Cytology and Genetics -Si-miRNA Cloning

ISSN 0095�4527, Cytology and Genetics, 2012, Vol. 46, No. 6, pp. 335–341. © Allerton Press, Inc., 2012.Original Ukrainian Text © V.A. Tsygankova, Ya.V. Andrusevich, S.P. Ponomarenko, A.P. Galkin, Ya.B. Blume, 2012, published in Tsitologiya i Genetika, 2012, Vol. 46, No. 6,pp. 3–11.

335

INTRODUCTION

Parasitic nematodes are infectious and damagingpests for the majority of cultivars, and they inflict hugeyield losses. The annual and cumulative damage toworld agricultural production due to nematode infes�tations are estimated at over 125 billion USD [1].

Parasitic nematodes belong to obligate endopara�sites with a sedentary localization at places of hostplant invasion. They begin their life cycle as nonfeed�ing organisms, but at the juvenile development stagethey turn into infectious larvae that move from soil tothe roots of host plants.

For successful parasitism, nematodes use secretoryproteins, introducing the latter through a tiny openingin injecting tubes (stylet) into metabolically activemultinucleate specialized plant cells from which nem�atodes uptake nutrients [2]. These cells—feeding sites(syncytia)—are formed from ordinary plant cells inthe process of cell differentiation and resemble eithergiant cells that are specific to root–knot nematodes orcyst�resembling cells typical for cyst nematodes.Secretory proteins of nematodes induce dramatic hostgene expression alterations in infected plant cellseither through direct penetration into the nucleus[2, 3] or indirectly through intermediate proteins[4, 5], and, as a result, the cell cycle is alterated [6];cytoskeleton is reorganized [7]; the processes ofendoreduplication, target protein degradation [8], andthe regulation of signaling and metabolic pathways [9]are disturbed; the phytohormone balance is altered[10]; a plant’s protective immune responses are weak�

ened; and its overall growth and development are sus�pended [11].

Over 60 phytoparasitism genes responsible for con�trolling nematodes’ life cycle have been identified todate [12, 13]. Some of these genes are characterized bya high level of homology with many eukaryotic genes[2]. Products of their expression are the most func�tionally important nematode�specific proteins, whichparticipate in their DNA replication and transcrip�tion, RNA processing, synthesis of tRNA, translation,control of the functioning of ribosomes and tRNA, inthe processes of modification, protein secretion andtransfer, controlling their stability and degradation,controlling mitochondria’s functions and the metabo�lism of intermediate proteins, controlling the cellcycle and the structure of cells, transduction of endo�and intercellular signals, the processes of endocytosisand their regulation, as well as the proteins responsiblefor nematodes’ reproductive cycle (for example, themajor sperm protein or chitin synthase) [14].

Under natural conditions, a key role in combatingpathogenic organisms in plant cells is played by smallregulatory RNAs (si/miRNAs) with their antisensestructure with regard to definite mRNA regions of par�asites. Using the pathway of their complementarypairing with these mRNAs in cells, si/miRNAs inhibitthe translation of foreign mRNA. The majority of plantsfail to synthesize si/miRNAs in a sufficient amount forcounteracting pathogenic organisms [15–23]. How�ever, with the advent of the RNA interference (RNAi)technology, it became possible to develop genetic

Isolation and Amplification of cDNA from the Conserved Region of the Nematode Heterodera schachtii 8H07 Gene

with a Close Similarity to Its Homolog in Rape PlantsV. A. Tsygankovaa, Ya. V. Andrusevicha, S. P. Ponomarenkob, A. P. Galkinc, and Ya. B. Blumec

a Institute of Bioorganic Chemistry and Petrochemistry, National Academy of Sciences of Ukraine, Kyiv, Ukraineb Interdepartmental Scientific and Technological Center “Agrobiotech”, National Academy of Sciences of Ukraine and Ministry

of Education and Sciences of Ukraine, Kyiv, Ukrainec Institute of Food Biotechnology and Genomics, National Academy of Sciences of Ukraine, Kyiv, Ukraine

e�mail: [email protected], [email protected] February 6, 2012

Abstract—An original method was developed for isolation of small regulatory RNAs (si/miRNAs) from plantcells. PCR�amplification was carried out for the cDNA fragment of the nematode Heterodera schachtii 8H07gene. Northern�blot hybridization of plant si/miRNAs with the cDNA fragment of the conserved regionfrom the nematode’s 8H07 gene confirmed the high degree of their homology. In the future, the amplifiedcDNA fragment of the nematode 8H07 gene will be used for creating a recombinant gene with an antisensedsRNA sequence for increasing the resistance of rape plants to parasitic nematodes.

DOI: 10.3103/S0095452712060114

336

CYTOLOGY AND GENETICS Vol. 46 No. 6 2012

TSYGANKOVA et al.

engineering strategies to control the spread of nema�todes by the pathway of posttranslational silencing ofvital genes for nematodes’ parasitic cycle and penetra�tion into a host plant. The discovery of small regula�tory RNAs (si/miRNAs) that play a key role in theposttranslational regulation of gene silencing hasmade it possible to realize gene expression control andcarry out a gene function analysis [25].

At the same time, a great success has been achievedin cloning these genes, in constructing antisensedsRNA vectors on their basis, and creating transgenicplants with increased resistance to parasitic nematodes[25–28]. In parallel, scientists have identified theoverexpressed genes in host plants that enable parasiticnematodes to penetrate and propagate. It has beenestablished that, blocking their expression by trans�forming them with antisense (complementary)si/miRNAs with regard to their nucleotide sequences,we increase the resistance of plants to pathogens and, asa result, the damaging capacity of nematode larvae, aswell as their ability to penetrate into roots and formfeeding sites, is reduced, while nematode metamorpho�sis and the reproductive cycle are destroyed [29–32].

Among the most important phytoparasitic genesthat control the vital cycle of the soybean cyst nema�tode Heterodera glycines and the sugar beet cyst nem�atode Heterodera schachtii (which also parasitizes onrape plants) are the gene families of the secretory pro�teins produced by the nematodes’ dorsal esophagealgland cells. The families include the 3B05(AF469058), 4G06 (AF469060), 8H07 (AF500024),and 10A06 (AF502391) genes, which are character�ized by a high degree of homology (90%) in thesenematode species to the corresponding plant genes(their nucleotide sequences are 40% identical to hostplant genes) [8], as well as the Hs4F01 gene possessinga nucleotide sequence that is 33% similar to a homol�ogous gene in plants [33]. The constitutive expressionof these genes in host plants supports their hypersensi�tivity to nematode�associated infection, that is, infes�tation of plants with nematodes, whereas the peak ofHs4F01 gene expression in nematodic organisms isobserved against the formation of syncytia in plants;the other four genes (3B05, 4G06, 8H07, and 10A06)are hyperexpressed in the period following the feedingof nematodes [8, 34].

The biological functions of the proteins encoded bythe above genes are clear. The 3B05 gene encodes aprotein with a cellulose�binding domain [35]. The4G06 gene encodes the widespread plant protein ubiq�uitin peptide, which has 14 amino acids with a uniqueC�terminal domain present only in nematodes thatcan be a target for silencing with antisense si/miRNAssynthesized in transgenic plants [8, 12]. The 8H07gene encodes a protein identical to plant SKP1 pro�teins—the components of the SCF�complex of pro�teolytic enzymes (proteasome), the participation ofwhich ensures the process of polyubiquitination and

degradation of proteins [8, 12]. It has been found thatthis nematodic gene (8H07) has the 8H07CR conservedregion (CR), which is homologous to the conservedregion of the 8H07 plant gene that encodes SKP1 pro�teins, as well as the 8H07UR unique region (UR),which is only specific for nematodes. Due to the pres�ence of a significant number of those nucleotidesequences in the conserved region of the nematodic8H07 gene that differ from the correspondingsequences in plants, as well as due to the presence of aUR in nematodes, there is a possibility to avoid non�specific silencing of this gene in plants; therefore, botha CR and a UR can be used for constructing expres�sion vectors with antisense dsRNAs in transgenicplants towards both regions. The 10A06 gene encodesa protein identical to the plant RING�H2 Zinc�fingerproteins—components of the SCF�complex respon�sible for the polyubiquitination of proteins [8, 12]. Forexperiments with the RNAi target, we can select thedomain of the 10A06 gene, which encodes the RING�H2Zinc�finger protein, or a nucleotide sequence thatgenuinely differs from the analogous domain of the10A06 plant gene, owing to which it is possible to avoidthe nonspecific silencing of this gene in plants.

The Hs4F01 gene that encodes annexin proteinshas four conserved domains. They are composed of60–70 nucleotide sequences, which are repeated fourtimes and have calcium�binding sites [8, 36]. Theannexin protein family participates in processes regu�lated by calcium on the surfaces of nematode cellmembranes. Annexins fulfill a variety of functions inplant cells. For example, annexins in pea and corn areconcentrated in secretory cells of root membranes inthe xylem and phloem [37, 38]. Annexins of cottoninhibit the activity of the callose synthase enzyme[38], whereas in Arabidopsis there are at least eightannexin genes, some of which are expressed inresponse to abiotic stress, fulfilling protective func�tions [33, 39]. Undoubtedly, each of the above pre�sented genes can be used for the cloning and construc�tion of antisense dsRNA vectors to their sequencesand for creating transgenic plants resistant to parasiticnematodes. Thus, the development of methods for theidentification of these genes, their cloning, and con�struction of vectors on their basis for the genetic trans�formation of plants is an important direction for theadvancement of genetic engineering.

As was revealed by our previous molecular geneticstudies, the resistance of plants to various pathogenscan be significantly strengthened if one stimulates thesynthesis of their own small regulatory si/miRNAs,participating in RNA interference processes, by theirtreatment with growth regulators of natural origin withbioprotective properties [40, 41]. Since the efficiencyof plant infestation by nematodes depends on thesecretory proteins synthesized in parasites’ esophagealglands at the moment when their injecting stylet pen�etrates into a plant’s root cells and forms syncytia inthese sites [8], considering the key role of the genes


ISOLATION AND AMPLIFICATION OF cDNA 337

that encode the synthesis of these proteins and thussupport the survival of pests, we set a goal for ourexperiments to develop some approaches, based onthe current methods of genetic engineering in combi�nation with the dsRNA gene expression biostimula�tion, for multiplying in infected rape cells the numberof antisense dsRNA copies specific to the structure ofone of the secretory protein genes (8H07) in nema�todes.

MATERIALS AND METHOD

Rape seeds with a high level of germinating powerwere grown in Petri dishes in a nematode�free aqueousmedium (control) and in another medium with a cystsuspension from the root�parasitizing nematodeH. schachtii, from which nematode larvae appeared(approximately from the fifth to the seventh day) in thecourse of incubation at 23°C.

To additionally increase the rape seed resistance tonematode invasions, the plants were treated with theRegoplant growth regulator with bioprotective prop�erties [41, 42]*. The composition of this multicompo�nent preparation includes products of vital activity inan in vitro culture of root fungus�endophyte isolatedfrom the ginseng Panax Ginsed M root system (a mix�ture of amino acids, carbohydrates, fatty acids,polysaccharides, phytohormones, and microele�ments) and aversectins—complex antiparasitic mac�rolide antibiotics that are metabolic products of thesoil streptomycete Streptomyces avermitilis [43]. Strep�tomyces are known to be producers of not only antibi�otics, but also of biologically active substances produc�ing phytoprotective and growth�stimulating effects onplants. This group is represented by a wide variety ofhormones, vitamins, amino acids, carotinoids,enzymes, toxins, and other substances that influencegrowth processes in plants, stimulate the growthcapacity of seeds, and increase yield [42]. In the con�ducted experiments, Regoplant was used at an aver�sectin concentration of 10 μg/mL.

Isolation of si/miRNAs from experimental rapeplant cells was performed using an earlier developedmethod consisting of the following steps:

(1) isolation of a total RNA preparation from plantcells [43–45]; the polymericity of the isolated totalRNA preparations was analyzed by electrophoresis ina 1.5% agarose gel in the presence of 7 M urea by theLocker method [46] (gels were stained with ethidiumbromide solution prior to photographing RNA frac�tions under UV light);

(2) separation of poly(A)+mRNA (that is, mRNA)and poly(A)–mRNA using an oligo(dT)�cellulose col�

* Created at the Institute of Bioorganic Chemistry and Petro�chemistry, National Academy of Sciences of Ukraine, togetherwith the Interdepartmental Scientific and Technological Center“Agrobiotech”, National Academy of Sciences and Ministry ofEducation and Science of Ukraine.

umn for the further use of poly(A)+mRNA for testingthe functional activity of si/miRNAs in cell�free pro�tein synthesis systems from wheat embryo [44, 46].

(3) high�molecular�weight poly(A)–mRNA wasprecipitated from the eluate using a 10% solution ofpolyethylene glycol (8000 M) with 0.5 M NaCl, whilesi/miRNAs were precipitated with an equal volume of96% ethanol at –22°C for 24 h; poly(A)+RNA wascollected from the column with 2–3 volumes of thefollowing buffer: 10 mM Tris�HCl (pH 7.5), 1 mMEDTA, 0.05% sodium dodecyl sulfate [47, 48]; thenpoly(A)+RNA eluates were precipitated from the col�umn with ethanol;

(4) molecular hybridization in a solution of2 × SSC of low�molecular�weight si/miRNAs withpoly(A)+mRNA fractions;

(5) placement of hybrid molecules ofpoly(A)+mRNA with si/miRNA in an oligo(dT)�cel�lulose column with further elution from the columnwith the buffer indicated above in item 3;

(6) temperature�increasing (95°C) denaturing ofpurified (using the column) hybrid molecules ofpoly(A)+mRNA with si/miRNAs;

(7) separation of poly(A)+mRNA from si/miRNAson an oligo(dT)�cellulose column, using the fractionalmethod;

(8) repetitive precipitation of si/miRNAs with 96%ethanol and retesting of the purity of the isolatedsi/miRNAs by electrophoresis in a 15% polyacryla�mide gel (PAAG electrophoresis) (Fig. 1).

For experiments on the hybridization of si/miR�NAs with the PCR�amplified conserved region of thenematode cDNA, si/miRNAs were initially inten�sively labelled in vivo with 33P using Na2HP33O4 [44].

Isolation of a Total mRNA Preparationfrom H. schachtii Cells

Eggs of H. schachtii, washed and purified in a sac�charose gradient, were placed on a filter paper soakedwith 3.14 mM ZnSO4 solution in Petri dishes andincubated in a thermostat at 26°C for 5–7 days untilthe emergence of nematode larvae. The larvae werecollected and sterilized initially for one hour in a0.001% hibitane and for 7 min in a 0.001% mercuricchloride solution.

Total RNA preparations were isolated from the lar�vae by the same method as was used for isolating totalRNA preparations from plants. The polymericity ofthe isolated total RNA preparations was analyzedusing the Locker method [46].

Poly(A)+RNA (i.e., mRNA) and poly(A)–RNAwere separated and high�molecular�weight poly(A)–

mRNA was precipitated from the eluate in anoligo(dT)�cellulose column in the same way asdescribed above in items 2 and 3.

338


TSYGANKOVA et al.

cDNA synthesis on poly(A)+RNA templates wascarried out using reverse transcriptase (revertase) and[α�33P]�labelled deoxycytidine triphosphate (dCTP)[40, 49].

PCR Amplification of cDNA Sequences of the Nematode 8H07 Gene

For further cloning and constructing an expressionvector for dsRNAs, which are structurally antisense tonematode mRNAs, we selected the nematode 8H07gene with a high degree of homology in its conservedregion (CR) in relation to the same region of an anal�ogous plant gene (Table).

The amplification of the conserved region of the 8H07gene cDNA was performed in an ABI Thermal Cycler(Applied Biosciences, Germany) using 0.025 U/μL Taqpolymerase (New England Biolabs, United States)and the following reagents (Invitrogen, UnitedStates): 1.5 mM MgCl2 and 200 μM of each of thedATP, dTTP, dGTP, and dCTP nucleotides. ThePCR temperature regimes were as follows: the initialtemperature for denaturing was 94°C for 2 min; suc�cessive 35 amplification cycles were carried out at94°C for 30 s, at 55°C for 45 s, and at 72°C for 1 min;the final elongation cycle was carried out at 72°C for7 min.

The amplified cDNA fragment from the conservedregion of the 8H07 gene was analyzed by 15% PAAGelectrophoresis soaked with ethidium bromide (Fig. 2).

In testing for the presence of homology betweenthe small regulatory si/miRNAs isolated from rapeplants treated with the multifunctional compositeRegoplant preparation and the amplified cDNA frag�ment of the conserved region of the nematodic 8H07gene, the cDNA eluate with gel was placed on modi�fied and activated nitrocellulose membrane filters(Whatman 50, 2�aminophenylthioether paper) andNorthern�blot hybridization was carried out [47] withlow�molecular�weight 33P�labelled si/miRNAs iso�lated from rape plants, which were untreated andtreated with a growth regulator (Fig. 3).

RESULTS AND DISCUSSION

With the aim to create a vector with antisense dsR�NAs, we selected the nematode 8H07 gene, whichencodes one of the secretory proteins produced byesophageal glands and has a high degree of homologyin its conserved region with the conserved region of the8H07 gene in plants. Therefore, it was decided to testthe degree of homology between the isolated (fromrape plants treated and untreated with the multifunc�tional composite Regoplant preparation) small regula�tory si/miRNAs and the amplified cDNA fragmentfrom the conservative region of nematode 8H07 gene.

The identification results (obtained using PAAGelectrophoresis) of the isolated si/miRNAs indicatethat si/miRNAs are preparations of high purity with

1 2 3

40

35

30

25

18

Fig. 1. PAAG electrophoresis of si/miRNA from rapeshoots. The marker polynucleotides (vertically, the lengthin nucleotides) and the preparation si/miRNA on gel paths1 and 2 are stained by ethidium bromide; radioautography33P�labelled si/miRNA with gel (path 3).

Index of sequences in the primers used for the amplification of the target 8H07 gene of the nematode H. schachtii

Primer SequencesNumber of nucleotide pairs

obtained by the PCR method

8H07�CR�S�Forward ATCTCGAGAACCATATTCCCCAAATG

3388H07�CR�S�Reverse ATGAATTCTATTTGGTTTGGCATTTGATTCGGCTG

8H07�CR�AS�Forward ATTCTAGAAACCATATTCCCCAAATG

8H07�CR�AS�Reverse ATAAGCTTTATTTGGTTTGGCATTTGATTCGGCTG

Note: CR is a conserved region; S is sense�related; and AS is an antisense sequence.



classical parameters of these RNA types from 21 to25 nucleotides in length.

For the PCR amplification of the cDNA fragmentsequences of the H. schachtii 8H07 gene, we usedprimers complementary to the conserved region ofthis gene, which are composed of CR sense and anti�sense sequences and contain restriction sites for perform�ing the cloning of the amplified conserved cDNA regionof the 8H07 gene and for its subsequent introduction intothe pHannibal vector (XhoI, CTCGAG; EcoRI,GAATTC; XbaI, TCTAGA; HindIII, AAGCTT; andClaI, ATCGAT) (table).

Electrophoresis of the amplified cDNA of the con�served region of the 8H07 gene in 15% PAAG stainedwith ethidium bromide showed the presence of aclearly expressed UV�exposed strip in the gel to be aconcentrated preparation of molecules related to therespective region of the indicated gene which, accord�ing to literature data, contains 338 nucleotide pairs(Fig. 2).

The Northern blot hybridization results of thePCR�amplified cDNA fragment from the conservedregion of the 8H07 gene with 33P�labelled low molec�ular�weight si/miRNAs (Fig. 3) confirm the presenceof a high level of homology between the si/miRNApreparations that we isolated from rape plants, treatedand untreated with growth regulators, and the amplifiedand homologous cDNA fragment of the H. schachtii8H07 gene.

The corresponding Northern blot hybridizationresults show that the application of the Regoplantgrowth regulator increases significantly the level ofsynthesis of the antinematodic si/miRNAs specific tothe conserved region of the 8H07 gene responsible fora parasitic nematode’s infectious properties. As hasbeen noted, to achieve an additional increase inplants’ resistance to nematodic invasions, it is not onlypossible to use Regoplant, but also our analogouscomposite preparations with growth�stimulating andantiparasitic activity, which were developed at theInstitute of Bioorganic Chemistry and Petrochemistry,National Academy of Sciences of Ukraine, and at theAgrobiotech Interdepartmental Scientific and Tech�nological Center (Stimpo, Biogen, etc.) [40, 41].

Thus, owing to the developed method for isolatinga highly purified preparation of small regulatorysi/miRNAs, we have managed to establish that the resis�tance of rape plants to H. schachtii attacks is conditionedby a sharp increase in the synthesis of si/miRNAs whichis due to the effect of the multifunctional Regoplantpreparation. Through Northern blot hybridization, ahigh degree of homology has been established betweensmall regulatory si/miRNAs isolated from rape cellsand the amplified cDNA fragment of the conserved8H07 gene region in H. schachtii. These results speakin favor of the fact that the antinematodic properties ofsi/miRNA preparations are associated with the pres�ence of antisense (complimentary) sequences to the

nematode 8H07 gene, owing to which the translationof nematodic mRNAs is blocked (silencing), causingtheir death. The fact that the synthesis of the specifiedantinematodic si/miRNAs in nematode�infected plantcells increases and is additionally strengthened byRegoplant’s effect is confirmed by our earlier obtainedresults related to the inhibition of protein synthesis onpoly(A)+mRNA templates in a cell�free protein syn�thesis system from wheat embryo [40, 49]. Thoseexperiments have established that si/miRNA prepara�tions extracted from infected plants, whether treatedor untreated with Regoplant, should be added to acell�free protein synthesis system until the translationof mRNAs, obtained from both nematode larvae andinfected plants, is practically completely inhibited. Onthe contrary, si/miRNA prepations isolated fromnematode�free plant cells exerted quite a low level ofinhibitory activity (because of blocking the translationof cellular mRNAs themselves).

On the whole, the obtained results point to clearprospects for the development of plants resistant toH. schachtii invasions, using genetic engineeringapproaches (construction of expression vectors for

1 2

22 bp

Fig. 3. Northern blot hybridization of the PCR�amplifiedcDNA fragment of the 8H07 gene’s conserved region withlow�molecular�weight 33P�labelled si/miRNAs: 1, cDNAhybrids with si/miRNA preparations isolated from rapeplants treated with a growth regulator; 2, cDNA hybridswith si/miRNA preparations isolated from rape plantsuntreated with a growth regulator.

Fig. 2. PAAG electrophoresis (15%) of the PCR�amplifiedcDNA fragment from the conserved region of the 8H07 gene.

338 bp

340


TSYGANKOVA et al.

antisense dsRNAs complimentary to the conservedregion of the 8H07 gene and genetic transformation ofplants using them).

REFERENCES

1. Chitwood, D.J., Research on Plant�Parasitic Nema�tode Biology Conducted by the United States Depart�ment of Agriculture Agricultural Research Service, PestManag. Sci., 2003, vol. 59, pp. 748–753.

2. Baum, T.J., Hussey, R.S., and Davis, E.L., Root�Knotand Cyst Nematode Parasitism Genes: The MolecularBasis of Plant Parasitism, Genet. Engin., 2007, vol. 28,pp. 17–43.

3. Elling, A.A., Davis, E.L., Hussey, R.S., and Baum, T.J.,Active Uptake of Cyst Nematode Parasitism Proteinsinto the Plant Cell Nucleus, Int. J. Parasitol., 2007,pp. 1269–1279.

4. Jammes, F., Lecomte, P., Almeida�Engler, J.,Bitton, F., Martin�Magniette, M., Renou, J.P., Abad, P.,and Favery, B., Genome�Wide Expression Profiling ofthe Host Response to Root�Knot Nematode Infectionin Arabidopsis, Plant J., 2005, vol. 44, pp. 447–458.

5. Ithal, N., Recknor, J., Nettleton, D., Hearne, L.,Maier, T., Baum, T.J., and Mitchum, M.G., ParallelGenome�Wide Expression Profiling of Host andPathogen during Soybean Cyst Nematode Infection ofSoybean, Mol. Plant–Microbe Interact., 2007, vol. 20,pp. 293–305.

6. Gheysen, G. and Fenoll, C., Gene Expression in Nem�atode Feeding Sites, Annu. Rev. Phytopathol., 2002,vol. 40, pp. 191–219.

7. Caillaud, M., Lecomte, P., Jammes, F., et al., MAP65�3Microtubule�Associated Protein Is Essential for Nem�atode�Induced Giant Cell Ontogenesis in Arabidopsis,Plant Cell, 2008, vol. 20, pp. 423–437.

8. Gao, B., Allen, R., Maier, T., Davis, E.L., Baum, T.J.,and Hussey, R.S., The Parasitome of the Phytonema�tode Heterodera Glycines, Mol. Plant–Microbe Interact.,2003, vol. 16, pp. 720–726.

9. Doyle, E.A. and Lambert, K.N., Meloidogyne javanicaChorismate Mutase 1 Alters Plant Cell Development,Mol. Plant–Microbe Interact., 2003, pp. 123–131.

10. Karczmarek, A., Overmars, H., Helder, J., andGoverse, A., Feeding Cell Development by Cyst andRoot�Knot Nematodes Involves a Similar Early, Localand Transient Activation of a Specific Auxin InduciblePromoter Element, Mol. Plant Pathol., 2004, vol. 5,pp. 343–346.

11. Huang, G., Allen, R., Davis, E.L., Baum, T.J., andHussey, R.S., Engineering Broad Root�Knot Resis�tance in Transgenic Plants by RNAi Silencing of aConserved and Essential Root�Knot Nematode Para�sitism Gene, Proc. Nat. Acad. Sci. U.S.A., 2006,vol. 103, pp. 14302–14306.

12. Gao, B., Allen, R., Maier, T., Davis, E.L., Baum, T.J.,and Hussey, R.S., Identification of Putative ParasitismGenes Expressed in the Esophageal Gland Cells of theSoybean Cyst Nematode Heterodera glycines, Mol.Plant–Microbe Interact., 2001, vol. 14, pp. 1247–1254.

13. Wang, X., Allen, R., Ding, X., Goellner, M., Maier, T.,de Boer, J.M., Baum, T.J., Hussey, R.S., and

Davis, E.L., Signal Peptide�Selection of CDNACloned Directly from the Esophageal Gland Cells ofthe Soybean Cyst Nematode Heterodera glycines, Mol.Plant–Microbe Interact., 2001, vol. 14, pp. 536–544.

14. Bradley, J.D., Chiapelli, B., Gao, B., McCarter, J.P.,Verbsky, M.L., and Williams, D.J., Methods and Com�positions for Root Knot Nematode Control, WOPatent No. 2009126896, 2009.

15. Hamilton, A., Voinnet, O., Chappell, L., et al., TwoClasses of Short Interfering RNA in RNA Silencing,EMBO J., 2002, vol. 21, no. 17, pp. 4671–4679.

16. Leung, R.K.M. and Whittaker, P.A., RNA Interfer�ence: From Gene Silencing to Gene�Specific Thera�peutics, Pharmacol. Therap., 2005, vol. 107, pp. 222–239.

17. Bakhetia, M., Charlton, W.L., Urwin, P.E., et al.,RNA Interference and Plant Parasitic Nematodes,Trends Plant Sci., 2005, vol. 10, no. 8, pp. 362– 367.

18. Gheysen, G. and Vanholme, B., RNAi from Plants toNematodes, Trends Biotechnol., 2006, vol. 25, no. 3,pp. 89–92.

19. Knox, D.P., Geldhof, P., Visser, A., and Britton, C.,RNA Interference in Parasitic Nematodes of Animals:a Reality Check?, Trends Parasitol., 2007, vol. 23,no. 3, pp. 105–107.

20. Auer, C. and Frederick, R., Crop Improvement UsingSmall RNAs: Applications and Predictive EcologicalRisk Assessments, Trends Biotechnol., 2009, vol. 27,no. 11, pp. 644–650.

21. Padmanabhan, Ch., Zhang, X., and Jin, H., HostSmall RNAs Are Big Contributors to Plant InnateImmunity, Curr. Opin. Plant Biol., 2009, vol. 12, no. 4,pp. 465–472.

22. Chen, R., Hu, Z., and Zhang, H., Identification ofMicro RNAs in Wild Soybean (Glycine soja), J. Integr.Plant Biol., 2009, vol. 51, no. 12, pp. 1071–1079.

23. Jian, X., Zhang, L., Li, G., et al., Identification ofNovel Stress�Regulated microRNAs from Oryza sativa L.,Genomics, 2010, vol. 95, pp. 47–55.

24. Baulcombe, D., RNA Silencing, Trends Biochem. Sci.,2005, vol. 30, pp. 290–293.

25. Tytgat, T., Vanholme, B., De Meutter, J., Claeys, M.,Couvreur, M., Vanhoutte, I., Gheysen, G., VanCriekinge, W., Borgonie, G., Coomans, A., and Ghey�sen, G., A New Class of Ubiquitin Extension ProteinsSecreted by the Dorsal Pharyngeal Gland in Plant Par�asitic Cyst Nematodes, Mol. Plant–Microbe Interact.,2004, vol. 17, pp. 846–852.

26. Chen, Q., Rehman, S., Smant, G., and Jones, J.T.,Functional Analysis of Pathogenicity Proteins of thePotato Cyst Nematode Globodera Rostochiensis usingRNAi, Mol. Plant–Microbe Interact., 2005, vol. 18,pp. 621–625.

27. Rosso, M.N., Dubrana, M.P., Cimbolini, N.,Jaubert, S., and Abad, P., Application of RNA Inter�ference to Root�Knot Nematode Genes EncodingEsophageal Gland Proteins, Mol. Plant–Microbe Inter�act., 2005, vol. 18, pp. 615–620.

28. Shingles, J., Lilley, C.J., Atkinson, H.J., andUrwin, P.E., Meloidogyne Incognita: Molecular andBiochemical Characterisation of a Cathepsin L Cys�



teine Proteinase and the Effect on Parasitism FollowingRNAi, Exp. Parasitol., 2007, vol. 115, pp. 114–120.

29. Wiig, A., Compositions and Methods using RNA Inter�ference of Opr3�Like Gene for Control of Nematodes,US Patent No. 2010115660, 2010.

30. Wiig, A., Compositions and Methods using RNA Inter�ference Targeting Mthfr�Like Genes for Control ofNematodes, US Patent No. 2010107276, 2010.

31. Favery, B., Abad, P., and Caillaud, M.C., Method forIncreasing the Resistance of a Plant to EndoparasiticNematodes, WO Patent No. 2008139334, 2008.

32. Ascenzi, R., Compositions and Methods Using RNAInterference of Cdpk�Like Genes for Control of Nem�atodes, US Patent No. 2010017910, 2010.

33. Clark, G.B., Sessions, A., Eastburn, D.J., andRoux, S.J., Differential Expression of Members of theAnnexin Multigene Family in Arabidopsis, Plant Phys�iol., 2001, vol. 126, pp. 1072–1084.

34. Elling, A.A., Mitreva, M., Recknor, J., et al., DivergentEvolution of Arrested Development in the Dauer Stageof Caenorhabditis elegans and the Infective Stage ofHeterodera glycines, Genome Biol., 2007, vol. 8,p. R211.

35. Gao, B.L., Allen, R., Davis, E.L., Baum, T.J., andHussey, R.S., Developmental Expression and Bio�chemical Properties of a β�1,4�Endoglucanase Familyin the Soybean Cyst Nematode, Heterodera glycines,Mol. Plant Pathol., 2004, vol. 5, pp. 93–104.

36. Creutz, C.E., The Annexins and Exocytosis, Science,1992, vol. 258, pp. 924–931.

37. Clark, G.N., Dauwalder, M., and Roux, S.J.,Immuno�Localization of an Annexin�Like Protein inCorn, Adv. Space Res., 1994, vol. 14, pp. 341–346.

38. Delmer, D.P. and Potikha, T.S., Structures and Func�tion of Annexins in Plants, Cell. Mol. Life Sci., 1997,vol. 53, pp. 546–553.

39. Cantero, A., Barthkur, S., Bushart, T.J., Chou, S.,Morgan, R.O., Fernandez, M.P., Clark, G.B., andRoux, S.J., Expression Profiling of the ArabidopsisAnnexin Gene Family during Germination, Deetiola�tion, and Abiotic Stress, Plant Physiol. Biochem., 2006,vol. 44, pp. 13–24.

40. Tsygankova, V.A., Andrusevich, Ya.V., andBlume, Ya.B., Isolation of Small si/miRNA with Anti�nematodal Activity from Cell from Plant Cells, Dop.NAN Ukraini, 2011, no. 9, pp. 159–164.

41. Tsygankova, V.A., Galkin, A.P., Galkina, L.A.,Musatenko, L.I., Ponomarenko, S.P., and Iutynska, H.O.,Gene Expression under Regulators’ Stimulation ofPlant Growth and Development, in New Plant GrowthRegulators: Basic Research and Technologies of Applica�tion, Ponomarenko, S.P. and Iutynska, H.O., Eds.,Kyiv : Nichlava, 2011.

42. Ponomarenko, S.P., Terek, O.I., Hritsaenko, Z.M.,Babayants, O.V., Moiseeva, T.V., Hu Wenxiu, andIkin, D., Bioregulation of Plant Growth and Develop�ment, in Bioregulyatsiya mikrobno�rastitel’nykh sistem (Bio�regulation of Microbial–Plant Systems, Iutinska, G.A. andPonomarenko, S.P., Eds., Kiev: Nichlava, 2010.

43. Tsygankova, V.A., Zayets, V.N., Galkina, L.A., Prika�zchikova, L.P., and Blume, Ya.B., An Unusual MinorProtein Appearing in Embryonic Axis Cells of HaricotBean Seeds Following Germination Process Stimu�lated by 6�Methylthiouracyl, Biopolym. Cell, 1998,vol. 14, no. 5, pp. 438–448.

44. Tsygankova, V.A., Concerning the Peculiarities ofGene Expression Changes in Plant Leaf Cells duringTwenty�Four�Hour Period, Biotekhnologiya, 2010,vol. 3, no. 4, pp. 86–95.

45. Tsygankova, V.A., Musatenko, L.I., Ponomarenko, S.P.,Galkina, L.A., Andrusevich, Ja.V., and Galkin, A.P.,Change of Functionally Active Cytoplasmic mRNAPopulations in Plant Cells under Growth RegulatorsAction and Biological Perspectives of Cell�Free Sys�tems of Protein Synthesis, Biotekhnologiya, 2010,vol. 3, no. 2, pp. 19–32.

46. Locker, J., Analytical and Preparative Electrophoresisof RNA in Agarose�Urea, Anal. Biochem., 1979,vol. 98, no. 2, pp. 358–367.

47. Maniatis, T., Fritsch, E.F., and Sambrook, J., Molecu�lar Cloning : A Laboratory Manual, New York: ColdSpring Harbor Lab., 1982.

48. Promega Protocols and Applications Guide, 2nd ed.,USA: Promega Corporation, 1991.

49. Tsygankova, V.A., Galkin, A.P., Galkina, L.O.,Sabluk, V.T., Kalatur, K.A., Stefanovska, T.R., andPonomarenko, S.P., An Increase in the Synthesis ofSmall Regulatory RNAs with Imunomodulatory Prop�erties in Plant Cells under the Influence of GrowthRegulators, Tsukr. Buryaki, 2011, vol. 82, no. 4,pp. 10–12.

Cytology and Genetics -Si-miRNA Cloning

Documents

Transcript of Cytology and Genetics -Si-miRNA Cloning