David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class...
-
Upload
shanon-joleen-russell -
Category
Documents
-
view
217 -
download
0
Transcript of David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class...
![Page 1: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/1.jpg)
David Evanshttp://www.cs.virginia.edu/evans
CS200: Computers, Programs and ComputingUniversity of VirginiaComputer Science
Class 39:Meaning of Life
DNA Helix Photomosaic from cover ofNature, 15 Feb 2001 (made by Eric Lander)
![Page 2: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/2.jpg)
23 April 2004 CS 200 Spring 2004 2
If P NP:
PNP
Decidable
Undecidable
Sorting: (n log n)
Simulating Universe: O(n3)
3SAT: O(2n) and (n)
Fill tape with 2n *s: (2n)
Halts: ()
NP-Complete
![Page 3: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/3.jpg)
23 April 2004 CS 200 Spring 2004 3
If P = NP:
P Decidable
Undecidable
Sorting: (n log n)
Simulating Universe: O(n3)
3SAT: if shown to be O(nk) (not yet known if this is true)
Fill tape with 2n *s: (2n)
Halts: ()
![Page 4: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/4.jpg)
23 April 2004 CS 200 Spring 2004 4
Is it ever useful to be confident that a problem is
hard?
![Page 5: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/5.jpg)
23 April 2004 CS 200 Spring 2004 5
Factoring Problem
– Input: an n-digit number
– Output: two prime factors whose product is the input number
• Easy to multiply to check factors are correct
• Not proven to be NP-Complete (but probably is)
• Most used public key cryptosystem (RSA) depends on this being hard
![Page 6: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/6.jpg)
23 April 2004 CS 200 Spring 2004 6
Speculations• Must study math for 15+ years before
understanding an (important) open problem– Was ~10 until Andrew Wiles proved Fermat’s Last
Theorem
• Must study physics for ~6 years before understanding an open problem
• Must study computer science for 1 semester before understanding the most important open problem– Unless you’re a 6-year old at Cracker Barrel
• But, every 5 year-old understands the most important open problems in biology!
![Page 7: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/7.jpg)
23 April 2004 CS 200 Spring 2004 7
Biology’s Open Problem
Which came first, the chicken or the egg?
How can a (relatively) simple, single cell turn into a chicken?
![Page 8: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/8.jpg)
23 April 2004 CS 200 Spring 2004 8
Brief History of Biology
Life isaboutmagic.(“vitalism”)
Most biologists work on ClassificationAristotle (~300BC) - genera and species
Descartes (1641) explain life mechanically
Life isaboutchemistry.
Life isaboutinformation.
Life isaboutcomputation.
1850 1950 2000
Schrödinger (1944) life is information crack the information code
Watson and Crick (1953) DNA stores the information
![Page 9: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/9.jpg)
23 April 2004 CS 200 Spring 2004 9
DNA
• Sequence of nucleotides: adenine (A), guanine (G), cytosine (C), and thymine (T)
• Two strands, A must attach to T and G must attach to C
A
G
T
CC
![Page 10: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/10.jpg)
23 April 2004 CS 200 Spring 2004 10
Central Dogma of Biology
• RNA makes copies of DNA segments
• RNA describes sequences of amino acids
• Chains of amino acids make proteins
DNA
Transcription
RNA
Translation
ProteinImage from http://www.umich.edu/~protein/
![Page 11: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/11.jpg)
23 April 2004 CS 200 Spring 2004 11
Encoding Proteins
• There are 4 nucleotides: adenine (A), guanine (G), cytosine (C), and thymine (T) (replaced with uracil (U) in RNA)
• There are 20 different amino acids, and a stop marker (to separate proteins)
• How many nucleotides are needed to encode one amino acid?
with 2, could encode 16 things: 4 * 4with 3, could encode 64 things: 4 * 4 * 4
![Page 12: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/12.jpg)
23 April 2004 CS 200 Spring 2004 12
Codons
• Three nucleotides encode an amino acid
• But, there are only 20 amino acids, so there may be several different ways to encode the same one
From http://web.mit.edu/esgbio/www/dogma/dogma.html
![Page 13: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/13.jpg)
23 April 2004 CS 200 Spring 2004 13
Shortest (Known) Life Program • Nanoarchaeum equitans
– 490,885 bases (522 genes)= 490,885 * ¼ * 21/64 = 40,268 bytes
– Parasite: no metabolic capacity,
must steal from host– Complete components for information processing:
transcription, replication, enzymes for DNA repair
• Size of compiling C++ “Hello World”: Windows (bcc32): 112,640 bytes
Linux (g++): 11,358 bytes
http://www.mediscover.net/Extremophiles.cfmKO Stetter and Dr Rachel Reinhard
![Page 14: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/14.jpg)
23 April 2004 CS 200 Spring 2004 14
How Big is the Make-a-Human Program?
• 3 Billion Base Pairs– Each nucleotide is 2 bits (4 possibilities)– 3 B pairs * 1 byte/4 pairs = 750 MB
• Every sequence of 3 base pairs one of 20 amino acids (or stop codon)– 21 possible codons, but 43 = 64 possible – So, really only 750MB * (21/64) ~ 250 MB
• Most of it (> 95%) is probably junk
![Page 15: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/15.jpg)
23 April 2004 CS 200 Spring 2004 15
1 CD ~ 650 MB
![Page 16: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/16.jpg)
23 April 2004 CS 200 Spring 2004 16
People are almost all the Same
• Genetic code for 2 humans differs in only 2.1 million bases– 4 million bits = 0.5 MB
• How big is 0.5MB?– 1/3 of a floppy disk– ~22 times the size of the PS6 adventure
game code
![Page 17: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/17.jpg)
23 April 2004 CS 200 Spring 2004 17
Is DNA Really a Programming Language?
![Page 18: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/18.jpg)
23 April 2004 CS 200 Spring 2004 18
Stuff Programming Languages are Made Of
• Primitives
• Means of Combination
• Means of Abstraction
codons (sequence of 3 nucleotides that encodes a protein)
?? Morphogenesis? Not well understood (by anyone).
DNA itself – separate proteins from their encodingGenes – group DNA by function (sort of)Chromosomes – package Genes togetherOrganisms – packages for reproducing Genes
This is where most of the expressiveness comes from!
![Page 19: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/19.jpg)
23 April 2004 CS 200 Spring 2004 19
Jacob and Monod, 1959
• Not so simple: cells in an organism have the same DNA, but do different things– Structural genes: make proteins that make us– Regulator genes: control rate of transcription
of other genes
The genome contains not only a series of blue-prints,but a coordinated program of protein synthesis and
the means for controlling its execution.François Jacob and Jacques Monod, 1961
![Page 20: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/20.jpg)
23 April 2004 CS 200 Spring 2004 20
Complexity
Molecular map of colon cancer cell from http://www.gnsbiotech.com/applications.shtml
![Page 21: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/21.jpg)
23 April 2004 CS 200 Spring 2004 21
Split Genes
• Richard Roberts and Phillip Sharp, 1977 • Not so simple – genome is spaghetti
code (exons) with lots of noops/comments (introns)
• Exons can be spliced together in different ways before transcription
• Possible to produce 100s of different proteins from one gene
![Page 22: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/22.jpg)
23 April 2004 CS 200 Spring 2004 22
Most Important Science/Technology Races
1930-40s:Decryption Nazis vs. British
Winner: British
Reason: Bletchley Park had computers (and Alan Turing), Nazi’s didn’t
1940s: Atomic Bomb Nazis vs. US
Winner: US
Reason: Heisenberg miscalculated, US has better physicists, computers, resources
1960s: Moon Landing Soviet Union vs. US
Winner: US
Reason: Many, better computing was a big one
1990s-2001: Sequencing Human Genome
![Page 23: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/23.jpg)
23 April 2004 CS 200 Spring 2004 23
Human Genome Race
• UVa CLAS 1970• Yale PhD• Tenured Professor at U.
Michigan
Francis Collins(Director of public National Center for Human Genome Research)(Picture from UVa Graduation 2001)
Craig Venter(President of Celera Genomics)vs.
• San Mateo College• Court-martialed• Denied tenure at SUNY
Buffalo
![Page 24: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/24.jpg)
23 April 2004 CS 200 Spring 2004 24
Reading the Genome
Whitehead Institute, MIT
![Page 25: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/25.jpg)
23 April 2004 CS 200 Spring 2004 25
Gene Reading Machines
• One read: about 700 base pairs
• But…don’t know where they are on the chromosome
AGGCATACCAGAATACCCGTGATCCAGAATAAGCActualGenome
ACCAGAATACCRead 1
TCCAGAATAARead 2
TACCCGTGATCCARead 3
![Page 26: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/26.jpg)
23 April 2004 CS 200 Spring 2004 26
Genome Assembly
Input: Genome fragments (but without knowing where they are from)
Ouput: The full genome
ACCAGAATACCRead 1
TCCAGAATAARead 2
TACCCGTGATCCARead 3
![Page 27: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/27.jpg)
23 April 2004 CS 200 Spring 2004 27
Genome Assembly
Input: Genome fragments (but without knowing where they are from)
Ouput: The smallest genome sequence such that all the fragments are substrings.
ACCAGAATACCRead 1
TCCAGAATAARead 2
TACCCGTGATCCARead 3
![Page 28: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/28.jpg)
23 April 2004 CS 200 Spring 2004 28
Common SuperstringInput: A set of n substrings and a maximum length k.
Output: A string that contains all the substrings with total length k, or no if no such string exists.
ACCAGAATACC
TCCAGAATAA
TACCCGTGATCCATACCCGTGATCCA
TCCAGAATAA
ACCAGAATACC
n = 26ACCAGAATACCCGTGATCCAGAATAA
![Page 29: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/29.jpg)
23 April 2004 CS 200 Spring 2004 29
Common SuperstringInput: A set of n substrings and a maximum length k.
Output: A string that contains all the substrings with total length k, or no if no such string exists.
ACCAGAATACC
TCCAGAATAA
TACCCGTGATCCAn = 25
Not possible
![Page 30: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/30.jpg)
23 April 2004 CS 200 Spring 2004 30
Common Superstring
• In NP:– Easy to verify a “yes” solution: just check the
letters match up, and count the superstring length
• NP-Complete– Similar to Smiley Puzzle!– Could transform 3SAT into Common
Superstring problem
![Page 31: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/31.jpg)
23 April 2004 CS 200 Spring 2004 31
Shortest Common Superstring
Input: A set of n substrings
Output: The shortest string that contains all the substrings.
ACCAGAATACC
TCCAGAATAA
TACCCGTGATCCATACCCGTGATCCA
TCCAGAATAA
ACCAGAATACC
ACCAGAATACCCGTGATCCAGAATAA
![Page 32: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/32.jpg)
23 April 2004 CS 200 Spring 2004 32
Shortest Common Superstring
• Also is NP-Complete:
function scsuperstring (pieces)
maxlen = sum of lengths of all pieces
for k = 1 to k = maxlen step 1 do
if (commonSuperstring (pieces, k))
return commonSuperstring (pieces, k)
end for
![Page 33: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/33.jpg)
23 April 2004 CS 200 Spring 2004 33
Human Genome
• 3 Billion base pairs
• 600-700 bases per read
• ~8X coverage required
• So, n 37 Million sequence fragments
• Celera used 27.2 Million reads (but could get more than 700 bases per read)
> (/ (* 8 (* 3 1000 1000 1000)) 650) 36923076 12/13
![Page 34: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/34.jpg)
23 April 2004 CS 200 Spring 2004 34
Give up?No way to solve an NP-Complete problem (best known solutions being O(2n) for n 20 Million)
1
100
10000
1E+06
1E+08
1E+10
1E+12
1E+14
1E+16
1E+18
1E+20
1E+22
1E+24
1E+26
1E+28
1E+30
2 4 8 16 32 64 128
2ntime since “Big Bang”
![Page 35: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/35.jpg)
23 April 2004 CS 200 Spring 2004 35
Approaches
• Human Genome Project (Collins)– Start by producing a genome map (using
biology, chemistry, etc) to have a framework for knowing where the fragments should go
• Celera Solution (Venter)– Approximate: we can’t guarantee finding the
shortest possible, but we can develop clever algorithms that get close most of the time in O(n log n)
![Page 36: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/36.jpg)
23 April 2004 CS 200 Spring 2004 36
Result: Draw
President Clinton announces Human Genome Sequenceessentially complete (with Venter and Collins), June 26, 2000
But, Human Genome Project mostly adopted Venter’s approach.
![Page 37: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/37.jpg)
23 April 2004 CS 200 Spring 2004 37
So Why Haven’t We Cured Cancer Yet?
0
5
10
15
20
25
30
NIH NSF DARPA
$ B
illio
ns
2004 Projected Budgets
![Page 38: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/38.jpg)
23 April 2004 CS 200 Spring 2004 38
Why Biologists Haven’t Done Much Useful with the Human Genome Yet
They are trying to debug highly concurrent, asynchronous, type-unsafe, multiple entry/exit, self-modifying programs that create programs that create programs running on an undocumented, unstable, environmentally-sensitive OS by looking at the bits (and just figuring out the shape of a protein is an NP-hard problem)
![Page 39: David Evans CS200: Computers, Programs and Computing University of Virginia Computer Science Class 39: Meaning of Life.](https://reader036.fdocuments.us/reader036/viewer/2022062408/56649ed05503460f94bdf1e0/html5/thumbnails/39.jpg)
23 April 2004 CS 200 Spring 2004 39
Charge: PS8 Due Monday• Before 10:55am Monday:
– Submit a zip file of all your code using a form linked from the CS200 web site
– If you want to use a few PowerPoint slides in your presentation, you may submit those also
• You only have 3 or 5 minutes: use them wisely– Figure out beforehand what you will do– Recommend: one team member drive web browser, one
(or two) talk– Talk about what users should know about your website,
not about how you built it (unless there is something especially interesting)