

Na+

-K+

-2C

l- co

tran

spor

ter,

TRPM

6: T

rans

ient

Rec

epto

r Pot

entia

l Mel

asta

tin t

ype

6, E

GF:

Epi

derm

al G

row

th F

acto

r, CN

NM

2: C

yclin

M2,

FX

YD2:

FX

YD d

omai

n co

ntai

ning

ion

tran

spor

t re

gula

tor

2, H

NF1

B: H

epat

ocyt

e N

ucle

ar F

acto

r 1B

, PCB

D1:

Pte

rin-4

-alp

ha-c

arbi

nola

min

e de

hydr

atas

e,

NCC

: Na+

-Cl-

cotr

ansp

orte

r, FH

HN

C: F

amili

al H

ypom

agne

sem

ia w

ith H

yper

calc

iuria

and

Nep

hroc

alci

nosi

s, H

SH: H

ypom

agne

sem

ia w

ith S

econ

dary

Hyp

o-

calc

emia

, IRH

: Iso

late

d Re

cess

ive

Hyp

omag

nese

mia

, HSM

R: H

ypom

agne

sem

ia w

ith S

eizu

res

and

Men

tal R

etar

datio

n, A

DH

: Aut

osom

al D

omin

ant

Hyp

o-

mag

nsem

ia, S

eSA

ME:

Sen

sorin

eura

l Dea

fnes

s, Se

izur

es, A

taxi

a, M

enta

l Ret

arda

tion

and

Elec

trol

yte

imba

lanc

e, E

AST

: Epi

leps

y, A

taxi

a, S

enso

rineu

ral D

eafn

ess

and

Tubu

lopa

thy,

IDH

: Iso

late

d D

omin

ant H

ypom

agne

sem

ia, R

CA

D: R

enal

Cys

ts a

nd D

iab

etes

, OM

IM: O

nlin

e M

ende

lian

Inhe

ritan

ce in

Man

, D: D

omin

ant,

R:

Rece

ssiv

e, T

AL:

Thi

ck A

scen

ding

Lim

b of

Hen

le’s

Loop

, DC

T: D

ista

l Con

volu

ted

Tubu

le, M

OD

Y: M

atur

ity O

nset

Dia

bet

es o

f the

You

ng.

258 | Chapter 10

technology is applied to identify new genes that may be involved in Mg2+ homeostasis (101). Identification of new genes will aid the understanding of the molecular mechanism of Mg2+ reabsorption in the DCT. These insights are important to design new treatment options for patients with renal Mg2+ wasting.

Treatment of Mg2+ DisordersHypomagnesemia is treated by oral Mg2+ supplementation (± 360 mg/day)(2). Generally, organic Mg2+ salts are considered to be more soluble and bioavailable than inorganic Mg2+ salts (18). Oral Mg2+ supplementation is not tolerated well in some patients because it can cause diarrhea (34). Alternatively, intravenous Mg2+ administration may be more effective, but is invasive and requires regular hospital visits. The treatment regimen of intravenous Mg2+ supplementation normally consists of ±10 g of MgSO4 in the first 24 hrs followed by ±5 g per day for several days (130). When serum Mg2+ levels are extremely low or accompanied by hypokalemia, Mg2+ supplementation may not be sufficient to restore normal plasma Mg2+ levels. In the latter case, patients are often co-supplemented with K+ or receive K+-sparing diuretics like amiloride. In many patients, oral Mg2+ supplementation is not sufficient to restore normal plasma Mg2+ levels. Therefore, alternative approaches to increase serum Mg2+ levels should be developed. It has been proposed that dietary fibers may increase intestinal Mg2+ absorption (17). Therefore, it would be interesting to treat patients with hypomagnesemia with these oligo- or polysaccharides. In Chapter 9, flavaglines were shown to stimulate TRPM6 activity. If these compounds would be suitable for clinical applications, elevated TRPM6 activation may result in improved intestinal and renal (re)absorption of Mg2+. Currently, flavaglines are subscribed for anticancer treatments in clinical trials and their application is marked by toxic effects (102). In the future, it would be interesting to develop more TRPM6-activating compounds to increase Mg2+ reabsorption in hypomagnesemia patients.

Although the recent advances in Mg2+ research have been mainly achieved in the relative small group of patients with genetic hypomagnesemia, the results can be often translated to more general diseases. Hypomagnesemia has been associated with diabetes mellitus type 2, chronic kidney disease and parkinson’s disease (93, 136, 146), and these diseases have been linked to activity of Mg2+ channels and transporters TRPM6, TRPM7 and SLC41A1, respectively (67, 78, 86). The findings on TRPM6 and SLC41A3 in this thesis may therefore be applicable to much larger population groups. Therefore, future research should be dedicated to further understand the molecular mechanisms by which Mg2+ can contribute to the etiology and progression of aforementioned general diseases. Especially because the first results with Mg2+ supplementation as treatment for diabetes and chronic kidney disease confirm that Mg2+ is potentially a powerful treatment option for these patients (105, 132).


The work presented in this thesis is the result of stimulating collaborations between clinicians, geneticists, physiologists and molecular biologists that have increased our understanding of Mg2+ reabsorption in the DCT. Nevertheless, many questions remain to be answered and ample patients with hypomagnesemia are still awaiting diagnosis. Aided by the many technological advances of recent years, integration of all different research disciplines will provide the first step towards true personalized medicine for hypomagnesemia patients. Combined efforts of clinicians, geneticists, and researchers are continuously necessary to improve patient care of hypomagnesemia patients and increase our understanding of Mg2+ homeostasis.

260 | Chapter 10

References1. Adalat S, Woolf AS, Johnstone KA, Wirsing A, Harries LW, Long DA, Hennekam RC, Ledermann SE, Rees

L, van’t Hoff W, Marks SD, Trompeter RS, Tullus K, Winyard PJ, Cansick J, Mushtaq I, Dhillon HK, Bingham C, Edghill EL, Shroff R, Stanescu H, Ryffel GU, Ellard S, Bockenhauer D. HNF1B mutations associate with hypomagnesemia and renal magnesium wasting. J. Am. Soc. Nephrol. 20: 1123–1131, 2009.

2. Agus ZS. Hypomagnesemia. J. Am. Soc. Nephrol. 10: 1616–1622, 1999.3. Arystarkhova E, Sweadner KJ. Splice variants of the gamma subunit (FXYD2) and their significance in

regulation of the Na, K-ATPase in kidney. J. Bioenerg. Biomembr. 37: 381–386, 2005.4. Barratt LJ, Rector FC, Kokko JP, Tisher CC, Seldin DW. Transepithelial potential difference profile of the

distal tubule of the rat kidney. Kidney Int. 8: 368–375, 1975.5. Belo J, Krishnamurthy M, Oakie A, Wang R. The role of SOX9 transcription factor in pancreatic and duodenal

development. Stem Cells Dev. 22: 2935–2943, 2013.6. Birkenhäger R, Otto E, Schürmann MJ, Vollmer M, Ruf EM, Maier-Lutz I, Beekmann F, Fekete A, Omran

H, Feldmann D, Milford DV, Jeck N, Konrad M, Landau D, Knoers NV, Antignac C, Sudbrak R, Kispert A, Hildebrandt F. Mutation of BSND causes Bartter syndrome with sensorineural deafness and kidney failure. Nat. Genet. 29: 310–314, 2001.

7. Bockenhauer D, Feather S, Stanescu HC, Bandulik S, Zdebik AA, Reichold M, Tobin J, Lieberer E, Sterner C, Landoure G, Arora R, Sirimanna T, Thompson D, Cross JH, van’t Hoff W, Masri Al O, Tullus K, Yeung S, Anikster Y, Klootwijk E, Hubank M, Dillon MJ, Heitzmann D, Arcos-Burgos M, Knepper MA, Dobbie A, Gahl WA, Warth R, Sheridan E, Kleta R. Epilepsy, ataxia, sensorineural deafness, tubulopathy, and KCNJ10 mutations. N. Engl. J. Med. 360: 1960–1970, 2009.

8. Brisch R, Saniotis A, Wolf R, Bielau H, Bernstein H-G, Steiner J, Bogerts B, Braun AK, Jankowski Z, Kumaritlake J, Henneberg M, Gos T. The role of dopamine in schizophrenia from a neurobiological and evolutionary perspective: old fashioned, but still in vogue. Front Psychiatry 5: 47, 2014.

9. Brunette MG, Vigneault N, Carriere S. Micropuncture study of magnesium transport along the nephron in the young rat. Am. J. Physiol. 227: 891–896, 1974.

10. Cao G, Lee KP, van der Wijst J, de Graaf M, van der Kemp A, Bindels RJM, Hoenderop JGJ. Methionine sulfoxide reductase B1 (MsrB1) recovers TRPM6 channel activity during oxidative stress. J. Biol. Chem. 285: 26081–26087, 2010.

11. Cao G, Thébault S, van der Wijst J, van der Kemp A, Lasonder E, Bindels RJM, Hoenderop JGJ. RACK1 inhibits TRPM6 activity via phosphorylation of the fused alpha-kinase domain. Curr. Biol. 18: 168–176, 2008.

12. Cao G, van der Wijst J, van der Kemp A, van Zeeland F, Bindels RJ, Hoenderop JG. Regulation of the epithelial Mg2+ channel TRPM6 by estrogen and the associated repressor protein of estrogen receptor activity (REA). J. Biol. Chem. 284: 14788–14795, 2009.

13. Christensen EI, Wagner CA, Kaissling B. Uriniferous tubule: structural and functional organization. Compr Physiol 2: 805–861, 2012.

14. Chubanov V, Waldegger S, Mederos y Schnitzler M, Vitzthum H, Sassen MC, Seyberth HW, Konrad M, Gudermann T. Disruption of TRPM6/TRPM7 complex formation by a mutation in the TRPM6 gene causes hypomagnesemia with secondary hypocalcemia. Proc. Natl. Acad. Sci. U.S.A. 101: 2894–2899, 2004.

15. Coddou C, Yan Z, Obsil T, Huidobro-Toro JP, Stojilkovic SS. Activation and regulation of purinergic P2X receptor channels. Pharmacol. Rev. 63: 641–683, 2011.

16. Cooke HJ, Wunderlich J, Christofi FL. “The force be with you”: ATP in gut mechanosensory transduction. News Physiol. Sci. 18: 43–49, 2003.

17. Coudray C, Demigné C, Rayssiguier Y. Effects of dietary fibers on magnesium absorption in animals and humans. J. Nutr. 133: 1–4, 2003.

18. Coudray C, Rambeau M, Feillet-Coudray C, Gueux E, Tressol JC, Mazur A, Rayssiguier Y. Study of magnesium bioavailability from ten organic and inorganic Mg salts in Mg-depleted rats using a stable isotope approach. Magnesium Research 18: 215–223, 2005.

19. Cromie MJ, Shi Y, Latifi T, Groisman EA. An RNA sensor for intracellular Mg(2+). Cell 125: 71–84, 2006.20. Curiel-García JA, Rodríguez-Morán M, Guerrero-Romero F. Hypomagnesemia and mortality in patients

with type 2 diabetes. Magnesium Research 21: 163–166, 2008.


21. Dai LJ, Kang HS, Kerstan D, Ritchie G, Quamme GA. ATP inhibits Mg(2+) uptake in MDCT cells via P2X purinoceptors. Am. J. Physiol. Renal Physiol. 281: F833–40, 2001.

22. Dai LJ, Ritchie G, Kerstan D, Kang HS, Cole DE, Quamme GA. Magnesium transport in the renal distal convoluted tubule. Physiol. Rev. 81: 51–84, 2001.


24. Decker AR, McNeill MS, Lambert AM, Overton JD, Chen Y-C, Lorca RA, Johnson NA, Brockerhoff SE, Mohapatra DP, MacArthur H, Panula P, Masino MA, Runnels LW, Cornell RA. Abnormal differentiation of dopaminergic neurons in zebrafish trpm7 mutant larvae impairs development of the motor pattern. Dev. Biol. 386: 428–439, 2014.

25. Desai BN, Krapivinsky G, Navarro B, Krapivinsky L, Carter BC, Febvay S, Delling M, Penumaka A, Ramsey IS, Manasian Y, Clapham DE. Cleavage of TRPM7 releases the kinase domain from the ion channel and regulates its participation in Fas-induced apoptosis. Dev. Cell 22: 1149–1162, 2012.

26. Diepens RJW, Dekker den E, Bens M, Weidema AF, Vandewalle A, Bindels RJM, Hoenderop JGJ. Charac-terization of a murine renal distal convoluted tubule cell line for the study of transcellular calcium transport. Am. J. Physiol. Renal Physiol. 286: F483–9, 2004.

27. Dimke H, van der Wijst J, Alexander TR, Meijer IMJ, Mulder GM, van Goor H, Tejpar S, Hoenderop JG, Bindels RJ. Effects of the EGFR Inhibitor Erlotinib on Magnesium Handling. J. Am. Soc. Nephrol. 21: 1309–1316, 2010.

28. Dudziak K, Mottalebi N, Senkel S, Edghill EL, Rosengarten S, Roose M, Bingham C, Ellard S, Ryffel GU. Transcription factor HNF1beta and novel partners affect nephrogenesis. Kidney Int. 74: 210–217, 2008.

29. Duong Van Huyen JP, Bens M, Teulon J, Vandewalle A. Vasopressin-stimulated chloride transport in tran-simmortalized mouse cell lines derived from the distal convoluted tubule and cortical and inner medullary collecting ducts. Nephrol. Dial. Transplant. 16: 238–245, 2001.

30. Dørup J. Ultrastructure of three-dimensionally localized distal nephron segments in superficial cortex of the rat kidney. J. Ultrastruct. Mol. Struct. Res. 99: 169–187, 1988.

31. Elizondo MR, Arduini BL, Paulsen J, MacDonald EL, Sabel JL, Henion PD, Cornell RA, Parichy DM. Defective skeletogenesis with kidney stone formation in dwarf zebrafish mutant for trpm7. Curr. Biol. 15: 667–671, 2005.

32. Faguer S, Decramer S, Chassaing N, Bellanne-Chantelot C, Calvas P, Beaufils S, Bessenay L, Lengele J-P, Dahan K, Ronco P, Devuyst O, Chauveau D. Diagnosis, management, and prognosis of HNF1B nephropathy in adulthood. Kidney Int. 80: 768–776, 2011.

33. Ferrè S, Veenstra GJC, Bouwmeester R, Hoenderop JGJ, Bindels RJM. HNF-1B specifically regulates the transcription of the γa-subunit of the Na+/K+-ATPase. Biochem. Biophys. Res. Commun. 404: 284–290, 2011.

34. Fine KD, ANA C, FORDTRAN JS. Diagnosis of Magnesium-Induced Diarrhea. N. Engl. J. Med. 324: 1012–1017, 1991.

35. Fujii T, Shindo Y, Hotta K, Citterio D, Nishiyama S, Suzuki K, Oka K. Design and synthesis of a FlAsH-type Mg2+ fluorescent probe for specific protein labeling. J. Am. Chem. Soc. 136: 2374–2381, 2014.

36. Geering K. Functional roles of Na,K-ATPase subunits. Curr. Opin. Nephrol. Hypertens. 17: 526–532, 2008.37. Gesek FA, Friedman PA. Mechanism of calcium transport stimulated by chlorothiazide in mouse distal

convoluted tubule cells. J Clin Invest 90: 429–438, 1992.38. Gitelman HJ, Graham JB, Welt LG. A new familial disorder characterized by hypokalemia and

hypomagnesemia. Trans. Assoc. Am. Physicians 79: 221–235, 1966.39. Glaudemans B, van der Wijst J, Scola RH, Lorenzoni PJ, Heister A, van der Kemp AW, Knoers NV,

Hoenderop JG, Bindels RJ. A missense mutation in the Kv1.1 voltage-gated potassium channel-encoding gene KCNA1 is linked to human autosomal dominant hypomagnesemia. J Clin Invest 119: 936–942, 2009.

40. Goytain A, Hines RM, El-Husseini A, Quamme GA. NIPA1(SPG6), the basis for autosomal dominant form of hereditary spastic paraplegia, encodes a functional Mg2+ transporter. J. Biol. Chem. 282: 8060–8068, 2007.

41. Goytain A, Quamme GA. Functional characterization of human SLC41A1, a Mg2+ transporter with similarity to prokaryotic MgtE Mg2+ transporters. Physiol. Genomics 21: 337–342, 2005.

42. Goytain A, Quamme GA. Functional characterization of the mouse solute carrier, SLC41A2. Biochem. Biophys. Res. Commun. 330: 701–705, 2005.

262 | Chapter 10

43. Goytain A, Quamme GA. Functional characterization of ACDP2 (ancient conserved domain protein), a divalent metal transporter. Physiol. Genomics 22: 382–389, 2005.

44. Goytain A, Quamme GA. Identification and characterization of a novel family of membrane magnesium transporters, MMgT1 and MMgT2. American Journal of Physiology - Cell Physiology 294: C495–C502, 2008.

45. Greenberg A. Diuretic complications. Am. J. Med. Sci. 319: 10–24, 2000.46. Groenestege WMT, Hoenderop JG, van den Heuvel L, Knoers N, Bindels RJ. The epithelial Mg2+ channel

transient receptor potential melastatin 6 is regulated by dietary Mg2+ content and estrogens. J. Am. Soc. Nephrol. 17: 1035–1043, 2006.

47. Groenestege WMT, Thébault S, van der Wijst J, van den Berg D, Janssen R, Tejpar S, van den Heuvel LP, van Cutsem E, Hoenderop JG, Knoers NV, Bindels RJ. Impaired basolateral sorting of pro-EGF causes isolated recessive renal hypomagnesemia. J Clin Invest 117: 2260–2267, 2007.

48. Günther T, Vormann J, Förster R. Regulation of intracellular magnesium by Mg2+ efflux. Biochem. Biophys. Res. Commun. 119: 124–131, 1984.


50. Hess MW, Hoenderop JGJ, Bindels RJM, Drenth JPH. Systematic review: hypomagnesaemia induced by proton pump inhibition. Aliment. Pharmacol. Ther. 36: 405–413, 2012.

51. Hiesberger T, Bai Y, Shao X, McNally BT, Sinclair AM, Tian X, Somlo S, Igarashi P. Mutation of hepatocyte nuclear factor-1beta inhibits Pkhd1 gene expression and produces renal cysts in mice. J Clin Invest 113: 814–825, 2004.

52. Hirata Y, Funato Y, Takano Y, Miki H. Mg2+-Dependent Interactions of ATP with the Cystathionine-β-Syn-thase (CBS) Domains of a Magnesium Transporter. J. Biol. Chem. 289: 14731–14739, 2014.

53. Hurd TW, Otto EA, Mishima E, Gee HY, Inoue H, Inazu M, Yamada H, Halbritter J, Seki G, Konishi M, Zhou W, Yamane T, Murakami S, Caridi G, Ghiggeri G, Abe T, Hildebrandt F. Mutation of the Mg2+ Transporter SLC41A1 Results in a Nephronophthisis-Like Phenotype. J. Am. Soc. Nephrol. 24: 967–977, 2013.

54. Ikari A, Okude C, Sawada H, Takahashi T, Sugatani J, Miwa M. Down-regulation of TRPM6-mediated magnesium influx by cyclosporin A. Naunyn Schmiedebergs Arch. Pharmacol. 377: 333–343, 2008.

55. Ikari A, Okude C, Sawada H, Yamazaki Y, Sugatani J, Miwa M. TRPM6 expression and cell proliferation are up-regulated by phosphorylation of ERK1/2 in renal epithelial cells. Biochem. Biophys. Res. Commun. 369: 1129–1133, 2008.

56. Ikari A, Sanada A, Okude C, Sawada H, Yamazaki Y, Sugatani J, Miwa M. Up-regulation of TRPM6 tran-scriptional activity by AP-1 in renal epithelial cells. J. Cell. Physiol. 222: 481–487, 2010.

57. Ikari A, Sanada A, Sawada H, Okude C, Tonegawa C, Sugatani J. Decrease in transient receptor potential melastatin 6 mRNA stability caused by rapamycin in renal tubular epithelial cells. Biochim. Biophys. Acta 1808: 1502–1508, 2011.

58. Jiang L, Chen C, Yuan T, Qin Y, Hu M, Li X, Xing X, Lee X, Nie M, Chen L. Clinical severity of Gitelman syndrome determined by serum magnesium. Am. J. Nephrol. 39: 357–366, 2014.

59. Johnston BC, Mills E. n-of-1 randomized controlled trials: an opportunity for complementary and alternative medicine evaluation. J Altern Complement Med 10: 979–984, 2004.

60. Kaissling B, Bachmann S, Kriz W. Structural adaptation of the distal convoluted tubule to prolonged furosemide treatment. Am. J. Physiol. 248: F374–81, 1985.

61. Kaissling B, Kriz W. Structural analysis of the rabbit kidney. Adv Anat Embryol Cell Biol 56: 1–123, 1979.62. Kim H-Y, Gladyshev VN. Methionine sulfoxide reduction in mammals: characterization of methionine-R-sulf-

oxide reductases. Mol. Biol. Cell 15: 1055–1064, 2004.63. Knoers NVAM, Levtchenko EN. Gitelman syndrome. Orphanet J Rare Dis 3: 22, 2008.64. Ko B, Mistry AC, Hanson L, Mallick R, Cooke LL, Hack BK, Cunningham P, Hoover RS. A new model of the

distal convoluted tubule. Am. J. Physiol. Renal Physiol. 303: F700–10, 2012.65. Kolisek M, Launay P, Beck A, Sponder G, Serafini N, Brenkus M, Froschauer EM, Martens H, Fleig A,

Schweigel M. SLC41A1 is a novel mammalian Mg2+ carrier. J. Biol. Chem. 283: 16235–16247, 2008.66. Kolisek M, Nestler A, Vormann J, Schweigel-Röntgen M. Human gene SLC41A1 encodes for the Na+/Mg2+

exchanger. American Journal of Physiology - Cell Physiology 302: C318–C326, 2012.


67. Kolisek M, Sponder G, Mastrototaro L, Smorodchenko A, Launay P, Vormann J, Schweigel-Röntgen M. Substitution p.A350V in Na+/Mg2+ Exchanger SLC41A1, Potentially Associated with Parkinson’s Disease, Is a Gain-of-Function Mutation. 8: e71096, 2013.

68. Konrad M, Schaller A, Seelow D, Pandey AV, Waldegger S, Lesslauer A, Vitzthum H, Suzuki Y, Luk JM, Becker C, Schlingmann KP, Schmid M, Rodriguez-Soriano J, Ariceta G, Cano F, Enriquez R, Juppner H, Bakkaloglu SA, Hediger MA, Gallati S, Neuhauss SCF, Nurnberg P, Weber S. Mutations in the tight-junction gene claudin 19 (CLDN19) are associated with renal magnesium wasting, renal failure, and severe ocular involvement. Am. J. Hum. Genet. 79: 949–957, 2006.

69. Krapivinsky G, Krapivinsky L, Manasian Y, Clapham DE. The TRPM7 chanzyme is cleaved to release a chro-matin-modifying kinase. Cell 157: 1061–1072, 2014.

70. Lameris ALL, Hess MW, van Kruijsbergen I, Hoenderop JGJ, Bindels RJM. Omeprazole enhances the colonic expression of the Mg(2+) transporter TRPM6. Pflugers Arch - Eur J Physiol 465: 1613–1620, 2013.

71. Lee C-T, Lien Y-HH, Lai L-W, Chen J-B, Lin C-R, Chen H-C. Increased renal calcium and magnesium transporter abundance in streptozotocin-induced diabetes mellitus. Kidney Int. 69: 1786–1791, 2006.

72. Leipziger J. Luminal nucleotides are tonic inhibitors of renal tubular transport. Curr. Opin. Nephrol. Hypertens. 20: 518–522, 2011.

73. Lê KT, Babinski K, Séguéla P. Central P2X4 and P2X6 channel subunits coassemble into a novel heteromeric ATP receptor. J. Neurosci. 18: 7152–7159, 1998.

74. Li M, Du J, Jiang J, Ratzan W, Su L-T, Runnels LW, Yue L. Molecular determinants of Mg2+ and Ca2+ permeability and pH sensitivity in TRPM6 and TRPM7. J. Biol. Chem. 282: 25817–25830, 2007.

75. Li M, Jiang J, Yue L. Functional characterization of homo- and heteromeric channel kinases TRPM6 and TRPM7. J. Gen. Physiol. 127: 525–537, 2006.

76. Lindenburg LH, Vinkenborg JL, Oortwijn J, Aper SJA, Merkx M. MagFRET: the first genetically encoded fluorescent Mg2+ sensor. PLoS ONE 8: e82009, 2013.

77. Ling S, Chang X, Schultz L, Lee TK, Chaux A, Marchionni L, Netto GJ, Sidransky D, Berman DM. An EGFR-ERK-SOX9 signaling cascade links urothelial development and regeneration to cancer. Cancer Res. 71: 3812–3821, 2011.

78. Louvet L, Büchel J, Steppan S, Passlick-Deetjen J, Massy ZA. Magnesium prevents phosphate-induced calcification in human aortic vascular smooth muscle cells. Nephrol. Dial. Transplant. 28: 869–878, 2013.

79. Low SE, Amburgey K, Horstick E, Linsley J, Sprague SM, Cui WW, Zhou W, Hirata H, Saint-Amant L, Hume RI, Kuwada JY. TRPM7 is required within zebrafish sensory neurons for the activation of touch-evoked escape behaviors. J. Neurosci. 31: 11633–11644, 2011.

80. Lubarski I, Asher C, Garty H. FXYD5 (dysadherin) regulates the paracellular permeability in cultured kidney collecting duct cells. Am. J. Physiol. Renal Physiol. 301: F1270–80, 2011.

81. Mandt T, Song Y, Scharenberg AM, Sahni J. SLC41A1 Mg 2+transport is regulated via Mg 2+-dependent endosomal recycling through its N-terminal cytoplasmic domain. Biochem. J. 439: 129–139, 2011.

82. Markadieu N, San-Cristobal P, Nair AV, Verkaart S, Lenssen E, Tudpor K, van Zeeland F, Loffing J, Bindels RJM, Hoenderop JGJ. A primary culture of distal convoluted tubules expressing functional thia-zide-sensitive NaCl transport. Am. J. Physiol. Renal Physiol. 303: F886–92, 2012.

83. Meij IC, Koenderink JB, De Jong JC, De Pont JJHHM, Monnens LAH, Van Den Heuvel LPWJ, Knoers NVAM. Dominant isolated renal magnesium loss is caused by misrouting of the Na+,K+-ATPase gamma-subunit. Ann. N. Y. Acad. Sci. 986: 437–443, 2003.

84. Meij IC, Koenderink JB, van Bokhoven H, Assink KF, Groenestege WT, de Pont JJ, Bindels RJ, Monnens LA, van den Heuvel LP, Knoers NV. Dominant isolated renal magnesium loss is caused by misrouting of the Na(+),K(+)-ATPase gamma-subunit. Nat. Genet. 26: 265–266, 2000.

85. Mishra NK, Peleg Y, Cirri E, Belogus T, Lifshitz Y, Voelker DR, Apell H-J, Garty H, Karlish SJD. FXYD proteins stabilize Na,K-ATPase: amplification of specific phosphatidylserine-protein interactions. J. Biol. Chem. 286: 9699–9712, 2011.

86. Nair AV, Hocher B, Verkaart S, van Zeeland F, Pfab T, Slowinski T, Chen Y-P, Schlingmann KP, Schaller A, Gallati S, Bindels RJ, Konrad M, Hoenderop JG. Loss of insulin-induced activation of TRPM6 magnesium channels results in impaired glucose tolerance during pregnancy. Proc. Natl. Acad. Sci. U.S.A. 109: 11324–11329, 2012.

264 | Chapter 10

87. Nijenhuis T, Vallon V, van der Kemp AWCM, Loffing J, Hoenderop JGJ, Bindels RJM. Enhanced passive Ca2+ reabsorption and reduced Mg2+ channel abundance explains thiazide-induced hypocalciuria and hypomagnesemia. J Clin Invest 115: 1651–1658, 2005.

88. Nilius B, Szallasi A. Transient Receptor Potential Channels as Drug Targets: From the Science of Basic Research to the Art of Medicine. Pharmacol. Rev. 66: 676–814, 2014.

89. North RA, Surprenant A. Pharmacology of cloned P2X receptors. Annu. Rev. Pharmacol. Toxicol. 40: 563–580, 2000.

90. Olanow CW, Tatton WG. Etiology and pathogenesis of Parkinson’s disease. Annu. Rev. Neurosci. 22: 123–144, 1999.

91. Paravicini TM, Chubanov V, Gudermann T. TRPM7: a unique channel involved in magnesium homeostasis. Int. J. Biochem. Cell Biol. 44: 1381–1384, 2012.

92. Petrelli F, Borgonovo K, Cabiddu M, Ghilardi M, Barni S. Risk of anti-EGFR monoclonal antibody-related hypomagnesemia: systematic review and pooled analysis of randomized studies. Expert Opin Drug Saf 11 Suppl 1: S9–19, 2012.

93. Pham P-CT, Pham P-MT, Pham SV, Miller JM, Pham P-TT. Hypomagnesemia in patients with type 2 diabetes. Clin J Am Soc Nephrol 2: 366–373, 2007.

94. Pizzonia JH, Gesek FA, Kennedy SM, Coutermarsh BA, Bacskai BJ, Friedman PA. Immunomagnetic separation, primary culture, and characterization of cortical thick ascending limb plus distal convoluted tubule cells from mouse kidney. In Vitro Cell. Dev. Biol. 27A: 409–416, 1991.

95. Pradervand S, Zuber Mercier A, Centeno G, Bonny O, Firsov D. A comprehensive analysis of gene expression profiles in distal parts of the mouse renal tubule. Pflugers Arch - Eur J Physiol 460: 925–952, 2010.

96. Pritchett J, Athwal V, Roberts N, Hanley NA, Hanley KP. Understanding the role of SOX9 in acquired diseases: lessons from development. Trends Mol Med 17: 166–174, 2011.

97. Quamme GA, Wong NL, Sutton RA, Dirks JH. Interrelationship of chlorothiazide and parathyroid hormone: a micropuncture study. Am. J. Physiol. 229: 200–205, 1975.

98. Quamme GA. Molecular identification of ancient and modern mammalian magnesium transporters. American Journal of Physiology - Cell Physiology 298: C407–C429, 2010.

99. Reginensi A, Clarkson M, Neirijnck Y, Lu B, Ohyama T, Groves AK, Sock E, Wegner M, Costantini F, Chaboissier M-C, Schedl A. SOX9 controls epithelial branching by activating RET effector genes during kidney development. Hum. Mol. Genet. 20: 1143–1153, 2011.

100. Reilly RF, Ellison DH. Mammalian distal tubule: physiology, pathophysiology, and molecular anatomy. Physiol. Rev. 80: 277–313, 2000.

101. Renkema KY, Stokman MF, Giles RH, Knoers NVAM. Next-generation sequencing for research and diagnostics in kidney disease. Nat Rev Nephrol 10: 433–444, 2014.

102. Ribeiro N, Thuaud F, Bernard Y, Gaiddon C, Cresteil T, Hild A, Hirsch EC, Michel PP, Nebigil CG, Désaubry L. Flavaglines as potent anticancer and cytoprotective agents. J. Med. Chem. 55: 10064–10073, 2012.

103. Ribeiro N, Thuaud F, Nebigil C, Désaubry L. Recent advances in the biology and chemistry of the flavaglines. Bioorg. Med. Chem. 20: 1857–1864, 2012.

104. Ripke S, O’Dushlaine C, Chambert K, Moran JL, Kähler AK, Akterin S, Bergen SE, Collins AL, Crowley JJ, Fromer M, Kim Y, Lee SH, Magnusson PKE, Sanchez N, Stahl EA, Williams S, Wray NR, Xia K, Bettella F, Borglum AD, Bulik-Sullivan BK, Cormican P, Craddock N, de Leeuw C, Durmishi N, Gill M, Golimbet V, Hamshere ML, Holmans P, Hougaard DM, Kendler KS, Lin K, Morris DW, Mors O, Mortensen PB, Neale BM, O’Neill FA, Owen MJ, Milovancevic MP, Posthuma D, Powell J, Richards AL, Riley BP, Ruderfer D, Rujescu D, Sigurdsson E, Silagadze T, Smit AB, Stefansson H, Steinberg S, Suvisaari J, Tosato S, Verhage M, Walters JT, Multicenter Genetic Studies of Schizophrenia Consortium, Levinson DF, Gejman PV, Laurent C, Mowry BJ, O’Donovan MC, Pulver AE, Schwab SG, Wildenauer DB, Dudbridge F, Shi J, Albus M, Alexander M, Campion D, Cohen D, Dikeos D, Duan J, Eichhammer P, Godard S, Hansen M, Lerer FB, Liang K-Y, Maier W, Mallet J, Nertney DA, Nestadt G, Norton N, Papadimitriou GN, Ribble R, Sanders AR, Silverman JM, Walsh D, Williams NM, Wormley B, Psychosis Endophenotypes International Consortium, Arranz MJ, Bakker S, Bender S, Bramon E, Collier D, Crespo-Facorro B, Hall J, Iyegbe C, Jablensky A, Kahn RS, Kalaydjieva L, Lawrie S, Lewis CM, Linszen DH, Mata I, McIntosh A, Murray RM, Ophoff RA, Van Os J, Walshe M, Weisbrod M, Wiersma D, Wellcome Trust Case Control Consortium 2,


Donnelly P, Barroso I, Blackwell JM, Brown MA, Casas JP, Corvin AP, Deloukas P, Duncanson A, Jankowski J, Markus HS, Mathew CG, Palmer CNA, Plomin R, Rautanen A, Sawcer SJ, Trembath RC, Viswanathan AC, Wood NW, Spencer CCA, Band G, Bellenguez C, Freeman C, Hellenthal G, Giannoulatou E, Pirinen M, Pearson RD, Strange A, Su Z, Vukcevic D, Langford C, Hunt SE, Edkins S, Gwilliam R, Blackburn H, Bumpstead SJ, Dronov S, Gillman M, Gray E, Hammond N, Jayakumar A, McCann OT, Liddle J, Potter SC, Ravindrarajah R, Ricketts M, Tashakkori-Ghanbaria A, Waller MJ, Weston P, Widaa S, Whittaker P, McCarthy MI, Stefansson K, Scolnick E, Purcell S, McCarroll SA, Sklar P, Hultman CM, Sullivan PF. Genome-wide association analysis identifies 13 new risk loci for schizophrenia. Nat. Genet. 45: 1150–1159, 2013.

105. Rodríguez-Morán M, Guerrero-Romero F. Oral magnesium supplementation improves insulin sensitivity and metabolic control in type 2 diabetic subjects: a randomized double-blind controlled trial. Diabetes Care 26: 1147–1152, 2003.

106. Romani AMP. Cellular magnesium homeostasis. Arch. Biochem. Biophys. 512: 1–23, 2011.107. Sahni J, Nelson B, Scharenberg AM. SLC41A2 encodes a plasma-membrane Mg2+ transporter. Biochem. J.

401: 505–513, 2007.108. Sahni J, Scharenberg AM. The SLC41 family of MgtE-like magnesium transporters. Mol. Aspects Med. 34:

620–628, 2013.109. Sargenti A, Farruggia G, Malucelli E, Cappadone C, Merolle L, Marraccini C, Andreani G, Prodi L,

Zaccheroni N, Sgarzi M, Trombini C, Lombardo M, Iotti S. A novel fluorescent chemosensor allows the assessment of intracellular total magnesium in small samples. Analyst 139: 1201–1207, 2014.

110. Schizophrenia Psychiatric Genome-Wide Association Study (GWAS) Consortium. Genome-wide association study identifies five new schizophrenia loci. Nat. Genet. 43: 969–976, 2011.

111. Schlingmann KP, Weber S, Peters M, Niemann Nejsum L, Vitzthum H, Klingel K, Kratz M, Haddad E, Ristoff E, Dinour D, Syrrou M, Nielsen S, Sassen M, Waldegger S, Seyberth HW, Konrad M. Hypomagnesemia with secondary hypocalcemia is caused by mutations in TRPM6, a new member of the TRPM gene family. Nat. Genet. 31: 166–170, 2002.

112. Schmitz C, Dorovkov MV, Zhao X, Davenport BJ, Ryazanov AG, Perraud A-L. The channel kinases TRPM6 and TRPM7 are functionally nonredundant. J. Biol. Chem. 280: 37763–37771, 2005.

113. Scholl UI, Choi M, Liu T, Ramaekers VT, Häusler MG, Grimmer J, Tobe SW, Farhi A, Nelson-Williams C, Lifton RP. Seizures, sensorineural deafness, ataxia, mental retardation, and electrolyte imbalance (SeSAME syndrome) caused by mutations in KCNJ10. Proc. Natl. Acad. Sci. U.S.A. 106: 5842–5847, 2009.

114. Schrag D, Chung KY, Flombaum C, Saltz L. Cetuximab therapy and symptomatic hypomagnesemia. J. Natl. Cancer Inst. 97: 1221–1224, 2005.

115. Sha Q, Pearson W, Burcea LC, Wigfall DA, Schlesinger PH, Nichols CG, Mercer RW. Human FXYD2 G41R mutation responsible for renal hypomagnesemia behaves as an inward-rectifying cation channel. Am. J. Physiol. Renal Physiol. 295: F91–9, 2008.

116. Shoshani L, Contreras RG, Roldán ML, Moreno J, Lázaro A, Balda MS, Matter K, Cereijido M. The polarized expression of Na+,K+-ATPase in epithelia depends on the association between beta-subunits located in neighboring cells. Mol. Biol. Cell 16: 1071–1081, 2005.

117. Simon DB, Bindra RS, Mansfield TA, Nelson-Williams C, Mendonca E, Stone R, Schurman S, Nayir A, Alpay H, Bakkaloglu A, Rodriguez-Soriano J, Morales JM, Sanjad SA, Taylor CM, Pilz D, Brem A, Trachtman H, Griswold W, Richard GA, John E, Lifton RP. Mutations in the chloride channel gene, CLCNKB, cause Bartter’s syndrome type III. Nat. Genet. 17: 171–178, 1997.

118. Simon DB, Karet FE, Hamdan JM, DiPietro A, Sanjad SA, Lifton RP. Bartter’s syndrome, hypokalaemic alkalosis with hypercalciuria, is caused by mutations in the Na-K-2Cl cotransporter NKCC2. Nat. Genet. 13: 183–188, 1996.

119. Simon DB, Karet FE, Rodriguez-Soriano J, Hamdan JH, DiPietro A, Trachtman H, Sanjad SA, Lifton RP. Genetic heterogeneity of Bartter’s syndrome revealed by mutations in the K+ channel, ROMK. Nat. Genet. 14: 152–156, 1996.

120. Simon DB, Lu Y, Choate KA, Velazquez H, Al-Sabban E, Praga M, Casari G, Bettinelli A, Colussi G, Rodri-guez-Soriano J, McCredie D, Milford D, Sanjad S, Lifton RP. Paracellin-1, a renal tight junction protein required for paracellular Mg2+ resorption. Science 285: 103–106, 1999.

266 | Chapter 10

121. Simon DB, Nelson-Williams C, Bia MJ, Ellison D, Karet FE, Molina AM, Vaara I, Iwata F, Cushner HM, Koolen M, Gainza FJ, Gitelman HJ, Lifton RP. Gitelman“s variant of Barter”s syndrome, inherited hypokalaemic alkalosis, is caused by mutations in the thiazide-sensitive Na|[ndash]|Cl cotransporter. Nat. Genet. 12: 24–30, 1996.

122. Simón-Sánchez J, Schulte C, Bras JM, Sharma M, Gibbs JR, Berg D, Paisan-Ruiz C, Lichtner P, Scholz SW, Hernandez DG, Krüger R, Federoff M, Klein C, Goate A, Perlmutter J, Bonin M, Nalls MA, Illig T, Gieger C, Houlden H, Steffens M, Okun MS, Racette BA, Cookson MR, Foote KD, Fernandez HH, Traynor BJ, Schreiber S, Arepalli S, Zonozi R, Gwinn K, van der Brug M, Lopez G, Chanock SJ, Schatzkin A, Park Y, Hollenbeck A, Gao J, Huang X, Wood NW, Lorenz D, Deuschl G, Chen H, Riess O, Hardy JA, Singleton AB, Gasser T. Genome-wide association study reveals genetic risk underlying Parkinson’s disease. Nat. Genet. 41: 1308–1312, 2009.

123. Sponder G, Svidova S, Schweigel M, Vormann J, Kolisek M. Splice-variant 1 of the ancient domain protein 2 (ACDP2) complements the magnesium-deficient growth phenotype of Salmonella enterica sv. typhimurium strain MM281. Magnes Res 23: 105–114, 2010.

124. Stuiver M, Lainez S, Will C, Terryn S, Günzel D, Debaix H, Sommer K, Kopplin K, Thumfart J, Kampik NB, Querfeld U, Willnow TE, Němec V, Wagner CA, Hoenderop JG, Devuyst O, Knoers NVAM, Bindels RJ, Meij IC, Müller D. CNNM2, encoding a basolateral protein required for renal Mg2+ handling, is mutated in dominant hypomagnesemia. Am. J. Hum. Genet. 88: 333–343, 2011.

125. Subramanya AR, Ellison DH. Distal Convoluted Tubule. Clin J Am Soc Nephrol (May 22, 2014). doi: 10.2215/CJN.05920613.

126. Thébault S, Alexander RT, Tiel Groenestege WM, Hoenderop JG, Bindels RJ. EGF increases TRPM6 activity and surface expression. J. Am. Soc. Nephrol. 20: 78–85, 2009.

127. Thébault S, Cao G, Venselaar H, Xi Q, Bindels RJM, Hoenderop JGJ. Role of the alpha-kinase domain in transient receptor potential melastatin 6 channel and regulation by intracellular ATP. J. Biol. Chem. 283: 19999–20007, 2008.

128. Thuaud F, Ribeiro N, Nebigil CG, Désaubry L. Prohibitin ligands in cell death and survival: mode of action and therapeutic potential. Chem. Biol. 20: 316–331, 2013.

129. Tong GM, Rude RK. Magnesium deficiency in critical illness. J Intensive Care Med 20: 3–17, 2005.130. Topf JM, Murray PT. Hypomagnesemia and hypermagnesemia. Rev Endocr Metab Disord 4: 195–206, 2003.131. Torres GE, Egan TM, Voigt MM. Hetero-oligomeric assembly of P2X receptor subunits. Specificities exist with

regard to possible partners. J. Biol. Chem. 274: 6653–6659, 1999.132. Turgut F, Kanbay M, Metin MR, Uz E, Akcay A, Covic A. Magnesium supplementation helps to improve

carotid intima media thickness in patients on hemodialysis. Int Urol Nephrol 40: 1075–1082, 2008.133. van Angelen AA, San-Cristobal P, Pulskens WP, Hoenderop JG, Bindels RJ. The impact of dietary

magnesium restriction on magnesiotropic and calciotropic genes. Nephrol. Dial. Transplant. 28: 2983–2993, 2013.134. van Angelen AA, van der Kemp AW, Hoenderop JG, Bindels RJ. Increased expression of renal TRPM6

compensates for Mg2+ wasting during furosemide treatment. Clin kidney j 5: 535–544, 2012.135. van der Wijst J, Hoenderop JGJ, Bindels RJM. Epithelial Mg2+ channel TRPM6: insight into the molecular

regulation. Magnesium Research 22: 127–132, 2009.136. Van Laecke S, Nagler EV, Verbeke F, Van Biesen W, Vanholder R. Hypomagnesemia and the risk of death

and GFR decline in chronic kidney disease. Am. J. Med. 126: 825–831, 2013.137. Van Landeghem L, Santoro MA, Krebs AE, Mah AT, Dehmer JJ, Gracz AD, Scull BP, McNaughton K,

Magness ST, Lund PK. Activation of two distinct Sox9-EGFP-expressing intestinal stem cell populations during crypt regeneration after irradiation. American Journal of Physiology - Gastrointestinal and Liver Physiology 302: G1111–G1132, 2012.


139. Wabakken T, Rian E, Kveine M, Aasheim H-C. The human solute carrier SLC41A1 belongs to a novel eukaryotic subfamily with homology to prokaryotic MgtE Mg2+ transporters. Biochem. Biophys. Res. Commun. 306: 718–724, 2003.


140. Walder RY, Landau D, Meyer P, Shalev H, Tsolia M, Borochowitz Z, Boettger MB, Beck GE, Englehardt RK, Carmi R, Sheffield VC. Mutation of TRPM6 causes familial hypomagnesemia with secondary hypocalcemia. Nat. Genet. 31: 171–174, 2002.

141. White JR, Campbell RK. Magnesium and diabetes: a review. American journal of pharmacotherapy 27: 775–780, 1993.

142. Wildman SS, Marks J, Churchill LJ, Peppiatt CM, Chraibi A, Shirley DG, Horisberger J-D, King BF, Unwin RJ. Regulatory interdependence of cloned epithelial Na+ channels and P2X receptors. J. Am. Soc. Nephrol. 16: 2586–2597, 2005.

143. Wilkinson P, Sengerova J, Matteoni R, Chen C-K, Soulat G, Ureta-Vidal A, Fessele S, Hagn M, Massimi M, Pickford K, Butler RH, Marschall S, Mallon A-M, Pickard A, Raspa M, Scavizzi F, Fray M, Larrigaldie V, Leyritz J, Birney E, Tocchini-Valentini GP, Brown S, Herault Y, Montoliu L, de Angelis MH, Smedley D. EMMA--mouse mutant resources for the international scientific community. Nucl. Acids Res. 38: D570–6, 2010.

144. Wright FS. Increasing magnitude of electrical potential along the renal distal tubule. Am. J. Physiol. 220: 624–638, 1971.

145. Wright PA, Burg MB, Knepper MA. Microdissection of kidney tubule segments. Meth. Enzymol. 191: 226–231, 1990.

146. Yasui M, Kihira T, Ota K. Calcium, magnesium and aluminum concentrations in Parkinson’s disease. Neurotox-icology 13: 593–600, 1992.

147. Zhai X-Y, Thomsen JS, Birn H, Kristoffersen IB, Andreasen A, Christensen EI. Three-dimensional reconstruction of the mouse nephron. J. Am. Soc. Nephrol. 17: 77–88, 2006.

148. Zhang N, Ren X, Zhu D, Li D, Wang D. Crystallization and preliminary crystallographic studies of CorC, a magnesium-ion transporter. Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 66: 681–683, 2010.

149. Zhang Z, Yu H, Huang J, Faouzi M, Schmitz C, Penner R, Fleig A. The TRPM6 kinase domain determines the Mg·ATP sensitivity of TRPM7/M6 heteromeric ion channels. J. Biol. Chem. 289: 5217–5227, 2014.

Summary | 271

Magnesium HomeostasisMagnesium (Mg2+) is an essential cofactor for more than 600 enzymes, a potent Ca2+ antagonist and anti-inflammatory agent. Therefore, Mg2+ plays an important role in virtually every cell in the human body. In brain, Mg2+ regulates the activity of the NMDA receptor. As a consequence, reduced serum Mg2+ levels cause hyperexcitability of the neurons and are associated with epilepsy, migraine, depression and traumatic brain injury. In heart, Mg2+ determines cardiac contractibility by antagonizing Ca2+ and as a result Mg2+ disturbances may result in cardiac arrhythmias. In muscle, low plasma Mg2+ levels result in hypercontract-ibility of the muscles and therefore cause muscle cramps or spasms. Blood Mg2+ levels are maintained between 0.7 and 1.1 mmol/L by the tightly controlled balance between intestinal uptake, storage in bone and renal excretion. In the intestine, Mg2+ is passively paracellularly reabsorbed in the small intestine. Fine-tuning takes place by active transcellular reabsorption in the colon, where Mg2+ is absorbed apically via TRPM6 and TRPM7 Mg2+ channels and extruded via the CNNM4 Na+-Mg2+-exchanger. In the kidney, Mg2+ is filtered in the glomerulus and reabsorbed along the kidney tubule in a similar fashion. First, bulk Mg2+ is reabsorbed paracellularly in the proximal tubule and thick ascending limb of Henle’s loop. Second, fine-tuning is achieved in the distal convoluted tubule (DCT) where Mg2+ is reabsorbed transcellularly. Here, apical uptake from the pro-urine is facilitated by TRPM6 Mg2+ channels. The molecular identity of the basolateral extrusion mechanism is still unknown. Over the last decade, genetic diseases have helped to identify the molecular players in DCT Mg2+ transport. Disturbances in Mg2+ reabsorption in the DCT inevitably result in renal Mg2+ wasting, since no reabsorption of Mg2+ takes place beyond the DCT. However, several players in Mg2+ transport, including the basolateral extrusion mechanism, remain to be identified. Therefore, this thesis aimed to identify and characterize new proteins in epithelial Mg2+ transport to extend our understanding of Mg2+ reabsorption in the DCT.

Identification of New Magnesiotropic Genes in the DCTTo identify novel genes that are involved in DCT, mice expressing GFP only in DCT were fed with low or high Mg2+ diets. The GFP expression allowed isolation of DCT cells by COPAS sorting. The gene expression of low vs. high Mg2+ diet fed mice was compared using microarrays. In chapter 2, four new candidate genes were identified to be involved in DCT Mg2+ transport. SLC41A3, PCBD1, TBC1D4 and uromodulin expression were increased in the low Mg2+ diet fed mice. Mutations in PCBD1 were previously linked transient neonatal primapterinuria. In chapter 3, we describe that these patients also suffer from hypomagnesemia due to renal Mg2+ wasting and MODY5-like diabetes. These clinical findings could be explained at the molecular level by the role of PCBD1 as tran-scriptional co-activator of HNF1B. Interestingly, the symptoms of HNF1B patients also include hypomagnesemia and MODY5. By luciferase assays, it was shown that PCBD1 increased HNF1B-induced FXYD2 transcription with 50 %. Indeed, mutant PCBD1 proteins were not capable to increase FXYD2 transcription.

272 | Chapter 11

Although the exact role of FXYD2 in Mg2+ transport remains elusive, it is known that FXYD2 regulates the Na+-K+-ATPase activity. The Na+-K+-ATPase is essential for Mg2+ transport in the DCT, since it sets the membrane potential that provides the driving force for apical Mg2+ uptake. In chapter 4, two new families with mutations in the FXYD2 gene were reported. This is the first account of FXYD2 mutations since the initial identification of FXYD2 mutations more than 10 years ago, unequivocally confirming the importance of FXYD2 in renal Mg2+ homeostasis. Interestingly, the new patients carry the same p.Gly41Arg mutation that was described in the original study. Haplotype analysis revealed an overlapping haplotype in all families, suggesting a founder effect. However, genealogy studies did not identify a common ancestor until 1700. Given that no other FXYD2 mutations have been reported to date, this may suggest that other FXYD2 mutations are embryonic lethal. The exact role of FXYD2 at the basolateral membrane of the DCT cell needs further investigation. In chapter 5, SLC41A3, which was also identified in the microarray study (chapter 2), was further characterized. Recent studies with SLC41A1, a close homologue of SLC41A3, showed that SLC41A1 functions as a Na+/Mg2+ exchanger. Therefore, SLC41A3 may function as the Mg2+ extrusion mechanism at the basolateral membrane of the DCT cell. To understand its role in Mg2+ homeostasis, SLC41A3 knockout mice were examined for blood en urine electrolyte concentrations. Interestingly, SLC41A3 knockout mice had lower serum Mg2+ levels than wild type littermates, but showed similar urinary Mg2+ excretion levels suggesting a renal Mg2+ leak. Using the stable 25Mg2+ isotope, it was shown that intestinal Mg2+ absorption is not altered in SLC41A3 knockout mice. Strikingly, hydronephrosis was detected in 10 % of the SLC41A3 knockout mice fed with a Mg2+-deficient diet. Taken together, our data suggest that SLC41A3 is essential for DCT Mg2+ reabsorption.

Characterization of the Structure and Function of CNNM2Recently, mutations in CNNM2 were shown to cause hypomagnesemia and seizures in two families with a dominant inheritance pattern. As SLC41A3 and FXYD2, CNNM2 is expressed at the basolateral membrane of the DCT cells. However, the exact function of CNNM2 remains to be identified. Although initial studies in Xenopus laevis oocytes suggested that CNNM2 operates as a Mg2+ transporter, these results could not be reproduced in mammalian cells. In chapter 6, the structure and regulation of CNNM2 was examined in detail. By immunocytochemistry, CNNM2 was shown to contain three membrane-spanning domains with an extracellular NH2-terminus and intracellular COOH- terminus. The NH2-terminus is glycosylated at position p.Asn112. Cell surface biotinylation studies showed that this residue is essential for normal plasma membrane expression of the CNNM2 protein. A homology model of the CBS domains in the COOH-terminus of CNNM2, identified a Mg-ATP binding site. Importantly, the model predicted that Mg-ATP binding is lost by the p.Thr568Ile mutation that was identified in the patient families.

Summary | 273

These findings resulted in the hypothesis that CNNM2 may function as a Mg2+-sensing mechanism rather than a Mg2+ transporter. In chapter 7, this hypothesis was tested using the stable 25Mg2+ isotope. HEK293 cells overexpressing CNNM2 exhibited higher 25Mg2+ uptake than mock-transfected cells. Interestingly, cells expressing mutated CNNM2 proteins did not display this stimulatory effect. The 25Mg2+ uptake was completely inhibited by the TRPM7 inhibitor 2APB, suggesting that CNNM2 may regulate TRPM7 activity. These findings were further examined in the zebrafish knockdown model. Using translation-blocking morpholinos, cnnm2 knockdown larvae were generated showing a decreased total Mg2+ content. Additionally, cnnm2 knockdown zebrafish suffered from a severely impaired brain development, increased embryonic spontaneous contractions and weak touch-evoked escape behaviour. Indeed, the weak touch-evoked escape behaviour is a characteristic of the trpm7 mutant zebrafish, further establishing the link between CNNM2 and TRPM7 function. Importantly, five new families were identified with CNNM2 mutations. All the affected family members reported hypomagnesemia, seizures, but for the first time also mental retardation. Thus, CNNM2 is an essential gene for Mg2+ homeostasis and normal brain development. Future studies should be aimed to elucidate the role of CNNM2 in the regulation of TRPM7 and other Mg2+ transporters.

New Regulatory Pathways of TRPM6 FunctionThe last part of this thesis was dedicated to new pathways involved in the regulation of TRPM6 activity. TRPM6 subunits form tetrameric structures comprising six transmembrane segments, with a central divalent-selective pore and a Ser/Thr-kinase fused to its COOH-terminus. The epithelial Mg2+ channels TRPM6 provide the apical uptake of Mg2+ from the pro-urine into the DCT cell. Mutations in TRPM6 cause hypomagnesemia with secondary hypocalcemia and two SNPs in TRPM6 were associated with increased risk for diabetes mellitus. Over the last decade, several important regulatory factors of TRPM6 were identified. EGF increases TRPM6 activity and plasma membrane expression and therefore patients using EGFR inhibitors often suffer from hypomagnesemia. In a similar fashion, TRPM6 can be activated by insulin. In chapter 8, extracellular ATP was shown to inhibit TRPM6 activity via the action of P2X4 purinergic receptors. P2X receptors form ATP-activated ion channels that transport cations into the cell. By RT-PCR, it was shown that P2X4 and P2X6 were specifically expressed in DCT and colon. Using whole-cell patch clamp, an inhibitory role of P2X4, but not of P2X6, on TRPM6 activity was demonstrated. The inhibition was dependent on the activity of P2X4, since a P2X4 mutant with reduced function did not inhibit TRPM6 activity. The inhibition was highly specific for TRPM6, since P2X4 was unable to inhibit TRPM7. The mechanism by which increased Na+ or Ca2+ influx via P2X4 can inhibit TRPM6 remains to be identified. The PKA, PKC and PI3K kinases were not involved in this process.

274 | Chapter 11

In chapter 9, flavaglines were studied as a new class of compounds activating TRPM6. Flavaglines belong to a family of natural compounds characterized by a cyclopenta[b]

benzofuran structure that binds to prohibitins. Previous studies have shown that prohibitin2 is capable to bind TRPM6 and can inhibit its activity. By whole-cell patch clamp, a stimulating role of FL3 and FL23, two flavaglines characterized by a bromine group at position 4’, on TRPM6 function was determined. Activation of TRPM6 is not dependent on its kinase activity, but requires the presence of the kinase domain. Moreover, HEK293 cells expressing the insulin-insensitive SNPs of TRPM6 do not respond to flavaglines. Given that flavagline-induced stimulation of TRPM6 activity provides great therapeutic potential for hypomagnesemia patients, in vivo effects were tested by the injection of flavaglines in mice. However, low doses of FL3 did not lead to significant changes in ion homeostasis over the time course of the 7 days trial. Further optimization of the quantity and bioavailability of flavaglines in the DCT may be necessary to observe significant effects in vivo.

The Art of Magnesium Transport: A Clinical PerspectiveThis thesis extended our knowledge on DCT Mg2+ transport. DCT cells are highly specialized cells that are characterized by basolateral invaginations and high amounts of mitochondria. They determine the final urinary Mg2+ excretion. By COPAS sorting of distal convoluted tubule cells, a new high efficiency and high quality alternative for micro-dissection was established that can be used for future DCT studies. TRPM6 mediates apical Mg2+ entry in the DCT and is regulated by EGF, insulin and pH. The identification of P2X4 purinergic receptors and flavagline compounds as new regulators of TRPM6 activity, provides novel pathways to target in the development of therapeutics to rescue Mg2+ disturbances. SOX9 and PCBD1 were identified as new transcriptional regulators of Mg2+ transport in the DCT. As a result, patients with PCBD1 can now be treated with Mg2+

supplements and sulfonylureas to improve their hypomagnesemia and MODY5-like diabetes, respectively. The molecular mechanism of basolateral Mg2+ extrusion remains elusive. The studies presented in this thesis, suggest that SLC41A3 may act as Mg2+ extrusion mechanism. CNNM2 may provide an Mg2+-sensing mechanism that regulates DCT Mg2+ transport. However, further studies are necessary to understand and connect all the molecular entities at the basolateral membrane. In a small but well-studied group of hypomagnesemia patients the disturbed blood Mg2+ levels could be attributed to a genetic defect. In the last years many causative genes have been identified, but there are still patients awaiting a molecular diagnosis. Recent technical advances in DNA sequencing techniques allow screening for mutations at a genome-wide scale. Although this will provide important insight in genetic orders of Mg2+ homeostasis, further development of bioinformatical techniques are necessary to deal with the enormous amount of data that are currently generated.

Summary | 275

In addition to the role of Mg2+ in the small group of genetic patients, there is increasing awareness for the important effects of Mg2+ in common diseases. Strong evidence is now available that the use of certain types of drugs, including proton pump inhibitors, EGFR antagonists and diuretics may cause hypomagnesemia. Nevertheless, Mg2+ measurements are still not standard in the clinic. Future studies should be directed to understand the function of Mg2+ in common diseases such as diabetes mellitus and chronic kidney diseases. Previous studies have evidenced a worse outcome of patients with these diseases when additionally suffering from hypomagnesemia. Only by further establishing the importance of Mg2+ in health and disease, the clinical attention for Mg2+

deficits will rise. Combined efforts of clinicians, geneticists, and researchers are continuously necessary to improve patient care of hypomagnesemia patients and increase our understanding of Mg2+ homeostasis.

Samenvatting | 279

Magnesium in het Menselijke LichaamMagnesium (Mg2+) speelt een belangrijke rol in vrijwel iedere cel in het menselijk lichaam. Op celniveau is Mg2+ essentieel voor de goede werking van enzymen en als ontstekings-remmer. Bovendien vervult Mg2+ vaak tegengestelde functies aan calcium (Ca2+), daarom moet de balans tussen Ca2+ en Mg2+ in de cel goed moet worden geregeld. In de hersenen beïnvloedt Mg2+ de werking van de NMDA receptor. Daardoor ontstaat bij een Mg2+ tekort een overactiviteit van neuronen die kan leiden tot epilepsie, migraine, depressie en hersentrauma’s. In het hart functioneert Mg2+ als Ca2+ antagonist en is daarmee erg essentieel voor een goede samentrekking van de hartspier. Mg2+ tekorten leiden om deze reden tot hartritmestoornissen. Lage Mg2+ waarden in de spieren kunnen zorgen voor spierkrampen of spasmes. De gebalanceerde samenwerking tussen de darmen, die Mg2+ opnemen, de botten, die Mg2+ opslaan, en de nieren, die Mg2+ uitscheiden, zorgt ervoor dat de Mg2+ bloedwaarden constant blijven tussen 0.7 en 1.1 mmol/L. In de dunne darm wordt Mg2+ opgenomen tussen de cellen door (paracellulair). De optimale afstemming van Mg2+ opname vindt vervolgens plaats in de dikke darm door Mg2+ door de cellen heen te transporteren (transcellulair). In de dikke darm wordt Mg2+ vanuit de darmholte (apicaal) opgenomen in de cel via TRPM6 en TRPM7 Mg2+ kanalen, en aan de bloedzijde (basolateraal) weer uitgescheiden via de CNNM4 Na+-Mg2+-uitwisselaar. In de nier wordt het bloed gefiltreerd in de glomerulus en hierdoor komt Mg2+ terecht in de pro-urine in de nierbuis. Op eenzelfde wijze als in de darm wordt Mg2+ vervolgens in twee stappen weer opgenomen uit de pro-urine. Eerst wordt de overgrote meerderheid van het Mg2+ paracellulair geresorbeerd in de proximale tubulus en het stijgende deel van de lis van Henle. Vervolgens vindt de afstemming van de definitieve Mg2+ uitscheiding plaats in het distaal convoluut (DCT) waar Mg2+ transcellulair wordt opgenomen. In het DCT neemt het TRPM6 Mg2+ kanaal Mg2+ apicaal op vanuit de pro-urine. De wijze waarop Mg2+ basolateraal wordt uitgescheiden naar het bloed moet nog geïdentificeerd worden. Het afgelopen decennium is door onderzoek naar patiënten met genetische vormen van Mg2+ tekorten (hypomagnesemie) de identiteit van de belangrijkste transporteiwitten in het DCT bekend geworden. Verstoringen van Mg2+ opname in het DCT leiden onvermijdelijk tot het verlies van Mg2+ via de urine, omdat er na dit segment geen Mg2+ meer kan worden geresorbeerd vanuit de nierbuis naar het bloed. Ondanks de recente vooruitgang zijn nog steeds niet alle Mg2+ transporterende eiwitten in het DCT, zoals het bovengenoemde basolaterale efflux mechanisme, bekend. Het doel van dit proefschrift was derhalve het identificeren en karakteriseren van nieuwe moleculaire spelers die deelnemen aan het Mg2+ transport in het DCT.

Identificatie van Nieuwe Genen die de Mg2+ Balans Beïnvloeden in het DCTAllereerst was het zaak om nieuwe genen te identificeren die betrokken zijn bij het Mg2+ transport in het DCT. Hiertoe werden muizen die een groen fluorescent eiwit (GFP) tot

280 | Chapter 12

expressie brengen in het DCT op een Mg2+ dieet geplaatst. De GFP expressie maakte het mogelijk om specifiek DCT cellen te isoleren en met behulp van microarrays konden genen worden aangetoond die ten gevolge van het Mg2+ dieet werden gereguleerd. In hoofdstuk 2 wordt aangetoond dat de mRNA expressie van Mg2+ transporter SLC41A3, transcriptieregulator PCBD1, insuline-signaaleiwit TBC1D4, en urine eiwit uromoduline was verhoogd in de DCT cellen van muizen die het laag Mg2+ dieet werd gevoerd. Mutaties in PCBD1 veroorzaken transiënte neonatale primapeterinurie. In hoofdstuk 3 wordt beschreven dat de patiënten met PCBD1 mutaties ook lijden aan een hypomagnesemie en MODY5-achtige diabetes. Deze symptomen leken erg op het ziektebeeld van patiënten met HNF1B mutaties, want ook zij presenteren zich met hypomagnesemie en een MODY5-type diabetes. HNF1B reguleert de mRNA expressie van FXYD2, een eiwit dat hypomagnesemie kan veroorzaken. Met behulp van bepalingen van de promotoractiviteit werd aangetoond dat PCBD1 de FXYD2 transcriptie verhoogt met 50 %, als HNF1B ook aanwezig is. Gemuteerde PCBD1 eiwitten hadden geen stimulerend effect op de FXYD2 transcriptie. Hoewel de exacte rol van FXYD2 bij Mg2+ transport in het DCT nog niet is opgehelderd, is het bekend dat FXYD2 de activiteit van het Na+-K+-ATPase reguleert. Het Na+-K+-ATPase is essentieel voor het Mg2+ transport in het DCT, omdat het een gunstige membraanpo-tentiaal opbouwt die de drijvende kracht levert voor de apicale Mg2+ opname. In hoofdstuk 4 worden twee nieuwe families met mutaties in het FXYD2 gen beschreven. Deze personen lijden aan hypomagnesemie en de gevolgen hiervan, die bestaan uit epilepsie en kraakbeenverkalking (chondrocalcinose). Dit is de eerste beschrijving van patiënten met FXYD2 mutaties sinds de identificatie van de hypomagnesemie patiënten met deze mutaties in 2000. Hierdoor wordt het belang van FXYD2 voor de Mg2+ huishouding ontegenzeggelijk vergroot en bevestigd. De nieuwe patiënten hebben dezelfde p.Gly41Arg mutatie als de patiënten die werd beschreven in 2000. Erfelijkheid-sonderzoek bevestigde hetzelfde haplotype in deze patiënten, waardoor het mogelijk is dat ze een gemeenschappelijke voorouder hebben. Genealogiestudies die teruggaan tot het jaar 1700 konden deze gemeenschappelijke voorouder echter niet identificeren. Omdat er buiten de p.Gly41Arg mutatie geen andere FXYD2 mutaties zijn gemeld, zou gesuggereerd kunnen worden dat andere FXYD2 mutaties in een vroeg embryonaal stadium lethaal zijn. Ondanks de nieuwe bevindingen zijn er aanvullende studies vereist om de exacte functie van het FXYD2 eiwit op de basolaterale membraan te begrijpen. In hoofdstuk 5 wordt het eerdergenoemde SLC41A3 gen, dat verhoogd tot expressie kwam in muizen op een laag Mg2+ dieet, verder gekarakteriseerd. Recente studies gericht op SLC41A1, een homoloog eiwit aan SLC41A3, tonen aan dat SLC41A1 functioneert als een Na+-Mg2+-uitwisselaar. In tegenstelling tot SLC41A1 komt SLC41A3 sterk verhoogd tot expressie in het DCT. Als het eiwit daar dezelfde functie heeft als SLC41A1, zou SLC41A3 een onderdeel kunnen zijn van het efflux mechanisme op de basolaterale membraan van de DCT cel. Om de rol van SLC41A3 in de Mg2+ huishouding te onderzoeken, werden

Samenvatting | 281

SLC41A3 knock-outmuizen onderzocht op de Mg2+ concentraties in het bloed en in de urine. Hieruit bleek dat de SLC41A3 knock-outmuizen een lagere bloed Mg2+ waarde hadden dan controle muizen uit hetzelfde nest. De SLC41A3 controle en knock-outmui-zen hadden wel een vergelijkbare Mg2+ uitscheiding in de urine. Dit duidt op een verstoring van het Mg2+ transport in de nier. Door gebruik te maken van het stabiele 25Mg2+ isotoop werd vervolgens vastgesteld hoeveel 25Mg2+ in het bloed terecht kwam na toediening in de maag. Hierdoor kon worden aangetoond dat de Mg2+ absorptie in de darm niet verlaagd was in de SLC41A3 knock-outmuizen. Een interessante bevinding was de aanwezigheid van een waternier (hydronefrose) in de linkernier van enkele SLC41A3 knock-outmuizen die een laag Mg2+ dieet werd gevoerd. Tezamen suggereren deze resultaten dat SLC41A3 essentieel is voor Mg2+ reabsorptie in het DCT.

Bepaling van de Structuur en de Functie van CNNM2Recent werd aangetoond dat mutaties in het CNNM2 gen hypomagnesemie en epilepsie veroorzaken, zoals vastgesteld in twee families met een dominante overerving. Net als FXYD2 en SLC41A3 komt CNNM2 tot expressie op de basolaterale membraan van de DCT cel. De precieze functie van CNNM2 is nog niet bekend. Hoewel initiële studies met Xenopus laevis oocyten aantonen dat CNNM2 functioneert als een Mg2+ transporteur, konden deze resultaten niet worden gereproduceerd in zoogdiercellen. In hoofdstuk 6 wordt de structuur en de regulatie van CNNM2 uitgebreid onderzocht. Door CNNM2 aan te kleuren op de plasmamembraan konden we laten zien dat CNNM2 drie transmembraan domeinen bezit met daarbij een extracellulaire NH2-terminus en een intracellulaire COOH-terminus. De NH2-terminus bevat een suikergroep op de positie p.Asn112. Door de CNNM2 van een label te voorzien op de plasmamembraan werd bewezen dat deze suikergroep essentieel is voor een correct transport van CNNM2 naar de plasmamembraan. Met behulp van een computer homologiemodel gebaseerd op de structuur van de bacteriële Mg2+ transporteur CorC, die veel verwantschap heeft met CNNM2, werd een Mg-ATP bindingsplek in de CBS domeinen van de COOH-terminus aangetoond. Volgens dit model zou de p.Thr568Ile mutatie, die werd gevonden in de patiënten, de binding van Mg-ATP op deze specifieke positie onmogelijk maken. Deze resultaten suggereren dat CNNM2 waarschijnlijk fungeert als een Mg2+-sensing mechanisme in plaats van als een Mg2+ transporteur. In hoofdstuk 7 wordt deze hypothese verder getest met behulp van het stabiele 25Mg2+ isotoop. De HEK293 cellen waarin CNNM2 tot overexpressie werd gebracht, hadden een verhoogde 25Mg2+ opname in vergelijking met controlecellen. De cellen die gemuteerde CNNM2 eiwitten tot expressie brachten, lieten geen verhoging van de 25Mg2+ opname zien. De 25Mg2+ opname werd volledig geremd door de TRPM7-remmer 2APB te gebruiken. Hieruit zou men kunnen opmaken dat CNNM2 de activiteit van TRPM7 reguleert. Met behulp van morpholino’s, die de eiwitproductie van CNNM2 blokkeerden, konden CNNM2 knock-down zebravislarven worden gegenereerd. Zebravissen waarin de

282 | Chapter 12

CNNM2 expressie werd onderdrukt, toonden een verlaagd Mg2+ gehalte. Bovendien leden de CNNM2 knock-down zebravissen aan een ernstig verstoorde hersenontwikkeling, een verhoogd aantal embryonische spontane contracties en een verminderd vluchtgedrag na aanraking. Juist dit verminderde vluchtgedrag werd eerder waargenomen in TRPM7 zebravismutanten. In hoofdstuk 7 werden vijf nieuwe families met CNNM2 mutaties geïdentificeerd. Opnieuw hadden de patiënten last van hypomagnesemie en epilepsie, maar nu werd ook een mentale retardatie aangetoond in alle patiënten. Hieruit werd opgemaakt dat CNNM2 essentieel is voor de Mg2+ huishouding en de hersenontwikkeling. Toekomstige studies zijn noodzakelijk om de rol van CNNM2 in de regulatie van TRPM7 en van andere Mg2+ transporteurs te begrijpen.

Nieuwe Regulatiemechanismen van TRPM6 ActiviteitHet laatste deel van dit proefschrift wordt gewijd aan de beschrijving van twee nieuwe regulatiemechanismen voor de functie van het Mg2+ kanaal TRPM6. Mutaties in TRPM6 veroorzaken hypomagnesemie met secundaire hypocalcemie. Daarnaast zijn twee amino-zuurvariaties in TRPM6 geassocieerd met een verhoogd risico op diabetes mellitus. TRPM6 kanalen zijn opgebouwd uit vier subunits die elk bestaan uit zes transmembraan segmenten en een Ser/Thr-kinase in de COOH-terminus. In de DCT cel zorgen TRPM6 Mg2+ kanalen ervoor dat Mg2+ wordt opgenomen vanuit de pro-urine in de DCT cel. De afgelopen jaren zijn enkele belangrijke regulatiefactoren voor de functie van TRPM6 geïdentificeerd. Zo verhoogt de epidermale groeifactor EGF de activiteit van TRPM6 en stimuleert het de hoeveelheid van TRPM6 kanalen op de plasmamembraan. Dit is ook de reden dat veel patiënten die remmers gebruiken van de EGF receptor vaak last hebben van hypo-magnesemie. Op eenzelfde wijze kan TRPM6 geactiveerd worden door insuline. In hoofdstuk 8 werd aangetoond dat ATP een remmende werking heeft op TRPM6 activiteit via een activering van de P2X4 receptoren. P2X receptoren zijn ATP-geactiveerde ionkanalen die positiefgeladen ionen de cel in transporteren. Met RT-PCR werd bewezen dat P2X4 en P2X6 verhoogd tot expressie komen in het DCT en in de dikke darm waar Mg2+ resorptie plaatsvindt. Activering van de P2X4 receptor leidde tot een verminderde activiteit van TRPM6, zo bleek uit patch clamp analyse. P2X6 activering had geen remmende werking op TRPM6 activiteit. Deze remming was afhankelijk van P2X4 activiteit, want een P2X4 eiwit met een verminderde functie had geen effect op TRPM6 activiteit. De effecten waren zeer specifiek voor TRPM6, want TRPM7 werd niet geremd door P2X4. Het mechanisme waarmee een verhoogde Na+ of Ca2+ opname via P2X4 de activiteit van TRPM6 reduceert is nog onbekend. De kinases PKA, PKC en PI3K waren niet betrokken bij dit proces. In hoofdstuk 9 werden flavaglines beschreven als een nieuwe groep van stoffen die de TRPM6 activiteit kan stimuleren. Flavaglines behoren tot een familie van natuurlijke stoffen die zijn opgebouwd uit een chemische cyclopento[b]benzofuraan structuur die bindt aan prohibitines. Eerdere studies hebben aangetoond dat prohibitine2 een interactie aangaat met TRPM6 waardoor de activiteit is verminderd. Met behulp van patch clamp

Samenvatting | 283

analyse werd een stimulerende werking van FL3 en FL23, twee flavaglines met een bromide groep op positie 4’, gemeten op TRPM6 activiteit. De activering was niet afhankelijk van de kinasefunctie van TRPM6, maar wel van de aanwezigheid van het kinase domein. Bovendien reageerden HEK293 cellen die de insuline-ongevoelige TRPM6 varianten tot expressie brachten, niet op de flavagline activatie. Aangezien de flavaglines de Mg2+ opname verhogen, zouden ze kunnen dienen als een manier om hypomagnesemie patiënten te behandelen. Daarom werden de effecten van de flavaglines vervolgens getest in muizen. Injectie van een lage dosis FL3 zorgde echter niet voor significante veranderingen in de Mg2+ huishouding binnen 7 dagen. Verdere optimalisatie van de hoeveelheid en de beschikbaarheid van de flavaglines in het DCT zijn mogelijk nodig om effecten te kunnen waarnemen in muizen.

De Kunst van het Magnesiumtransport: Een Klinisch PerspectiefConcluderend kan gesteld worden dat dit proefschrift een bijdrage levert aan onze kennis over het Mg2+ transport in het DCT. DCT cellen zijn zeer gespecialiseerde cellen die grote basolaterale inhammen hebben. De DCT cellen bepalen de uiteindelijke excretie van Mg2+ in de urine, omdat er na het DCT geen Mg2+ meer wordt opgenomen. Door met behulp van GFP expressie in DCT cellen te isoleren, wordt het mogelijk om met hoge efficiëntie en kwaliteit DCT cellen te gebruiken voor onderzoek. In het DCT is TRPM6 het eiwit dat Mg2+ opname verzorgt. Het is al jaren bekend dat TRPM6 wordt gereguleerd door EGF, insuline en de pH waarde. In dit proefschrift werden ook flavaglines en ATP gevonden als twee nieuwe regulatiemechanismen, die kunnen worden gebruikt voor de ontwikkeling van gerichte medicijnen om verstoringen in de Mg2+ balans te verbeteren. SOX9 en PCBD1 werden geïdentificeerd als nieuwe transcriptieregulatoren in de celkernen van het DCT. Hierdoor worden patiënten met mutaties in het PCBD1 gen nu behandeld met Mg2+ supplementen en sulfonylureumderivaten voor hun hypomagnesemie en diabetes. Hoewel het moleculaire Mg2+ uitscheidingsmechanisme aan de basolaterale membraan van het DCT nog altijd niet definitief is opgehelderd, suggereren de studies in dit proefschrift dat SLC41A3 hierbij een rol speelt. CNNM2 lijkt zelf niet direct onderdeel van het Mg2+ effluxmechanisme te zijn, maar kan mogelijk DCT Mg2+ transport reguleren via zijn functie als Mg2+-sensor. Verdere studies zijn vereist om de functies en de interacties van alle basolaterale eiwitten die betrokken zijn bij Mg2+ transport te begrijpen. In een kleine, maar uitgebreid bestudeerde, groep patiënten kunnen Mg2+ tekorten in het bloed worden toegeschreven aan een genetisch defect. Ondanks dat er de afgelopen jaren veel van deze defecten zijn opgehelderd, zijn er nog steeds patiënten die wachten op een diagnose. De recente technische vooruitgang in genetische onderzoeks-technieken maakt het mogelijk te screenen voor mutaties op genoomschaal. Hoewel dit verder inzicht zal verschaffen in de genetische Mg2+ afwijkingen, zijn verdere bioinformatische ontwikkelingen nodig om te kunnen omgaan met de significante hoeveelheid data die deze technieken genereren.

284 | Chapter 12

Naast de rol van Mg2+ in de kleine groep patiënten met een genetisch defect, komt er steeds meer aandacht voor de belangrijke effecten van Mg2+ in algemene en veelvoor-komende ziektebeelden. Er is sterk bewijs beschikbaar dat het gebruik van bepaalde medicijnen zoals protonpompremmers (PPI’s), EGFR antagonisten en diuretica hypo-magnesemie kunnen veroorzaken. Niettemin worden Mg2+ bepalingen nog altijd niet standaard uitgevoerd bij bloedtesten in de kliniek. Toekomstige studies zouden meer aandacht moeten besteden aan de rol van Mg2+ in veelvoorkomende ziektes als diabetes mellitus en chronisch nierfalen. Eerdere studies hebben reeds aangetoond dat hypo-magnesemie de progressie van deze ziekten negatief kan beïnvloeden. Alleen door de belangrijke rol van Mg2+ in ziekte en gezondheid verder te benadrukken, zal de klinische aandacht voor het probleem toenemen. Verdergaande samenwerking tussen artsen, genetici en onderzoekers is vereist om de patiëntenzorg van hypomagnesemie te verbeteren en onze kennis van de Mg2+ huishouding te verbeteren.

Samenvatting | 285

List of Abbreviations | 289

List of Abbreviations

1,25(OH)2D3 1,25 hydroxy-vitamin D3

17βE 17β-estradiol28K Calbindin-D28K

2APB 2-amino-ethoxydiphenyl borateA Average signal valueACDP2 Ancient conserved domain protein 2 or CNNM2 ADH Autosomal dominant hypomagnesemiaALP Alkaline phosphataseALT Alanine transaminaseANOVA Analysis of varianceAP1 Activator protein 1AQP1 Aquaporin1AQP2 Aquaporin2AS160 Akt substrate of 160 kD or TBC1D4AST Aspartate transaminaseATP Adenosine 5’-triphosphateATPase Adenosine 5’-triphosphataseBCRP Breast cancer resistance proteinBH4 TetrahydrobiopterinBIODEF International database of tetrahydrobiopterin deficienciesBSA Bovine serum albuminBSND Gene encoding barttinC3 Complement component 3C4 Complement component 4C57Bl/6 C57 black 6 mouse strainCa2+ Calcium ionCaC2O4 Calcium oxalateCa(H2PO4)2 Calcium phosphate CaSR Calcium-sensing receptorCBS Cystathionine beta synthaseCC Chelerythrine chlorideCD Collecting ductCDH5 Cadherin 5, type 2CDK5 Cyclin-dependent kinase 5CGH Comparative genomic hybridizationCl- Chlorine ion ClC-Kb Voltage-sensitive chloride channel KbCLCNKB Gene encoding ClC-KbCLDN14 Gene encoding claudin-14CLDN16 Gene encoding claudin 16CLDN19 Gene encoding claudin 19CNI Calcineurin inhibitor CNNM1 Cyclin M1CNNM2 Cyclin M2CNNM3 Cyclin M3CNNM4 Cyclin M4CNS Central nervous systemCNT Connecting tubuleCOPAS Complex object parametric analyzer and sorter

290 | Chapter 13

COPD Chronic obstructive pulmonary disorder CorC Magnesium and cobalt efflux protein CorCcRaf Raf-1 proto-oncogene, serine/threonine kinaseD Dimerization domainDAPI 4’,6-diamidino-2-phenylindoleDCOH Dimerization cofactor of hepatocyte nuclear factor 1 alphaDCT Distal convoluted tubuleDNA Desoxy ribonucleic acidDpf Days post fertilizationEAST Epilesy, ataxia, sensorineuronal deafness and renal tubulopathy EC50 Half maximal effective concentrationEDTA Ethylenediaminetetraacetic acidEEG ElectroencephalographyEGF Epidermal growth factoreGFP Enhanced green fluorescent proteinEGFR Epidermal growth factor receptorENaC Epithelial sodium channelER Endoplasmic reticulumERK Extracellular signal-regulated kinaseFE Fractional excretionFHHNC1 Familial hypomagnesemia with hypercalciuria and nephrocalcinosis type 1FHHNC2 Familial hypomagnesemia with hypercalciuria and nephrocalcinosis type 2FL FlavaglineFLAG FLAG octapeptide FRET Förster resonance energy transferFXYD2 FXYD domain containing ion transport regulator 2 FXYD2 FXYD domain containing ion transport regulator 5GAPDH Glyceraldehyde 3-phosphate dehydrogenaseGCK GlucokinaseGEO Gene expression omnibusGFR Glomerular filtration rateGluR Glutamate receptorGNB2L1 Guanine nucleotide-binding protein subunit beta-2-like 1GO Gene ontology GSEA Gene set enrichment analysish SlopeH-89 N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamideHA Human influenza hemagglutinin HbA1c Glycosylated haemoglobinHCO3

- Bicarbonate ionH&E Hematoxylin and eosinHEK293 Human embryonic kidney clone 293HNF1B Hepatocyte nuclear factor 1 betaHNF4A Hepatocyte nuclear factor 4 alphaHPABH4D Transient neonatal hyperphenylalaninemia and primapterinuriaHpf Hours post fertilizationhs-CRP High-sensitivity C reactive proteinHSH Hypomagnesemia with secondary hypocalcemiaHSMR Hypomagnesemia, seizures and mental retardationIB ImmunoblotIC50 Half maximal inhibitory concentrationIDH Isolated dominant hypomagnesemiaIgA Immunoglobulin A


IgG Immunoglobulin G IgM Immunoglobulin MIL1β Interleukin 1 betaIP ImmunoprecipitationIR Insulin receptor IRES Interinal ribosome entry siteIRH Isolated recessive hypomagnesemia IV Current voltageK+ Potassium ionKCNA1 Gene encoding Kv1.1KCNJ1 Gene encoding ROMKKCNJ10 Gene encoding Kir4.1KD KnockdownkDa Kilo daltonKir4.1 Potassium channel 4.1Km Michaelis Menten ConstantKO Knock outKv1.1 Voltage-gated potassium channel 1.1LacZ β-galactosidase cassetteMAPK Mitogen-activated protein kinaseMb Megabases MC Metabolic cagesMCM2 Minichromosome maintenance complex component 2MDCK Madin-Darby canine kidneymDCT Murine distal convoluted tubule MG-132 N-(benzyloxycarbonyl)leucinylleucinylleucinalMg2+ Magnesium ionMGI Mouse genome informatics databaseMgSO4 Magnesium sulfateMgtE Bacterial Mg2+ transporter EMHB Midbrain hindbrain boundaryMMgT Membrane magnesium transporterMO MorpholinoMODY Maturity-onset diabetes of the youngmpkDCT Mouse microdissected distal convoluted tubuleMRI Magnetic resonance imagingMRS2 Magnesium homeostasis factorMSRB1 Methionine-R-sulfoxide reductase B1MT Mutant MW Molecular weightn Number of replicatesN Reference valueNa+ Sodium ionNCC Thiazide-sensitive sodium chloride co-transporter Neo Neomycin resistance geneNIPA Nonimprinted in Prader-Willi/Angelman syndromeNKCC2 Sodium potassium chloride co-transporterNLS Nuclear localization signalNMDA N-methyl-D-aspartic acidNMDG N-methyl-D-glucamine NPHP NephronophthisisNSAID Non-steroidal anti-inflammatory drugsOMIM Online Mendelian inheritance in man

292 | Chapter 13

P Probability value P2X4 P2X purinoceptor 4P2X6 P2X purinoceptor 6 pA Poly adeninePAH Phenylalanine hydroxylasePBS Phosphate buffered salinePCBD1 Pterin-4 alpha-carbinolamine dehydratase PCR Polymerase chain reactionPDB Protein data bank PGE2 Prostaglandin E2PHB Prohibitin Pi Phosphate ionPI3K Phosphoinositide 3-kinase PIP2 Phosphatidylinositol 4,5-bisphosphatePKA Protein kinase APKC Protein kinase CPKHD1 Polycystic kidney and hepatic disease 1PNGase F Peptide N-glycosidase FPOUH Atypical POU homeodomain POUS POU-specific domainPPI Proton pump inhibitorPT Proximal tubulePTH Parathyroid hormone PV ParvalbuminRAC1 Ras-related C3 botulinum toxin substrate 1RACK1 Receptor for activated C-kinase 1RCAD Renal cysts and diabetes syndromeREA Repressor of estrogen receptor activityRNA Ribonucleic acidROMK Renal outer medullary potassium channelRT-PCR Real time polymerase chain reactionSA Splice acceptor SeSAME Seizures, sensorineural deafness, ataxia, mental retardation and electrolyte ImbalanceSEM Standard error of meanSLC12A1 Solute carrier family 12 type 1, Gene encoding NKCC2SLC12A3 Solute carrier family 12 type 3, Gene encoding NCCSLC41A1 Solute carrier family 41 type 1SLC41A2 Solute carrier family 41 type 2SLC41A3 Solute carrier family 41 type 3 SOX9 SRY (sex determining region Y)-box 9SPC Signal peptidase complex SPFH Stomatin/prohibitin/flotillin and HflK/CSRP Signal recognition particlet1/2 Time of half-maximal activationTAL Thick ascending limb of Henle’s loopTBC1D4 TBC1 domain family, member 4TH Tamm-Horsfall proteinTM Transmembrane domainTNFα Tumor necrosis factor alphaTRPM6 Transient receptor potential melastatin type 6TRPM7 Transient receptor potential melastatin type 7


TRPV5 Transient receptor potential vanilloid type 5TUSC3 Tumor suppressor candidate 3UMOD Gene encoding uromodulinWB Western blot WNT4 Wingless-type MMTV integration site family, member 4WT Wild typeZDHHC Putative ZDHHC-type palmitoyltransferase 6-like

In this thesis protein and gene names are abbreviated and formatted according to the guidelines of the HUGO Gene Nomenclature Committee (HGNC), the International Committee on Standardized Genetic Nomenclature for Mice and the Zebrafish Nomenclature Committee:

Human (Homo sapiens) GENE PROTEIN Mouse (Mus musculus) Gene PROTEIN Zebrafish (Danio rero) gene Protein

List of Publications | 295

List of Publications

De Baaij JHF, Hoenderop JGJ, Bindels RJM. Regulation of Magnesium Balance: Lessons Learned from Human Genetic Disease. Clin. Kidney J. 5 (Suppl 1): i15-i24, 2012.

De Baaij JHF, Stuiver M, Meij IC, Lainez S, Kopplin K, Venselaar H, Müller D, Bindels RJM, Hoenderop JGJ. Membrane Topology and Intracellular Processing of Cyclin M2 (CNNM2). J. Biol. Chem. 287: 13644-13655, 2012.

Keuylian Z, De Baaij JHF, Glorian M, Rouxel C, Merlet E, Lipskaia L, Blaise R, Mateo V, Limon I. The Notch Pathway Attenuates Interleukin 1β (IL1β)-Mediated Induction of Adenylyl Cyclase 8 (AC8) Expression during Vascular Smooth Muscle Cell (VSMC) Trans-Differ-entiation. J. Biol. Chem. 287: 24978-24989, 2012.

De Baaij JHF, Groot Koerkamp M, Lavrijsen M, van Zeeland F, Meijer H, Holstege F, Bindels RJM, Hoenderop JGJ, Elucidation of the Distal Convoluted Tubule Transcriptome Identifies New Candidate Genes Involved in Renal Magnesium Handling. Am. J. Physiol.

Renal Physiol. 305: F1563-1573, 2013.Ferrè S*, De Baaij JHF*, Ferreira P, Germann R, de Klerk JB, Lavrijsen M, van Zeeland F,

Venselaar H, Kluijtmans LA, Hoenderop JGJ, Bindels RJM. Mutations in PCBD1 Cause Hypomagnesemia and Renal Magnesium Wasting. J. Am. Soc. Nephrol. 25: 574-586, 2014.

Arjona FJ*, De Baaij JHF*, Schlingmann KP*, Lameris ALL, Van Wijk E, Flik G, Regele S, Korenke GC, Neophytou B, Rust S, Reintjes N, Konrad M, Bindels RJM, Hoenderop JGJ. CNNM2 Mutations Cause Impaired Brain Development and Seizures in Patients with Hypomagnesemia. PLOS Genet. 10: e1004267, 2014.

De Baaij JHF*, Blanchard MG*, Lavrijsen M, Leipziger J, Bindels RJM, Hoenderop JGJ. P2X4 Receptor Regulation of Transient Receptor Potential Melastatin Type 6 (TRPM6) Mg2+ Channels. Pflügers Archiv. 466: 1941-1952, 2014.

De Baaij JHF, Hoenderop JGJ, Bindels RJM. Magnesium in Man: Implications for Health and Disease. Physiol. Rev. in press, 2014.

De Baaij JHF*, Dorresteijn EM*, Hennekam EAM, Kamsteeg EJ, Meijer R, Dahan K, Muller M, Bindels RJM, Hoenderop JGJ, Devuyst O, Knoers NVAM. Recurrent FXYD2 p.Gly41Arg Mutation in Patients with Isolated Dominant Hypomagnesemia. Submitted, 2014.

Blanchard MG*, De Baaij JHF*, Verkaart S, Lameris ALL, Désaubry L, Bindels RJM, Hoenderop JGJ. Flavaglines Stimulate Transient Receptor Potential Melastatin Type 6 (TRPM6) Channel Activity. Submitted, 2014.

De Baaij JHF, Kompatscher A, Lavrijsen M, Lameris ALL, Van den Brand M, Bindels RJM, Hoenderop JGJ, Identification of SLC41A3 as a Novel Player in Magnesium Homeostasis. In preparation, 2014.

* These authors contributed equally to this work

Curriculum Vitae | 297

Curriculum Vitae

Jeroen de Baaij was born in Nijmegen, the Netherlands on 16 May 1987. In 2005 he obtained his Gymnasium (VWO) diploma from the Stedelijk Gymnasium Nijmegen. Subsequently, he studied (Medical) Biology at the Faculty of Science of the Radboud University Nijmegen, from 2005-2008 and obtained his diploma with distinction bene meritum. From 2008-2010 he enrolled in the Master of Integrative Biology with specialization Physiology and pathophysiology at the Université Pierre et Marie Curie (UPMC, Paris VI) in Paris,

France. During his internship in 2009, he studied the efficiency of glucocorticoid treatment of cystic fibrosis patients under supervision of Dr. Philippe LeRouzic at the St. Antoine Hospital in Paris, France. In 2010, under supervision of Prof. Dr. Isabelle Limon, he investigated the role of AC8 and Notch receptors in the on-set of atherosclerosis at the UPMC, Paris, France. Jeroen became first of his year and obtained his master’s degree with highest honors (mention tres bien). Subsequently, he started as PhD Student at the department of Physiology, Radboud university medical center, Nijmegen, in 2010. Under the supervision of Prof. Dr. Joost G.J. Hoenderop and Prof. Dr. René J.M. Bindels, he focused on new genes involved in the regulation of magnesium transport in the kidney. During his graduation research, Jeroen’s work was selected twice (2012, 2013) for oral presentations at the yearly Kidney Week of the American Society for Nephrology (ASN). Moreover, he was awarded with the ‘Best Poster Award’ at the New Frontiers Symposium of the Nijmegen Center for Molecular Life Sciences (NCMLS) in 2012. In 2014, his poster on ‘Functiomics of newly identified magnesiotropic genes’ was awarded with the Best Poster Price at the annual EURenOmics meeting in Heidelberg, Germany. Moreover, he obtained a NCMLS Travel Award to attend the International Society of Nephrology (ISN) Forefronts meeting on Renal Genetics in Boston, USA in 2014. Additionally, Jeroen was selected for the Radboudumc Da Vinci Talent Program for personal development of excellent PhD students. During his PhD, Jeroen supervised nine students from Biomedical Sciences, Medicine, Medical Biology and Molecular Mechanisms of Disease Bachelor’s and Master’s studies.

RIMLS Portfolio | 299

Radboud Institute for Molecular Life Sciences

PHD PORTFOLIO

Name PhD student: Jeroen H.F. de BaaijDepartment: PhysiologyResearch School: Radboud Institute for Molecular Life Sciences

PhD period: 01-09-2010 – 31-08-2014Promotors: Prof. dr. Joost G.J. Hoenderop Prof. dr. René J.M. Bindels

Year(s) ECTS

TRAINING ACTIVITIES

a) Courses & Workshops- RIMLS Graduate Course- RIMLS PhD Retreat- Radiation Safety Course – Level 5B- Laboratory Animal Science – Article 9- Nierstichting Winterschool- Keystone Proteomics Course- Radboud da Vinci Challenge – Talent Program

20112011-201420112012201120122013

331311,254,25

b) Seminars & Lectures- RIMLS Seminars- RIMLS Technical Forums- RIMLS in the Spotlight / Forum Evenings / Radboud Research

Rounds

2010-20142010-20142010-2014

22,32,2

c) (Inter)national Symposia & Congresses- Eunefron- RIMLS New Frontiers 2011 #- Dutch Physiology Days #- Keystone Proteomics Course #- RIMLS New Frontiers 2012 #- ASN Kidney Week 2012 *- Kidney Theme *- ASN Kidney Week 2013 *- NfN Najaarssymposium *- EURenOmics Meeting *#- ERA-EDTA Congress *- Radboud Research Rounds *

201120112011201220122012201220132013201420142014

0,51,50,50,51,51,50,51,50,751,51,50,25

d) Other- Peer Review Scientific Papers- Organization RIMLS Technical Forum

2012-20142014

0,61

TEACHING ACTIVITIES

e) Students- Supervision Kelly Menting- Supervision Michelle Damen- Supervision Fariza Bouallala- Supervision Marieke Wever- Supervision Zilin Song- Supervision Stijn Elbers- Supervision Levi van Iersel- Supervision Anke Hoefnagels

20112011201220122013201420142014

112,312112

TOTAL 47,9

Oral and poster presentations are indicated with a * and # after the name of the activity, respectively.

Dankwoord – Acknowledgments – Remerciements | 303

Dankwoord – Acknowledgements – Remerciements

De anatomische tekeningen die dit proefschrift sieren, tonen dat de kennis van de nieranatomie van 1500 tot nu steeds gedetailleerder is geworden. Iedere kunstenaar en wetenschapper leerde van zijn leermeesters, en voegde daarna zijn eigen inzichten toe. Ik hoop dat ik met dit proefschrift mijn steentje heb kunnen bijdragen aan de kennis van magnesiumtransport in de nier. Maar ook ik had dit nooit kunnen doen zonder de expertise, de inspiratie en de motivatie van mijn promotoren, collega’s, vrienden en familie.

Natuurlijk wil ik ten eerste mijn promotoren Prof. dr. Joost Hoenderop en Prof. dr. René Bindels bedanken voor alle kansen en mogelijkheden die ze mij de afgelopen jaren hebben geboden. Joost, jouw enthousiasme en energie zijn onuitputtelijk en motiveren mij om dat stapje extra te zetten, ook als de resultaten tegen zitten. Het vertrouwen dat je de afgelopen jaren hebt laten blijken en in mij hebt uitgesproken ervaar ik als iets heel bijzonders. Hopelijk kunnen we de komende jaren samen nog veel wetenschappelijke successen vieren. René, ik bewonder de georganiseerde en efficiente manier waarop jij het onderzoek binnen de iontransport groep, de afdeling Fysiologie en het RIMLS richting geeft. Je leert mij altijd het einddoel voor ogen te houden. Mede dankzij deze focus heb ik binnen 4 jaar mijn proefschrift kunnen afronden.

To achieve great science, I am convinced that collaborations are essential to continuously exchange knowledge, ideas and expertise. During my PhD project I have had the privilege of enjoying many fruitful collaborations, for all of which I am extremely grateful.Thanks to the joint-effort with Prof. dr. Dominik Müller, Dr. Iwan Meij and Dr. Marchel Stuiver, publication of the molecular characterization of CNNM2 went extremely smoothly. I would like to thank Prof. dr. Martin Konrad and Dr. Karl Peter Schlingmann for the stimulating and open discussions on the CNNM2 protein. Because of your detailed clinical characterization of CNNM2 patients, we could further understand its physiological function. I have experienced the extensive collaboration with Prof. dr. Olivier Devuyst as highly motivating. You have challenged me to develop new scientific hypotheses and goals. Although only a few of our collaborative efforts are currently at the stage of publication, I am confident that more papers will follow soon. The expertise of Prof. dr. Jens Leipziger has been an important starting point, when we embarked on a journey to characterize the purinergic regulation of TRPM6. I remember our regular discussions to be of great scientific benefit, but also as a lot of fun! I want to thank Dr. Laurent Désaubry for the collaboration on the flavaglines project. Because of the unique properties of the compounds that you synthesize we have new important tools to study TRPM6.

304 | Chapter 14

Prof. dr. Frank Holstege and Marian Groot Koerkamp, met jullie hulp konden we de microarray analyse uitvoeren die de basis vormt van drie hoofdstukken in dit proefschrift. Dr. Hanka Venselaar, bedankt voor de eiwittenstructuren van CNNM2 en PCBD1.De langlopende samenwerking met de genetica afdelingen van het Radboudumc en het UMC Utrecht zijn een continue bron van vooruitgang binnen het magnesiumonderzoek. In het bijzonder wil ik hierbij Dr. Erik-Jan Kamsteeg bedanken. Erik-Jan, geweldig dat je altijd tijd hebt willen maken om mijn vele vragen te beantwoorden en mij verder te helpen als ik eens niet verder kwam. Daarnaast dank aan Dr. Kornelia Neveling voor de exoomanalyse en alle anderen binnen de afdeling genetica die hebben bijgedragen aan dit proefschrift.Een speciaal woord van dank voor Prof. dr. Nine Knoers. Nine, jij wees mij erop dat de afdeling Fysiologie misschien wel iets voor mij was. Wat heb je gelijk gehad! Ik heb het altijd als leuk en bijzonder ervaren dat ik met je mag samenwerken. Ik hoop dat we de familie niet teveel hebben verveeld met kleine discussies tijdens verjaardagen. Hopelijk is hoofdstuk 4 van dit boekje pas het begin van veel mooiere resultaten. Ik kijk uit naar de verdediging waar ik je tegenover me tref. Daarnaast ben ik alle artsen dankbaar die direct of indirect betrokken waren bij de studies die hebben geleid tot dit proefschrift. Hun opmerkzaamheid en zorg in de dagelijkse klinische praktijk vormen de basis voor veel van het werk dat ik heb kunnen verrichten.In het bijzonder wil ik hierbij noemen Eiske Dorresteijn, Pattrick Ferreira, Roger Germann en Johannis de Klerk vanwege de prettige samenwerking. Aansluitend hierop ben ik ook dank verschuldigd aan de vele patiënten en hun familieleden die toestemming gaven voor genetische analyse en publicatie van hun medische geschiedenis. Dankzij de welwillendheid van deze patiënten hebben we veel wetenschappelijke vooruitgang kunnen boeken.

Avant de débuter mes études doctorales, j’ai étudié à Paris où j’ai été encouragé et enthousiasmé à l’idée de poursuivre dans la recherche. Durant mes stages dans les laboratoires de Prof. dr. Isabelle Limon et Dr. Philippe LeRouzic, j’ai appris les techniques moléculaires et cellulaires les plus courantes. Mais plus encore, j’ai appris à construire un raisonnement scientifique, former des hypothèses et intégrer des résultats moléculaires dans un contexte physiologique. Chers Philippe et Isabelle, grâce a vous, j’ai vraiment aimé mes études à Paris et me suis retrouvé « accro » a la science ! (me suis retrouvé passionné de science) J’ai, en particulier, des souvenirs de diner chez Philippe et de mes visites chez Isabelle. J’espère vous revoir souvent dans l’avenir, la prochaine fois sera, je l’espère, à Nimègue pour la soutenance de ma thèse.

Daarnaast waren er de afgelopen jaren gelukkig heel veel mensen die mijn leven in en om het lab heel plezierig hebben gemaakt!


Eline, jij was jarenlang mijn unit-buurvrouw en ik vind het nog altijd heel gek dat je nu niet meer op de afdeling rondloopt. Ik heb je enorme inzet altijd bewonderd. Ondanks dat je er enge mannen in de trein voor moest trotseren, was je al op het lab als ik nog in mijn bed lag en ging je tot laat door. Maar met een boekje als resultaat waar je trots op mag zijn! Bedankt voor de leuke tijd die we samen hebben gehad en heel veel succes in je nieuw baan.Anke, mijn ‘lab-vriendinnetje’, jouw betrokkenheid en zorgzaamheid voor alles wat er in en om het lab gebeurt, zorgt dat je een soort labmoeder bent geworden ;) (dit zal me wel weer op een relatiebreuk komen te staan…). Bedankt voor je lieve woorden als ik er eens doorheen zat, maar vooral voor het vele plezier dat we samen hebben gehad! Het is maar goed dat we nooit in elkaars buurt hebben gezeten, anders was er door het geplaag weinig meer van werk terecht gekomen. Het is gek dat je binnenkort Fysiologie gaat verlaten, maar ik ben er zeker van dat je een zonnige toekomst tegemoet gaat. Durf op jezelf te vertrouwen! Bedankt voor je fantastische hulp bij de dierexperimenten, jij hebt mij de kneepjes van het vak geleerd. Jouw expertise en wetenschappelijke onderlegdheid hebben bijgedragen aan ieder hoofdstuk van dit boekje, iedere tekst is door jou van commentaar voorzien. Daarom ben ik blij dat jij als paranimf ook bij mijn verdediging mijn steun wil zijn.Paco, Pacote, Pacito, it’s a small world! When I got to know all your friends in Cádiz during my studies, you were in Holland. Luckily you joined the Physiology department during my PhD and I could meet you too! You brought the zebrafish expertise to the fishiology department, which is a great asset for the lab and resulted in the nicest paper in this thesis. I have great memories to our trips to Cadiz, eating kebab after work and seeing you play against Jonkerboys. Thank you for your help and friendship!Sjoerd, sjulz, short, helaas heb ik niet zoveel bijnamen voor jou als jij voor mij. Jouw enthousiasme en vele ideeën zijn een continue bron van inspiratie, je propjes en vliegen een een bron van afleiding. Bedankt voor de vele wetenschappelijke discussies, je kritische blik op mijn schrijfsels en het vele plezier dat we hebben gehad in de kluizenaar, in Spanje en op het lab!EvL, Ellen, het is fantastisch om te zien hoe jij bent gegroeid van twijfel over een PhD tot een harde werker die tig projecten tegelijk doet. Bovendien ben je met je vrolijke humeur, je grapjes en je oprechte interesse in al je collega’s, de sociale lijm van de afdeling Fysiologie. Bedankt voor je enthousiasme en betrokkenheid. Daar kan ik veel van leren, om te beginnen zal ik zorgen dat ik eens bij je presentaties zal zijn. ;)Two chapters in thesis would not have been possible without Maxime. Maxime, I’ve enjoyed working with you a lot! Your impressive patch clamp expertise, calm attitude and great sense of humor moved our projects forward. I’ve learned a lot from your great writing skills.Jenny en Mark H. jullie completeren het magnesium-team. Bedankt voor het vele plezier dat we samen hebben en de wetenschappelijke discussies die onze projecten sterker maken.

306 | Chapter 14

Tijdens mijn PhD heb ik de ongekende luxe gehad een aantal mensen te mogen uitkiezen om mee samen te werken. Andreas, ik herinner me het gesprek tijdens onze eerste onmoeting als enorm leuk en al snel hielp je me met het SLC41A3 project. Met jouw humor en geduld houd je me scherp en weet je ieder probleem te relativeren. Wat ben ik blij dat je nu als PhD je eigen project runt op onze afdeling! Al was het alleen maar om niet alleen als laatste over te blijven op feestjes/avondjes in de kluizenaar. Caro, ik heb veel bewondering voor hoe jij jezelf onmisbaar hebt gemaakt op onze afdeling tijdens een enorme hectische periode! Helaas heb je nu als chief CDL niet zoveel tijd meer voor mijn projectjes, maar ik ben blij dat je nog zolang aan ons lab verbonden bent!Daarnaast ben ik ongelooflijk veel dank verschuldigd aan alle analisten op onze afdeling zonder wiens hulp mijn projecten nooit allemaal hadden kunnen worden uitgevoerd. Marla, telkens als ik weer aankwam met een nieuw idee voor een kleuring of een dierexperiment, zag ik je denken: ‘Hoe gaan we dit dan weer doen?’. En toch maakte je altijd weer ruimte in je planning en bedacht je een nieuwe technische oplossing. Bedankt voor je hulp, je humor en het enorme plezier dat we ook buiten het lab hebben gehad, in de kluizenaar en bij de Backstreet Boys. Femke L., bij welk project was jij niet betrokken? Jij bent degene die mij wegwijs hebt gemaakt op het lab toen ik net begon. Bedankt voor al je hulp, inzet en Hek cellen! ;) AnneMiete, Hans, Judy, zonder jullie had ik nooit alle dierexperimenten kunnen uitvoeren, bedankt! Lonneke, Mark d. G., Marleen, jullie inzet en hulp bij de vele moleculaire experiment zijn van grote waarde.

Irene, jouw bijdrage aan de afdeling Fysiologie is onschatbaar groot. Bedankt voor alle hulp, je begrip als ik weer eens ongeduldig was en je hart onder de riem als NEC weer eens verloor. Femke K., bedankt voor het vele regelwerk als ik weer eens een onmogelijk afspraak wilde inplannen. Nu nog de avondjes aeculaaf goed inplannen zonder afspraken met honden en goudvissen! ;)

Daarnaast wil ik alle collega’s bedanken die ieder op hun eigen wijze hebben bijgedragen aan een geweldige tijd op het lab: Liz, Lauriane, Marcel, Erik, Silvia, Kukiat, Jitske, Ramon, Rick, Steef, Sabina, Theun, Anil, Sergio, Pedro, Wilco, Sandor, Miyuki, Marco, Sami, Omar, Mohammad, Annelies, Ganesh, Joanna, Fareeba, Milène, Joris, Melissa, Claudia, Seng, Christiane, Genoveva, Tomasz, Anne, Dennis, Sjoeli, Peter, Michiel, Femke v.d. H., de collega’s van integratieve fysiologie en iedereen die ik hier nog vergeet!

Ik heb tijdens mijn promotie het geluk gehad dat ik veel studenten heb mogen begeleiden. Ik heb van ieder van hen minstens net zoveel geleerd als zij hopelijk van mij. Michelle, Kelly, Fariza, Marieke, Robert, Stijn, Levi, Anke, Daan, Britta en adoptie-studentes (puppies) Julia en Rosalie bedankt voor jullie hulp en inzet!


De dierstudies die beschreven zijn in dit boekje waren onmogelijk geweest zonder de geweldige hulp van de medewerkers van het centraal dierenlaboratorium. Karin, zonder jou kunnen ze de VGD beter opheffen! Bedankt voor je hulp, humor en altijd positieve benadering, ook als ik weer eens de administratie niet goed had gedaan. Jij bent altijd bereid om mee te denken om tot goede en snelle oplossingen te komen. Heel erg bedankt. Daarnaast dank aan Maikel, Alex H., Alex I., Jeroen, Wilma en alle andere mensen binnen het CDL die hebben geholpen om mijn dierstudies tot een goed einde te brengen.

Tijdens mijn promotie heb ik de unieke ervaring gehad van deelname aan de Radboud da Vinci Challenge. De bijzondere gesprekken met Ellen van der Linden en Anja Schumann hebben mij geholpen mezelf beter te zien. Ook wil ik alle deelnemers bedanken voor de geweldige tijd die we samen hebben gehad. Michiel, leuk dat we samen hebben kunnen werken aan het SLC41A3 project! Sami en Dennis, de gezellige avondjes met wijn, humor en goede gesprekken zijn de ideale voortzetting van het Da Vinci gevoel.

Cas, toen jij het lab op kwam lopen, kon ik niet vermoeden hoe snel we een hechte vriendschap zouden ontwikkelen. We hebben eigenlijk geen woorden nodig en toch praten we oneindig veel. Ik vind het heel bijzonder hoe je mij aanvoelt en begrijpt. Met veel plezier kijk ik terug op onze tripjes naar Antwerpen en door Australië. Het was voor mij de ideale manier om los te komen van 4 jaar PhD. Jouw bijdrage aan dit proefschrift moet niet worden onderschat. Bedankt voor het vele proeflezen, je hulp bij de lekenfolder en je bijdrage aan de experimenten. Ik ben blij dat Maxime onze poepexplosie heeft overleefd! Ik ben onder de indruk van de kennis en kwaliteiten die jij als beginnende wetenschapper laat zien, hopelijk kan jij in je toekomstige baan als arts tijd voor de wetenschap blijven vrijmaken. Nog zo’n cadeautje uit het laatste jaar van mijn promotie was jij, Koen. Jouw denkvermogen en muziekkennis zijn indrukwekkend. Bedankt voor de tekening die de voorkant van dit hoofdstuk siert. Wees niet te bang voor de onbekende toekomst! De chocolade staat altijd voor je klaar.

Mijn oud-klasgenoot, mede NEC-supporter, tennispartner, maar vooral goede vriend, Roel, hoe vaak hebben we niet tegen elkaar gezegd: ‘We zien elkaar wel weer heel vaak deze week.’? Jij hebt misschien wel de meest labverhalen moeten aanhoren. Ik voel me gelukkig dat ik iedere week een avond bij je kan aanschuiven, de tennis nemen we dan maar op de koop toe! Bedankt voor alle keren dat je mij hebt losgetrokken van het werk, door concerten, sportwedstrijden, tennis of de vele reisjes die we hebben gemaakt. Ik ben blij dat je bij mijn verdediging naast me staat als paranimf.Yvo, Jonathan, Birgitta en alle andere vrienden en vriendinnen die mij de afgelopen jaren hebben afgeleid van mijn werk. Bedankt, ga zo door! ;)

308 | Chapter 14

Linde, Mieke, Tijmen, Anne, Antal, Myrthe, Wouter, Silke, Janneke, Marc mijn lijstje van broertjes en zusjes is de afgelopen jaren steeds langer geworden. Er is altijd wat te doen in de huizen De Baaij-Wijgerde, Knoers-Princen! Maar wat is het fijn om zoveel lieve mensen om me heen te hebben. Bedankt voor al het plezier en de zorgzaamheid. Lieve Opa Fons en Oma Riet, helaas zijn jullie er niet meer bij om mijn promotie te vieren. Bedankt voor jullie aanmoedigingen, interesse en trots die zelfs in jullie laatste dagen bleek. Ik mis de bezoekjes aan de Beunigerbeemd. Opa, het is bijzonder om mijn proefschrift te verdedigen aan de universiteit waar jij mij voorging.

Lieve Papa, in jouw grote tuin is het heerlijk bijkomen van het drukke leven. Samen met Jeanne zorg je dat deur in Stevensbeek altijd open staat. Het is bijzonder hoe julie samen een veilig thuis creëren waar iedereen zichzelf kan zijn. Bedankt voor je hulp, zorg en betrokkenheid, ook in de voorbereiding van dit proefschrift. Lieve Mama, we kijken terug op een jaar dat niet makkelijk was. Maar juist op dat soort momenten besef je wat we samen hebben. Zonder jouw liefde, zorg en aandacht had ik nooit gestaan waar ik nu ben. Ik ben dankbaar voor de bijzondere momenten in Spanje, in Parijs en in Nijmegen en ben blij dat je er samen met Thijs altijd voor me bent.

“Principles for the Development of a Complete Mind: Study the science of art. Study the art of science. Develop your senses- especially learn how to see.

Realize that everything connects to everything else.”

Leonardo da Vinci (1452-1519)

In this thesis our senses were stimulated by artistic scientific drawings that show the development of renal anatomy and renal physiology. The anatomical drawings that are presented in thesis are adapted from:Chapter 1 Leonardo da Vinci, A Kidney with Notes (1509). Chapter 2 Andreas Vesalius, De Humani Corporis Fabrica (1543). Chapter 3 Bartholomeus Eustachius, Opuscola Anatomica (1564). Chapter 4 Frederik Ruysch, Thesaurus Anatomicus (1709).Chapter 5 Govard Bidloo, Anatomia Humani Corporis (1685).Chapter 6 Alexander Schumlansky, De Structura Renum (1782).Chapter 7 Friedrich Gustav Jacob Henle, Zur Anatomie der Niere (1862).Chapter 8 Camillo Golgi, Annotazioni Intorno all’Istologia dei Reni dell’Uomo e di Altri Mammiferi e

Sull’Istogenesi dei Canalicoli Oriniferi (1889).Chapter 9 William Bowman, The Physiological Anatomy and Physiology of Man (1857).Chapter 10 Homer W. Smith, The Kidney: Structure and Function in Health and Disease (1951).Chapter 11 Andreas Vesalius, De Humani Corporis Fabrica (1543).Chapter 12 William Cheselden, Anatomy of the Human Body (1750).Chapter 13 Richard Quain, The Anatomy of the Arteries of the Human Body, with its Applications to Pathology

and Operative Surgery (1844).Chapter 14 Koen Ketelaars (2014).

de-baaij-thesis.pdf

Documents

Transcript of de-baaij-thesis.pdf