CS273a Lecture 1, Autumn 10, Batzoglou

DNA Sequencing

CS273a Lecture 1, Autumn 10, Batzoglou

DNA sequencing

How we obtain the sequence of nucleotides of a species

…ACGTGACTGAGGACCGTGCGACTGAGACTGACTGGGTCTAGCTAGACTACGTTTTATATATATATACGTCGTCGTACTGATGACTAGATTACAGACTGATTTAGATACCTGACTGATTTTAAAAAAATATT…

CS273a Lecture 1, Autumn 10, Batzoglou

Which representative of the species?

Which human?

Answer one:

Answer two: it doesn’t matter

Polymorphism rate: number of letter changes between two different members of a species

Humans: ~1/1,000

Other organisms have much higher polymorphism rates Population size!

CS273a Lecture 1, Autumn 10, Batzoglou

Why humans are so similar

A small population that interbred reduced the genetic variation

Out of Africa ~ 40,000 years ago

Out of Africa

Heterozygosity: H

H = 4Nu/(1 + 4Nu)

u ~ 10-8, N ~ 104

H ~ 410-4

N

CS273a Lecture 1, Autumn 10, Batzoglou

Human population migrations

• Out of Africa, Replacement “Grandma” of all humans (Eve) ~150,000yr

• Ancestor of all mtDNA

“Grandpa” of all humans (Adam) ~100,000yr• Ancestor of all Y-chromosomes

• Multiregional Evolution Fossil records show a continuous change of

morphological features Proponents of the theory doubt mtDNA and

other genetic evidence

• New fossil records support out of Africa Good popular article in Economist on thathttp://www.economist.com/science/displaystory.cfm?story_id=9507453

CS273a Lecture 1, Autumn 10, Batzoglou

DNA Sequencing – Overview

• Gel electrophoresis Old technology by F. Sanger Newer sequencing technologies

• Whole genome strategies Physical mapping Shotgun sequencing

• Computational fragment assembly

• Future variants of sequencing Resequencing of humans Microbial and environmental sequencing Cancer genome sequencing

1975

2015

CS273a Lecture 1, Autumn 10, Batzoglou

DNA Sequencing

Goal:

Find the complete sequence of A, C, G, T’s in DNA

Challenge:

There is no machine that takes long DNA as an input, and gives the complete sequence as output

Can only sequence ~900 letters at a time

CS273a Lecture 1, Autumn 10, Batzoglou

DNA Sequencing – vectors

+ =

DNA

Shake

DNA fragments

VectorCircular genome(bacterium, plasmid)

Knownlocation

(restrictionsite)

CS273a Lecture 1, Autumn 10, Batzoglou

Different types of vectors

VECTOR Size of insert

Plasmid2,000-10,000

Can control the size

Cosmid 40,000

BAC (Bacterial Artificial Chromosome)

70,000-300,000

YAC (Yeast Artificial Chromosome)

> 300,000

Not used much recently

CS273a Lecture 1, Autumn 10, Batzoglou

DNA Sequencing – gel electrophoresis

1. Start at primer(restriction site)

2. Grow DNA chain

3. Include dideoxynucleoside (modified a, c, g, t)

4. Stops reaction at all possible points

5. Separate products with length, using gel electrophoresis

CS273a Lecture 1, Autumn 10, Batzoglou

Pyrosequencing / 454

11Image credits: 454 Life Sciences

CS273a Lecture 1, Autumn 10, Batzoglou

Solexa / ABI SOLiD

12Image credits: Illumina, Applied Biosystems

CS273a Lecture 1, Autumn 10, Batzoglou

Illumina / Affymetrix genotyping

13Image credits: Illumina, Affymetrix

CS273a Lecture 1, Autumn 10, BatzoglouCS273a Lecture 1

Human Genome Project (1990 – 2003)

$3 billion 3 Gbp

2008 100,000 Gbp

2010 500,000 Gbp

2011 5,000,000 Gbp

Growth of DNA Sequencing Capacity

CS273a Lecture 1, Autumn 10, BatzoglouCS273a Lecture 1

100 million species

Each individualhas different DNA

Within individual, some cellshave different DNA(i.e. cancer)

Sequencing Applications

CS273a Lecture 1, Autumn 10, BatzoglouCS273a Lecture 1

What genes are on/off,when, and in which cells?

Where do moleculesbind to DNA?

Sequencing Applications