cultural and molecular detection of aflatoxigenic activity in Aspergillus flavus isolated from...

Cultural and molecular detection of

aflatoxigenic activity in Aspergillus flavus

isolated from poultry feed

A thesis submitted to the council of College of Veterinary Medicine-

University of Basrah in partial fulfillment of the requirements for the

Master Science Degree in Veterinary Medicine / Microbiology

By:

Raed Najeeb Kadhim Alkhersan

B.Sc. (2002)

Supervised by:

Prof.Dr. Mohammed H.Khudor Prof. Dr.Basil A. Abbas

2016 AD 1437 AH

Republic of Iraq

Ministry of Higher Education and Scientific Research

University of Basrah

College of Veterinary Medicine

بسم الله الرحمن الرحيم

ويسألونك عن الروح قل الروح من أمر ربي وما

(58)أوتيتم من العلم إلا قليلا

صدق اهلل العلي العظيم

(سورة اإلسراء)

Dedication

This humble work is dedicated to those who never left my mind a moment;

Granter of humanity science , culture and morals …

Messenger of Allah and Ahl al-Bayt,

To my parents who supported and kept supporting me when needed.

To my wife who helped a lot and continued in every step to

complete my work.


Acknowledgment

Praise be to Allah, the Almighty who blessed me with the wisdom to

perceive ideas for understanding this project.

I humbly pay my great gratitude and respects to the Holy Prophet “Peace

be upon Him and his family for their care throughout the duration of this

study.

It is my pleasant duty to express gratitude to my supervisors Prof .Dr.

Mohammed H. Khudor and Prof .Dr. Basil A. Abbas for their constructive

guidance and constant cooperation throughout my study.

I extend my thanks and appreciations to Assist.Prof.Dr.Ghazi Al-emarah

dean of College of Veterinary Medicine , Assist.Prof.Dr.Rasha Munther

Othman, head of department of microbiology and parasitology , and the

academic staff of Microbiology and parasitology department for awarding me

this valuable opportunity to complete my M.Sc. study.

I say my sincerest thanks to Prof. Abdullah Al Sadoon from Biology

department – College of Science for his valuable guidance, encouragement

help in the fungi identification throughout my research.

I express my gratitude to Prof. Dr. Atef A. Hassan , professor of

Mycology and Mycotoxins, Animal Health Research Institute, Dokki, Egypt,

for his valuable guidance for useful suggestions and moral support.

I am also thankful to Prof. Dr. Muslem Abdulrahman Mohamed, assist.

Prof. Dr. Kareem Hilal Thamer from Biology department – College of Science

and Dr. Ali Abdulrazzaq chemistry department, College of Science for their

efforts and assistance in chemicals preparations .

I would like to appreciate the help extended to me by Prof. Dr. Adnan

Albadran cell and biotechnology researches unit , for extending lab facilities

for my research work.

I feel great pleasure in expressing my sincerest thanks to Assist. Prof .Dr.

Munaf Jawdat from Biology department –College of Science and Dr.

Labeed Abdullah Najim Al-Saad, Agriculture College for their expert

guidance and cooperation in analysis of results of DNA sequencing .

Special thanks to all my friends , especially Hayder Abbas, Amged

Abdalrazaq , Hussein Jabbar Alrekaby and Jalal Afandi , M.S.c students and

Hayder Alhassanee M.S.c in engineering for their help and encouragement.

Finally, I appreciate any support, help and/or advice provided by any

generous person may I forget to list his name here and ask him/her to forgive

me.


I

Summary

The present study aimed to the occurrence of mycoflora in poultry feed,

determination of aflatoxigenic Aspergillus flavus and compatible homology

aflatoxigenic A.flavus strains with other strains in gene bank. A total of 180 samples

of concentrated poultry feed pellet were collected from different broilers, broiler

breeders and layers farms and local market of poultry in Basrah province . Feed

samples were collected during the period from Sep. 2014 to Apr. 2015. About 10 -

30 representative samples of 1 kg were collected from several locations. They were

cultured on Potato dextrose agar(PDA) and malt extract agar (MEA) and then

subcultured on Sabouraud dextrose agar (SDA) and coconut medium agar(CAM)

.Seven genera were recovered from 180 samples of poultry feed .The most genera

which recovered were Aspergillus (frequency(Fr) 62.77% - Relative density(RD)

52.03%), followed by Penicillium (Fr 47.77% - RD 17.01%) were the predominant

genera isolated from poultry feed, while Fusarium isolates were less frequency and

relative density(Fr.1.66%, RD 2.11%) .The most frequently isolated Aspergillus

spp.was Aspergillys flavus ( Fr 65.48%) and had the most RD (27.55%) , followed

by A.niger (Fr. 58.40%, RD14.23%),the less occurrence of Aspergillus was

A.paraciticus(Fr.1.76%, RD0.89%) .Fifty isolates of A. flavus were detect by UV

light (365nm) and ammonia vapor to detect aflatoxigenic A.flavus on CAM by

colored with blue –green on reverse of glass petri dish under UV light and produce a

pink to red color by exposure to ammonia vapor. The detection by fluorescent blue

revealed that 26 (52%) of isolates were aflatoxigenic (positive)by produce

II

fluorescent color under UV (356nm) light , and also 26 (52%) of isolates were

aflatoxigenic (positive) by ammonia vapor test. The molecular assessment was done

on 50 isolates of A.flavus by using primers pair for the aflatoxin regulatory gene

aflR in polymerase chain reaction (PCR). Five isolates of aflatoxigenic A. flavus

positive identified isolates by PCR were randomly selected to sequence and analyze

by basic local alignment search tool analysis (BLAST) to confirm the aflatoxigenic

strains. Five isolates were positive and confirmed approximately compatible(100%

and 99%) homology with other A.flavus strains on NCBI .

III

List of Contents

Numbers Subject Page

Summary I

List of contents III

List of tables VI

List of figures VII

List of abbreviations VIII

Chapter one: Introduction

1.1 Introduction 1

1.2 The aim of study 3

Chapter two: Review of literatures

2.1 Important mycotoxigenic fungi 4

2.1.1 Aspergillus species 4

2.1.2 Fusarium species 5

2.1.3 Penicillium species 6

2.1.4 Other toxigenic fungi 6

2.2 Mycotoxins 7

2.3 Mycotoxin occurrence 11

2.4 Factors influencing growth of fungi and production of

mycotoxin

12

2.4.1 Abiotic factors 14

2.4.1.1 Water activity 15

2.4.1.2 Temperature 16

2.4.1.3 Hydrogen ion potential (pH) 16

2.4.1.4 Oxygen supply 17

2.4.1.5 Carbon dioxide 18

2.4.2 Biotic factors 18

2.5 Regulation of mycotoxin biosynthetic genes cluster 19

2.6 Pre- and postharvest of mycotoxin contamination 20

2.7 Mycotoxin exposure , mechanisms of action and effect 21

2.7.1 Effects of mycotoxin on human 24

2.7.2 Effects of mycotoxin on animals 24

2.7.3 Effects of mycotoxin (phytotoxin) on plant 26

2.8 Methods to detect mycotoxigenic fungi 27

2.8.1 Detection by conventional microbiological methods 27

2.8.2 Analytical detection of mycotoxin production 28

2.8.2.1 Mycotoxins analysis by methods of chromatograph 28

2.8.2.1.1 TLC 28

IV

2.8.2.1.2 HPLC 28

2.8.2.1.3 GC 29

2.8.2.1.4 CE 29

2.8.2.2 Immunological methods for analysis of mycotoxins 29

2.8.2.2.1 ELISA 30

2.8.3 Cultural methods 30

2.8.3.1 Blue fluorescence 30

2.8.3.2 Ammonium hydroxide vapor-induced color change 31

2.8.4 Molecular detection of mycotoxin-producing molds 31

2.8.4.1 Polymerase Chain Reaction (PCR) 31

2.8.4.2 Real-time PCR 32

2.8.4.3 Future perspectives: new molecular methods 33

2.9 Main mycotoxins 33

2.9.1 Aflatoxins 33

2.9.1.1 Exposure and absorption into the organism 35

2.9.1.2 Metabolism of aflatoxin 36

2.9.1.2.1 Bioactivation 36

2.9.1.2.2 Conjugation 38

2.9.1.2.3 Deconjugation 38

2.9.1.3 The mechanism of toxicity 38

2.9.1.4 The role of aflR in aflatoxin pathway regulation 40

2.9.2 Fumonisins 40

2.9.3 Ochratoxins 41

2.10 The prevention and reduction of mycotoxins strategies 42

2.10.1 Practices of good agricultural quality 42

2.10.2 Biological control 44

2.10.3 Chemical control 45

Chapter three: Materials and methods

3.1 Materials 46

3.1.1 Instruments and equipment 46

3.1.2 Chemicals 47

3.1.3 Media 48

3.1.3.1 Coconut-Agar Medium (CAM) 48

3.1.3.2 Potato Dextrose Agar (PDA) 48

3.1.3.3 Malt Extract Agar (MEA) 48

3.1.3.4 Sabouraud Dextrose Agar (SDA) 49

3.1.4 Stains 49

3.1.4.1 Lactophenol cotton blue 49

3.1.4.2 Lacto-fuchsin 49

3.1.5 Kits 50

3.2 Methods 51

3.2.1 Collection of samples 51

V

3.2.2 Isolation and identification of fungi 51

3.2.3 Detection tools of aflatoxigenic A.flavus 52

3.2.3.1 Coconut based medium detection 52

3.2.3.2 Ammonia vapor detection 53

3.2.3.3 Molecular assay 53

3.2.3.3.1 Preparation of buffers, solutions and stains 54

3.2.3.3.1.1 TBE (1X) 54

3.2.3.3.1.2 Ethidium bromide 54

3.2.3.3.1.3 Agarose gel preparation 54

3.2.3.3.2 Preparing A.flavus mycelia for DNA extraction 55

3.2.3.3.3 DNA extraction 55

3.2.3.3.4 Polymerase chain reaction 57

3.2.3.3.5 PCR result analysis 59

3.2.3.3.6 Sequencing of PCR products for aflR gene 59

3.2.3.3.6.1 The basic local alignment search tool analysis (BLAST) 59

Chapter four: Results

4.1 Fungal isolation 60

4.2 Coconut based medium and ammonia vapor detection 69

4.3 Molecular detection 71

4.3.1 PCR 71

4.3.2 Sequencing analysis of PCR product 74

Chapter five: Discussion

5.1 Fungal isolation 82

5.2 Coconut based medium and ammonia vapor detection 84

5.3 Molecular detection 85

5.3.1 PCR 85

5.3.2 Sequencing and sequences analysis of PCR products for aflR

gene 86

Conclusions and recommendation 87

References 89

Appendix 116

VI

List of tables

Number Subject Page

1 Optimal conditions for fungal growth and mycotoxin production 14

2 Instruments and equipment with their remarks 46

3 Chemicals and biological materials 47

4 DNA extraction kit contents 50

5 PCR reaction kit and related materials 50

6 The sequences of the primers 54

7 Reaction components for PCR 58

8 PCR Program 58

9 Range and average count of cfu/g of recovered molds genera from

poultry feed samples 67

10 Frequency and relative density of recovered mold genera from

poultry feed samples 67

11 Range and average count of cfu/g of recovered Aspergillus

spp.from poultry feed samples 68

12 Frequency and relative density of recovered Aspergillus spp.

from poultry feed samples 68

13 Detection of aflatoxigenic and nonaflatoxigenic A.flavus isolates

from poultry feed by three methods 72

14

Aflatoxigenic and nonaflatoxigenic results obtained by CAM ,

ammonia vapor and PCR detection of A.flavus isolates recovered

from poultry feed samples

72

15 The compatibility of strains of A.flavus with other strains from

NCBI 76

VII

List of figures

Number Subject Page

1 Chemical structure of the different aflatoxins 35

2 Aflatoxin B1 pathways 37

3 Mechanisms of AFB1 toxicity 39

4 Fumonisins B1 structure 41

5 Ochratoxin A structure 42

6 The isolated molds genera from poultry feed on PDA medium 62

7 The isolated molds genera from poultry feed on PDA medium 63

8 The isolated Aspergillus spp. from poultry feed on PDA medium 64



11 The result of detection of aflatoxigenic A.flavus by CAM under

UV light (365nm) 70

12 The result of detection of aflatoxigenic A.flavus by ammonia

vapor 70

13 PCR products obtained through agarose gel electrophoresis from

DNA of A.flavus isolates showing amplicons for aflR primer 71

14 Sequence alignment of A. flavus isolate (Af1) 77





VIII

List of abbreviations

Abbreviation Full name

AF Aflatoxin

AFB1 Aflatoxin B1

AFB2 Aflatoxin B2

AFBS Aflatoxin B1 and B2

AFG1 AflatoxinG1

AFG2 Aflatoxin G2

AflR Transcriptional (regulatory) gene in Aflatoxin B1 biosynthesis

genes cluster

aflC A structural gene in in aflatoxin B1 biosynthesis genes cluster

aflD A structural gene in in aflatoxin B1 biosynthesis genes cluster

aflM A structural gene in in aflatoxin B1 biosynthesis genes cluster

aflP Amplified fragment length polymorphism

AfP1 Aflatoxin P1

AAT Alternaria alternata Toxin

ALT Alternariol

APA Aflatoxin producing-ability medium

BEN Balkan endemic nephropathy

IX


CE Capillary electrophoresis

CIT Citrinin

D.W Distal water

Don Deoxynivalenol

DAS Diacetoxyscirpenol

DA Diode array

DNAse Deoxyribonuclease

ELISA Enzyme-linked immunosorbent assay

FBs Fumonisins B

FL Fuorescence

g gram

GC Gas chromatography

GLIO Gliotoxin

GST Glutathione S-Transferase

h hour

HACCP Hazard analysis critical control point

HPLC High-performance liquid chromatography

X


UHPLC High-performance liquid chromatography

IARC International agency for research on cancer

IgA Immunoglobulin A

ITS Internal transcribed spacer

kDa kilo dalton

LD50 Median lethal dose

lps Lipopolysaccharide

LAMP Loop-mediated isothermal amplification

MLN Mesenteric lymph node

mm millimeter

min minute

MPA Mycophenolic acid

nm nanometer

NRPSs Nonribosomal peptide synthetases

OTA Ochratoxin A

Pat Patulin

PA Penicillic acid

XI


PEN Penitrem

PKSs Polyketide synthases

PRT Penicillium roqueforti toxin

qPCR quantitative polymerase chain reaction

RNAse Ribonucleic acid (RNA) enzyme

RQ Roquefort

MS Mass spectrometry

ST Sterigmatocystin

MS/MS Tandem Mass Spectrometry

TZA Tenuazonic acid

LC/ESI-

QTOF-MS/MS

The liquid chromatography and electrospray ionization quadruple

time-of- flight mass spectrometry

TLC Thin-layer chromatography

TF Transcription factor

T-2 Trichothecene

UV Ultraviolet

VER Verruculogen

Chapter one

Introduction

Chapter one Introduction

________________________________________________________________

1

1.1 Introduction

Poultry feed is food to poultry of farm such as ducks ,chickens , geese

,quails and domestic fowl . Poultry were mostly put on general farms before the

twentieth century, and feed of their, grain, eating insects, and plants near the

farm (Scherf, 2000; Romanov et al., 2009).Those of farms and hatcheries are

the source of the poultry feed .

The animal feeds purchased from abroad with large quantity and with the

increased confirmation on resources of animal, this quantity is predictable to

increase basically in coming years. Because the feed have a wide effect on the

birds ,it is necessary to have necessary quality control on them(Beg et al., 2005;

Shareef, 2010) . Poultry feed made for broiler: starter, finisher, and layer mash

(Beg et al., 2005).These feeds consist mainly of cereal, supplements of material

such as protein and as meal of soybean oil, vitamin (Steenfeldt et al., 2007;

Ravindran , 2013) .

Poultry feed industry is closely in relation with the primary agricultural

production and acts as an essential component of the food chain. Feed is

considered the major cost of poultry production that lies between 65 and 75%. ,

therefore , any effect on the feed leads to change on the performance of broilers

and layers (Ashraf et al., 2013).

The storage conditions are necessary to safe feed , so weather extremes

unsuitable storage practices and improper feeding conditions can cause feed –

fungal contamination that increase mycotoxins production (Dowd, 2004 and


________________________________________________________________

2

Hassan et al., 2012). Poultry feed is more susceptible to fugal growth during

processing, therefore identification of fungi with the ability to produce

mycotoxins is essential (Rosa et al. 2006).

Molds can grow and produce mycotoxins in preharvest and through

storage, convey, operations of processing or feeding . During these periods,

humidity and temperature play an important role in the fungi growth and

mycotoxins contamination (Krnjaja et al., 2008) . In wet feeds, increasing of

moisture levels help mold growth if oxygen is available (Lanyasunya et al.,

2005). Feeds with more than 12-15% moisture suitable to grow fungi . Because

aerobically growth of most molds, increasing of moisture concentrations can

eliminate air and prevent mold growth (Whitlow and Hagler, 2008).These

conditions are most appropriate for mold growth and for mycotoxin production

are not necessarily the same (Simpson et al., 2001). About 100.000 fungal

species are believed as natural contaminants of agricultural and products of

food.

There are general standard methods for determination of mycotoxins in food

including conventional methods and molecular methods. The conventional

methods such as culture and microscopic which are composed of culture-based

methods for detection and enumeration of fungi also determination and

identification of mycotoxins.The molecular methods including polymerase chain

reaction (PCR), pulsed-field gel electrophoresis(Yeni et al., 2014).


________________________________________________________________

3

1.2 The Aim of Study

1. Study the occurrence of mycoflora in poultry feed.

2.Determination of aflatoxigenic Aspergillus flavus which cause

contamination in poultry feed .

3. Compatible homology aflatoxigenic A.flavus strains with other strains in

gene bank.

Chapter two

Review of literatures

Chapter two Review of literatures

________________________________________________________________

4

2.1 Important mycotoxigenic fungi

Most filamentous fungi produce one or more mycotoxins (Demain and Fang

,2000) .Those of economic importance with respect to producing mycotoxins are

those belonging to the Fusarium, Aspergillus, Penicillium, Claviceps and Alternaria

, Although , one cannot forget the benefits derived from the use of fungi in the

food and pharmaceutical industry.

2.1.1 Aspergillus species

The Aspergillus spp. are filamentous and are among the most group of

microorganisms that are found in nature as in the soil, plant debris and indoor air

environments ((Myatt et al., 2008). The teleomorphic state has been described for

some of the Aspergillus spp. and others are without any known sexual spore

production. About 180 Aspergillus spp. exist (Klich, 2002) of which A. flavus and A.

parasiticus, are most widely studied because of their important role in AFs

production (Sánchez et al.,2005). Other spp. as A. sojae , A. oryzae and A.

awamori are economically important, they are used in industry as for enzymes

(amylase) and organic acids (citric acid) production or in the beverage and food

industries as flavourants and colorants (Klich, 2002). Several of these fungi act as

causative agents of opportunistic infections in human , animal and plant .They often

contaminate cereal grains, nuts and animal feeds . Within this genus, A. fumigatus is

the most commonly isolated spp., followed by A. niger and A. flavus (Eidi et al .,

2014) .


________________________________________________________________

5

This species of fungi are found mainly in tropical and subtropical regions and

their occurrence is more common than Penicillium (Samson et al., 2002). Among

this group , A .flavus and A. parasiticus are known to produce AFs (AFB1, AFB2,

AFG1 and AFG2), A. ochraceus, A. ostianus, A. sclerotiorum A. niger and A.

carbonarium have the ability to be producers of OTA and PA, while PAT was

produced mainly by A. clavatus and A. terreus., A. carneus and A. terreus are

known to produce CIT (Klich , 2002). In addition, several other mycotoxins such as

cytochalasin E, VER and GLIO produced by A. versicolor, A. fumigatus (Mwanza,

2011). A. flavus is widely distributed in nature and is largely found at cereal and

grains. Before harvest or during storage, A. flavus grows at agricultural crops (Saini

and Kaur, 2012). Its growth is affected by the environmental condition such as

temperature and relative humidity (Giorni et al., 2012).

2.1.2 Fusarium species

Fusarium is widely considered as an amorphic genus, and they are considered as

one of the most economically important genera of fungi common in tropical and

subtropical regions(Gräfenhan et al., 2011). Fusarium spp. are found in soil which

contaminate almost all plant spp.Some of them are pathogenic to human and

animals causing fusariosis in human , pulmonary edema in dairy cattle and necrotic

enteritis in poultry , other have to be plant pathogen and cause disease such as

crown and root rots (Marczuk et al ., 2012 ; Antonissen et al 2014) These species

include F. verticillioides , F. sacchari, F. fujikuroi, F. proliferatum, F. subglutinans

(Hsuan et al., 2011) .Most of these species are economically important as , F.


________________________________________________________________

6

verticillioides (F. moniliforme) which is known to produce FBs mycotoxins F.

graminearum is also an important Fusarium spp. known to produce zearalenone

(ZEA) and DON ,other Fusarium spp. of interest are F. proliferatum and F.

nygamai, also known to be producers of fumonisin mycotoxins such as

trichothecenes (Czembor et al., 2015).

2.1.3 Penicillium species

Penicillium spp. are widely found in soil, decaying vegetation and in the air and

food (Pitt and Hocking, 2009).Almost Penicillium spp. are looked to be

opportunistic saprophytes and many appear as habitat of primary natural on cereal

grains (Frisvad and Thrane, 2002).Several members such as P. digitatum, P.

expansum, P. italicum and P. roqueforti are pathogens on fruits capable of causing

food spoilage. Others may cause infections, particularly in immuno-compromised

hosts, as P. marneffei which is pathogenic particularly in patients with HIV-AIDS.

In addition, P. marneffei isolation from blood has been used as an HIV marker in

endemic areas (Pitt and Hocking, 2009). And also, some species act as poultry

pathogen and cause neurotoxic effect . Penicillium spp. are known to be producers

of OTA, CIT, PAT , PEN, RQ, PRT, PA and MPA in human , animals and

plants ( Bouhet and Oswald, 2005).

2.1.4 Other toxigenic fungi

Alternaria and Claviceps are the fungal genera of economic importance not only

recognized as plant pathogens (Dutton and Kinsey, 1996). The species A. alternata


________________________________________________________________

7

being the most common human pathogen . The common mycotoxins produced by

this genus are TZA, AAT and ALT ( Pose et al., 2010) .The fungus Claviceps

purpurea, is one of the most important and notorious fungi in human history (Alm,

2003). Claviceps purpurea is known to grow on the ears of rye and related cereal

and forage plants (Lev-Yadun et al., 2004) .

2.2 Mycotoxins

Mycotoxins are low molecular weight (Khayoon et al.,2014). Natural products

and toxic chemical secondary metabolites produced by filamentous fungi when they

grow under favorable conditions on foods and feeds (Aquino, 2011; Bolechová et

al.,2015; Cardoso et al.,2015). Chemical structure , they vary from simple C4

compounds, e.g., moniliformin, to complex substances such as the phomopsins

(O’Brien and Dietrich , 2005 ; Milićević et al., 2010 ) .

Mycotoxins resist decomposition or being broken down in digestion and

thermal stable , so they remain in the food chain even after heat treatment, such as

cooking and freezing (Milicevic,2009; Al-Kahtani ,2014; Czéh, 2014 ). There is no

reason of mycotoxins production known yet (Fox and Howlett , 2008 ; Suhaimi

et al., 2014 ), but they inhibit the physiological functioning of other organisms as

antibiotics which inhibit the growth of bacteria to provide a competitive advantage,

also may inhibit the growth of fungal species (Godish, 2001; Magan and Aldred

,2007). They do not have role in a normal metabolism containing growth and

development of the fungi (Mashinini, 2004;Keller et al.,2005 ; Al-Fakih, 2014) ,

http://www.sciencedirect.com/science/article/pii/S0956713514003740



________________________________________________________________

8

but they are produced after the fungus has completed its initial growth phase (Calvo

et al., 2002; Bhat et al., 2010 b).

Significantly , mycotoxins are non-volatile, therefore, they are non-airborne

except if they are attached with a particle and there are an aerosolization happening

,therefore , enough exposure through inhalation is uncommon (Fischer et al., 2000;

Jargot and Melin , 2013;Täubel and Hyvärinen, 2015) So, they remain in food or

feed products long after fungi have disappeared (Pscheidt and Ocamb, 2015).

Mycotoxins affect several agricultural products, including root crops ,cereals,

oilseeds, pulses, nuts, dried fruits, and coffee beans (Rohr et al ., 2015 ; McMullin

et al ., 2015; Stoev ,2015) . Contamination of agricultural products occurs because

of infection by toxigenic fungi under favorable environmental conditions in the field

at various stages in the food chain, e.g., pre-harvest, harvest, drying and storage

(Paterson and Lima,2010; Waliyar,2015). The presence of mycotoxins in feedstuffs

decrease the quality of feed in of both protein and value of energy (Pizzolitto et al.,

2013;Greco et al., 2014) ,therefore , they cause economic decline , an annual loss of

25percentage of the food production in world is rated to be lost because of spoilage

by mycotoxins. Additionally 5 - 10% of food losses can be attributed to fungal

spoilage (Pitt and Hocking, 2009; Wu, 2015).Annually, there are around 2.2 million

people died because of food contaminated with mycotoxins (WHO, 2013; Wu,

2015 ).

Fungi need moisture (relative >12%), oxygen as a minimum 1% - 2%, time and

temperature (changing depending on species; high temperature supports Aspergillus,

http://www.ncbi.nlm.nih.gov.sci-hub.org/pubmed/?term=Fischer%20G%5BAuthor%5D&cauthor=true&cauthor_uid=11109562

http://pubs.rsc.org/en/results?searchtext=Author%3ADani%C3%A8le%20Jargot


http://pubs.rsc.org/en/results?searchtext=Author%3ASandrine%20Melin

http://www.ncbi.nlm.nih.gov/pubmed/?term=McMullin%20D%5BAuthor%5D&cauthor=true&cauthor_uid=25258282

http://www.ncbi.nlm.nih.gov/pubmed/?term=Stoev%20SD%5BAuthor%5D&cauthor=true&cauthor_uid=25734690


________________________________________________________________

9

low temperatures supports Fusarium) for growth (Magan et al.,2004; Pardo et al.

2005a,b ; Vieira et al ., 2015). Mycotoxins may get concentrated more in broken

grain than whole grain. (CAST, 2003; Chaytor et al. ,2011). Mycotoxins mainly

have synergistic effects, so the damage and spoilage caused by the combination is

more destructive (Ruiz et al ., 2011; Klarić et al., 2013 ; Li et al ., 2014). At low to

temperate levels, multiple mycotoxins can cause symptoms predominantly rather

than those associated with individual mycotoxins(Chaytor et al., 2011; Antonissen

et al ., 2014).The Immunosuppression is one of the serious outcomes of

contamination with mycotoxin, often is not noticed., making the bird or animal

susceptible to infection and problems of complex disease (CAST, 2003; Ramos et

al., 2010). Only about 100 of fungi are known to produce mycotoxin .There are

three main genera of fungi which produce mycotoxins: Aspergillus, Penicillium and

Fusarium (Dersjant-Li et al,. 2003; Gajęcka et al., 2011; Azaiez et al.,2014), the

global occurrence of them is considered to be a major risk factor, affecting human

and animal health. It is estimated that up to 25% of the world’s crop production is

contaminated to some extent by these toxigenic fungi (Larsen et al .,2004; Schmidt-

Heydt et al.,2011).Some fungal species are able to produce many mycotoxin , also

some mycotoxins are produced by more than one species (Pereyra et al., 2010;

Gutleb et al ., 2015).

Over 400 mycotoxins have been isolated and identified , but only a small

number of mycotoxins known to cause serious diseases in humans also animals

were studied (Kabak et al., 2006 ; Dzuman et al.,2015; Cao et al.,2015) . There are

http://www.ncbi.nlm.nih.gov/pubmed/?term=Cao%20X%5BAuthor%5D&cauthor=true&cauthor_uid=24239936


________________________________________________________________

10

five major types of mycotoxins which infect human , animals health and

agricultural significance: (i) aflatoxins, (ii) fumonisins, (iii) ochratoxin A, (iv)

zearalenone and (v) trichothecenes (Marroquín-Cardona et al.,2014; Njumbe Ediage

et al., 2015; Degraeve et al., 2015). When mycotoxins ingested by animals or

humans, mycotoxins cause a toxic response known as mycotoxicosis (Richard and

Payne,2003; Pruimboom et al.,2014 ; Armenda´riz et al., 2014) , and cause acute

and chronic disease and effects on humans and domesticated animals as acute toxic,

carcinogenic, mutagenic, teratogenic and oestrogenic effects at the levels of

exposure (CAST, 2003; Gomaa et al., 2008 ;Cortinovis et al., 2013; Wcislo and

Szarlej-Wcislo 2015 ; Bennett and Moore ,2015) .

The presence of excessive mycotoxins can cause grain shipments to be

rejected by importing countries resulting in a loss in consumer confidence in the

importing country and severe economic losses for the exporting country. A main

possibility danger of mycotoxins is in the human diet, therefore, resides in the

disability in detection of them biologically( CAST,2003 ; Dohlman, 2003; Calvet et

al ., 2015). Mycotoxins can be classified into four kinds of toxicity: as hepatotoxins,

nephrotoxins, , immunotoxins and neurotoxins. Cell biologists place them in generic

toxins such as mutagens ,teratogens, carcinogens, and allergens (Omar, 2013;

Sorrenti et al., 2013). Kidney and liver function deterioration has been described as

the most common effect of acute mycotoxin poisoning, that were in excessive cases

may cause death (Voss et al .,2001; Zomborszky-Kovacs et al., 2002 ; Wild and

Montesano, 2009).


________________________________________________________________

11

Some of mycotoxins can interfere with synthesis of protein, and result in effects

fluctuating from sensitivity of skin or necrosis to extreme immunodeficiency

(CAST,2003 ; Li et al., 2011; Ferreras et al., 2013) . Others are neurotoxins, which

at low doses, can lead to continuous quiver in animals at high doses result in a brain

damage or death (Pitt , 2000; CAST,2003).

The primary effect of chronic of many mycotoxins is the induction of cancer,

particularly of the liver (O’Brien and Dietrich, 2005;Groopman et al., 2008; Ouko,

2014). Some mycotoxins inhibit DNA and RNA replication through impairment of

amino acid transport and m-RNA transportation cause antibody production in lower

level, and hence can cause mutagenic or teratogenic effects (Egner et al., 2001;Surai

et al., 2008; Liu et al., 2014; Hedayati et al.,2014).

2.3 Mycotoxin occurrence

Mycotoxin occurs in products of agricultural raw, processing foods, and

products of animal like meat, eggs and milk(CAST,2003; Streit et al., 2012).

Approximately 25% of crops in the world are affected by mycotoxins with variable

level annually (Lawlor and Lynch , 2005; Bhat et al., 2010b).

Mycotoxins contamination of samples feeds are six types: aflatoxin B1, ZEA,

DON, fumonisin, T-2 toxin and OTA ( Škrinjar et al .,2011 ; Rodrigues and Chin ,

2012). Feed of products obtain from production of ethanol can be contaminated up

to three times with mycotoxins than the main grain which product is derived from it,

because of removing of starch and mycotoxins would be concentrated in the

leftover(Zhang et al., 2009;Rodrigues and Chin,2012).Occurrence of mycotoxins

http://www.ncbi.nlm.nih.gov.sci-hub.org/pubmed/?term=Pitt%20JI%5BAuthor%5D&cauthor=true&cauthor_uid=10885115

http://www.ncbi.nlm.nih.gov/pubmed/?term=Groopman%20JD%5BAuthor%5D&cauthor=true&cauthor_uid=17914931


________________________________________________________________

12

and concentrations are changeable annually and related with changeable in

conditions of weather and stresses of plant (Coulumbe, 1993; Whitlow and

Hagler,2008).

Occurrence of mycotoxins is less frequent at greatly concentrations can be

caused instant and exciting damages in health and activities of animal, although they

happen considerably in a different feeds and in animals feeds (Danicke,

2002;Whitlow et al., 2010 ).

2.4 Factors influencing growth of fungi and production of mycotoxin

Growth of fungi is mainly dependent on several factors within the environment.

However, the moisture is very important for surviving them, but other

circumstances equally affect the development and mycotoxin synthesis (Atalla et al.

, 2003; Essono et al. ,2009) . The conditions production of mycotoxin are ordinarily

more finite than are the normal growth conditions of fungi (Magan et al., 2014).

Fungal colonization, development and subsequent mycotoxins production in foods

and feeds depend on different variables, which can be classed as abiotic and biotic

factors (Marin et al.,2012 ; Milani, 2013) .

The most important abiotic factor (environmental factors) are water activity

(aw) of the substrate and temperature that in combination provide ideal cases for

growth of fungi and production of mycotoxin (Guo et al., 2005). Other abiotic

factors are the gaseous composition of the surrounding atmosphere and pH of the

substrate. Respiration, insects and mites as well as competitions with other fungal

species and other microorganism are the most important biotic factors that

http://www.ncbi.nlm.nih.gov/pubmed/?term=Atalla%20MM%5BAuthor%5D&cauthor=true&cauthor_uid=12653428


________________________________________________________________

13

influence fungal growth on food (Yu, 2012). Also, studies have shown that

interactions and combination between these factors influence the predominance of

fungi, particularly mycotoxigenic spp. (De la Campa et al., 2005).

Fungi foray only a secondary part of a commodity in which convenient

conditions for a growth exist (Murphy et al., 2006). CO2,O2 and genetic

characteristics also influence the production of mycotoxins and may obviously

differ from those for fungal growth (Atalla et al. , 2003). The optimal conditions of

mycotoxins production by some important fungi have been listed in table(1)

according to Murphy et al. (2006) , who showed that most mycotoxins are

produced under temperatures varying between 0-33C° and aw between 0.93-0.99. A

relationship that exists between these factors and fungal growth (Sautour, 2001a, b;

Astoreca et al., 2009).

The influence of abiotic factors on growth of fungi and mycotoxin production

can be an important consideration in expectation fungal contamination of foods both

in the field and during storage(Paterson and Lima, 2010 ; Lee et al., 2015). Food

and feed materials vary in their capability to assist growth of fungi because of their

variation in chemical and physical properties, as aw, O2 availability and surface

area (Tirado et al., 2010). Also other factors such chemical constituents (nutrient

composition) as fat, carbohydrates, protein and trace elements that support this

growth and production (Zaki et al., 2012).



________________________________________________________________

14

Table (1) Optimal conditions for fungal growth and mycotoxin production

Mycotoxigenic fungi

spp.

Mycotoxins

Temp

(°C)

Aw Reference

Aspergilluskflavus,

A.parasiticus

aflatoxins 33 0.99

Hill and others 1985

A. ochraceus. A. niger ochratoxin 31-37 0.98 Ramos and others 1998

A. carbonarius ochratoxin 15-20 0.85-0.90 Cairns and others 2003

Fusarium verticillioides fumonisin 10-30 0.93 Mitchell and others2003

F. proliferatum fumonisin 10-30 0.93 Marin and others 1999

F. proliferatum deoxynivalenol 11 0.90 Hope and Magan 2003

F. graminearum zearalenone 25-30 0.98 Sanchis 2004

Penicillium expansum patulin 0-25 0.95-0.99 Sanchis 2004

2.4.1 Abiotic factors

Abiotic factors are not living compositions environmental(chemical and physical)

factors. Abiotic factors are classed to four general types: physiographic factors

(topography and location); climatologic factors like light, temperature, air pressure ,

wind, , humidity and rainfall ; edaphic factors: soil composition such as sand, clay,

loam , mineral salts , pH of soil, and trace elements, water-holding capacity

(Mandeel, 2002 ; Cardwell and Henry, 2004) and gases factors such as vapour,

oxygen, carbon dioxide and nitrogen (Mwanza, 2011).

http://www.tandfonline.com/author/Cardwell%2C+K+F

http://www.tandfonline.com/author/Henry%2C+S+H


________________________________________________________________

15

2.4.1.1 Water activity (aw)

It is the pressure of vapor of food at same temperature and external

pressure(Chirife and Fontana, 2007) , and is unlinked water measurement in the

food obtainable for the growth of fungi (Zaki et al., 2012). In low aw , the fungi

ability to survive and adapt to environments varies from one species to

another(Leong et al., 2011). The required aw for fungal growth is between 0.61 and

0.91, and most storage fungi grow at aw below 0.75 (De Camargo et al., 2012;

Juneja et al ., 2012).

Water activity is affected by various small molecular and soluble compounds in

food. In case of spore formers, decrease of aw extends lag phase of growth and

extends the time to toxin production ,decreases growth rate, and reduces the

densities of maximum population (Juneja et al ., 2012).

The lowest aw for growth is 0.61 and below this value the spoilage of foods

cannot be fungal it may be insect damage or chemical (Adams and Moss, 2000).

Other factors such as temperature, pH, acid and nutrients can also interact with aw

and either inhibit or support fungal growth (CAST, 2003). Fusarium grows best at

higher aw of 0.98 whereas Penicillium and Aspergillus grow best at aw of 0.95,

(Choi et al.,2015). High moisture determines the extent of mycotoxin contamination

in stored food and feed and in the field and at storage (Hell et al., 2008) .

Aflatoxin production was highest at 0.98 and 0.95 aw at 25°C, ZEA at 0.98 aw

at 25°C and 0.95 aw at 16°C, the production of OTA was best at 25°C (Bhat et al.,


________________________________________________________________

16

2010 a). Thus, aw is very important for fungal growth and mycotoxins production.

2.4.1.2 Temperature

Temperature is an important factor for fungal growth and mycotoxin production

in food and feeds (Paterson and Lima,2010) . The role of temperature in the survival

of fungi by its influence on functioning of membrane-localized transporters and

enzymes activates the cell by effect on fatty acids incorporated into phospholipids in

the membrane (Maheshwari et al., 2000) .

The values of temperature are vary from one species of fungi to another , the

optimal temperature for production of most mycotoxins varies between 25-33°C

depending on the fungus and the type of mycotoxins they produce (Pitt and

Hocking, 2009). Aspergillus spp. require a narrower temperature range 15-40 C° for

growth and Penicillium spp. 25-30 C° , whereas the optimal temperature range of

37-47 C° for most Aspergillus and 28-30°C is ideal for Penicillium. Conversely,

Fusarium spp. can be considered as psychrophilic, because of its ability of growth

and reproduction in very low temperatures (Robinson, 2001; Francisco and Usberti,

2008).The suitable temperature of production of AFBs by A. flavus and A.

parasiticus occurred between 24-28 C° with optimum production at 25 C°, while F.

verticillioides have an best growth between 25 and 30°C (Marın et al., 2010). The

maximum production of OTA by A. ochraceus was around 30°C (Soso et al., 2012).

2.4.1.3 Hydrogen ion potential (pH)

The pH is a measure of the alkalinity or acidity of a substrate and expressed as

the negative logarithm of the H ion (H+) concentration . Food and feed materials

http://www.ncbi.nlm.nih.gov/pubmed/?term=Maheshwari%20R%5Bauth%5D


________________________________________________________________

17

vary with respect to their pH values and will host different fungal spp. and these

organisms have specific pH requirement for growth. There are a competition

between fungi and bacteria as food spoilers at high pH, but at lower pH, fungi can

out compete with most bacteria, and most of these fungi are less affected at pH

values, commonly 3 and 8 , other fungi can be grown at pH less than 2, (Pitt and

Hocking, 2009). However, the medium pH act as an necessary control over an

obtained morphogenic factors such as color, smell and density without affecting the

overall growth of some fungi(Zaki et al., 2012).

The H ion concentration is an important element in the mycotoxins production

, and it can influence the three dimensional structure of proteins, including the

enzymes , then affect on the cellular metabolism, the transport of nutrients and the

electrons transfer (Cojocaru, 2007),so the optimum pH for AF production by

Aspergillus spp. is between 3.5 and 8.0 (Oseni, 2011) while OTA production by A.

ochraceus is at minimum pH of 2.2 (Soso et al ., 2012) and for FB1 production by

F. verticillioides is at pH of 7.5 (Rao et al., 2010).

2.4.1.4 Oxygen supply

The most important and necessary element required for fungal growth is O2,

but also under anaerobic conditions , certain species can grow with the ethanol and

organic acids formation (Deacon , 2006). Almost fungi require 1-2% O2 in growing

(Forristal et al., 2000), while mycotoxins production influenced by the presence or

absence of O2 in the environment (Deacon , 2006). The growth of most Aspergillus

spp. is restricted at an O2 concentration of less than 1% ( Valero et al ., 2008),


________________________________________________________________

18

except F.moniliforme , it is able to grow at 60% CO2 and less than 0.5 % O2

(Bakutis et al ., 2006).

Penicillium roqueforti have the lowest growth requirement of oxygen than other

Penicillium species(Deacon , 2006).Production of FB1 under O2-limited conditions,

less growth occurred, while glucose consumption was increased with no FB1 being

produced. The entrance of oxygen will allow the growth of fungi , resulting losses in

the silage nutrient (McNamara et al., 2002).

2.4.1.5 Carbon dioxide

All fungi need carbon dioxide in small amounts to generate fatty acids,

oxaloacetate, etc. Anaerobic fungi grow in conditions often have a high CO2

requirement, whereas several aerobic fungi can be grown by high concentrations of

CO2(Deacon , 2006 ).Slightly increased CO2 concentrations ,in addition to elevated

temperature and water providing may induce some mycotoxigenic fungi growth,

particularly with stress of water (Magan et al.,2011).

2.4.2 Biotic factors

They are an important factors can influence fungal growth and mycotoxins

production , and are mainly living organisms effect on the growth, structure, and

composition of the fungi and mycotoxins (Magan and Aldered, 2007). Filamentous

fungi respond to numerous biotic signals that come from other organisms (fungi,

bacteria, animals and plants) in the natural environment . Other organisms can

produce a variety of physical and chemical signals, which influence the growth,

behavior, metabolism and gene expression of filamentous fungi. Physical and


________________________________________________________________

19

chemical signals from plant or animal hosts can assist the invasion and penetration

of hosts by fungi (Gow, 2004; Lucas, 2004).

Insect pests are among common biotic factor , causes problems in grains and

grow and multiply at water availableness much drier than those at which fungal

growth in grain (Magan et al., 2004). They can generate heat by metabolism of

organic material to generate water and can condense on grain surfaces due to

temperature differentials to induce fungal growth and grain spoilage (Magan et al.,

2004).

Post-harvest production of aflatoxin in maize increase by pre-harvest insect

infection as damage to the host plant, susceptible crop growth stages, poor soil

fertility, high crop density, and weed competition (Bruns, 2003) .Some storage

insects are provider of storage fungi by carrying the spores (Magan et al., 2004).

2.5 Regulation of mycotoxin biosynthetic genes cluster

Mycotoxin producer fungi have complex genomes, with species variations

predominantly in regulation of genes of the secondary metabolites synthesis, as

mycotoxins (Moretti et al ., 2013). The pathways of mycotoxin biosynthetic and the

producing fungi identification have relation with health interest that associated with

mycotoxin contamination (Wang and Tang, 2005).The genes responsible for

biosynthesis of mycotoxin are often clustered (Bhatnagar et al., 2006) that can

occupy several kilo-bases on the genome (Alkhayyat and Yu, 2014). At least one

pathway-specific (TF) in each mycotoxin gene cluster is often contained that

regulates genes within the cluster. AflR gene is the most studied which regulates AF


________________________________________________________________

20

biosynthetic genes in Aspergillus flavus and A. parasiticus and (ST) gene cluster in

A. nidulans (Ehrlich et al., 2005) , while FUM genes cluster regulate fumonisin

biosynthesis in Fusarium verticillioides (Brown et al., 2007) .

Many gene clusters contain one or several enzymes that belong to PKSs or

(NRPSs) family act as colossal multimodular enzymes which facilitate the structure

of the main scaffold of many secondary metabolites . These enzymes encoding by

key structural genes(Brodhun and Feussner, 2011). Other enzymes can provide

various modifications to the original structure (Karlovsky, 2011).

2.6 Pre- and postharvest of mycotoxin contamination

ontamination with mycotoxin is a collective process which starting in the

field , increasing during harvest, drying, and storage Mej a-Teniente et al ., 2011).

Fungi which colonize grain classed into two groups: field fungi and storage fungi.

Field fungi affect the seeds before the harvest ,while the crop is found in the field

and need high conditions of moisture about 20-21% to grow, but the storage fungi

are fungi which invade grains or seeds during storage and could grow at moisture

contents in equilibrium with relative humidity of 70 to 90% (Bakutis et al ., 2006).

By this dividing, Alternaria, Cladosporium, Fusarium, and Helminthosporium were

classified as field fungi; Aspergillus and Penicillium were dividing as storage fungi.

Even in climates of temperate when the growth season is often dry and hot,

Aspergillus and Penicillium species can invade seeds in the field (CAST,2003).

Aspergillus flavus is an important species which affect seeds in the field and storage

(Horn, 2005) .


________________________________________________________________

21

Fungus is predominately a storage fungus in temperate climates. Many

Fusarium species as well as some Penicillium species, effect grain in the field and

in storage (Atanda et al., 2011) . Many mycotoxigenic fungi grow in saprophytic

form , and these fungi may be contaminate grain by contact with soil or debris of

plant. Inoculum in field with affected seeds would be transmit to other kernels in

storage (CAST,2003).

Mycotoxin contamination widespread during cultivation, harvest, drying,

storage, transit and distribution. Preharvest infection by A. flavus is the major cause

of aflatoxin contamination in peanut. Mycotoxins have been contaminated a wide

range of commodities with both pre- and post-harvest ,this concerns both farmers

and consumers (Milicevic et al ., 2010) . The fungi species contaminant pre-harvest

crops are Fusarium, Alternaria and Aspergillus, while post-harvest infection fungi

species is most often caused by Penicillium roqueforti, P. paneum, Zygomycetes,

Aspergillus fumigatus, Byssochlamys nivea and a few other fungi(Storm et al .,

2014).

2.7 Mycotoxin exposure , mechanisms of action and effect

Growth of mycotoxin concerns occur increasingly because of their effect on

human , animal health and plant. There are four main routes of mycotoxins

exposures in human and animals: ingestion, inhalation, dermal and parental routes.

The main route of exposure to mycotoxins is ingestion, which come from

consuming of mycotoxin contaminated food or feed, while inhalation or bioaerosol

route is more severe route than others , by which airborne mycotoxins can be


________________________________________________________________

22

inhaled during the breathing process. In case of dermal route is exposure of the skin

to mycotoxins , via handling material contaminated with mycotoxins (Zain , 2011).

Parental exposure is transmission of mycotoxin from a mother to child through the

placenta or during breast feeding (Njobeh et al.,2010).

There are many factors affecting the toxicity quantity of human or animal

consuming foods or feeds contaminated with mycotoxin, they include species,

action mechanisms/modes, metabolism, and defense mechanisms(Hussein and

Brasel , 2001) .

Direct effect of mycotoxin range from acute to chronic disease . At acute ,

severe conditions as poisoning of liver or kidney function may lead to health as a

result of exposure to high levels of a mycotoxin (Pitt, 2000) . Chronic conditions

have a much greater impact , immunosupression and cancer are chronic effects ,

reduced growth and development, that have a greater happening continual exposure

to minimum level ingestion of mycotoxin (Bryden, 2007).

Other conditions(e.g., growth retardation, impaired immunity, immunosupression

and cancer are chronic effects, reduced milk or egg production) or more chronic

manifestations of disease (e.g., formation of tumor) because of protracted exposure

to small quantities of toxin. The exposure at low level is concern where food and

feeds are in a better quality. When the mycotoxin effected the contaminated foods

is aflatoxin , The diseases caused called aflatoxicoses (CAST, 2003) .


________________________________________________________________

23

Combined effect of more mycotoxins or with bacterial toxins is very hard to

predict than the effect of a single mycotoxin because it is influenced by several

factors, including chemistry and mechanism of action, toxicodinamics and

toxicokinetics as synergistic effect (Šegvić Klarić, 2012) . The combination of DAS

with AF suggesting a synergistic effect and have been confirmed as acutely and

fatally hepatotoxic and nephrotoxic (Zain , 2011) . Increasing of mortality can be

occur partly by the synergistic effects of mycotoxin combination with bacterial toxin

, (LPS) and T-2 at the late phase of murine salmonellosis. Also Salmonella

Typhimurium, DON with Salmonella Enteritidis decreased the resistance to oral

infection in mice by promoting translocation of Salmonella to MLN, spleen and

liver (Antonissen et al ., 2014).

Mycotoxicoses are diseases caused by mycotoxins , occur by ingestion routes

, also dermal and inhalation routes, range from tumor formation to rapid death, and

related with feed or food, considered as non-transferable ,non-contagious , non-

infectious, and non-traceable to microorganisms other than fungi mycotoxins (Zain ,

2011). Several commodities may be contaminated with mycotoxins in both pre-

and post-harvest ( CAST, 2003) .

More obscure disease happened after interferes of mycotoxin occur with

immune system , a high susceptible of performance of the patient take place to

infectious diseases.A fundamental event of mycotoxin can be increased by the

infectious disease.Epidemiological,clinical and histological results in mycotoxicoses

outbreaks coming from exposure to aflatoxins, ergot, ochratoxins ,trichothecenes, 3-


________________________________________________________________

24

nitropropionic acid, zearalenone and fumonisins(Bennett and Moore , 2015). A

wide range of actions of mycotoxins on animals and humans to include cytotoxic,

nephrotoxic and neurotoxic, carcinogenic, mutagenic, immunosuppressive and

oestrogenic effects have been characterized (Krska et al., 2007).

2.7.1 Effects of mycotoxin on human

Mycotoxins related with a number diseases of human.Their effects and

symptoms will equally vary significantly ,although , mycotoxins have highly

variable structural chemistry and different toxicological properties, (Njobeh et al.,

2010).Mycotoxins effects include toxigenic activities in sensitive species which

include carcinogenicity, immunosuppression, protein synthesis inhibition, dermal

irritation, and other metabolic perturbations depending on the type of toxin duration

and amount of exposure(Turner et al., 2003).

The synergistic effect of mycotoxin exposure with some important diseases

such as kwashiorkor, tuberculose malaria and HIV/AIDS have been recorded

(Turner et al., 2003; Gong et al., 2004).The important role of mycotoxicosis is in

suppression of immune in populations of human , this exposure was associated with

decreased levels of secretory IgA (Turner et al., 2003).

2.7.2 Effects of mycotoxin on animals

Contamination of mycotoxins in cereals and related products used in animal

feeds production may cause poisoning , particularly in farm animals (Krska et al.,

2007), causing loss of animals and equally reduces the economic output of the


________________________________________________________________

25

farm enterprise. Ruminants (cattle, sheep and goats) are less sensitive to mycotoxins

than non-ruminants (Hussein and Brasel, 2001).When the animals consume high to

moderate amounts of mycotoxins, this may induce acute mycotoxicosis leading to

different clinical manifestations of diseases including hepatitis, haemorrhage,

nephritis, oral necrosis, epithelial cells enteric and even death (Rohit Talwani et al

.,2011). In the case of mycotoxicosis in animals, symptoms may include poor milk

production, poor feed consumption, poor body weight gain and diarrhoea, anoestrus,

poor reproductive performance, abortion, feed refusal, vomiting ,high disease

incidence and general lethargy (CAST , 2003).

Poultry are the most susceptible to mycotoxins contamination than ruminants ,

and they are more resistant to FBs than are equines and swine, but to induce

measurable effects , doses should be high as 450 and 525 ppm of FBs for 21 days in

feed , this cause weight gains (Whitlow et al., 2010). Aflatoxicoses made great

economic losses in the poultry industry, affecting broilers,ducklings, layers, quail

and turkeys causing clinical signs include anorexia, decreasing in weight gain,

decreasing in egg production, hemorrhage, embryotoxicity, and increasing in

susceptibility to environmental and microbial stressors (CAST ,2003 and Cegielska-

Radziejewska et al.,2013).

At high level (1.5 ppm) of dietary aflatoxin in chicken , histopathologic effects

occur as fatty liver, necrosis and hyperplasia of bile duct (Dhanasekaran et al.,

2011). Aflatoxicoses also contribute in decreased activities of pancreatic amylase,

trypsin, lipase, RNAse, and DNAse when exposed to 1.25 and 2.5 mg AFB1/kg


________________________________________________________________

26

diet (Yunus et al., 2011) . In contaminated corn with aflatoxin near LD50 levels

cause decreasing of egg production to 5% in laying hens, also decreasing the

percentage of total yolk weight from total egg weight (CAST,2003). The exposure

to lower levels of OTA in poultry may reduce consumption of feed in addition to

weight gain and immunosuppression which increase susceptibility to infection

(Murugesan et al., 2015).

2.7.3 Effects of mycotoxin (phytotoxin) on plant

Phytotoxins are fungal metabolites which are toxic to plants (Lou et al., 2013) .

They act as a pathogenic or virulence factors, cause a plant disease or they can play

a role in increasing various plant diseases. The phytotoxins made by fungal

pathogens as Alternaria, Aspergillus, Fusarium, and Penicillium are the most

common fungi of contamination of crop plants with mycotoxin, they infect many

different field crops including wheat, maize, rice, barley as well as peanuts, tree

nuts, coffee, grapes, and cotton (Amalfitano et al., 2002; Horbach et al.,2011). They

can lead to a high range of diseases of plant as stalk rots , crown and rots of root

(Stergiopoulos et al ., 2012).

Aflatoxins occurrence in agricultural raw materials depends on factors such as

season ,region and the conditions under which an appointed crop is grown,

harvested or stored. The harvests of crop plants are endangered because of plant

diseases lead to losses of at least 10% of the harvest in the world ( Endah ,2011).

Fungal Infection to plant pathogens occurs via several pathways such as seeds,

stems, roots, flower and fruit (CAST,2003). Most phytotoxins are organic acids,


________________________________________________________________

27

polyketides , cyclic polypeptides and cyclic terpenoids (Pusztahelyi et al., 2015).

Phytotoxins differ in the way they act but the main effects of their activities are

damage to the cell membrane as well as abnormalities and biochemical changes in

plant cells. Generally , effects of phytotoxins are wilting and growth suppression, as

well as spotting of aerial portions (Andolfi et al, 2011). Phytotoxins are divided

into host-specific and non-host-specific.At low concentrations , host-specific toxins

act as pathogenicity factors ,while non-host-specific phytotoxins act as virulence

factors (Taj et al .,2015) .

2.8 Methods to detect mycotoxigenic fungi

The detection and quantification of mycotoxins and mycotoxigenic fungi in

food and feed are preprocessed for the safe foods production. Rapid methods of

theses fungi presence within (HACCP) systems take suitable corrective actions to

avoid and prevent risks of mycotoxin accumulation in foods , thus prevent

economic damages such as resulting of removing of foods contaminated with

mycotoxins.These strategy can be dividing into which depending on description of

fungi by conventional strategy, analytical methods and molecular techniques

(Galaverna et al., 2009; Berthiller et al., 2013).

2.8.1 Detection by conventional microbiological methods

This method includes processes comprised of sampling, culture, isolation, and

characterization of production of mycotoxin which including extraction of toxin,


________________________________________________________________

28

procedures of cleanup and at end mycotoxins analysis qualitatively or quantitatively

(Yeni et al., 2014) .

2.8.2 Analytical detection of mycotoxin production

The method in which the procedure of sampling is the largest source of

mycotoxin variance test and the generality definitive step to obtain trustworthy

results (Köppen et al., 2010).There are several factors determine the of preparing a

representative sample difficulty such as a size of particle or the number of particles

in the mass or culture media complication or food models.(Whitaker et al.,

2009).These factors do it unattainable to determinate all mycotoxins. ( Shephard et

al., 2013).

2.8.2.1 Mycotoxins analysis by methods of chromatograph

After using cleanup or pretreatment methods, mycotoxins should be metabolites

free which may be interfere in their analysis (Cheli et al., 2012) .

2.8.2.1.1 TLC

It is a rapid and low-cost analytical technique and by visual inspection , it

offers capability to screen of yielding qualitative samples as a large numbers or semi

quantitative assessments(Cigic and Prosen, 2009;Turner et al., 2009).It is applied

for separation by screening , purity estimation and identification of mycotoxin.

2.8.2.1.2 HPLC

These methods are depend on coupled detector based on HPLC. The most

generally detection methods are DA ,UV, FL, MS, and MS/MS. The method of

HPLC-MS/MS is used for the simultaneous determination of different chemical


________________________________________________________________

29

families .The recent UHPLC technique has provided more features and adventages

in the mycotoxins determination in food by applying of columns stuffed with 2 μm

particles, to get tight peaks differs from which obtained by traditional HPLC

columns (Beltrán et al., 2013).New techniques of LC/ESI-QTOF-MS/MS give a

great sample throughput, great resolution, to obtained complete range data of

spectral mass as an alternative of only a single ion. This look as active instrument

for the detection of mycotoxins in foods, as aflatoxins (Sirhan et al., 2013).

2.8.2.1.3 GC

A method used to analysis only the thermally stable and volatile products.

Several mycotoxins do not volatile compound ,but they are to be derivative and

would be analyzed by GC (Cigic and Prosen, 2009). This method is joined to FID,

MS or FTIR detection techniques.

2.8.2.1.4 CE

It allows separation of a many mycotoxins, but it is not depended as HPLC. CE

has a serious problem and is performing a low limits detection , so the detection of

mycotoxins with this method have been developed by using fluorescence detection

(Cigic and Prosen, 2009(.

2.8.2.2 Immunological methods for analysis of mycotoxins

It is performed by the capability of a specific antibody to characterize the

structure-three dimensional of specific mycotoxin from among molecules. It is


________________________________________________________________

30

important before immunization , bind mycotoxins to a carrier protein because they

do not have immunogenicity and low-molecular substances , this achieved by

reaction results a specific monoclonal and polyclonal antibodies against the toxin,

therefore, just commercial kits can be developed for specific mycotoxins.These

method are rapid as the results are gotten within two hour to a few minutes , they

are used for a single requirements, which can raise the screening cost.

2.8.2.2.1 ELISA

Commercially kits for the detection of mycotoxins depend on a direct

competitive assay of primary antibody which consider as specific for the target

molecule or a link of an enzyme and the desired target.The formed compound react

with a chromogenic substrate to obtain commensurable results in one to two hour

(Turner et al., 2009).

2.8.3 Cultural methods

2.8.3.1 Blue fluorescence

This method is using for developing qualitative cultural methods for

aflatoxigenic Aspergillus species detection which grown on appropriate media. This

techniques use either solid media, such as CAM and PDA or liquid media, like

APA medium and a medium supplied with steep liquor (Abbas et al., 2004(a,b)

and Atanda et al., 2005), and achieved by cut a small plugs from Aspergillus

colonies on medium to culture on the other media.The aflatoxins producer

Aspergillus were detected under long-wave UV light (365nm)This rapid


________________________________________________________________

31

identification to determine aflatoxigenic isolates from non-aflatoxigenic by appear

blue to blue –green fluorescent to aflatoxigenic,and nonaflatoxigenic is non-produce

fluorescent (Rodrigues et al., 2007).

2.8.3.2 Ammonium hydroxide vapor-induced color change

A rapid and sensitive method for detection of aflatoxigenic and nontoxigenic

strains of Aspergillus (Yazdani et al., 2010). A single colony was grown in the

center of Petri dish. The reverse of colony of aflatoxigenic Aspergillus strain turned

to pink color when their medium were exposed to ammonia vapor by dropped of

ammonia hydroxide on it but nonaflatoxigenic is no color production( Saito and

Machida , 1999 ).

2.8.4 Molecular detection of mycotoxin-producing molds

The alternative technique used to detect genes by involved in the metabolites

biosynthesis by nucleic acid–based methods and give a characterization of mold

plus mycotoxins evaluation for mycotoxin-producing molds detection in

foods(CAST,2003). PCR-based techniques are among these methods.Recently,new

molecular techniques, such LAMP is used as example of this method (Notomi et

al., 2000).

2.8.4.1 Polymerase Chain Reaction(PCR)

It is a sensitive and specific technique using for early toxigenic molds detection

to control or reduce mass of mold (Dao et al., 2005 ( . As result of its specificity


________________________________________________________________

32

and sensitivity , PCR is an most suitable technique for identification of fungi.(Atkins

and Clark, 2004).The variety in ITS sequences applies for PCR-based tests

development for detection of many species of phytopathogenic fungi (Hussain et

al., 2014). This method with specific primers of fungi is a potent technique in

diagnostics and in ecological reports for fungi screening in environments, like soil,

water, plant samples.A biomolecular technique (PCR) applied by using a set of

primers of aflatoxigenic genes (aflR, aflD and aflM) to distinguish between

aflatoxigenic strains and non-aflatoxigenic strains of A. flavus and A. parasiticus

contaminating food and feed (Criseo et al., 2001). Recently this test has been

advanced to detect the quantity of Fusarium producing trichothecene, depending on

primers came from from Tri5 gene which can encode synthase gene of trichodiene

(Edwards et al., 2001).

2.8.4.2 Real-Time PCR

Technique used to measure the amplified PCR product at each cycle throughout

the PCR reaction. Real-time quantitative PCR is considered as the most sensitive

and reproducible form of PCR-based quantification and assists in the continuous

collection of fluorescent signal from one or more polymerase chain reactions over a

range of cycles(Bernard and Wittwer,2000).The increase in the amplifiers number

during PCR is amplification based on the proportional increase in fluorescence

intensity can be detected by Real-time PCR machines. By these tools ,any change in

amplified product is indicated in a change in the fluorescence intensity measured .

In the early cycles of PCR, there is no detectable signal and the amplification is


________________________________________________________________

33

below the level of detection of the real time instrument.This knows the baseline for

the amplification plot. A raise in fluorescence above the baseline give the

accumulated PCR product detection.A fixed fluorescence onset can be adjust above

the baseline.The parameter beginning cycle is defined as the number of fractional

cycle at which the fluorescence passes the fixed beginning (Valones et al., 2009) .

2.8.4.3 Future perspectives: new molecular methods

New techniques are defined as new molecular procedures for mycotoxin-

producing molds detection. An alternative technique for PCR LAMP of DNA is

using in testing of food safety and which is utilized RNA and DNA amplification

with isothermal situations .This technique is using DNA polymerase in addition of

a set of four specific primers which distinguish an aggregate of six sequence

specificity on the target DNA (Notomi et al., 2000).The characteristics of this

method in which the reaction time is shorter, without requirements for certain

instruments, great specificity and sensitivity, also relatively less susceptibility to

inhibitors which found in feed and food, then detection of pathogens, and shorter in

analysis and preparation time (Niessen et al., 2013).This method is special for

several mycotoxin-producer Aspergillus and Fusarium species food detection.

2.9 Main mycotoxins

2.9.1 Aflatoxins

Aflatoxins are difuranocumarin derivatives. They are classified to six main

toxins (figure 1) , based on their fluorescent features(blue or green) under UV of


________________________________________________________________

34

length wave 365 nm, and their chromatographic mobility(1 or 2) : B1, B2 (blue ),

G1, and G2 (green) , M1 and M2 a derivative of AFB1 monohydroxylated,present

in the milk of lactating animals by formation and excretion (Yao et al., 2015).AFs

are somewhat soluble in water about 10 to30 μg/ml, and they are in insolubility

form in solvents with non-polarity , while soluble in middling polar organic

solvents like chloroform and methanol ,but they have highly solubility in dimethyl

sulfoxide (Bertuzzi et al., 2012). Under the influence of ultraviolet light they are

unstable and with presence of O2, to severe of pH (< 3, > 10) and to oxidizing

agents (Khalil et al., 2013).

A group of aspergilli: A. flavus, A.parasiticus, and A.nomius strains Aflatoxins

are the main source of aflatoxin production(Moss,2002).Species as A.bombycis, ,

A.pseudotamari and A.ochraceoroseus can also producing aflatoxin, while they are

present in less considerably(Ito et al ., 2001). Aflatoxin cause a problem to several

commodities ,and AFB1 act as mutagenicity ,carcinogenicity and acute

toxicology.The IARC classified it as a human carcinogen .


________________________________________________________________

35

Figure (1): Chemical structure of the different aflatoxins(C17H12O6 of AFB1)

2.9.1.1 Exposure and absorption into organism

Aflatoxins are general incident in feeds, foods and milk products, so they act

as a dangerous threat to humans and animal(Zain,2011). Main contamination means

is oral route, also inhalation which occurs when people or animals have beeng

exposed to the dust of grains (Nuntharatanapong et al., 2001).During respiratory

exposure, AfB1 may occur in the blood more rapidly than after oral exposure. After

ingestion, Af B1 is well absorbed in the intestinal tract, and major site of absorption

is duodenum. Because of the particle with low molecular weight, the essential

mechanism of mycotoxin absorption is passive diffusion(Silvia, 2007).


________________________________________________________________

36

2.9.1.2 Metabolism of aflatoxin

Liver is the general metabolizing organ for aflatoxin, this also can be happen

directly in the blood or in many extra-hepatic organs. AfB1metabolism can be

divided into 3 phases( Yiannikouris and Jouany, 2002) :

1) Bioactivation.

2) Conjugation.

3) Deconjugation.

2.9.1.2.1 Bioactivation

In which AfB1 is oxidized into several hydroxylated metabolites. The pathways

of metabolites for AfB1 contain O-demethylation to AfP1(figure 2), reduction to

aflatoxicol and hydroxylation to AfB1-8,9-epoxide which is considered as acutely

toxic, mutagenic and carcinogenic, AfM1 (acutely toxic) and AfFQ1 or AfB2 ,both

somewhat non-toxic ( Yiannikouris and Jouany, 2002) .


________________________________________________________________

37

Figure (2) : Aflatoxin B1 pathways

Aflatoxin B1- 8,9 epoxide is greatly unstable, hence many reactions can happen,

according on the presence of the second molecule:

Biological nucleophils as nucleic acids – stable links to RNA and DNA are

resulted, inducing mutations of point and breaking of strands of DNA. These

reactions and the formation of AfB1-DNA adducts are highly correlated with the

AfB1carcinogenic effect in human and animal cancer. When water molecules

present, Aflatoxin B1– 8,9 epoxide will be hydrolyzed into AfB1– 8,9- dihydrodiol


________________________________________________________________

38

and become ready to be linked with proteins of serum, like albumin and

lysine(Friedman and Rasooly,2013).

2.9.1.2.2 Conjugation

It is responsible for phase I metabolites reaction in which the biotransformation

involving the enzymes (GST), β-glucuronidase, and/or sulfate transferase produce

conjugates of AfB1-glutathione, AfB1-glucuronide, and AFB1-sulfate, respectively

(Valko et al., 2006). The main identified of conjugate of AfB1-epoxide is the AfB1-

glutathione conjugate. This conjugation is the essential pathway of detoxification of

activated AfB1 in several mammals which is main in the AfB1 induced

carcinogenicity reduction and prevention.The forming conjugates are easily excreted

via the bile into the intestinal tract. The activity of cytosolic GST is inversely

correlated to the several animal species susceptibility to carcinogenicity of AfB1.

(Shetty and Jespersen, 2006).

2.9.1.2.3 Deconjugation

It can be happen in the intestinal tract as result of efficiency of bacteria. It acts

as a part of the large intestine flora metabolic role.

2.9.1.3 The mechanism of toxicity

The main target organ to AfB1 is liver, so the protein metabolism, lipids and

carbohydrates in liver will be affected . After AfB1conversion to AFB1-Epoxoide

by cytochrome P450, it will link with the guanine in DNA and RNA resulting


________________________________________________________________

39

depuration. The primary influence of this mechanism is DNA synthesis inhibition in

most active tissues, involving liver, intestine and bone marrow which leads to DNA

damage in the form of mutation (GC to AT mutation) and/or carcinogenic as liver

cancer after long-term exposure. The fast rate metabolism of aflatoxin B1 in some

animals like ducklings result in fast formation of AFB1-8,9-epoxoid which inhibits

RNA polymerase and protein synthesis subsequently. Other effects are represented

by affecting liver microsomal enzymes expressed as depletion of hepatic glycogen

stores (figure 3).The toxin also reduce activity of microsomal glucose-6-

phosphatase (Williams et al., 2004; Santella, 2007; Yunus et al., 2011).

Figure(3) : Mechanisms of AFB1 toxicity


________________________________________________________________

40

2.9.1.4 The role of aflR in aflatoxin pathway regulation

The activation of transcriptionl of most structural genes in the pathway cluster

of aflatoxin needed a 47 kDa sequence-specific zinc-finger DNA-binding protein, a

Gal 4-type 47-kDa polypeptide is encoded by aflR gene. The aflatoxin pathway

genes transcription will be activated after this protein links to the palindromic

sequence 5'-TCGN5CGA-3' (also called aflR-binding motif) in the promoter region

of the structural genes in A.flavus, A.parasiticus and A.nidulans. In case of more

than one motif in the promoter region, just one of them will be preferred as a

binding site such as in the case of aflC (pksA). (Yu et al., 2004; Yu and Ehrlich,

2011; Yu, 2012).

2.9.2 Fumonisins

Fumonisins are diester compounds with variaty tricarboxylic acids and

polyhydric alcohols and primary amine moiety (Oancea and Stoia , 2008).

Fumonisins B1 (FB1) and B2 (FB2) are examples of this group and have been found

in significant amounts.FB1 is formed by F.moniliforme and F.proliferatum. High

concentrations of fumonisins are related with hot and dry weather, and the periods

of high humidity(Fandohan et al., 2005). This species cause fusariotoxicoses to

human and animals, act as a carcinogenic effect on human and necroses and crusts

of the buccal mucosa in poultry , in plant may cause root disease (CAST, 2003).


________________________________________________________________

41

Figure (4): Fumonisins B1 Structure ( C34H59NO15)

2.9.3 Ochratoxins

Ochratoxins are produced of A. ochraceus and P.verrucosum in an enormous

diversity of feeds and foods.There are four types of ochratoxins : A, B, C, and D.

OTA is the main mycotoxin among them. (CAST,2003).Their chemical structure

contains an isocoumarin moiety bounded by a peptide bond to phenylalanine (figure

5) (Gallo et al., 2012) . They responsible for several disease, in humans, ochratoxins

are the essential agent causing the fatal disease of kidney, affecting villager

communities in the central Balkan regions , as Bulgaria or Croatia, caused (BEN) ,

and this is distinguished by a reducing in size of kidney .This toxin is a contaminant

of beans ,cereals and other products of plant, also cause nephrotoxicity to farm

animals.


________________________________________________________________

42

Figure(5): Ochratoxin A Structure ( C20H18ClNO6)

2.10. The prevention and reduction of mycotoxins strategies

There are many strategies realized to reduce mycotoxins levels in foods which

must be taken to prevent or reduce the effect of mycotoxins .

2.10.1 Practices of good agricultural quality

Agricultural practices have been applied to decrease contaminated mycotoxins

effect on crops in the field.

(i) Early harvesting:

This decrease crops infection happen by fungi in the field before harvest and

harvested product contamination. The early harvesting results decreasing level of

aflatoxin and increasing in gross returns of 27% than in belated harvesting

(Rachaputi et al. 2002).


________________________________________________________________

43

(ii) Correct drying:

Reducing the moisture level of agricultural products by rapid drying .It is

critical to create less appropriate fungal growth and proliferation conditions. The

drying harvested corn to 15.5% moisture or less within 24-48 h may be reduce the

danger of growth of fungi and production of aflatoxin (Lanyasunya et al., 2005) .

(iii) Physical treatment:

This strategy elucidated that sorting, winnowing, washing, crushing joint with

hulling of grains of maize were influential in removing of mycotoxins.This have

been achieved by contaminated grain separation from the bulk that rely on the

heavy contamination of only a small part of the seeds (Park,2002) .

(iv) Sanitation:

The debris removing and destruction from previous harvest may be helped in

decreasing infection in the field. Cleaning of the stores before freight new produce

is indispensable to be correlated aflatoxin levels reduction (Hell et al., 2000).

(v) Proper storage:

Preventing of biological activity is necessary to preserve quality in storage,

through sufficient drying to lower than 10% moisture, insect activity removal which

raise moisture content through respiration, decrease temperatures, and inert

atmospheres ( Turner et al., 2005).


________________________________________________________________

44

(vi) Insect management:

Insect damage of maize is best foreteller of contamination by Fusarium

mycotoxins, so the level of its damage influences the extent of mycotoxins

contamination by carrying mycotoxins producing fungi spores from surfaces of

plant to the stalk interior or kernels or create infection wounds through their feeding

behaviors (Avantaggio et al. 2002 ; Munkvold, 2003).

(vii) Other methods:

Containing tillage , rotation of crop, date of planting and management of

irrigation and fertilization, have finite effects on infection and accumulation of

mycotoxins (Munkvold, 2003; Champeil et al., 2004).

2.10.2 Biological control

Progressive strategies would made in forming different bio control strategies

like atoxigenic bio-control fungi development that can out-compete their closely

related, toxigenic strains in field then they decreasing the mycotoxins levels in the

crops (Cleveland et al., 2003). Application of atoxigenic A. flavus and A. parasiticus

strains which decreased aflatoxin contamination of post-harvest by 95.9%. Use of

biological agents to suppress growth of fumonisin production by atoxigenic F.

verticillioides strains( Dorner and Cole , 2002). The endophytic bacteria can be

used as control of fumonisin producing fungi and also lactic acid bacteria as

Lactobacillus reuteri strain provided good control to fungi by lactic mixture

production (0.9% w/w), acetic (0.2% w/w), and succinic acids (0.2% w/w)


________________________________________________________________

45

(Plockova et al., 2001).Masoud and Kaltoft )2006) confirmed in vitro inhibition of

production of OTA by A. ochraceus by three yeasts (Pichia anomala, P.kluyveri and

Hanseniaspora uvarum).Other mechanism of use Trichoderma spp. to control

pathogenic fungi through competition for nutrients and space, fungistasis, antibiosis,

modification of rhizosphere, mycoparasitism, biofertilization and the plant-defense

mechanisms stimulation (Benitez et al., 2004).

2.10.3 Chemical control

A suitable pesticides using during the process of production may be minimized

the infection of fungi or infestation by insect of crops and resulting mycotoxin

contamination. fungicides application could reduce fumonisins contamination by

using chemical compound as propiconazole,prochloraz,epoxyconazole,

cyproconazole ,tebuconazole and azoxystrobin (Haidukowski et al., 2004).While

fungicides as amphotericin B and itraconazole have been appered to actively control

the aflatoxin-producing Aspergillus species (Ni and Streett, 2005). However, the

fungicides using is thwarting because of the economic reasons and growing related

with environment and food safety problems.

Chapter three

Materials and methods

Chapter three Materials and methods

_______________________________________________________________

46

3 Materials and methods

3.1 Materials

3.1.1 Instruments and equipment

The instruments and equipment which were used in this study are listed

below (table 2 ) .

Table (2): Instruments and equipment with their remarks.

N0. Name of equipment Manufacturer / State

1 Autoclave Monarch MSI/ Germany

2 Centrifuge Hettich / Germany

3 Compound light microscope Olympus /Japan

4 Cooled centrifuge Hettich/ Germany

5 Cooled incubator Binder / USA

6 Digital camera HD Sony / China

7 Electric oven Memmert/ Germany

8 Electrophoresis apparatus MD-300N/ UK

9 Hood Cruma / Spain

10 Thermocycler apparatus Techne/ UK

11 Vortex Memmert/ Germany


_______________________________________________________________

47

3.1.2 .Chemicals

The chemicals and biological materials which were used throughout the

study are listed in (table 3) below:

Table ( 3 ) : Chemicals and biological materials

No. Type of chemical or biological Manufacturers/ state

1 Absolute ethanol Fluka / Germany

2 Agarose gel Promega /USA

3 Chloramphenicol

Grand

Pharmaceutical/China

4 Coconut-agar medium Local market

5 Ethidium bromide Sigma-Aldrich/Germany

6 Free water nucleas Promega / USA

7

Lactofuchsin

AEML, Inc.

microbiological

laboratories/USA

8 Lactophenole blue stain Hardy Diagnostics/USA

9 Liquid nitrogen Local factory

10 MEA agar LabM/United Kindom

11 PDA medium Titan biotech / India

12 SDA medium Titan biotech / India

13 TBE(10 X) solution Bio basic / Canada

14 Tween 80 Sigma-Aldrich/Germany


_______________________________________________________________

48

3.1.3 Media

3.1.3.1 Coconut-Agar Medium (CAM)

It was prepared by weighing of 100 g of ripped coconut , then it was

mixed with 300 ml of hot distilled water for 5 min for homogenizing. Through

four layered cheesecloth , the homogenate was filtered. The clear filtrate was

regulated to pH 7.0 with 2 N of NaOH. About 20 g/l of agar was added, and

chloramphenicol (500 mg / l) for prevention of bacterial growth. By

autoclaving at 121 °C for 15 min ,the mixture was sterilized. (Davis et al.,

1987).

3.1.3.2 Potato Dextrose Agar (PDA)

About 39 g. were dissolved in 1000 ml. distilled water. Adding of

chloramphenicol (500 mg / l), then stirring of suspension to dissolve

completely. Sterilizing was done by autoclaving at 15 psi (121°C) for 15

minutes. After this , cooling at room temperature to dispense(Beuchat and

Cousin, 2001) .

3.1.3.3 Malt Extract Agar (MEA)

Suspending of 50 g in 1000 ml. of distilled water, about 500 mg /l of

chloramphenicol were added. Bring to the boil to dissolve. Sterilized by

autoclaving at 115°C for 10 minutes, then remain to cool.


_______________________________________________________________

49

3.1.3.4 Sabouraud Dextrose Agar (SDA)

Dissolving of 65 g. in 1000 ml. distilled water. Adding of chloramphenicol

(500 mg /l), then boil of suspension to dissolve completely. Sterilizing was

done by autoclaving at 15 psi (121°C) for 15 minutes . After this , cooling at

45-50 C◦ mixing well and dispense (Tokhadze et al., 1975). .

3.1.4 Stains

3.1.4.1 Lactophenol cotton blue

This stain is prepared over two days.

a. Dissolving of the cotton blue in the D.W. Leaving it to remove insoluble

dye overnight, this was done at first day.

b. Second day, in a glass beaker phenol crystals was added to the lactic acid. It

must be placing on magnetic stirrer to dissolved the phenol .

3. Then glycerol was added .

4. Filtering the cotton blue and D.W. solution into the solution of glycerol

/phenol/ lactic acid. Mixed , then stored at 25◦ C.

3.1.4.2 Lacto-fuchsin

Is prepared by adding of 0.1 g acid fuchsin with 100.0 ml. (85% ) of lactic

acid (McGinnis , 1980)


_______________________________________________________________

50

3.1.5 Kits

The Kits were used in the diagnosis are listed below (table 4,5) :

Table (4) : DNA extraction kit contents (Bio basic / Canada) .

NO. Component

1 EZ-10 column

2 Collection tube

3 Buffer of universal digestion

4 Buffer PF

5 Buffer BD

6 PW solution (concentrate)

7 wash solution (concentrate)

8 buffer of TE

9 Proteinase K

Table (5): PCR reaction kit and related materials

N0. Component Manufacturer / state

1 DNA ladder 100 bp Bioneer / South Korea

2 DNA purification kit Bio basic / Canada

3 Green master mix Bioneer / South Korea

4 Oligonucleotide primers Bioneer / South Korea


_______________________________________________________________

51

3.2 Methods

3.2.1 Collection of samples

A total of 180 samples of concentrated poultry feed pellet from different

breeders broiler farm and local markets of poultry feed were collected in

Basrah province . Feed samples were collected during one year from Sep. 2014

up to Apr. 2015. The feed stored for 2-3 days in sterile containers at room

temperature (22-25ºC). After that, they were prepared for fungal isolation and

identification( Shareef, 2010).

3.2.2 Isolation and identification of fungi

Twenty gram of the poultry feed samples were suspended with 180 ml of

saline solution (0.85% sodium chloride) in addition to 0.05% Tween 80

(polyoxyethylene sorbitan monoleate) on a horizontal shaker for 30 min. to

liberate the spores from fruiting bodies and to break the spore clumps (Mishra

et al.,2013) , then 0.1 ml of suspension was inoculated on PDA and MEA

media(Pitt and Hocking ,2009 and Greco et al., 2014) . The distinct colonies

were stained on a slide using lactophenol cotton blue and lacto-fuchsin , then

morphological characteristics of fungal isolates were described under

microscope ( Domsch and Gams. 1980 and Klich, 2002) The colony color

and conidia morphology were investigated. Each colony type was counted for

individual cfu/g counts and were recorded (Beuchat, and Cousin, 2001). The

frequency (Fr.) and relative density (RD) of isolation of genus and species


_______________________________________________________________

52

were calculated ( Gonzalez et al., 1995; Pacin et al. , 2003 ; Saleemi et al. ,

2010) as follows :

samples number with a genus or specie

Fr. (%) = ___________________________________ X 100 ,

samples total number

isolates number of a genus or specie

RD(%) = ______________________________________ X 100 .

fungi isolated total number

3.2.3 Detection tools of aflatoxigenic A.flavus

These tests carried out on 50 isolates of A.favus to detect aflatoxigenic or

nonaflatoxigenic isolates by UV light , ammonia vapor and molecular detection

by PCR.

3.2.3.1 Coconut based medium detection

The detection of aflatoxigenic isolates was done by blue-green

fluorescence on CAM. A preliminary screen for aflatoxin producer A.flavus

was done on the basis of blue to blue – green fluorescence emission by light

of UV irritation at 365 nm when the isolate was grown on CAM ,this agar is

inductive of aflatoxin production (Dyer and McCammon , 1994). The isolates

can be identified by fluorescence in the reverse side of the culture because of

the reaction with coconut fats (Lin and Dianese, 1976 and Davis et al., 1987)


_______________________________________________________________

53

in glass Petri dishes . Use 5 mm diameter sterile cork borer to make a hole in

the center of CAM medium in Petri dish . A mass of conidia of isolates were

inoculated of by cork borer to hole at the centric point of CAM in glass Petri

dish, then they were incubated at 28 °C for 7 days. The isolates of

aflatoxigenic A.flavus appeared blue to blue-green fluorescence under UV light

with long wavelength 365 nm, while the isolates of non aflatoxigenic A.flavus

remain colorless. Isolates of A.niger under the same conditions, was used as

nonaflatoxigenic control (Hara et al ., 1974 and Davis et al., 1987).

3.2.3.2 Ammonia vapor detection

The isolates of A.flavus were inoculated on CAM by cork borer (5mm)

diameter in the center of plate and incubated in the dark at 28 °C. for 7 days .

The dish was upended , then 1 or 2 drops of ammonium hydroxide solution

(concentrated) are put on the the lid inside of petri dish. The Petri dish inverted

over the lid containing the ammonium hydroxide.The colonies of aflatoxin-

producer A.flavus rapidly turn reddish pink after the bottom of the culture. No

color change occurs in colonies of non aflatoxins producer A.flavus (Saito and

Machida 1999) . A control as was mentioned in previous test was prepared.

3.2.3.3 Molecular assay

This assay is designed to include the examination of A.flavus isolates (table

6) by extraction of their DNA and using PCR technique , depending on primers

sequences of aflatoxin regulatory gene aflR (Manonmani et al., 2005).


_______________________________________________________________

54

Table (6): The sequences of the primers

primer primer Sequence Characterized Molecular

weight(bp)

aflR-1 Forward ´5 -AACCGCATCCACAATCTCAT-3´

A.flavus 798

aflR-2 Reverse ´5-AGTGCAGTTCGCTCAGAACA-3´

3.2.3.3.1 Preparation of buffers, solutions and stains

3.2.3.3.1.1 TBE (1X)

It was prepared by mixing 100 ml of stock TBE-10X ,the volume was

completed to 900 ml with D.W., and stored at 4°C until use in electrophoresis

( Sambrook et al., 2000) .

3.2.3.3.1.2 Ethidium bromide (0.5% (

Ethidium bromide stain was ready to be use .

3.2.3.3.1.3 Agarose gel preparation

The agarose gel was prepared according to the method of Sambrook et. al.,

(2000 ). The protocol of electrophoresis consists of two step:

A-Making the Gel

1- Twenty five ml. of TBE buffer(1X) was taken in a beaker .

2- About 0.175 g. of agarose was added to the buffer.

3- Agarose was melting in the microwave for 1 min. until the gel particles

dissolve .

4- Molten agarose was allowed to cool.


_______________________________________________________________

55

5- The ethidium bromide was added to the buffer , then mixed before pouring

in casting apparatus.

B- Casting of the horizontal agarose gel

1- The previous mix was poured to casting tray at a depth of 4-8 mm and the

comb was positioned at one end of the tray.

2- The mix was allowed to hard at room temperature for 30 min .

3- the comb was carefully remove and the mix replaced in electrophoresis

chamber .The chamber was filled with TBE - electrophoresis buffer until

the buffer reached 3-5 mm over the surface of the gel.

3.2.3.3.2 Preparing A.flavus mycelia for DNA extraction

DNA was extracted from 0.5 g (wet weight) freshly growing cultures of

A.flavus mycelia harvested on PDA medium. Grinding the mycelium into a

fine powder by liquid nitrogen using a pre-cooled pestle,then transferred in an

Eppendorf tube (Arendrup et al., 2011) .

3.2.3.3.3 DNA extraction

The genomic DNA was extracted by using fungal genomic DNA extraction

mini-preps kit(Bio Basic / Canada ).

Procedures

1. Grinding cell pellets collected from 0 100-500 mg (wet weight)

mycelia/spores in liquid nitrogen using a pestle. grinded sample was

transferred to a clean 1.5 ml microtube.


_______________________________________________________________

56

2. Universal digestion buffer (180 μl) and proteinase K (20 μl) were added to

the sample, and mix thoroughly by vortex. Incubate at 56°C for 30-60 min.

3. Universal Buffer PF (100 μl) was added, mix by inverting, and incubate at -

20°C for 5 min.

4. Centrifuge at 12,000 x g for 5 min at room temperature supernatant was

transferred the to a new 1.5 ml tube.

5. Universal Buffer BD (200 μl ) was added, mixed thoroughly by vortex.

6. ethanol 96-100% (200 μl) was added, mixed thoroughly by vortex.

7. The mixture from step 6 (including any precipitate) was transferred into EZ-

10 column was placed in a 2 ml collection tube. Centrifuged at 12000 rpm

for 1 min. Discarded the flow-through.

8. Universal PW Solution (500 μl) was added, centrifuged for 1 min. at 12000

rpm. Discarded the flow through. 18 ml of PW solution were diluted previously

with 12 ml of isopropanol.

9. Universal Wash Solution (500 μl) was added, centrifuged for 1 min. at

12000 rpm. Discarded the flow through.

10. empty column was placed the in the microcentrifuge and centrifuged for an

additional 2 min at 12000 rpm to dry the EZ-10 membrane. Discarded flow-

through and transferred the spin column to a clean 1.5 ml centrifuged tube.

11. Buffer TE (50-100 μl) was added directly onto the center part of EZ-10

membrane. Incubated at room temperature for 1 min, and then centrifuged for 1

min at 12,000 rpm to elute the DNA.


_______________________________________________________________

57

3.2.3.3.4 Polymerase chain reaction

The polymerase chain reaction (PCR)was used in amplification aflR

fragments of aflatoxigenic A.flavus genomic DNA. The forward and reverse

primers aflR sequence was mentioned prevously in table (6) , and were done

based on the sequence strand for A. flavus with size of 798 bp (Manonmani et

al., 2005). .

Protocol

- The following reagent was added for each tube of 20 µl (Bioneer /South

Korea) on ice (table 7( .


_______________________________________________________________

58

Table (7) : Reaction components of PCR (Bioneer /South Korea)

NO. Reagent Volume

1 Green master mix 5 µl

2 Upstream primer 1 µl

3 Downstream primer 1 µl

4 Template DNA 5 µl

5 Nuclease free water 8µl

- About 5 µl of template DNA were added plus 1µl of upstream primer and

1 µl of downstream primer to the tube containing (5 µl) green master . Mix

them thoroughly by vortex.

- To avoid contamination, all reagents were taken with separate clean tips.

- The volume of the mixture was completed to20µl with nuclease-free water.

- The tubes of PCR were put to preheated thermocycler to start the program

in table (8).

Table (8) : PCR Program

No. Step Temperature C° Time / Sec. No. of cycles

1 Initial denaturation 95 600 1

2

Denaturation

Annealing

Extension

94

50

72

18

45

75

30

3 Final extension 72 600 1


_______________________________________________________________

59

3.2.3.3.5 PCR result analysis

The products of PCR were analyzed by electrophoresis by a 1.2% mix of

agarose gel in TBE 1 X buffer stained with 0.25 µl ethidium bromide. The

positive and negative control were included .

3.2.3.3.6 Sequencing of PCR products for aflR gene

Five PCR products of aflatoxigenic A.flavus that identified by PCR were

randomly selected , sequenced at Macrogen company in South Korea .

3.2.3.3.6.1 The basic local alignment search tool analysis (BLAST)

The sequenced aflR products were analyzed homology with standard

sequences of aflR gene deposited to NCBI gene bank using BLAST analysis

software at (http://blast.ncbi.nlm.nih.gov/Blast.cgi ).

http://blast.ncbi.nlm.nih.gov/Blast.cgi

Chapter four

Results

Chapter four Results

__________________________________________________________________

60

4 Results

4.1 Fungal isolation

In the present study more than 10 fungi genera and more than 40 species were

recovered from 180 samples of poultry feed. Several species were identified in each

sample. Up to 20 different species were isolated in several samples were recovered.

The morphological characteristics of fungal isolates were described under microscope

.The colony color and conidia morphology were investigated. The most important

recovered genera of fungi were Aspergillus, Penicillium, Rhizopus, Cladosporium ,

Mucor , Alternaria and Fusarium (figure 6,7). There were 9 Aspergillus spp. recovered

: A.flavus , A.niger , A.fumigatus , A. terreus , A.flavipes , A.carbonarius , A.

ochraceus , A. candidus and A. parasiticus (figure 8,9,10 ) .

The total fungal counts cfu/g were ranged from 5X101- 2.1X10

6 of feed sample,

with an average 1.5X 105

cfu/g sample ( tables 9) .The frequency(Fr.) and relative

density(RD) recorded a highest value which was belong to Aspergillus, while

Fusarium was identified as low value of Fr. and RD(table 10). The most frequent

mycotoxigenic fungi from 180 samples were those from the genus Aspergillus. This

genus recovered from113 samples ( Fr. 62.77%) also with most RD52.03% with a

range of 2.2X105 - 2.1X10

6 cfu/g and a mean value of 1.7X10

6 cfu/g , followed by

Penicillium which recovered from 90 samples (Fr.47.77%), in addition of RD17.01%

with a range of 7.1X103 - 8.0X10

4 cfu/g and a mean value 4.1X10

4 cfu/g , Rhizopus

was recovered from 86 samples with Fr. 50% and RD10.01% and had a range 4.2 X


__________________________________________________________________

61

103 - 2.1X10

4 cfu/g , with mean value 1.6X10

4 cfu/g . Fusarium, was reported as a low

ratio, it was recovered from 7 samples (Fr. 1.66%) with a range of 5X101-

5.6X10

1

cfu/g and of a mean value of 7.8X101 cfu/g.

The total Aspergillus spp. counts cfu/g were ranged from (0.3X102 - 1.5X10

5) of

feed samples, with an average 7.5X104 cfu/g sample (table11). The frequency and RD

recorded a highest value which was belong to A.flavus, while A. parasiticus was

identified as low value of Fr. and RD(table 12) .The most predominant Aspergillus

species recovered from 117 samples of Aspergillus was A. flavus , recovered from 74

(Fr. 65.48 %) with RD 27.55 % and with range 1.1X104

-1.5X105 and had mean value

of 8.6X104 cfu/g , followed by A.niger , ecovered from 66 samples (Fr. 58.40%) and

RD14.23 ,with a range 5.8X103-7.4X10

3 and a mean value 9.5X10

3 cfu/g , A.fumigatus

, recovered from 19 samples (Fr.16.81%) with RD(7.60%) , recorded with range

1.7X103-3.0X103 cfu/g and mean value 3.2X103 cfu/g , A. parasiticus , were

recovered as low percentage and cfu/g , it was recovered from 2 samples with Fr.

1.76 % and with RD 0.89% , which recorded a range 0.2X102 - 0.4X10

2 cfu/g with

mean value 0.4X101 cfu/g .


__________________________________________________________________

62

Figure(6): The isolated molds genera from poultry feed on PDA medium. a:

Aspergillus(*), b: Aspergillus (**), c: Penicillium (*), d: Penicillium(**),

e:Rhizopus(*), f: Rhizopus(**), g:Cladosporium(*), h:Cladosporium(**).

(*): In culture, (**): Microscopically,40X.

a

c

b

d

e f

g h

b

d

e f

Ali

Line


__________________________________________________________________

63

Figure(7): The isolated molds genera from poultry feed on PDA medium. i:Mucor(*),

j:Mucor(**),k:Alternarial(*), l:Alternaria(**), m:Fusarium(*), n:Fusarium(**).

(*):In culture ,( **):Microscopically , 40X .

i j

k l

m n


__________________________________________________________________

64

Figure(8): The isolated Aspergillus spp. from poultry feed on PDA medium. a:

Aspergillus flavus(*), b: A.flavus(**), c: A.niger (*), d: A.niger (**), e:A.fumigatus(*), f:

A.fumigatus (**). (*): In culture, (**): Microscopically, 40X.

a b

c d

e f


__________________________________________________________________

65

Figure(9): The isolated Aspergillus spp. from poultry feed on PDA medium.

.g:A.terreus(*), h: A.terreus (**),i:A.flavipes(*), j: A.flavipes (**) ,k:A.carbonarius(*),

l: A.carbonarius (**). (*):In culture, (**): Microscopically, 40X.

g h

i j

k l


__________________________________________________________________

66

Figure(10): The isolated Aspergillus spp. from poultry feed on PDA medium.

m:A.ochraceus(*), n: A.ochraceus (**), o:A.candidus(*), p: A.candidus

(**),q:A.parasiticus(*), r: A.parasiticus (**).

(*):In culture , (**):Microscopically, 40X.

m n

o p

q r

m

q

Ali

Line


__________________________________________________________________

67

Total mold count (CFU/g)

Genus

Mean values Range

1.7X106 2.2X105 - 2.1X106

Aspergillus spp.

4.1X104 7.1X103 - 8.0X104 Penicillium spp.

1.6X104 4.2X103 - 2.1X104 Rhizopus spp.

3.6X103 2.4X103 -2.5X103 Cladosporium spp.

2.5X103 1.5X103 -2.0X103 Mucor spp.

9.1X101 6.0X101 - 6.3X101 Alternaria spp.

7.8X101 5.0X101- 5.6X101 Fusarium spp.

RD% Fr.% Fr. of Positive

samples Genus

52.03 62.77 113 Aspergillus spp.

17.01 47.77 90 Penicillium spp.

10.01 50 86 Rhizopus spp.

6.23 11.66 21 Cladosporium spp.

2.55 4.44 21 Mucor spp.

2.24 3.88 8 Alternaria spp.

2.11 1.66 7 Fusarium spp.

Table(9) : Range and average count cfu/g of recovered molds genera from

poultry feed samples.

Table (10 ):Frequency and relative density of recovered mold genera from

poultry feed samples.


__________________________________________________________________

68

4.2 based medium and ammonia vapor detection

Total mold count (CFU/g) Total mold count (CFU/g)

Mean values Range

8.6X104 1.1X104-1.5X105

A.flavus

9.5X103 5.8X103-7.4X103 A.niger

3.2X103 1.7X103-3.0X103 A.fumigatus

2.4X103 1.2X103 - 2.4X103 A. terreus

1.0X102 0.5X102 - 1.0X102 A.flavipes

7.5X101 0.4X102 - 0.7X102 A. carbonarius

7.5X101 0.4X102 - 0.7X102 A. ochraceus

0.5X101 0.3X102 - 0.4X102 A. candidus

0.4X101 0.2X102 - 0.4X102 A. parasiticus

RD% Fr.% Fr. of Positive

samples Aspergillus spp.

27.55 65.48 74 A.flavus

14.23 58.40 66 A.niger

7.60 16.81 19 A.fumigatus

0.50 10.61 12 A. terreus

2.13 7.96 9 A.flavipes

2.40 7.07 8 A. carbonarius

2.12 5.30 6 A. ochraceus

1.34 2.65 3 A. candidus

0.89 1.76 2 A. parasiticus

Table( 11 ):Range and average count cfu/g of recovered Aspergillus spp.


Table (12 ):Frequency and relative density of recovered Aspergillus spp.


Poultry feed samples


__________________________________________________________________

69

4.2 Coconut based medium and ammonia vapor detection

Fifty positive isolates of A. flavus were selected to test by coconut based

medium and ammonia vapor in order to determine either aflatixigenic or non

aflatoxigenic isolates .The detection by UV light (365nm) recognized aflatoxigenic

by produce blue-green fluorescent colonies in the center of Perti dish glass of CAM in

the reverse , from nonaflatoxigenic which were nonproducing fluorescent colonies ,

similar to the control isolates of nonaflatoxigenic A.niger ( figure 11).The detect by

ammonia vapor to characterize as aflatoxigenic by produce pink to red color colonies

in inverted Perti dish by applying 1or 2 drop of concentrated ammonia hydroxide

solution on the inside of the lid , but no color change occurred in nonaflatoxigenic

isolates, (figure 12) . This detection revealed that 26 (52%) of isolates were

aflatoxigenic (positive) and 24(48%) of isolates were nonaflatoxigenic (Negative).


__________________________________________________________________

70

Figure(11): The result of detection of aflatoxigenic A.flavus by CAM under

UV light (365nm) .(a) control of nonaflatoxigenic Aspergillus isolate A.niger ,

(b) nonaflatoxigenic A.flavus (negative) isolate, and (c) aflatoxigenic A.flavus

(positive) isolate , showing a blue-green fluorescent ring around the colony.

Figure(12): The result of detection of aflatoxigenic A.flavus by ammonia vapor.(a)

control of nonaflatoxigenic Aspergillus isolate A.niger , (b) nonaflatoxigenic

A.flavus (negative) isolate, and (c) aflatoxigenic A.flavus (positive) isolate ,

showing a pink-red ring around the colony.


__________________________________________________________________

71

4.3 Molecular detection

4.3.1 PCR

Fifty isolates of A. flavus were tested in order to determine either aflatixigenic or

non aflatoxigenic isolates.This test confirmed that 34(68%) were aflatoxigenic

isolates(positive) by PCR and 16(32%) were nonaflatoxigenic , after extracted

DNA was applied as template and PCR program was done with primers of the

target biosynthetic gene of aflatoxin aflR. As in corresponding to aflR with size

approximately 798 bp was showed through agarose gel electrophoresis , (figure 13).

M 1 2 3 4 5 6 7

Figure(13): PCR products obtained through agarose gel electrophoresis

from DNA of A.flavus isolates showing amplicons for aflR primer.

Lanes: M- 100bp standard, Lanes1–7: A. flavus (aflatoxin producer)

in corresponding to 798 bp.

100bp

500bp

700bp

800bp 798bp


__________________________________________________________________

72

There were difference in number of positive result in identification of isolates of

aflatoxigenic A.flavus by cultural and molecular methods ,(table 13). The details

results of these methods were listed in (table14).

Table(13): Detection of aflatoxigenic and nonaflatoxigenic A.flavus isolates

from poultry feed by three methods

Detection method Total number

tested

No. of positive

isolates

%

No. of negative

isolates

%

Coconut based

medium detection 50

26

52%

24

48%

Ammonia vapor

detection 50

26

52%

24

48%

PCR results assay 50 34

68%

16

32%

Table (14) : Aflatoxigenic and nonaflatoxigenic results obtained by CAM ,

ammonia vapor and PCR detection of A.flavus isolates recovered from poultry

feed samples .

PCR Ammonia vapor

test

Coconut based

medium test No. of isolate

+ +

+ 1

+ +

+ 2

+ +

+ 3

+ +

+ 4

+ -

- 5

+ -

- 6

+ -

- 7

- -

- 8


__________________________________________________________________

73

PCR Ammonia vapor

test

Coconut based


- +

+ 9

+ +

+ 10

+ +

+ 11

+ -

- 12

+ -

- 13

+ +

+ 14

- +

+ 15

+ +

+ 16

+ +

+ 17

+ +

+ 18

+ -

- 19

- -

- 20

+ +

+ 21

- -

- 22

- +

+ 23

- -

- 24

- +

+ 25

- +

+ 26

- -

- 27

+ +

+ 28

+ +

+ 29

+ +

+ 30

+ -

- 31

+ +

+ 32

+ +

+ 33

+ +

+ 34


__________________________________________________________________

74

PCR Ammonia vapor

test

Coconut based


+ +

+ 35

- +

+ 36

+ -

- 37

+ -

- 38

- +

+ 39

- -

- 40

+ -

- 41

+ +

+ 42

+ -

- 43

+ -

- 44

+ -

- 45

+ -

- 46

+ -

- 47

- -

- 48

- -

- 49

- -

- 50

Total 50

4.3.2 Sequencing analysis of PCR product

The sequence analysis of aflR sequences results showed that all the tested

sequences were compatible with standard sequences in NCBI gene bank, (table 15)

and (Appendix 1).The first isolate of A.flavus (Af1) showed 100 % homology with

the A.flavus ITEM 8083 strain , ID: emb|FN398162.1|strain from NCBI at range of

alignment 284-913,(figure 14), the second isolate (Af2) has 99% homology with


__________________________________________________________________

75

A.flavus ITEM 8083 strain , ID: emb|FN398162.1| at range of alignment 224-

940,(figure15) , the third isolate (Af3) has compatibility 99% homology with the

A.flavus strain ITEM 8083 strain , ID: emb|FN398162.1 at range of alignment 292-

1013,(figure16) , the fourth isolate (Af4) showed 100% homology with strain A.flavus

ITEM 8083 strain,(figure17) , ID: emb|FN398162.1 at range of alignment 592-940 in

NCBI and the fifth isolate (Af5) result 100% homology with A.flavus ITEM 8083

strain , ID: emb|FN398162.11 at range of alignment 597-938, (figure18).


__________________________________________________________________

76

Percentage

of homology Range of

alignment

Aligned reference

strain Gene Isolate

100% 284-913 ITEM 8083

ID: emb|FN398162.1|

AflR with

size of 798

bp

Af1

99% 224-940 ITEM 8083

ID: emb|FN398162.1| Af2

99% 292-1013 ITEM 8083

ID: emb|FN398162.1| Af3

100% 592-940 ITEM 8083

ID: emb|FN398162.1| Af4

100% 597-938 ITEM 8083

ID: emb|FN398162.1| Af5

Table(15):The compatibility of strains of A.flavus with other

strains from NCBI.


__________________________________________________________________

77

Aspergillus flavus partial aflR gene for AFLR, strain ITEM 8083

Sequence ID: emb|FN398162.1| Length: 1079 Number of Matches: 1 Range 1: 284 to 913

Score Expect Identities Gaps Strand Frame

1164 bits(630) 0.0() 630/630(100%) 0/630(0%) Plus/Plus

Features:

Query 1 CAGTAGCGTCTCCGCCATCTTTTCTCATCAGAGTCCGCCGCCACCCGTGGAGACCCAGGG 60 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 284 CAGTAGCGTCTCCGCCATCTTTTCTCATCAGAGTCCGCCGCCACCCGTGGAGACCCAGGG 343

Query 61 CCTTGGAGGAGATCTGGCTGGTCAGGAGCAAAGCACCCTGTCTTCCCTAACAGTCGATTC 120 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 344 CCTTGGAGGAGATCTGGCTGGTCAGGAGCAAAGCACCCTGTCTTCCCTAACAGTCGATTC 403

Query 121 GGAATTCGGGGGCTCGTTGCAGTCAATGGAACACGGAAACCATGCCGATTTCTTGGCCGA 180 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 404 GGAATTCGGGGGCTCGTTGCAGTCAATGGAACACGGAAACCATGCCGATTTCTTGGCCGA 463

Query 181 GTCGACGGGGAGTCTTTTCGACGCGTTTTTGGAAGTAGGGACCCCCATGATCGACCCGTT 240 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 464 GTCGACGGGGAGTCTTTTCGACGCGTTTTTGGAAGTAGGGACCCCCATGATCGACCCGTT 523

Query 241 CCTCGAGTCGGCCCCACTACCACCGTTTCAGGCGCGCTATTGCTGCTTTTCGCTAGCACT 300 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 524 CCTCGAGTCGGCCCCACTACCACCGTTTCAGGCGCGCTATTGCTGCTTTTCGCTAGCACT 583

Query 301 ACAAACACTGACCCACCTCTTCCCCCACGCCCCGCTGGGCTGTCAACTACGGCTGACGGA 360 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 584 ACAAACACTGACCCACCTCTTCCCCCACGCCCCGCTGGGCTGTCAACTACGGCTGACGGA 643

Query 361 CGGTGAGGACAGTTCGTACAACCTGATGACGACTGATATGGTCATCTCGGGGAACAAGAG 420 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 644 CGGTGAGGACAGTTCGTACAACCTGATGACGACTGATATGGTCATCTCGGGGAACAAGAG 703

Query 421 GGCTACCGATGCGGTCCGGAAGATCCTCGGGTGTTCGTGCGCGCAGGATGGCTACTTGCT 480 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 704 GGCTACCGATGCGGTCCGGAAGATCCTCGGGTGTTCGTGCGCGCAGGATGGCTACTTGCT 763

Query 481 GAGCATGGTCGTCCTTATCGTTCTCAAGGTGCTGGCATGGTATGCTGCGGCAGCAGGCAC 540 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 764 GAGCATGGTCGTCCTTATCGTTCTCAAGGTGCTGGCATGGTATGCTGCGGCAGCAGGCAC 823

Query 541 CCAGTGTACCTCAACGGCGGCGAGTGGAGAAACCAACAGTGGCAGCTGTAGCAACAGTCC 600 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 824 CCAGTGTACCTCAACGGCGGCGAGTGGAGAAACCAACAGTGGCAGCTGTAGCAACAGTCC 883

Query 601 CGCCACCGTGTCCAGTGGCTGTCTGACGGA 630 ||||||||||||||||||||||||||||||

Sbjct 884 CGCCACCGTGTCCAGTGGCTGTCTGACGGA 913

Figure(14): Sequence alignment of A. flavus isolate( Af1 isolate).

http://www.ncbi.nlm.nih.gov/nucleotide/262113551?report=genbank&log$=nuclalign&blast_rank=5&RID=5EWH0591014

http://www.ncbi.nlm.nih.gov/nucleotide/262113551?report=genbank&log$=nuclalign&blast_rank=5&RID=5EWH0591014


__________________________________________________________________

78




1315 bits(712) 0.0() 716/718(99%) 0/718(0%) Plus/Minus

Features:

Query 1 ATACTAGGGAGGTGCAGCACGCGCTCTTCCGTCAGACAGCCACTGGACACGGTGGCGGGA 60 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 940 ATACTAGGGAGGTGCAGCACGCGCTCTTCCGTCAGACAGCCACTGGACACGGTGGCGGGA 881

Query 61 CTGTTGCTACAGCTGCCACTGTTGGTTTCTCCACTCGCCGCCGTTGAGGTACACTGGGTG 120 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 880 CTGTTGCTACAGCTGCCACTGTTGGTTTCTCCACTCGCCGCCGTTGAGGTACACTGGGTG 821

Query 121 CCTGCTGCCGCAGCATACCATGCCAGCACCTTGAGAACGATAAGGACGACCATGCTCAGC 180 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 820 CCTGCTGCCGCAGCATACCATGCCAGCACCTTGAGAACGATAAGGACGACCATGCTCAGC 761

Query 181 AAGTAGCCATCCTGCGCGCACGAACACCCGAGGATCTTCCGGACCGCATCGGTAGCCCTC 240 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 760 AAGTAGCCATCCTGCGCGCACGAACACCCGAGGATCTTCCGGACCGCATCGGTAGCCCTC 701

Query 241 TTGTTCCCCGAGATGACCATATCAGTCGTCATCAGGTTGTACGAACTGTCCTCACCGTCC 300 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 700 TTGTTCCCCGAGATGACCATATCAGTCGTCATCAGGTTGTACGAACTGTCCTCACCGTCC 641

Query 301 GTCAGCCGTAGTTGACAGCCCAGCGGGGCGTGGGGGAAGAGGTGGGTCAGTGTTTGTAGT 360 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 640 GTCAGCCGTAGTTGACAGCCCAGCGGGGCGTGGGGGAAGAGGTGGGTCAGTGTTTGTAGT 581

Query 361 GCTAGCGAAAAGCAGCAATAGCGCGCCTGAAACGGTGGTAGTGGGGCCGACTCGAGGAAC 420 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 580 GCTAGCGAAAAGCAGCAATAGCGCGCCTGAAACGGTGGTAGTGGGGCCGACTCGAGGAAC 521

Query 421 GGGTCGATCATGGGGGTCCCTACTTCCAAAAACGCGTCGAAAAGACTCCCCGTCGACTCG 480 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 520 GGGTCGATCATGGGGGTCCCTACTTCCAAAAACGCGTCGAAAAGACTCCCCGTCGACTCG 461

Query 481 GCCAAGAAATCGGCATGGTTTCCGTGTTCCATTGACTGCAACGAGCCCCCGAATTCCGAA 540 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 460 GCCAAGAAATCGGCATGGTTTCCGTGTTCCATTGACTGCAACGAGCCCCCGAATTCCGAA 401

Query 541 TCGACTGTTAGGGAAGACAGGGTGCTTTGCTCCTGACCAGCCAGATCTCCTCCAAGGCCC 600 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 400 TCGACTGTTAGGGAAGACAGGGTGCTTTGCTCCTGACCAGCCAGATCTCCTCCAAGGCCC 341

Query 601 TGGGTCTCCACGGGTGGCGGCGGACTCTGATGAGAAAAGATGGCGGAGACGCTACTGCTA 660 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 340 TGGGTCTCCACGGGTGGCGGCGGACTCTGATGAGAAAAGATGGCGGAGACGCTACTGCTA 281

Query 661 CCATTCAGGGTGGGCAGAGCGTGTGGTGGTTGATTCGATTGACGATGAGATTGTGGAT 718 |||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||

Sbjct 280 CCATTCGGGGTGGGCAGAGCGTGTGGTGGTTGATTCGATTGAGGATGAGATTGTGGAT 223


http://www.ncbi.nlm.nih.gov/nucleotide/262113551?report=genbank&log$=nuclalign&blast_rank=5&RID=5H6V9Y2601R

http://www.ncbi.nlm.nih.gov/nucleotide/262113551?report=genbank&log$=nuclalign&blast_rank=5&RID=5H6V9Y2601R


__________________________________________________________________

79




1328 bits(719) 0.0() 721/722(99%) 0/722(0%) Plus/Plus

Features:

Query 1 TCTCCGCCATCTTTTCTCATCAGAGTCCGCCGCCACCCGTGGAGACCCAGGGCCTTGGAG 60 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 292 TCTCCGCCATCTTTTCTCATCAGAGTCCGCCGCCACCCGTGGAGACCCAGGGCCTTGGAG 351

Query 61 GAGATCTGGCTGGTCAGGAGCAAAGCACCCTGTCTTCCCTAACAGTCGATTCGGAATTCG 120 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 352 GAGATCTGGCTGGTCAGGAGCAAAGCACCCTGTCTTCCCTAACAGTCGATTCGGAATTCG 411

Query 121 GGGGCTCGTTGCAGTCAATGGAACACGGAAACCATGCCGATTTCTTGGCCGAGTCGACGG 180 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 412 GGGGCTCGTTGCAGTCAATGGAACACGGAAACCATGCCGATTTCTTGGCCGAGTCGACGG 471

Query 181 GGAGTCTTTTCGACGCGTTTTTGGAAGTAGGGACCCCCATGATCGACCCGTTCCTCGAGT 240 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 472 GGAGTCTTTTCGACGCGTTTTTGGAAGTAGGGACCCCCATGATCGACCCGTTCCTCGAGT 531

Query 241 CGGCCCCACTACCACCGTTTCAGGCGCGCTATTGCTGCTTTTCGCTAGCACTACAAACAC 300 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 532 CGGCCCCACTACCACCGTTTCAGGCGCGCTATTGCTGCTTTTCGCTAGCACTACAAACAC 591

Query 301 TGACCCACCTCTTCCCCCACGCCCCGCTGGGCTGTCAACTACGGCTGACGGACGGTGAGG 360 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 592 TGACCCACCTCTTCCCCCACGCCCCGCTGGGCTGTCAACTACGGCTGACGGACGGTGAGG 651

Query 361 ACAGTTCGTACAACCTGATGACGACTGATATGGTCATCTCGGGGAACAAGAGGGCTACCG 420 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 652 ACAGTTCGTACAACCTGATGACGACTGATATGGTCATCTCGGGGAACAAGAGGGCTACCG 711

Query 421 ATGCGGTCCGGAAGATCCTCGGGTGTTCGTGCGCGCAGGATGGCTACTTGCTGAGCATGG 480 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 712 ATGCGGTCCGGAAGATCCTCGGGTGTTCGTGCGCGCAGGATGGCTACTTGCTGAGCATGG 771

Query 481 TCGTCCTTATCGTTCTCAAGGTGCTGGCATGGTATGCTGCGGCAGCAGGCACCCAGTGTA 540 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 772 TCGTCCTTATCGTTCTCAAGGTGCTGGCATGGTATGCTGCGGCAGCAGGCACCCAGTGTA 831

Query 541 CCTCAACGGCGGCGAGTGGAGAAACCAACAGTGGCAGCTGTAGCAACAGTCCCGCCACCG 600 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 832 CCTCAACGGCGGCGAGTGGAGAAACCAACAGTGGCAGCTGTAGCAACAGTCCCGCCACCG 891

Query 601 TGTCCAGTGGCTGTCTGACGGAAGAGCGCGTGCTGCACCTCCCTAGTATGATGGGCGAGG 660

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


Sbjct 892 TGTCCAGTGGCTGTCTGACGGAAGAGCGCGTGCTGCACCTCCCTAGTATGGTGGGCGAGG 951

Query 661 ATTGTGTGGATGAGGAAGACCAGCCGCGAGTGGCGGCACAGCTTGTTCTGAGCGAACTGC 720

Sbjct 952 ATTGTGTGGATGAGGAAGACCAGCCGCGAGTGGCGGCACAGCTTGTTCTGAGCGAACTGC 1011

Query 721 AC 722

Sbjct 1012 AC 1013

http://www.ncbi.nlm.nih.gov/nucleotide/262113551?report=genbank&log$=nuclalign&blast_rank=5&RID=85XW0T3A014

http://www.ncbi.nlm.nih.gov/nucleotide/262113551?report=genbank&log$=nuclalign&blast_rank=5&RID=85XW0T3A014


__________________________________________________________________

80




------_______________________________________________________--------------------------

645 bits(349)

Features:

0.0() 349/349(100%) 0/349(0%) Plus/Minus

Query 1 ATACTAGGGAGGTGCAGCACGCGCTCTTCCGTCAGACAGCCACTGGACACGGTGGCGGGA 60 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 940 ATACTAGGGAGGTGCAGCACGCGCTCTTCCGTCAGACAGCCACTGGACACGGTGGCGGGA 881

Query 61 CTGTTGCTACAGCTGCCACTGTTGGTTTCTCCACTCGCCGCCGTTGAGGTACACTGGGTG 120 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 880 CTGTTGCTACAGCTGCCACTGTTGGTTTCTCCACTCGCCGCCGTTGAGGTACACTGGGTG 821

Query 121 CCTGCTGCCGCAGCATACCATGCCAGCACCTTGAGAACGATAAGGACGACCATGCTCAGC 180 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 820 CCTGCTGCCGCAGCATACCATGCCAGCACCTTGAGAACGATAAGGACGACCATGCTCAGC 761

Query 181 AAGTAGCCATCCTGCGCGCACGAACACCCGAGGATCTTCCGGACCGCATCGGTAGCCCTC 240 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 760 AAGTAGCCATCCTGCGCGCACGAACACCCGAGGATCTTCCGGACCGCATCGGTAGCCCTC 701

Query 241 TTGTTCCCCGAGATGACCATATCAGTCGTCATCAGGTTGTACGAACTGTCCTCACCGTCC 300 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 700 TTGTTCCCCGAGATGACCATATCAGTCGTCATCAGGTTGTACGAACTGTCCTCACCGTCC 641

Query 301 GTCAGCCGTAGTTGACAGCCCAGCGGGGCGTGGGGGAAGAGGTGGGTCA 349 |||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 640 GTCAGCCGTAGTTGACAGCCCAGCGGGGCGTGGGGGAAGAGGTGGGTCA 592


http://www.ncbi.nlm.nih.gov/nucleotide/262113551?report=genbank&log$=nuclalign&blast_rank=6&RID=85ZX7Y4G014

http://www.ncbi.nlm.nih.gov/nucleotide/262113551?report=genbank&log$=nuclalign&blast_rank=6&RID=85ZX7Y4G014


__________________________________________________________________

81




632 bits(342)

Features:

1e177() 342/342(100%) 0/342(0%) Plus/Minus

Query 1 ACTAGGGAGGTGCAGCACGCGCTCTTCCGTCAGACAGCCACTGGACACGGTGGCGGGACT 60 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 938 ACTAGGGAGGTGCAGCACGCGCTCTTCCGTCAGACAGCCACTGGACACGGTGGCGGGACT 879

Query 61 GTTGCTACAGCTGCCACTGTTGGTTTCTCCACTCGCCGCCGTTGAGGTACACTGGGTGCC 120 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 878 GTTGCTACAGCTGCCACTGTTGGTTTCTCCACTCGCCGCCGTTGAGGTACACTGGGTGCC 819

Query 121 TGCTGCCGCAGCATACCATGCCAGCACCTTGAGAACGATAAGGACGACCATGCTCAGCAA 180 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 818 TGCTGCCGCAGCATACCATGCCAGCACCTTGAGAACGATAAGGACGACCATGCTCAGCAA 759

Query 181 GTAGCCATCCTGCGCGCACGAACACCCGAGGATCTTCCGGACCGCATCGGTAGCCCTCTT 240 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 758 GTAGCCATCCTGCGCGCACGAACACCCGAGGATCTTCCGGACCGCATCGGTAGCCCTCTT 699

Query 241 GTTCCCCGAGATGACCATATCAGTCGTCATCAGGTTGTACGAACTGTCCTCACCGTCCGT 300 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 698 GTTCCCCGAGATGACCATATCAGTCGTCATCAGGTTGTACGAACTGTCCTCACCGTCCGT 639

Query 301 CAGCCGTAGTTGACAGCCCAGCGGGGCGTGGGGGAAGAGGTG 342 ||||||||||||||||||||||||||||||||||||||||||

Sbjct 638 CAGCCGTAGTTGACAGCCCAGCGGGGCGTGGGGGAAGAGGTG 597


http://www.ncbi.nlm.nih.gov/nucleotide/262113551?report=genbank&log$=nuclalign&blast_rank=6&RID=860PE192014

http://www.ncbi.nlm.nih.gov/nucleotide/262113551?report=genbank&log$=nuclalign&blast_rank=6&RID=860PE192014

Chapter five

Discussion

Chapter five Discussion

____________________________________________________________________

82

5 Discussion

5.1 Fungal isolation

In the present study, total fungal counts were ranged from 5X101- 2.1X10

6 in

feed sample, with an average of 1.5X 105 cfu/g sample and were considered as high

contaminant to poultry feed as a compared with GMP, (2005) which demonstrated

that the fungal propagules were useful indicators to determine a quality of feeds

hygienic, that should not over a value of 1X104

cfu /g .These results are similar with

those of Bragulat et al., (1995) from Spain , Dalcero et al., (1997) in Argentina ,

Rosa et al., (2006) in Brazil and similar to the study of Shareef (2009) in Iraq and

Greco et al.,( 2014) in Argentina .

The present study reported different results with Magnoli et al., (1999) in

Argentina , and Oliveira et al., (2006) in Brazil , that found a level of cfu/g in their

study about 103 cfu/g .They deals with samples in different ways from this study in

collection place , and the quantity of samples used in homogenizing because they

collected monthly during one year from factories immediately from the production

part after processing and used ten grams of each sample for homogenizing also they

incubated with cold lamps of white and black fluorescent in a 12/12 h photoperiod

for 7 days . The processing way could cause decrease of different microorganisms

during storage (Bakker , 2004), most of these fungi are slow growing under these

conditions and observations may be made after 20 days( Gorfu and Sangchote ,

2005). In the present study, the samples were collected from farms and local market


____________________________________________________________________

83

of poultry , then 20 g of samples were used in homogenizing then incubated in dark

incubator , therefore the mean of cfu/g of the present study was higher 105.

The genera of Aspergillus was the predominant isolate in poultry feed in the

present study with mean value of 1.7X106 cfu/g (Fr 56.66% - RD 52.03%) because

temperature during collection was 37-47°C which considers the optimal for

growth of Aspergillus (Francisco and Usberti, 2008) , followed by Penicillium with

mean value of 4.1X104 cfu/g (Fr 11.15% - RD 16.53%) and Rhizopus had mean

value of 1.6X104 cfu/g ( Fr.50% -RD10.1%). Similar results which were found by

Abarca et al., (1994), Bragualt et al., (1995) in Spain , Dalcero et al., (1997) in

Argentina , Magnoli et al., (1999) in Argentina and Simas et al., (2007) in Bazil ,

and Shareef ,( 2010) in Iraq , they reported that the Aspergillus genera was the most

frequent .While it differs from the study of Oliveira et al., (2006) in Serbia who

reported that Penicillium was the most frequent isolated genus followed by

Aspergillus and Fusarium . While Magnoli et al., (2002) in Serbia and Krnjaja et al.,

(2014) who confirmed that the Fusarium is the predominant genera followed by

Penicillium and Aspergillus, because the location of Serbia is consider as belt

moderate continental climate, geographical factors are of superior importance for the

occurrence of Fusarium and the most frequently isolated mold contaminating feed,

cereals, fruits and vegetable are from the Fusarium (Lević et al., 2004 ; Popovski,

and Celar,2013) , also Greco et al., (2014) in Argentina reported that Fusarium is

the most genera recovered from poultry feed , followed by Eurotium, Penicillium

and Aspergillus , they collected the samples from region in Argentina suitable to


____________________________________________________________________

84

permanent of Fusarium growth. The Aspergillus spp. in the present study , nine

species recovered and the A.flavus was the most frequently and RD isolated

Aspergillus with mean value of 8.6X104 cfu/g and (Fr. 65.48 % , RD 27.55 %),

followed by A.niger with mean value of 9.5X103 cfu/g and with Fr. 58.40% , RD

14.23% and A.fumigatus with mean value of 3.2X103 cfu/g and with Fr. 16.81% ,

RD 7.60%. The highest dominance of A.flavus in the present study is similar with

Magnoli et al., (2002) in Serbia , Oliveira et al., (2006) in Argentina and Ariyo et al.,

(2013) in Nigeria , and also is similar to those published by Atehnkeng et al., (2008)

, but differs to Saleemi et al ., (2010) in Pakistan who found that the most frequently

Aspergillus were A. niger followed by A. flavus , because of high humidity and

high temperature which responsible for higher frequency of A. niger in poultry feeds

as a compared with other species of Aspergillus.

5.2 Coconut based medium and ammonia vapor detection

In the present study , detection by UV light on culture on CAM medium revealed

that 26 isolates of A.flavus were aflatoxigenic with blue –green color ( positive )

on reverse of glass Petri dish of CAM . This result is similar with those obtained by

Saito and Machida, (1999 ) and Yazdani et al.,( 2010) . While there was difference

with Riba et al., (2013) who confirmed that the cultures of aflatoxigenic Aspergillus

were tested for 365 nm UV light fluorescence and for bright orange-yellow colony

reverse coloring. The rapid techniques by using ammonia vapor revealed that 26

isolates of A.flavus were aflatoxigenic by turn the culture to pink color ,this is

similar to Zrari, (2013) and Yazdani et al., 2010).


____________________________________________________________________

85

5.3 Molecular detection

5.3.1 PCR

In the present study , DNA was extracted from dry colony in culture .Positive

result amplification was gotten with 0.05 g of mycelium of aflatoxigenic A.flavus.

The used primer was designed to gene aflR of aflatoxin regulatory pathway. This

process consider as the rapid method for detection of aflatoxigenic A.flavus in

selected poultry feed as compared with conventional detection method. PCR result of

50 isolates confirmed that 43 isolates of A.flavus belonging to the A.flavus (positive

) and considered as high specificity of aflR primer with strong signals or band were

obtained . An amplicon corresponding to aflR approximately 798 bp was appear after

agarose gel electrophoresis ,this result is similar to the report of Farber et al.,(1997),

Manonmani et al., (2005) , Noorbakhsh et al., (2009) and Hashim et al.,(2013) .

The present study dissimilar with Shapira et al., (1996) who have described PCR

technique for the aflatoxigenic A.flavus detection by the genes ver-1 and omtA as

targets which came by results of DNA of A. parasiticus, but weak signals were

gained from those of A. flavus with the same primer pairs. In this study aflR primer

based PCR method had strong signals with aflR gene and high sensitivity and

specificity through detecting of aflatoxigenic aspergilli in pure culture .These

varieties are due to the different primer pairs in amplification.

The CAM using for detection of aflatoxins is not always reliable because of the

high sensitivity of Aspergillus to ingredients of the medium (Yazdani et al., 2010), so

the results of aflatoxigenic detection are not always positive, for determination by

CAM is positive by PCR detection based on aflR gene , and vice versa, these result


____________________________________________________________________

86

similard with Abdel-Hadi et al., (2011) and Navya et al ., (2013), so this detection is

not accurate to determine the aflatoxigenic from nonaflatoxigenic A.flavus , but the

detection by PCR is more accurate , sensitive , specific and less laborious (Shweta et

al., 2013).

5.3.2 Sequencing and sequences analysis of PCR products for aflR gene

The compatibility of all analyzed isolates with the same standard type strain of

A.flavus ITEM 8083 strain , ID: emb|FN398162.1 could be related to the high

similarity of aflR copy with the standard copy of A.flavus ITEM 8083 strain , ID:

emb|FN398162.1strain .According to the alignment loci difference which may related

to the sequence process as the noise of sequence which should be discarded from

different locations loci according to the part of sequence that contained the noise.

Conclusions and

Recommendations

Conclusions and recommendations

_______________________________________________________________________

87


Conclusions

1-There were contamination with aflatoxin in poultry feed in farms and local markets in

Basrah province.

2- There are several fungi in collected poultry feed .

3-Several identification and detection methods of aflatoxigenic Aspergillus flavus were

used , the most specific , powerful and accurate methods were molecular method

(PCR and sequences analysis) .This method detects the specific gene and genetic

sequences which produce the aflatoxin.

4- The sequences analysis revealed that the poultry feed were contaminated with

aflatoxigenic A.flavus isolates , and these isolates were compatible(100% and 99%)

with other A.flavus strains in gene bank.

Recommendations

1- Deep study should be done on mycotoxigenic fungi and the amount of mycotoxin in

several farms storage and local markets in Basrah province.

2- Control and prevent factors such as moister and temperature which play important role

in fungal growth and mycotoxin production by make them unsuitable .

3- Bioassay is very important measurement in this type of studies, so it is recommended

to held more deep studies to estimate the effect of degradation residues on domestic

animals especially blood parameters and status.


_______________________________________________________________________

88

4- Application of biocontrol agent as a powerful control factor for aflatoxins especially

the aflatoxin B1( AFB1).

5- Storage the feed in cooling stores.

References

References

_______________________________________________________________

89

Abarca, M.L., Bragulat, M.R., Castella ,G. and Cabanes, F.J. (1994). Mycoflora

and aflatoxin producing strains in animal mixed feeds. J. Food Prot., 57:

256-258.

Abbas, H. K. , Shier ,W. T., Horn, B. W. and Weaver ,M. A. (2004a). Cultural

methods for aflatoxin detection. J. Toxicol., 23( 2 – 3):295-315.

Abbas, H.K., Zablotowics, R.M., Weaver, M.A., Horn, B.W., Xie, W.and Shier,

W.T.(2004b).Comparison of cultural and analytical methods for

determination of aflatoxin production by Mississippi Delta Aspergillus

isolates. Can. J. Microbiol. 50:193-199.

Abdel-Hadi,A.,Carter,D.and Magan, N.(2011).Discrimination between

aflatoxigenic and non-aflatoxigenic strains of Aspergillus section Flavi

group contaminating Egyptian peanuts using molecular and analytical

techniques. World Myco. J.,4(1): 69-77.

Adams, M.R. and Moss, M.O.( 2000.) Food Microbiology, 2nd ed. Royal

Society of Chemistry.43.

Al-Fakih,A.A.(2014).Overview on the fungal metabolites involved in

mycopathy. Open J. Med. Microbiol., 4(1): 38-63.

Al-Kahtani, M.D.F. ( 2014). Isolation of fungi and their mycotoxin extract from

stored wheat and other grains importer in Saudi Arabia. Am. J. Food

Technol., 9: 370-376.

Alkhayyat,F. and Yu,J.H.(2014).Upstream regulation of mycotoxin

biosynthesis. Adv. Appl. Microbioil., 86:251-278.

Alm, T. (2003). The witch trials of Finnmark, northern Norway, during the 17th

century: Evidence for ergotism as a contributing factor. Econ. Bot.,

57(3):403–416.

Amalfitano, C., Pengue, R., Andolfi, A., Vurro, M., Zonno, M.C. and Evidente

,A .(2002) HPLC analysis of fusaric acid, 9,10-dehydrofusaric acid and

their methyl esters, toxic metabolites from weed pathogenic Fusarium

species. Phytochem. Anal., 13(5):277–282 .

Andolfi, A., Mugnai ,L., Luque, J., Surico, G., Cimmino, A.and Evidente, A.

(2011). Phytotoxins produced by fungi associated with grapevine trunk

diseases. Toxins, 3(12): 1569-1605.

Antonissen, G. , Martel, A. , Pasmans, F. , Ducatelle, R. , Verbrugghe, E. , Li, S.

, Haesebrouck, F. , Van Immerseel, F. and Croubels ,S. (2014). The Impact

References

_______________________________________________________________

90

of Fusarium mycotoxins on human and animal host susceptibility to

infectious diseases. Toxins, 6(2): 430-452.

Aquino,S.(2011).Gamma radiation against toxigenic fungi in food, medicinal

and aromatic herbs. In: Science against microbial pathogens: Comm. Curr.

Res.Technolo.Adv.,Mendez-Vilas,A.(Ed.),272-281.

Arendrup,M.C., Zhao,Y.and Perlin, D.S.(2011). Aspergillus. Dongyou Liu (ed).

Molecular Detection of Human Fungal Pathogens, CRC Press, 171-189.

Armenda´riz, C.R., Ferna´ndez, A´. J.G., Girone´s, M.C.L.R. and de la Torre,

A.H. (2014). Mycotoxins: Encyclopedia of Toxicology(3rd

ed). 424–427.

Ashraf ,S., Zaneb ,H., Yousaf ,M., Ijaz, A., Sohail ,M., Muti, S., Usman, M.,

Ijaz ,S.and Rehman, H.(2013).Effect of dietary supplementation of

prebiotics and probiotics on intestinal microarchitecture in broilers reared

under cyclic heat stress. J. Anim. Physiol. Anim. Nutr. 97(1): 68-73.

Astoreca ,A., Barberis, C., Magnoli,C.,Combina,M.and Dalcero,A.(2009).

Influence of ecophysiological factors on growth, lag phase and ochratoxin

A production by Aspergillus niger aggregate strains in irradiated corn

grains. Intl. J .Food Microbiol., 129(2):174-179.

Atalla, M.M., Hassanein, N.M., El-Beih,A.A andYoussef,Y.A.(2003).

Mycotoxin production in wheat grains by different aspergilli in relation to

different relative humidities and storage periods. Nahrung. ,47(1):6-10. Atanda, O.O., Akpan, I., Rati, E.R., and Ozoje, M. (2005).Palm kernel: a

potential substrate for rapid detection of aflatoxigenic fungi. Food Sci.

Tech. Intl., 11(1): 67–74.

Atehnkeng, J., Ojiambo, P. S., Donner, M., Ikotun, T., Sikora, R. A., and Cotty,

P. J. (2008). Distribution and toxigenicity of Aspergillus species isolated

from maize kernels from three agro-ecological zones in Nigeria, Intl .J.

Food Microbiol. ,122(1-2):74-84.

Atkins, S. D. and Clark, I. M. (2004). Fungal molecular diagnostics: a mini

review. J. Appl. Gen., 45(1):3-15.

Avantaggio, G., Quaranta, F., Desidero, E and Visconti, A.( 2002). Fumonisin

contamination of maize hybrids visibly damaged by Sesamia. J. Sci., Food

Agric., 83:13–18.

Azaiez, I., Font, G., Mañes, J. and Fernández-Franzón, M.(2014). Survey of


http://www.ncbi.nlm.nih.gov/pubmed/?term=Hassanein%20NM%5BAuthor%5D&cauthor=true&cauthor_uid=12653428

http://www.ncbi.nlm.nih.gov/pubmed/?term=El-Beih%20AA%5BAuthor%5D&cauthor=true&cauthor_uid=12653428

http://www.ncbi.nlm.nih.gov/pubmed/?term=Youssef%20YA%5BAuthor%5D&cauthor=true&cauthor_uid=12653428

http://www.ncbi.nlm.nih.gov/pubmed/12653428

References

_______________________________________________________________

91

mycotoxinsin dates and dried fruits from Tunisian and Spanish markets.

j.foodcont.,51: 340-346.

Bakker, G. R. (2004).The effects of disease management practices on

phylloplane microorganism populations of apple. M.Sc. thesis. Lincoln

University, New Zealand.

Bakutis, B., Baliukonienė ,V., Lugauskas ,A. (2006). Factors predetermining the

abundance of fungi andmycotoxins in grain from organic and conventional

farms. Ekologija, 3:122-127.

Beg ,M. U., Al-Mutairi ,M., Beg, K. R., Al-Mazeedi, H. M., Ali, L. N. and

Saeed, T. (2005). Mycotoxins in poultry feed in Kuwait. Arch. Environ.

Contam. Toxicol. 50:594–602.

Beltrán, E., Ibáñez, M., Portolés, T., Ripollés, C., Sancho, J.V., Yusà, V., Marín,

S., Hernández, F. (2013) . Development of sensitive and rapid analytical

methodology for food analysis of 18 mycotoxins included in a total diet

study. Analytica Chimica Acta. ,783:39-48.

Benítez, T., Rincón ,A.M., Limón, M.C.and Codón, A.C.(2004). Biocontrol

mechanisms of Trichoderma strains. Intl. Microbiol. ,7(4):249-260.

Bennett ,J.W. and Moore ,G.G. (2015). Mycotoxins. Clin Microbiol. ,16(3):497-

516. Bernard, P.S. and Wittwer, C. T. (2000).Homogeneous amplification and variant

detection byfluorescent hybridization probes. Clin. Chem., 46: 147-148.

Berthiller, F., Crews, C., Dall'Asta, C., Saeger, S.D., Haesaert, G., Karlovsky,

P.,Oswald,I.P.,Seefelder,W.,Speijers,G. and Stroka,J.(2013).Masked

mycotoxins: A review. Molec. Nutr. Food Res. ,57:165-186.

Bertuzzi ,T., Rastelli, S., Mulazzi, A., and Pietri, A. (2012). Evaluation and

improvement of extraction methods for the analysis of aflatoxins B1, B2,

G1 and G2 from naturally contaminated maize. Food Anal. Meth.,5(

3):512-519.

Beuchat, L.R.and Cousin, M.A.( 2001). Yeasts and molds. In: Downes, F.P., Ito,

K. (Eds.), Compendium of methods for the microbiological examination of

foods, 4th ed. American Public Health Association, Washington, D. C.,

209–215.


References

_______________________________________________________________

92

Bhat, A.R., Bhat, G.V. and Shenoy, G.G.( 2010 a). Synthesis and in vitro

antimicrobial activity of new 1, 2, 4-triazoles. J. Pharm. Pharmacol.,

53(2):267-272.

Bhat, A.R., Rai, R. V. and Karim, A.A. (2010 b), Mycotoxins in food and feed:

present status and future concerns. comprehensive reviews in food. Sci.

food safety, 9(1): 57–81.

Bhatnagar, D., Proctor, R., Payne, G.A., Wilkinson, J., Yu, J., Cleveland, T.E.,

and Nierman, W.C. (2006) Genomics of mycotoxigenic fungi. In: D. Barug

(ed.), The Mycotoxin Factbook. Wageningen Academic Publishers,

Wageningen, The Netherlands, 157–177.

Bolechová, M. , Benešová, K ., Běláková ,S., Cáslavský, J., Pospíchalová, M.,

and Mikulíková ,R.(2015). Determination of seventeen mycotoxins in

barley and malt in the Czech Republic. Food Control, 47:108-113.

Bouhet, S. and Oswald, I.P.( 2005). The effects of mycotoxins, fungal food

contaminants, on the intestinal epithelial cell-derived innate immune

response. Vet. Immunol. Immunopathol.108(1-2): 199-209.

Bragualt, M.R., Abarca M.L., , Castella, G., and Cabanes ,F.J. (1995). A

mycological survey on mixed poultry feeds and mixed rabbit feeds. J. Sci.

Food Agri., 67(2): 215-220.

Brodhun, F. and Feussner, I. (2011). Oxylipins in fungi. The FEBS Journal, 278:

1047–1063.

Brown, D.W., Butchko, R.A., Busman, M., Proctor, R.H. (2007). The Fusarium

verticillioides FUM gene cluster encodes a Zn(II)2Cys6 protein that affects

FUM gene expression and fumonisin production. Eukaryot.Cell,6(7):

1210–1218.

Bruns, H.A. (2003). Controlling aflatoxin and fumonisin in maize by crop

management. Toxin Rev., 22:153- 173.

Bryden ,W. L. (2007). Mycotoxins in the food chain: human health implications.

A review. Asia Pac. J. Clin. Nutr. ,16 (1):95-101.

Cairns, V., Hope, R.and Magan N. (2003). Environmental factors and competing

microflora affect growthandochratoxin production by Penicillium

verrucosum on wheat grain.Aspects Appl Biol., 68:81–90.

Calvet,R. M., Pereira,M.M. G., Costa,A. P. R. I, Torres, A. M. and Maria

Christina Sanches Muratori(2015). Toxigenic mycobiota and mycotoxins in

shrimp feed. Ciência Rural, Santa Maria, 45 (6):1021-1026.








References

_______________________________________________________________

93

Calvo, A.M., Wilson, R.A., Bok, J.W. and Keller, N.P. (2002). Relationship

between secondary metabolism and fungal development. Microbiol.

Molec. Biol. Rev., 66:447-459.

Cao, X., Wu, S., Yue, Y., Wang, S., Wang, Y., Tao, L., Tian, H., Xie, J.and

Ding, H.(2015).A high-throughput method for the simultaneous

determination ofmultiple mycotoxins in human and laboratory animal

biological fluidsand tissues by PLE and HPLC–MS/MS. J Chromatogr. B.

Analyt. Technol. Biomed .Life Sci. ,942-943:113-125.

Cardoso, F., F. das C., Pinheiro, R. E. E., Azevedo, M. L. X., Neves, J. A., de

Albuquerque, W. F., Torres, A. M., Costa, A. P. R. and Muratori, M. C. S.

(2015). Microbiological and mycotoxicological evaluation of rice products

used in human food in northeastern Brazil. Afri. J. Microbiol. Res., 9(22):

1487-1491.

Cardwell, K. F. and Henry, S. H. (2004). Risk of exposure to and mitigation

of effect of aflatoxin on human health: A west african example. Journal of

Toxicology: Toxin Reviews, 23 (2-3): 217–247.

CAST. (2003). Mycotoxins: risks in plant, animal, and human systems. Council

for Agric. Sci. Technol. Task Force Report, 139. Ames, IA.

Cegielska-Radziejewska ,R., Stuper, K. and Szablewski ,T. (2013). Microflora

and mycotoxin contamination in poultry feed mixtures from western

Poland. Annals of Agricul. Environ. Med., 20( 1): 30-35.

Champeil, A., Fourbet, J.F., Dore, T. and Rossignol, L.( 2004). Influence of

cropping system on Fusarium head blight and mycotoxin levels in winter

wheat. Crop Protect. 23(6): 531–537.

Chaytor, A, C. , Hansen ,J.A. , Heugten, E. V.. Todd See ,M.and Kim, S. W.

(2011).Occurrence and decontamination of mycotoxins in swine feed.

Asian-Aust. J. Anim. Sci., 24 (5) : 723 – 738.

Cheli ,F., Campagnoli, A, Pinotti, L .and Dell’Orto, V. (2012). Rapid methods

as analytical tools for food and feed contaminant evaluation:

methodological implications for mycotoxin analysis in cereals In: Food

production : approaches, challenges and tasks. Prof. Anna Aladjadjiyan

(Ed.), In.Tech. , 185-204,

Chirife, J. and Fontana, A. J. (2007) Introduction: Historical highlights of water

activity research, in water activity in foods: fundamentals and applications

(eds G. V. Barbosa-Cánovas, A. J. Fontana, S. J. Schmidt and T. P.

Labuza), Blackwell Publishing Ltd, Oxford, UK.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Cao%20X%5BAuthor%5D&cauthor=true&cauthor_uid=24239936

http://www.ncbi.nlm.nih.gov/pubmed/?term=Wu%20S%5BAuthor%5D&cauthor=true&cauthor_uid=24239936

http://www.ncbi.nlm.nih.gov/pubmed/?term=Yue%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=24239936

http://www.ncbi.nlm.nih.gov/pubmed/?term=Wang%20S%5BAuthor%5D&cauthor=true&cauthor_uid=24239936

http://www.ncbi.nlm.nih.gov/pubmed/?term=Wang%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=24239936

http://www.ncbi.nlm.nih.gov/pubmed/?term=Tao%20L%5BAuthor%5D&cauthor=true&cauthor_uid=24239936

http://www.ncbi.nlm.nih.gov/pubmed/?term=Tian%20H%5BAuthor%5D&cauthor=true&cauthor_uid=24239936

http://www.ncbi.nlm.nih.gov/pubmed/?term=Xie%20J%5BAuthor%5D&cauthor=true&cauthor_uid=24239936

http://www.ncbi.nlm.nih.gov/pubmed/?term=Ding%20H%5BAuthor%5D&cauthor=true&cauthor_uid=24239936



http://www.tandfonline.com/author/Cardwell%2C+K+F

http://www.tandfonline.com/author/Henry%2C+S+H

http://www.tandfonline.com/loi/itxr19?open=23#vol_23

http://www.tandfonline.com/toc/itxr19/23/2-3

References

_______________________________________________________________

94

Choi, S., Jun ,H., Bang ,J., Chung, S.H., Kim, Y., Kim, B.S., Kim ,H., Beuchat,

L.R.and Ryu, J.H. (2015). Behavior of Aspergillus flavus and Fusarium

graminearum on rice as affected by degree of milling, temperature, and

relative humidity during storage. Food Microbiol., 46:307–313

Cigić, I.K.and Prosen, H.(2009). An overview of conventional and emerging

analytical methods for the determination of mycotoxins. International

Journal of Molecular Sciences ,10 (1): 62–115.

Cleveland, T.E., Dowd, P.F., Desjardins, A.E., Bhatnagar, D. and Cotty, P.J.(

2003). United States department of agriculture–agricultural research

service on pre-harvest prevention of mycotoxins and mycotoxigenic fungi

in US crops. Pest Manage. Sci. 59(6-7): 629-642.

Cojocaru, D.C. (2007): General entomology , Editura Tehnopress, Iasi, 25- 30.

Cortinovis, C., Pizzo, F., Spicer, L.J. and Caloni, F.( 2013). Fusarium

mycotoxins: effects onreproductive function in domestic animalse . A

review. Theriogenology 80:557-564.

Coulombe, R.A.(1993).Biological action of mycotoxins .J. Dairy Sci. ,

76(3):880-891.

Criseo, G., Bagnara, A.and Bisignano, G.(2001). Differentiation of aflatoxin-

producing and non-producing strains of Aspergillus flavus group. Letters in

Applied Microbiology, 33(4): 291-295.

Czéh,A.(2014).Multiplexed solid phase immunoassay platform for poly-

mycotoxins: beyond 20th century applications. PhDThesis. University of

Pécs. Hungary.

Czembor ,E., Stępień, Ł.and Waśkiewicz, A. (2015). Effect of environmental

factors on Fusarium species and associated mycotoxins in maize grain

grown in Poland. PLoS ONE , 10(7):1-18.

Dalcero ,A., Magnoli, C., Chiacchiera, S., Palacios, G. and Reynoso ,M. (1997). Mycoflora and incidence of aflatoxin B1, zearalenone and deoxynivalenol

in poultry feeds in Argentina. Mycopathologia 137: 179-184.

Danicke, S.(2002). Prevention and control of mycotoxins in the poultry

production chain: A European view. World. Poult. Sci. J. 58:451-474.

Dao, H.P., Mathieu, F. and Lebrihi, A.(2005). Two primer pairs to detect OTA

producers by PCR method. Intl. J. Food Microbiol. ,104(1):61-7.

References

_______________________________________________________________

95

Davis, N.D., Iyer, S.K.and Diener, U.L.(1987). Improved method of screening

for aflatoxin with a coconut agar medium. Appl. Environ. Microbiol.

53(7):1593–1595.

De Camargo, A.C., de Souza Vieira, T.M., Regitano-d'Arce, M.A.and de

Alencar, S.M., Calori-Domingues, M.A., Spoto, M.H., Canniatti-Brazaca,

S.G. (2012). Gamma irradiation of in-shell and blanched peanuts protects

against mycotoxic fungi and retains their nutraceutical components during

long-term storage. Intl. J. Mol. Sci., 13(9):10935-10958.

De la Campa, R., Hooker, D.C., Miller, J.D., Schaafsma, A.W. and Hammond,

B.G. (2005).Modeling effects of environment, insect damage, and Bt

genotypes on fumonisin accumulation in maize in Argentina and the

Phillipines. Mycopathologia. 159(4):539-552.

Deacon ,J.W. (2006). Fungal Biology , 3ed . Blackwell Publishing Ltd, US.12.

Degraeve ,S., Madege ,R.R., Audenaert ,K. , Kamala ,A. , Ortiz, J. , Kimanya,

M. , Tiisekwa ,B., De Meulenaer, B. and Haesaert ,G. (2015). Impact of

local pre-harvest management practices in maize on theoccurrence of

Fusarium species and associated mycotoxins in twoagro-ecosystems in

Tanzania. Food Control. ,59:225-233.

Demain, A.L .and Fang, A. (2000) The natural functions of secondary

metabolites. Adv Biochem Eng Biotechnol., 69:1-39.

Dersjant-Li, Y., Verstegen, M. W. A. and Gerrits ,W. J. J.( 2003). The impact of

low concentrations of aflatoxin, deoxynivalenol or fumonisin in diets on

growing pigs and poultry. Nutr. Res. Rev.,16:223-239.

Dhanasekaran, D., Shanmugapriya S., Thajuddin, N.and Panneerselvam, A.

(2011). Aflatoxins and aflatoxicosis in human and animals. Aflatoxins-

Biochem.Molec. Biol., 221-254.

Dohlman, E .(2003) .Mycotoxin hazards and regulations: impacts on food and

animal feed crop trade. In: Buzby J (ed) International trade and food safety:

economic theory and case studies. United States Department of

Agriculture, Agricultural Economic Report , 828, Washington DC.

Domsch, K.H., Gams, W. (1980) .Compendium of soil fungi. Academic Press.

London, New York, Toronto, Sydney, San Francisco,566.

Dorner, J.W. and Cole, R.J.(2002). Effect of application of nontoxigenic strain

of Aspergillus flavus and A. parasiticus on subsequent aflatoxin

contamination of peanuts in storage. J. Stored Prod.Res. 38(4): 329–339.

References

_______________________________________________________________

96

Dowd, P. (2004). Validation of a mycotoxin predicting computer program for

U.S. midwest grown maize in commercial fields. Proc. Aflatoxin & Fungal

Genomics Workshop. Mycopathologia, 157:463.

Dutton ,M., Kinsey, A.(1996).A note on the occurrence of mycotoxins in cereals

and animal feedstuffs in Kwazulu Natal, South Africa. South Africa J.

Anim. Sci. , 26:53-57.

Dyer, S.K .and Mccammon. S. (1994). Detection of toxigenic isolates of

Aspergillus flavus and related species on coconut cream agar. J.Appl.

Bacteriol., 76: 75-78.

Dzuman, Z., Zachariasova ,M., Veprikova, Z., Godula, M.and Hajslova, J.

(2015). Multi-analyte high performance liquid chromatography coupled to

high resolution tandem mass spectrometry method for control of pesticide

residues, mycotoxins, and pyrrolizidine alkaloids. Anal Chim Acta. ,

863:29-40.

Edwards, S. G., Pirgozliev, S. R., Hare, M. C. and Jenkinson, P.( 2001).

Quantification of trichothecene-producing Fusarium species in harvested

grain by competitive PCR to determine the efficacy of fungicides against

Fusarium head blight of winter wheat. Appl. Environ. Microbiol., 67(4):

1575-1580.

Egner ,P.A., Wang, J.B., Zhu, Y.R., Zhang, B.C., Wu, Y., Zhang, Q.N., Qian,

G.S., Kuang, S.Y., Gange, S.J., Jacobson, L.P., Helzlsouer ,K.J., Bailey,

G.S., Groopman, J.D.and Kensler, T.W.( 2001). Chlorophyllin intervention

reduces aflatoxin-DNA adducts in individuals at high risk for liver cancer.

Proc. Natl. Acad. Sci. USA , 98:14601-14606.

Ehrlich, K.C. , Yu ,J. and Cotty, P.J. (2005). Aflatoxin biosynthesis gene

clusters and flanking regions. J.Appl.Microbiol., 99(3): 518–527.

Eidi ,S., Fata, A., Farid-Hosseini, R., Amir Kamali, S., Hajari ,Z., Naseri, A.

and Bakhshaee, M. (2014). Isolation of Aspergillus species from nasal

cavity and bedroom of healthy volunteers and patients with allergic rhinitis

in Mashhad, Iran. Zahedan J. Res .Med. Sci ., 16(11): 15-19.

Endah, N.B. (2011) Investigating the mode of action of the mycoherbicide

component Fusarium oxysporum f.sp. strigae on Striga parasitizing

sorghum and its implication for Striga control in Africa. PhD thesis. University of Hohenheim, Germany.

Essono, G., Ayodele, M., Akoa, A., Foko, J., Filtenborg, O. and Olembo, S.

(2009). Aflatoxin producing Aspergillus spp. and aflatoxin levels in stored

cassava chips as affected by processing practice. Food Control, 20: 648-

654.


References

_______________________________________________________________

97

Fandohana, P., Gnonlonfina, B., Hellb, K., Marasasc W.F.O. and Wingfieldd

,M.J. (2005). Natural occurrence of Fusarium and subsequent fumonisin

contamination in preharvest and stored maize in Benin, West Africa. Int. J.

Food Microbiol.,99(2):173-83.

Farber, P., Geisen, R.and Holzapfe, W.H. (1997).Detection of aflatoxigenic

fungi in figs by a PCR reaction. Intl. J .Food Microbiol. , 36(2-3):215–220.

Ferreras, M. C., J. Benavides,C. Garcia- Pariente, L. Delgado, M. Fuertes,M.

Munoz, J., Garcia-Marin, F. and Perez, V. (2013). Acute and chronic

disease associated with naturally occurring T-2 mycotoxicosis in sheep. J.

Comp. Path. , 148:236-242.

Fischer, G., Müller ,T., Schwalbe ,R., Ostrowski, R. and Dott, W.(2000).

Species-specific profiles of mycotoxins produced in cultures and associated

with conidia of airborne fungi derived from biowaste .Intl. J. Hyg. Environ.

Health , 203(2):105-116.

Forristal, P.D., O’Kiely, P. and Lenehan, J.J. (2000). The influence of the

number of layers of film cover and stretch level on silage preservation, gas

composition and mould growth on big bale silage. Irish J.Agricul. Food

Res., 39(3): 467.

Fox, E.M. and Howlett ,B.J. (2008). Secondary metabolism: regulation and role

in fungal biology. Curr. Opin. Microbiol. ,11 (6): 481–487.

Francisco,F. G., Usberti, R. (2008). Seed health of common bean stored at

constant moisture and temperature. Sci. Agric., 65 (6): 613-619.

Friedman,M.and Rasooly,R.(2013).Review of the inhibition of biological

activities of food-related selected toxins by natural compounds. Toxins, 5:

743-775.

Frisvad, J.C., Thrane, U.( 2002). Mycotoxin production by common filamentous

fungi. In: Samson, R.A., Hoekstra, E.S., Frisvad, J.C., Filtenborg, O.

(Eds.), Introduction to Food- and Air Borne Fungi. CBS,Utrecht,

Netherlands. 321-331.

Gajęcka ,M., Zielonka, Ł., Dąbrowski, M.and Gajęcki, M. (2011). Threats

resulting from the presence of zearalenone in water, Medycyna Wet. ,67:

643-646.

Galaverna, G., Dall’Asta, C., Mangia, M., Dossena, A.and Marchelli, R. (2009)

.Masked mycotoxins: An emerging issue for food safety. Czech J.Food

Sci., 27: 89–92.

http://www.ncbi.nlm.nih.gov.sci-hub.org/pubmed/?term=Fischer%20G%5BAuthor%5D&cauthor=true&cauthor_uid=11109562

http://www.ncbi.nlm.nih.gov.sci-hub.org/pubmed/?term=M%C3%BCller%20T%5BAuthor%5D&cauthor=true&cauthor_uid=11109562

http://www.ncbi.nlm.nih.gov.sci-hub.org/pubmed/?term=Schwalbe%20R%5BAuthor%5D&cauthor=true&cauthor_uid=11109562

http://www.ncbi.nlm.nih.gov.sci-hub.org/pubmed/?term=Ostrowski%20R%5BAuthor%5D&cauthor=true&cauthor_uid=11109562

http://www.ncbi.nlm.nih.gov.sci-hub.org/pubmed/?term=Dott%20W%5BAuthor%5D&cauthor=true&cauthor_uid=11109562

http://www.ncbi.nlm.nih.gov.sci-hub.org/pubmed/11109562

http://www.ncbi.nlm.nih.gov.sci-hub.org/pubmed/11109562

References

_______________________________________________________________

98

Gallo, A, Bruno, K.S., Solfrizzo, M., Perrone, G., Mulè, G., Visconti, A. and

Baker, S.E.(2012). New insight into the ochratoxin A biosynthetic pathway

through deletion of a nonribosomal peptide synthetase gene in Aspergillus

carbonarius. Appl Environ Microbiol., 78(23):8208-8218.

Giorni, P., Leggrieri, M.C., Magan, N., and Battilani, P. (2012). Comparison of

temperature and moisture requirements for sporulation of Aspergillus

flavus sclerotia on natural and artificial substrates. Fungal Biol.

,116(6):637-642.

Godish, T.(2001). Indoor environmental quality, CRC Press LLC, U.S.174.

Gomaa, A.I., Khan, S.A., Toledano, M.B., Waked. I.and Taylor-Robinson, S.D.

(2008).Hepatocellular carcinoma: epidemiology, risk factors and

pathogenesis. World J .Gastroenterol. ,14(27):4300–4308.

Gong, Y.Y., Hounsa, A., Egal, S., Turner, P.C., Sutcliffe, A.E., Hall A.J.,

Cardwell, K. and Wild, C.P.(2004). Postweaning exposure to aflatoxin

results in impaired child growth: a longitudinal study in Benin, West

Africa. Environ Health Perspect. 112(13):1334-1338.

Gonzalez, H. H., Resnik,S.L., Boca, R. T., and Marasas,W. F.( 1995).Mycoflora

of Argentinian corn harvested in the main production area in 1990.

Mycopathol., 130(1): 29–36.

Good Manufacturing Practices, GMP(2005). Regulations on product standards

in the animal feed sector. GMP14: 17-08-05.

Gorfu, D. and Sangchote, S. (2005). Fungi associated with field pea seeds from

Ethiopia and seed transmission of Ascochyta pinodes. Seed Sci. & Technol.

33:387-396.

Gow, N.A .(2004). New angles in mycology: studies in directional growth and

directional motility. Mycol. Res.,108(1): 5–13.

Gräfenhan, T., Schroers ,H.J., Nirenberg, H.I. and Seifert, K.A.(2011). An

overview of the taxonomy, phylogeny, and typification of nectriaceous

fungi in Cosmospora, Acremonium, Fusarium, Stilbella, and Volutella.

Stud Mycol. ,68:79-113.

Greco, M.V., Franchi, M.L., Rico Golba, S.L., Pardo ,A.G. and Pose,

G.N.(2014). Mycotoxins and mycotoxigenic fungi in poultry feed for food-

producing animals. Scientific World J. ,968215.

References

_______________________________________________________________

99

Groopman ,J.D., Kensler, T.W. and Wild, C.P. (2008) Protective interventions

to prevent aflatoxininduced carcinogenesis in developing countries. Annu.

Rev. Public Health,29: 187-203.

Guo, B.Z., Holbrook, C.C., Yu, J., Lee, R.D., Lynch, R.E.(2005). Application of

technology of gene expression in response to drought stress and elimination

of preharvest aflatoxin contamination. In aflatoxin and food safety; Abbas,

H.K., Ed.; CRC Press: Boca Raton, FL,USA, 313–331.

Gutleb ,A.C., Caloni ,F., Girauda , F., Cortinovis, C., . Pizzo ,F., Hoffmann, L.,

Bohn, T. and Pasquali, M.(2015).Detection of multiple mycotoxin

occurrences in soy animal feed by traditional mycological identification

combined with molecular species identification. Toxicol. Rep. ,2:275–279.

Haidukowski, M., Pascale, M., Perrone, G., Pancaldi, D., Campagna, C.and

Visconti, A. (2004). Effect of fungicides on the development of Fusarium

head blight, yield and deoxynivalenol accumulation in wheat inoculated

under field conditions with Fusarium graminearum and Fusarium

culmorum. J. Sci. Food Agric. ,85(2):191–198.

Hara, S., Fennell, D.I. and Hesseltine, C.W.(1974). Aflatoxin-producing strains

of Aspergillus flavus detected by fluorescence of agar medium under

ultraviolet light. Appl Microbiol. ,27(6):1118-1123.

Hashim, A. , Al-Kazaz, A., Abdulmalek (2013). PCR detection of Aspergillus

flavus isolates for aflatoxin B1 producer. J. Biotechnol. Res. Center ,7(3):

81-89.

Hassan, Z.U., Khan, M.Z., Khan, A., Javed ,I., Sadiqu ,U., Khatoon, A. (2012):

Ochratoxicosis in white leghorn breeder hens: production and breeding

performance. Pak Vet J., 32( 4):557-561.

Hedayati, M. , Manafi, M. and Yari ,M. (2014).Aflatoxicosis in broilers:

efficacy of a commercial mycotoxin binder on performance and immunity

parameters. Intl. J. Ecosys., 4(4): 176-183.

Hell, K., Cardwell, K.F., Setamou, M.and Poehling, H.M.( 2000) . The influence

of storage practices on aflatoxin contamination in maize in four

agroecological zones of Benin, West Africa. J. Stored Prod. Res., 36(4):

365–382.

Hell, K., Fandohan, P., Bandyopadhyay, R., Cardwell, K., Kiewnick, S., Sikora,

R.and Cotty, P.(2008). Pre- and post-harvest management of aflatoxin in

maize. In Leslie et al. (eds) Mycotoxins: detection methods, management,

http://www.ncbi.nlm.nih.gov/pubmed/?term=Groopman%20JD%5BAuthor%5D&cauthor=true&cauthor_uid=17914931

http://www.ncbi.nlm.nih.gov/pubmed/?term=Kensler%20TW%5BAuthor%5D&cauthor=true&cauthor_uid=17914931

http://www.ncbi.nlm.nih.gov/pubmed/?term=Wild%20CP%5BAuthor%5D&cauthor=true&cauthor_uid=17914931

References

_______________________________________________________________

100

public health and agricultural trade. CABI Publishing, Wallingford, UK,

210-219.

Hill ,R.A., Wilson ,D.M., McMillan, W.W., Widstrom ,N.W., Cole, R.J.,

Sander, T.H. and Blakenskip,P.D. (1985). Ecology of Aspergillus flavus

group and aflatoxin formation in maize andgroundnut. In: Lacey J,

editor.Trichothecenes and othermycotoxins.Hoboken, N.J.:JohnWiley and

Sons. 79–95.

Hope, R.and Magan, N. (2003).Two dimensional environmental profiles of

growth, Deoxynivalenol and nivalenol production by Fusarium culmorum

on a wheat-based substrate. Lett. Appl.Microbiol., 37:70-74.

Horbach,R.,Navarro-Quesada,A.R.,Knogge,W.and Deising,H. B.(2011).When

and how to kill aplant cell:infection strategies of plant pathogenic fungi.

J.PlantPhysiol. ,168(1):51–62.

Horn, B.W. (2005). Colonization of wounded peanut seeds by soil fungi:

selectivity for species from Aspergillus section Flavi. Mycologia, 97(1),

202–217.

Hsuan ,H.M., Salleh, B.and Zakaria, L.(2011).Molecular Identification of

Fusarium species in Gibberella fujikuroi species complex from rice,

sugarcane and maize from Peninsular Malaysia . Intl. J. Mol. Sci.,

12(10):6722-6732.

Http://blast.ncbi.nlm.nih.gov/Blast.cgi.

Http://www.macrogen.com/eng.

Hussain, T., Singh, B.P.and Anwar ,F. (2014). A quantitative Real Time PCR

based method for the detection of phytophthora infestans causing Late

blight of potato, in infested soil. Saudi J.Biol. Sci. , 21(4): 380–386.

Hussein, H.S., Brasel, J.M.(2001).Toxicity, metabolism, and impact of

mycotoxins on humans and animals. A review. Toxicology ,167(2): 101–

134.

Ito,Y.,Peterson,S.W.,Wicklow,D.T.andGoto,T.(2001).Aspergillus seudotamarii,

a new aflatoxin producing species in Aspergillus section Flavi. Mycol. Res.

,105(2): 233-239.

Jargot, D. and Melin,S.(2013). Characterization and validation of sampling and

analytical methods for mycotoxins in workplace air.Environ. Sci.:

Processes Impacts,15: 633-644.


http://pubs.rsc.org/en/results?searchtext=Author%3ASandrine%20Melin

References

_______________________________________________________________

101

Juneja, V. K., Huang, L. and Yan, X. (2012). Intrinsic and extrinsic parameters

for microbial growth and heat inactivation, in handbook of food safety

engineering (ed D.-W. Sun), Wiley-Blackwell, Oxford, UK.

Kabak, B., Dobson ,A.D.W.and Var, I. (2006). Strategies to prevent mycotoxin

contamination of food and animal feed.Critical Revi.Food Sci.Nut.,46(8):

593–619.

Karlovsky,P. (2011). Biological detoxification of the mycotoxin deoxynivalenol

and its use in genetically engineered crops and feed additives. Appl

Microbiol Biotechnol. , 91(3): 491–504.

Keller,N.P.,Turner,G.and Bennett,J.W. (2005). Fungal secondary metabolism—

from biochemistry to genomics. Nature Rev. Microbiol., 3: 937-947.

Khalil, M. M. H., Gomaa, A. M. and Sebaei ,A. S. (2013). Reliable HPLC

Determination of Aflatoxin M1 in Eggs. J. Anal. Methods Chem.,817091.

Khayoon ,W. S., Saad ,B., Salleh, B., Manaf ,N. H. A. and Latiff, A.(2014).

Micro-solid phase extraction with liquid chromatography-tandem mass

spectrometry for the determination of aflatoxins in coffee and malt

beverage.Food Chemistry,147:287-294.

Klarić, M. Š., Rašić,D. and Peraica ,M.(2013).Deleterious effects of mycotoxin

combinations involving ochratoxin A. Toxins, 5: 1965-1987.

Klich,M.A.(2002).Identification of common Aspergillus species, Centraalbureau

voor Schimmelcultures, Utrecht, Netherlands.

Köppen, R., Koch, M., Slegel, D., Merkel, S., Maul, R. and Nehls, I.(2010).

Determination of mycotoxins in foods: Current state of analytical methods

and limitations. Appl. Microbiol. Biotechnol. , 86 (6):1595–1512.

Krnjaja ,V., Pavlovski, Z., Lukić, M., Škrbić ,Z., Stojanović, L.j., Bijelić, Z. and

Mandić ,V. (2014). Fungal contamination and natural occurrence of T-2

toxin in poultry feed. Biotechnol.Anim. Husb., 30 (2): 321-328.

Krnjaja ,V., Stojanović, L.j., Cmiljanić, R., Trenkovski ,S., Tomašević,D .(2008)

The presence of potentially toxigenic fungi in poultry feed. Biotehnol.

Anim. Husb., 24(5-6):87-93.

Krska, R., Welzig, E. and Boudra, H.( 2007). Analysis of Fusarium toxins in

feed. Ani. Feed Sci. Tech. ,137(3-4):241-264.

References

_______________________________________________________________

102

Lanyasunya, T.P., Wamae, L.W., Musa, H.H., Olowofeso, O.and Lokwaleput,

I.K.(2005). The risk of mycotoxins contamination of dairy feed and milk

on smallholder dairy farms in Kenya. Pak. J. Nutr., 4(3): 162–169.

Larsen ,J.C., Hunt ,J., Perrin, I. and Ruckenbauer, P. ( 2004). Workshop on tri-

chothecenes with a focus on DON: summary report, Toxicol. Lett.,153: 1-

22.

Lawlor, P.G. and Lynch ,P.B. (2005). Mycotoxin management. Afr. Farming

Food Process, 46: 12-13.

Lee, H.B., Patriarca, A., Magan ,N. (2015). Alternaria in food: ecophysiology,

mycotoxin production and toxicology. Mycobiology, 43(2): 93–106.

Leong, S.L., Pettersson, O.V., Rice, T., Hocking, A.D. and Schnürer, J. (2011)

The extreme xerophilic mould Xeromyces bisporus – growth and

competition at various water activities. Intl .J. Food Microbiol. ,145(1): 57–

63.

Lević, J., Stanković, S.,Bočarov-Stančić, A., Škrinjar, M.and Mašić, Z.(2004).

The overview on toxigenic fungi and mycotoxins in Serbia and

Montenegro. In An Overview on Toxigenic Fungi and Mycotoxins in

Europe; Logrieco, A., Viskonti, A., Eds.; Kluwer Academic Publishers:

Dordrecht, The Netherlands, 201−218.

Lev-Yadun, S., Dafni, A., Flaishman, M.A., Inbar, M., Izhaki, I., Katzir, G. and

Ne`eman, G. (2004).Plant coloration undermines herbivorous insect

camouflage. Bio. Ess., 26(10):1126-1130.

Li ,Y., Wang, Z., Beier, R.C., Shen, J., De Smet, D., De Saeger, S., Zhang, S.

(2011).T-2 toxin, a trichothecene mycotoxin: review of

toxicity,metabolism, and analytical methods. J. Agri. Food Chem., 59:

3441-3453.

Li, Y., Zhang ,B., He, X., Cheng, W.H., Xu ,W., Luo, Y., Liang ,R., Luo. H.and

Huang, K. (2014). Analysis of individual and combined effects of

ochratoxin A and zearalenone on HepG2 and KK-1 cells with mathematical

models. Toxins, 2 (6): 1177-1192.

Lin, M.T. and Dianese, J.C.( 1976). A coconut-agar medium for rapid detection

of aflatoxin production by Aspergillus spp. Phytopathology, 66: 1466-1469

Liu, P., Cheng ,Y. , Yang ,M., Liu ,Y. , Chen, K., Long, C.and Deng, X. (2014).

Mechanisms of action for 2-phenylethanol isolated from Kloeckera

apiculata in control of Penicillium molds of citrus fruits. Liu et al. BMC

Microbiology , 14:242.

References

_______________________________________________________________

103

Lou ,J., Fu ,L., Peng, Y. and Zhou, L. (2013). Metabolites from Alternaria fungi

and their bioactivities. Molecules, 18(5): 5891-5935.

Lucas, J. A. (2004). Survival, surfaces and susceptibility – the sensory biology

of pathogens. Plant Pathol., 53( 6): 679-691.

Magan, N. and Aldred, D.( 2007). Post-harvest control strategies: minimizing

mycotoxins in the food chain. Intern. J. Food Microbiol., 119(1-2):131-139.

Magan, N., Aldred, D., and Baxter, E.S. (2014) .Good postharvest storage

practices for wheat grain. In: J.F. Leslie and A.F. Logrieco (eds)

Mycotoxins in Food Chains. Wiley Blackwell, Ames, Iowa, USA, 258–

267.

Magan, N., Medina, A., and Aldred, D. (2011). Possible climate-change effects

onmycotoxin contamination of food crops pre- and postharvest. Plant

Pathol., 60(1(:150-163.

Magan, N., Sanchis, V.and Aldred, D. (2004). Role of spoilage fungi in seed

deterioration. Chapter 28, In fungal biotechnology in agricultural, food and

environmetal applications,. ed. D.K.Aurora Marcell Dekker. ,311-323.

Magan,N. and Aldred, D.(2007).Why do fungi produce mycotoxins?

In:Dijksterhuis J, Samson RA, editors. Food mycology: a multifaceted

approach to fungi and food. Boca Raton: Taylor and Francis, 121-33.

Magnoli, C. E., Saenz, M.A., Chiacchiera ,S. M. and Dalcero, A. M. (1999). Natural occurrence of Fusarium species and fumonisin-production by

toxigenic strains isolated from poultry feeds in Argentina. Mycopathologia

145: 35–41.

Magnoli, C., Chiacchiera, S., Miazzo, R., Palacio, G., Angeletti, A., Hallak,

C.and Dalcero, A.(2002). The mycoflora and toxicity of feedstuffs from a

production plant in córdoba, Argentina. Mycotoxin Res., 18(1):7-22.

Maheshwari, R., Bharadwaj ,G.and Bhat, M.K. (2000). Thermophilic fungi:

their physiology and enzymes. Microbiol. Mol.Biol. Rev. ,64(3):461-488.

Mandeel, Q. A. (2002). Microfungal community associated with rhizosphere

soil of zygophyllum qatarense in arid habitats of Bahrain. J. Arid Environ. ,

50 (4): 665–681.

Manonmani ,H.K., Anand ,S., Chandrashekar, A. and Rati, E.R. (2005).

Detection of aflatoxigenic fungi in selected food commodities by PCR.

Process Biochemistry ,40 (8):2859–2864.

Marczuk, J., Obremski, K., Lutnicki, K., Gajecka, M.and Gajecki ,M. (2012).


References

_______________________________________________________________

104

Zearalenone and deoxynivalenol mycotoxicosis in dairy cattle herds. Polish

J.Vet. Sci. ,15 ( 2 ): 365-372.

Marin, S., Magan, N., Serra, J., Ramos, A.J., Canela, R.and Sanchis, V. (1999).

Fumonisin B1 production and growth of Fusarium moniliforme and

Fusarium proliferatum in maize,wheat, and barley grain. J. Food Prot

.,64:921–24.

Marín, P., Magan, N., Vázquez, C. and González-Jaén, M.T. (2010). Differential

effect of environmental conditions on the growth and regulation of the

fumonisin biosynthetic gene FUM1 in the maize pathogens and fumonisin

producers Fusarium verticillioides and Fusarium proliferatum. FEMS

Microbiol. Ecol.,73 (2): 303-311.

Marin, S., Ramos ,A.J., German ,C-S., Sanchis, V.(2012) Reduction of

mycotoxins and toxigenic fungi in the Mediterranean basin maize chain.

Phytopathol. Mediterr ., 51(1):93–118.

Marroquín-Cardona, A.G., Johnson ,N.M., Phillips ,T.D. and Hayes, A.W.(

2014). Mycotoxins in a changing global environment. A review. Food

Chem .Toxicol., 69:220-300.

Mashinini, K.(2004). Determination of fungi and mycotoxins in South African

wheat and wheat-based products.M.Sc. Thesis. University of Johannesburg.

South Africa.

Masoud, W., Kaltoft, C.H. (2006). The effects of yeasts involved in the

fermentation of coffea arabica in East Africa on growth and ochratoxin A

(OTA) production by Aspergillus ochraceus. Intl. J. Food Microbiol.,

106(2): 229-234.

McGinnis ,M.R.(1980) Laboratory handbook of medical mycology. New York:

Academic Press.

McMullin, D., Mizaikoff, B. and Krska, R.(2015). Advancements in IR

spectroscopic approaches for the determination of fungal derived

contaminations in food crops. Anal. Bioanal. Chem. , 407:,653-660.

McNamara, K.M., O’Kiely, P., Whelan, J., Forristal, P.D.and Lenehan, J.J.

(2002) Simulated bird damage to the plastic stretch film surrounding baled

silage and its effects on conservation characteristics. Ir. J. Agric. Res., 41:

29–41.

Mej a-Teniente, L., Chapa-Oliver A.M., Vazquez-Cruz, M. A., Torres-Pacheco,

http://www.ncbi.nlm.nih.gov/pubmed/?term=Marroqu%C3%ADn-Cardona%20AG%5BAuthor%5D&cauthor=true&cauthor_uid=24769018

http://www.ncbi.nlm.nih.gov/pubmed/?term=Johnson%20NM%5BAuthor%5D&cauthor=true&cauthor_uid=24769018

http://www.ncbi.nlm.nih.gov/pubmed/?term=Phillips%20TD%5BAuthor%5D&cauthor=true&cauthor_uid=24769018

http://www.ncbi.nlm.nih.gov/pubmed/?term=Hayes%20AW%5BAuthor%5D&cauthor=true&cauthor_uid=24769018



http://www.ncbi.nlm.nih.gov/pubmed/?term=McMullin%20D%5BAuthor%5D&cauthor=true&cauthor_uid=25258282

http://www.ncbi.nlm.nih.gov/pubmed/?term=Mizaikoff%20B%5BAuthor%5D&cauthor=true&cauthor_uid=25258282

http://www.ncbi.nlm.nih.gov/pubmed/?term=Krska%20R%5BAuthor%5D&cauthor=true&cauthor_uid=25258282

References

_______________________________________________________________

105

I.and Guevara-González, R. G.O (2011). Aflatoxins biochemistry and molecular

biology - biotechnological approaches for control in crops. In.Tech.,317-

354.

Milani ,J.M. (2013). Ecological conditions affecting mycotoxin production in

cereals: a review. Veterinarni Medicina, 58 (8): 405–411 .

Milićević, D. R., Škrinjar, M.and Baltić, T. (2010). Real and perceived risks for

mycotoxin contamination in foods and feeds: challenges for food safety

control. Toxins, 2(4): 572–592.

Milicevic, D.(2009).Mycotoxin in the food chain – old problems and new

solutions. Tehnologija Mesa.,50(1-2): 99-111.

Mishra,S., Kumar, P.and Malik, A.(2013). Evaluation of Beauveria bassiana

spore compatibility with surfactants. World Acad. Sci. Eng. Technol., 73:

109-113 .

Mitchell,D., Aldred, D.and Magan,N.(2003).Impact of ecological factors

on growth and Ochratoxin Aproduction by Aspergillus carbonarius

from different regions of Europe.Aspects Appl Biol., 68:109–16.

Moretti,A., Susca, A., Mulé ,G. , Logrieco, A.F. and Proctor ,R.H. (2013).

Molecular biodiversity of mycotoxigenic fungi that threaten food safety.

Intl. J. Food Microbiol. ,167(1): 57-66.

Moss, M.O.(2002). Risk assessment for aflatoxins in foodstuffs. International

Biodeterioration and Biodegradation ,50(3-4): 137-142.

Munkvold,G.P.(2003). Cultural and genetic approaches to managing mycotoxins

in maize. Ann. Rev. Phytopathol., 41: 99-116.

Murphy, P. A., Hendrich, S., Landgren, C. and Bryant, C.M.(2006). Food

mycotoxins: An update. J.Food Sci., 71(5): 51-65.

Murugesan, G. R., Ledoux ,D. R., Naehrer ,K., Berthiller, F., Applegate, T. J.,

Grenier, B., Phillips, T. D. and Schatzmayr, G. (2015). Prevalence and

effects of mycotoxins on poultry health and performance, and recent

development in mycotoxin counteracting strategies. Poult .Sci. ,94(6):1298-

1315.

Mwanza ,M.(2011). A comparative study of fungi and mycotoxin contamination

in animal products from selected rural and urban areas of South Africa with

particular reference to the impact of this on the health of rural black people.

PhD Thesis. University of Johannesburg, South Africa.

References

_______________________________________________________________

106

Myatt, T.A., Minegishi, T., Allen, J.G.and Macintosh, D.L. (2008).Control of

asthma triggers in indoor air with air cleaners: a modeling analysis.

Environ.health 7: 43.

Navya, H. M., Hariprasad ,P., Naveen ,J., Chandranayaka, S. and Niranjana, S.

R.(2013).Natural occurrence of aflatoxin, aflatoxigenic and non-

aflatoxigenic Aspergillus flavus in groundnut seeds across India. African

J.Biotechnol., 12(19):2587-2597.

Ni, X. and Streett, D.A. ( 2005). Modulation of water activity on fungicide

effect on Aspergillus niger growth in Sabouraud dextrose agar medium.

Lett. Appl. Microbiol. 41(5): 428–433.

Niessen ,L., Luo ,J., Denschlag ,C. and Vogel, R. F. (2013). The application of

loop-mediated isothermal amplification )LAMP) in food testing for

bacterial pathogens and fungal contaminants. Food Microbiol .,36(2):191-

206.

Njobeh, P.B., Dutton, M.F., Koch, S.H., Chuturgoon, A.A., Stoev, S.D. and

Mosonik, J.S. (2010). Simultaneaous occurrence of mycotoxins in human

food commodities from Cameroon. Mycotox. Res. 26(1):47-57.

Njumbe Ediage, E., Van Poucke, C., De Saeger ,S. (2015). A multi-analyte LC–

MS/MS method for the analysis of 23 mycotoxins in different sorghum

varieties: The forgotten sample matrix. Food Chem., 177:397–404.

Noorbakhsh, R. , Bahrami, A.R., Mortazavi, S.A. , Forghani, B. and Bahreini,

M. (2009) . PCR-based identification of aflatoxigenic fungi associated with

Iranian saffron. Food Sci. Biotechnol. ,18 (4): 1038 – 1041.

Notomi ,T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino,

N. and Hase, T.(2000). Loop-mediated isothermal amplification of DNA.

Nucleic Acids Res. ,28(12): 63.

Nuntharatanapong, N., Suramana, T., Chaemthavorn, S., Zapuang, K., Ritta, E.,

Semathong, S., Chuamorn, S., Niyomwan, V., Dusitsin, N., Lohinavy, O.

and Sinhaseni, P.(2001). Increase in tumour necrosis factor-alpha and a

change in the lactate dehydrogenase isoenzyme pattern in plasma of

workers exposed to aflatoxin-contaminated feeds. Arh Hig Rada Toksikol.

,52(3):291-298.

O’Brien, E.and Dietrich, D.R.( 2005). Mycotoxins affecting the kidney. In:

Tarloff, J., Lash, L. (Eds.), Toxicology of the Kidney. CRC Press, Boca

Raton, Florida, USA, 895.

References

_______________________________________________________________

107

Oancea ,S. and Stoia, M. (2008). Mycotoxins : A review of toxicology ,

analytical methods and health risks. A review. Acta Universitatis

Cibiniensis Series E: food Technology ,12 (1):19-36.

Oliveira G.R., Ribeiro, J. M. , Fraga M. E. , Cavaglieri L. R., Direito G. M. ,

Keller K. M., Dalcero A. M. and Rosa, C. A. (2006). Mycobiota in poultry

feeds and natural occurrence of aflatoxins,fumonisins and zearalenone in

the Rio de Janeiro State, Brazil Mycopathologia , 162: 355–362.

Omar, H.E. (2013) Mycotoxins-induced oxidative stress and disease. INTECH,

Chapter 3.

Oseni, O.A.(2011). Production of microbial protease from selected soil fungal

isolates. Nig .J. Biotechnol., 23: 28 - 34.

Ouko, O.E.(2014). Sources and levels of human exposure to aflatoxins in

Makueni county. PhD thesis. University of Nairobi, Kenya .

Pacin, A. M., Gonz´alez, H. H. L., Etcheverry, M., Resnik, S. L., Vivas, L., and

Espin,S.(2003).Fungi associated with food and feed commodities from

Ecuador. Mycopathol., 156( 2): 87–92.

Pardo, E, Ramos A.J, Sanchis, V.and Marin, S.( 2005a). Effect of water activity

and temperature on mycelial growth and ochratoxin A production by

isolates of Aspergillus ochraceus on irradiated green coffee beans. J. Food

Protec., 68:133–138.

Pardo, E., Ramos, A.J., Sanchis, V.and Marin, S. (2005b). Modelling of effects

of water activity and temperature on germination and growth of

ochratoxigenic isolates of Aspergillus ochraceus on a green coffee-based

medium. Intl. J.Food Microbiol. ,98:1-9.

Park, D.L.(2002). Effect of processing on aflatoxin. Adv. Exp. Med. Biol., 504:

173-179.

Paterson, R. R. M., and Lima, N.(2010).How will climate change affect

mycotoxins in food? Food Res. Intl., 43(7): 1902–1914.

Pereyra C.M., Cavaglieri L. R., Chiacchiera S.M.and Dalcero, A. M. (2010).

Fungi and mycotoxins in feed intended for sows at different reproductive

stages in Argentina. Vet. Med. Intl., 1-7.

Pitt, J.I. (2000). Toxigenic fungi and mycotoxins. Br Med Bull. ,56(1):184-92.

Pitt, J.I. and Hocking, A.D. (2009). Fungi and Food Spoilage. 3rd ed., Springer,

USA., 519.

Pizzolitto ,R. P., Armando, M. R. , Salvano, M. A., Dalcero, A. M. and Rosa, C.

References

_______________________________________________________________

108

A.(2013).Evaluation of Saccharomyces cerevisiae as an antiaflatoxicogenic

agent in broiler feedstuffs. Poult. Sci. 92:1655–1663.

Plockova, M., Stiles, J., Chumchalova, J.and Halfarova, R. (2001). Control of

mould growth by Lactobacillus rhamnosus VT1 and Lactobacillus reuteri

CCM 3625 on milk agar plates. Czech J.Food Sci., 19(2): 46-50.

Popovski, S. and Celars F.A. (2013). The impact of environmental factors on

the infection of cereals with Fusarium species and mycotoxin production –

a review. Acta. Agricul Slovenica, 101(1): 105-116.

Pose, G., Patriarc, A. Kyanko, V., Pardo, A. and Fernandez, V.P.( 2010). Water

activity and temperature effects on mycotoxin production by Alternaria

alternata on a synthetic tomato medium Inter. J. Food Microbiol.,

142(3):348-353.

Pruimboom ,L. , Fox, T. and Muskiet, F. A.J. (2014). Lactase persistence and

augmented salivary alpha-amylase gene copy numbers might have been

selected by the combined toxic effects of gluten and (food born) pathogens.

Med. Hypoth., 82:326-334.

Pscheidt, J.W. and Ocamb, C.(2015).Pacific Northwest Plant Disease

Management Handbook. Oregon State University.USA.

Pusztahelyi ,T., Holb, I.J., Pócsi, I. (2015) . Secondary metabolites in fungus-

plant interactions.Front. Plant Sci.,6:573.

Rachaputi, N.R., Wright, G.C.and Kroschi, S.( 2002). Management practices to

minimise pre-harvest aflatoxin contamination in Australian groundnuts.

Austr. J. Exp. Agric., 42: 595–605.

Ramos, A.J., Labernia, N.,Marin, S., Sanchis, V.and Magan, N. (1998). Effect of

water activity and temperature on growth and ochratoxin production by

three strains of Aspergillus ochraceus on a barley extract medium and on

barley grains. Intl. J. Food Microbiol .,44:133–40.

Ramos, C.M., Martinez, E.M., Carrasco, A.C., Puente, J.H.L.,Quezada, F.,

Perez, J.T.,Oswald, I.P.and Elvira, S.M. (2010) .Experimental trial of the

effect of fumonisin B and the PRRS virus in swine. J. Anim. Vet. Adv., 9:

1301–1310.

Rao, K. N., B. Reddy ,V., Girisham ,S. and Reddy, S.M. (2010). Factors

influencing fumonisins (B1) production by Fusarium moniliforme. Indian

J. Sci. Technol. 3(4):213-215.


References

_______________________________________________________________

109

Ravindran ,V. (2013). Poultry development review. poultry feed availability and

nutrition in developing countries :main ingredients used in poultry feed

formulations viruses in liver cancer aetiology and prevention. Cancer

Letters, 286: 22-28.

Riba, A., Matmoura, A., Mokrane, S., Mathieu ,F. and Sabaou, N. (2013).

Investigations on aflatoxigenic fungi and aflatoxins contamination in some

nuts sampled in Algeria. African J. Microbiol. Res., 7(420): 4974-4980.

Richard ,J.L., Payne, G.A.(2003). Mycotoxins: risks in plant, animal and human

systems.

Robinson, C.H. (2001) Cold adaptation in Arctic and Antarctic fungi. New

Phytol., 151(2):341–353.

Rodrigues, P., Soares ,C., Kozakiewicz ,Z., Paterson ,R.R.M., Lima, N. and

Venâncio ,A. (2007). Identification and characterization of Aspergillus

flavus and aflatoxins. Comm. Curr. Res. Edu.Topics Trends in Appl.

Microbiol., 527-534.

Rodrigues,I. and Chin ,L.J. (2012). A comprehensive survey on the occurrence

of mycotoxins in maize dried distillers’ grain and solubles sourced

worldwide . World Mycotoxin Journal, 5 (1): 83-88.

Rohit Talwani, M.D., Bruce, L. Gilliam, M.D. and Charles Howell, M.D.(2011).

Infectious diseases and the liver. Clin Liver Dis. , 15(1): 111-130.

Rohr, A.C., Campleman, S.L. , Long C.M., Peterson M.K. , Weatherstone, S. ,

Quick ,W. and Lewis ,A. (2015).Potential occupational exposures and

health risks associated with biomass-based power generation. Intl. J.

Environ. Res. Public Health, 12: 8542-8605.

Romanov M.N., Sazanov, A. A. , Moiseyeva ,I., and Smirnov A. F. (2009)

Poultry. In: Kole, Chittaranjan and Cockett, Noelle E, eds. Genome

Mapping and Genomics in Domestic Animals, 3: 75-141.

Rosa, C.A., Ribeiro, J.M., Fraga, M.J., Gatti, M., Cavaglieri, L.R., Magnoli,

C.E., Dalcero, A.M.and Lopes, C.W. (2006). Mycoflora of poultry feed and

ochratoxin- producing ability of isolated Aspergillus and Penicillium

species. Vet. Microbiol., 113: 89-96.

Ruiz, M.J., Macakova, P., Juan-Garcia, A.and Font, G. (2011).Cytotoxic effects

of mycotoxin combinations in mammalian kidney cells. Food Chem.

Toxicol., 49: 2718–2724.

Paterson, R. R. M., and Lima, N. (2010). How will climate change affect

mycotoxins in food. Food Res. Intl., 43 (7):1902-1914.

References

_______________________________________________________________

110

Saini, S. S. and Kaur, A. (2012). Aflatoxin B1: Toxicity, characteristics and

analysis. Global Adv. Res.J. Chem. Material Sci.,1(4): 063-070.

Saito, M. and Machida ,S. (1999). A rapid identification method for aflatoxin

producing strains of Aspergillus flavus and A. parasiticus by ammonia

vapor, Mycoscience ,40 (2):205-208.

Saleemi, M.K., Khan, M.Z., Khan, A. and Javed ,I.(2010). Mycoflora of poultry

feeds and mycotoxins producing potential of Aspergillus species. Pakistan

Journal of Botany , 42 (1): 427-434.

Sambrook , J., MacCalluon, P.and Russell ,D.(2000). Molecular Cloning: A

Laboratory manual Third Edition. Cold spring harbor laboratory press,

New York, USA.

Samson, R.A., Hoekstra, E.S., Frisvad, J.C.and Filtenborg, O. ( 2002).

Introduction to food and airborne fungi. central bureau for

Schimmelculture, Utrecht.306-320.

Sánchez ,E., Heredia, N.and García, S.(2005). Inhibition of growth and

mycotoxin production of Aspergillus flavus and Aspergillus parasiticus by

extracts of Agave species. Intl. J. Food Microbiol. , 98(3):271-279.

Sanchis, V.( 2004). Environmental conditions affecting mycotoxins. In:Magan

N, Olsen M, editors.Mycotoxins in food: detection and control. Boca

Raton, Fla.: CRC Press., 174–89.

Santella, R.M. (2007). Aflatoxin B1: Mechanism of muatgenesis. Suplemento

IATREIA. 20(1): 38-39.

Sautour, M. (2001a). A temperature-type model for describing the relationship

between fungal growth and water activity, Inter. J. Food Microbiol. ,67(1-

2):63-9.

Sautour,M.(2001b).Prediction of conidialgermination of Penicillium

chrysogenum as influenced by temperature, water activity andpH. Lett.

Appl. Microbiol. ,32(3):131-134.

Scherf ,B.D. (2000). World watch list for domestic animal diversity, 3rd. Food

and Agriculture Organization of the United Nations, Rome, Italy.

Schmidt-Heydt ,M., Parra, R., Geisen ,R. and Magan, N. (2011). Modelling the

relationship between environmental factors, transcriptional genes and

deoxynivalenol mycotoxin production by strains of two Fusarium species,

J. R. Soc. Interface ,8: 117-126.

References

_______________________________________________________________

111

Šegvić Klarić, M. (2012). Adverse effects of combined mycotoxins. Arh Hig

Rada Toksikol. ,63(4):519-530.

Shapira, R., Pasti, N.R., Fyai, O., Minastherov, M., Mett, A.and Salomon,

R.(1996). Detection of aflatoxigenic moulds in grains by PCR. Appl

Environ Microbiol. ,62(9):3270–3273.

Shareef, A. M. (2009). Molds and mycotoxins in poultry feeds from farms of

potential mycotoxicosis. Iraqi Journal of Veterinary Sciences, 24(1): 17-25.

Shetty, P.H., and Jespersen, L. (2006). Saccharomyces cerevisiae and lactic acid

bacteria as potential mycotoxin decontaminating agents. Trends in Food

sci.Technolo.,17: 48-55.

Shephard, G.S., Burger, H.M., Gambacorta, L., Gong, Y.Y., Krska, R., Rheeder,

J.P., Solfrizzo, M., Srey, C., Sulyok, M., Visconti, A., Warth, B. and Van

der Westhuizen, L.(2013)clark. Multiple mycotoxin exposure determined

by urinary biomarkers in rural subsistence farmers in the former Transkei,

South Africa. Food Chem. Toxicol., 62: 217-225.

Shweta, S., Madhavan, S., Paranidharan, V. and Velazhahan, R.(2013).

Detection of Aspergillus flavus in maize kernels by conventional and real-

time PCR assays. IFRJ ., 20(6): 3329-3335.

Silvia, G. (2007). Aflatoxin binding by probiotics: Experimental studies on

intestinal aflatoxin transport, metabolism and toxicity. PhD thesis. Kuopio

University , Kuopio , Finland .

Simpson, D.R., Weston ,G.E., Turner, J.A., Jennings ,P. and Nicholson P.

(2001). Differential control of head blight pathogens of wheat by

fungicides and consequences for mycotoxin contamination of grain.

European J. Plant Path. 107(4):421-431.

Sirhan, A.Y., Tan, G.H. and Wong, R.C.S. (2013) Determination of aflatoxins

in food using liquid chromatography coupled with electrospray ionization

quadrupole time of flight mass spectrometry (LC-ESI-QTOF-MS/MS).

Food Control , 31 (1): 35-44.

Škrinjar, M., Jakić-Dimić ,D., Blagojev, N., Šošo ,V. (2011). Results of one-

year investigations of the contamination of dairy cattle feed and raw milk

with moulds and mycotoxins. Biotechnol. Anim. Husb., 27 (3): 985-992.

Sorrenti, V., Di Giacomo, C., Acquaviva, R., Barbagallo, I., Bognanno, M. and

Galvano, F.(2013). Toxicity of Ochratoxin A and Its Modulation by

Antioxidants: A Review. Toxins, 5: 1742-1766.

References

_______________________________________________________________

112

Soso,V., Skrinjar, M., Blagojev, N. (2012). Influence of ecophysiological factors

on the presence of ochratoxin A in dried vine fruits: A review. APTEFF,

43: 1-342 .

Stergiopoulos, I, Collemare, J, Mehrabi ,R. and De Wit, P.J. (2012). Phytotoxic

secondary metabolites and peptides produced by plant pathogenic

Dothideomycete fungi. FEMS Microbiol Rev .,37(1): 67–93.

Stoev,S.D.(2015).Foodborne mycotoxicoses, risk assessment and

underestimated hazard of masked mycotoxins and joint mycotoxin effects

or interaction. Environ. Toxicol. Pharmacol., 2:794-809.

Storm ,I.M., Rasmussen, R.R., Rasmussen, P.H. (2014). Occurrence of pre- and

post-harvest mycotoxins and other secondary metabolites in Danish maize

silage. Toxins, 6(8): 2256-2269.

Streit, E., Schatzmayr, G. , Tassis, P. , Tzika E. , Marin , D., Taranu ,I., Tabuc

,C. , Nicolau, A., Aprodu, I. , Puel ,l. and Oswald I. P. (2012). Current

Situation of Mycotoxin Contamination and Co-occurrence in Animal .

Toxins , 4(10):788-809.

Suhaimi, D., Wan Syahidah, H., Lily Suhaida, M.S . and Terjuddin, G.(2014).

Effect of different laboratory storage conditions of animal feed samples on

mycotoxin detection: A case study. Malaysian J.Vet. Res. , 5(1):1- 7.

Surai, P.F., Mezes, M., Melnichuk, S.D. and Fotina ,T.I. (2008). Mycotoxins

and animal health: From oxidative stress to gene expression. Krmiva ,50:

35-43.

Taj, G., Meena, P.D., Giri, P., Pandey,D., Kumar, A. and Kumar, A. (2015).

Pathogenesis mechanisms employed by Alternaria species. J.Oilseed

Brassica, 6 (2): 213-240.

Taubel, M. and Hyvärinen, A .(2015).Occurrence of mycotoxins in indoor

environments. SIY raportti .,33: 1237-1866.

Tirado ,M.C., Clarke, R., Jaykus, L.A.C., McQuatters-Gollop, A.and Frank J.M.

(2010). Climate change and food safety: A review. Food Res. Intl. ,43 (7):

1745–1765.

Tokhadze, E.V., Kvachadze, L. L. and Kvesitadze, G.I. (1975). Effect of the

composition on nutrient medium on the synthesis of acid fast alpha amylase

by different strains of Aspergillus. J.Microbiol., 11(4): 515-518.

Turner, N.W., Subrahmanyam, S.and Piletsky, S.A.(2009). Analytical methods

http://www.ncbi.nlm.nih.gov/pubmed/?term=Stoev%20SD%5BAuthor%5D&cauthor=true&cauthor_uid=25734690


http://www.myjurnal.my/public/browse-journal-view.php?id=337

http://www.myjurnal.my/public/issue-view.php?id=4071&journal_id=337

https://www.google.com/url?sa=t&rct=j&q=&esrc=s&source=web&cd=4&cad=rja&uact=8&ved=0CDMQFjADahUKEwiWha6j6vzGAhUBuSwKHVytDSw&url=https%3A%2F%2Fwww.julkari.fi%2Fbitstream%2Fhandle%2F10024%2F125924%2FOccurrence%2520of%2520mycotoxins_SIS.pdf%3Fsequence%3D1&ei=yu-2VZb4HYHysgHc2rbgAg&usg=AFQjCNGQ6PvNBkhP-kk0NJK5CNzjYQD2ow&bvm=bv.98717601,d.bGg

https://www.google.com/url?sa=t&rct=j&q=&esrc=s&source=web&cd=4&cad=rja&uact=8&ved=0CDMQFjADahUKEwiWha6j6vzGAhUBuSwKHVytDSw&url=https%3A%2F%2Fwww.julkari.fi%2Fbitstream%2Fhandle%2F10024%2F125924%2FOccurrence%2520of%2520mycotoxins_SIS.pdf%3Fsequence%3D1&ei=yu-2VZb4HYHysgHc2rbgAg&usg=AFQjCNGQ6PvNBkhP-kk0NJK5CNzjYQD2ow&bvm=bv.98717601,d.bGg

References

_______________________________________________________________

113

for determination of mycotoxins: A Review. Analytica Chimica Acta., 632(2):

168–180.

Turner, P., Sylla, A., Gong, Y., Diallo, M., Sutcliffe, A., Hall, A. and Wild, C.

(2005). Reduction of exposure to carcinogenic aflatoxins by postharvest

intervention measures in West Africa: a community based intervention

study. Lancet, 365(9475):1950-1956.

Turner, P.C., Moore, S.E., Hall, A.J., Prentice, A.M. and Wild, C.P.(2003).

Modification of immune function through exposure to dietary aflatoxin in

Gambian children. Environ. Health Perspec.,111(2):217-220.

Valero A., Begum, M., Hocking, A.D., Marı´n, S., Ramos, A.J. and Sanchis, V.

(2008). Mycelial growth and ochratoxin A production by Aspergillus

section Nigri on simulated grape medium in modified atmospheres. Journal

of Applied Microbiology, 105(2):372-379.

Valko ,M., Rhodes, C.J., Moncola, J., Izakovic. M.and Mazura. M. (2006). Free

radicals, metals and antioxidants in oxidative stress-induced cancer

Chemicol. Biol. Interact., 160: 1-40.

Valones,M.A.A., Guimarães, R. L., Brandão L. A. C., De Souza, P. R. E.,

Carvalho A. D. T. and Crovela, S. (2009). Principles and applications of

polymerase chain reaction in medical diagnostic fields .A Review. Braz. J.

Microbiol. ,40(1): 1–11.

Vieira, T., Cunha, S. and Casal ,S. (2015). Mycotoxins in Coffee. Elsevier Inc.

Coffee in Health and Disease Prevention.

Voss, K.A., Riley, R.T., Norred, W.P., Bacon, C.W., Meredith, F.I., Howard

,P.C., Plattner, R.D., Collins, T.F., Hansen, D.K. and Porter ,J.K. (2001).

An overview of rodent toxicities: liver and kidney effects of fumonisins

and Fusarium moniliforme. Environ Health Perspect, 109(2):259–266.

Waliyar, F. (2015). Post-harvest management of aflatoxin contamination in

groundnut . World Mycot. J., 2: 245-252.

Wang ,J.S. and Tang, L. (2005). Epidemiology of aflatoxin exposure and human

liver cancer. In aflatoxin and food safety. Edited by H.K. Abbas. Taylor

and Francis, Boca Raton, Fla.,195-211.

Wcislo,G. and Szarlej-Wcislo, K.(2015).Human immunodeficiency virus

infection–associated cancer and , Chapter 4. Health of HIV infected

people,1.

References

_______________________________________________________________

114

Whitaker, T.B., Trucksess, M.W., Weaver, C.M. and Slate, A.(2009). Sampling

and analytical variability associated with the determination of aflatoxins

and ochratoxin A in bulk lots of powdered ginger marketed in 1-lb bags.

Analyt. Bioanalyt. Chem., 395(5): 1291-1299.

Whitlow ,L.W., Hagler, J.R.W.M. and Diaz, D.E. (2010). Mycotoxins in feeds.

Feedstuffs, 74.

Whitlow, L. W. and Hagler, J.r. W. M.(2008). Mold and mycotoxin issues in

dairy cattle:effects, prevention and treatment. WCDS Advances in Dairy

Technol. , 20:195-209.

Wild, C. P. and Montesano, R. (2009). A model of interaction: Aflatoxins and

hepatitis. Cancer Lett. ,286(1):22-28.

Williams, J.H., Phillips, T.D., Jolly, P.E., Stiles, J.K., Jolly, C.M .and

Aggarwal, D. (2004). Human aflatoxicosis in developing countries: A

Review of toxicology, exposure, potential health consequences, and

interventions. Am. J.Clin. Nut., 80(5):1106-1122.

World Health Organization (2013), Food Safety portal, accessed on January 4th.

Wu ,F. (2015). Global impacts of aflatoxin in maize: trade and human health.

World Mycot. J., 8 (2): 137-142.

Yao, H., Hruska Z. and Diana Di Mavungu ,J. (2015). Developments in

detection and determination of aflatoxins. World Mycotoxin Journal, 8 (2):

181-191 .

Yazdani, D., Zainal Abidin, M. A., Tan, Y. H. and Kamaruzaman, S.(2010).

Evaluation of the detection techniques of toxigenic Aspergillus isolates.

Afr. J. Biotechnol., 9 (45): 7654-7659.

Yeni ,F., Acar ,S., Polat, Ö.G. , Soyer Y. and Alpas ,H. (2014). Rapid and

standardized methods for detection of foodborne pathogens and

mycotoxins on fresh produce. Food Cont. 40: 359–367.

Yiannikouris, A. and Jouany, J.P. (2002) Mycotoxins in feeds for ruminants;

their coming and their effects in animals. INRA Prod. Anim., 15: 3-16.

Yu ,J., Chang ,P., Ehrlich, K.C., Cary ,.JW., Bhatnagar ,D., Cleveland, T.E,.

Payne, G.A., Linz, J.E., Woloshuk, C.P. and Bennett, J.W. (2004).

Clustered pathway genes in aflatoxin biosynthesis. Appl. Environ.

Microbiol.,70( 3):1253-1262.

Yu, J. (2012). Current understanding on aflatoxin biosynthesis and future

perspective in reducing aflatoxin contamination. Toxins, 4:1024-1057.

References

_______________________________________________________________

115

Yu, J.and Ehrlich, K.C. (2011). Aflatoxin biosynthetic pathway and pathway

genes. In: Guevara-González R. G.. Aflatoxins – Biochemistry and Molec.

Biol. In Tec. Croatia, 41-66.

Yunus, A,W., Razzazi-Fazeli, E.and Bohm, J. (2011). Aflatoxin B1 in affecting

broiler’s performance, immunity, and gastrointestinal tract: A review of

history and contemporary issues. Toxins, 3(6): 566-590.

Zain ,M. E. (2011). mpact of mycotoxins on humans and animals. Journal of

Saudi Chem. Soc. ,15(2) : 129–144.

Zaki, M. M., El-Midany, S. A., Shaheen, H. M. and Rizzi, L. (2012).

Mycotoxins in animals: Occurrence, effects, prevention and management:

Areview. Journal of Toxicology and Environmental Health Sciences ,4(1):

13-28.

Zhang, Y., Caupert, J., Imerman, P.M., Richard, J.L. and Shurson, G.C.( 2009).

The occurrence and concentration of mycotoxins in U.S. distillers dried

grains with soluble. J.Agri. Food Chem. ,57:9828-9837.

Zomborszky-Kovács ,M., Vetési, F., Horn, P., Repa, I.and Kovács, F. (2002).

Effects of prolonged exposure to low-dose fumonisin B1 in pigs. J. Vet.

Med. B. Infect. Dis. Vet. Public Health ,49(4): 197–201.

Zrari ,T.J.O. (2013). Detection of aflatoxin from Some Aspergillus spp. isolated

from wheat seeds. J.Life Sci., 7 (10): 1041-1047.

Appendix

Appendixes

___________________________________________________________

116

Aspergillus flavus isolate chromatogen:

1-A.flavus isolate(Af1)


Appendixes

___________________________________________________________

117



Appendixes

___________________________________________________________

118


انخالصت

Aspergillus flavus حشخص انفطزحذف انذراطت ان حاخذ انفطزبث ف اػالف انذاخ

بك اندبث.يطببمت ذ انؼشالث يغ طالالث انفطز فظ ف انفبرس نظى االفالحكظ

نحهت ف يحبفظت انبصزةق ااػت ي اػالف انذاخ انزكشة ي حمل انذاخ االط 081خؼج

أبو ف حببث بالطخكت يؼمت ف درخت 3-4نذة خشج. 4102إن أبزم 4102ي طبخبز نهفخزة

PDAانفطزبث ططػه سرػج بؼذ حخشب، .درخت يئت ف انخخبز(42-44حزارة انغزفت )

MEA ثب كم يظخؼزة فطزت ػه طظ ػشنجنغزض ػشل انفطزبث ثىSDA .سرػج

طبؼت اخبص حؼد نفطزبث يخخهفت ػشنج . CAMػه طظ ثب A. flavusػشالث انفطز

- ٪62.77خزددب Aspergillusانفطزبث انخ حؼد ان اندض حهك حث كب اكثز ظبت حزدد كثبفت

، ف ح كبج %17.01 كثبفت %47.77, خزددب Penicilliumه انفطز - ٪52.03 كثبفت ظبت

حظؼت ااع ػبئذة ج، ػشنػه انخان ٪2.11، ٪1.66 ألم حزددا كثبفت ظبت Fusariumانؼشالث

ثبفت ك %56.48خزدد باكثز االاع حذثب A.flavus ، حث كب انع Aspergillusان انفطز

A.paraciticus ، كب انفطز ٪14.23كثبفت %58.40زدد بخ A.nigerه ،٪27.55 ظبت

نهكشف ػ A.flavusػشنت ي 50اخخزث . %0.89كثبفت ظبت %1.76الم االاع حذثب بخزدد

362nmفؼبنخب انظت لببهخب ػه اخبج االفالحكظ باططت األشؼت فق انبفظدت بطل يخ

خضز يشرق يشغ ػه اندت انؼبكظت ي طبك بخز ػ طزك اخبج ن CAM ػه بخبر األيب

سخبخ ححج ضء األشؼت فق انبفظدت كذنك ػ طزك اخبج انه انرد ف انطظ ػذ انخؼزض

ي انؼشالث كبج يخبت يخدت (%52) 26كشف االخخببر ببالشؼت انفق انبفظدت أ .نبخبر األيب

أضب (nm 365)الخضز انشرق انشغ ححج األشؼت فق انبفظدت نالفالحكظ ببخبخب انه ا

ػشنت يخبت بخحنب ان انه انرد ػذ حؼزضب نبخبر االيب. حى انخمى اندشئ ػه %52 )) 26

(PCR) ف حفبػم انبهزة انخظهظم aflRببطخخذاو سج ي ببدء اند A.flavusفض ػشالث

aflRحث كبج حهك اند %68))خدت إدببت A. flavus ث ػشنت ي فطز.أظزث أربؼت ثال

انخدت نالفالحكظ A.flavus ي ثػشالخض .حى اخخبر انمبدر ػه افزاس االفالحكظ

Blastانخحهم باططت sequencingنخحههب باططت انخظهظم انخخببؼ اند PCRانشخصت بـ

نهخأكذ انمببهت اندشئت نهظالالث ػه اخبج االفالحكظ ي خالل يطببمخب يغ NCBIػه يلغ

%99) %100كبج يخطببمت )انخض ؼشالث انانظالالث االخز ف انبك اندبث .اظزث انخبئح ا

. NCBI ػه يلغ A.flavus يغ طالالث اخز ي

فالتىكضنألانتبج ا تانجزئ نفعبن انزرع و انكشف

انعزول ين أعالف Aspergillus flavusف انفطر

اندواجن

جبيعت انبصرة -يجهش كهت انطب انبطري رصبنت يقديت إنى

( االحبء انجهرت انطب انبطري )عهى نبجضتر ف عهىووه جزء ين يتطهببث نم درجت ا

ين

رائد نجيب كاظم

( 2002بكبنىرىس عهىو حبة )

اشراف

عبد السهرة عباشد. باسل أ. أ.د.محمد حسن خضر

نه0341 و2002

جمهىريت العراق

وزارة التعليم العالي والبحث العلمي

جامعت البصرة

كليت الطب البيطري

cultural and molecular detection of aflatoxigenic activity in Aspergillus flavus isolated from...

Documents

Transcript of cultural and molecular detection of aflatoxigenic activity in Aspergillus flavus isolated from...