S

Cs

Ha

MCb

S

a

ARRAA

KHTGCG

1

luottmin

ghlfnhg

(

h1

Process Biochemistry 56 (2017) 57–61

Contents lists available at ScienceDirect

Process Biochemistry

jo ur nal home p age: www.elsev ier .com/ locate /procbio

hort communication

RISPR-Cas9 assisted gene disruption in the higher fungus Ganodermapecies

ao Qina,1, Han Xiaoa,∗,1, Gen Zoub, Zhihua Zhoub, Jian-Jiang Zhonga,∗

State Key Laboratory of Microbial Metabolism, Joint International Research Laboratory of Metabolic & Developmental Sciences, and Laboratory ofolecular Biochemical Engineering, School of Life Sciences and Biotechnology, Shanghai Jiao Tong University,800 Dongchuan Road, Shanghai, 200240,

hinaCAS-Key Laboratory of Synthetic Biology, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy ofciences, 300 Fenglin Road, Shanghai, 200032, China

r t i c l e i n f o

rticle history:eceived 1 December 2016eceived in revised form 2 February 2017ccepted 10 February 2017vailable online 16 February 2017

a b s t r a c t

Mushrooms, as an important group of higher fungi, are regarded as promising cell factories for productionof bioactive secondary metabolites, but there is a lack of methods of genetic manipulation, such as genedisruption, which hinders the studies on biosynthesis and its regulation of those useful natural products.In this study, the CRISPR-Cas9 assisted gene disruption was established for the first time in mushroomsby taking Ganoderma species as typical examples. With double strand break (DSB) introduced by CRISPR-

eywords:igher fungiraditional Chinese medicinal mushroomene disruptionRISPR-Cas9

Cas9, non-homologous end joining (NHEJ) was induced and further assisted the gene disruption. As proofof concept, the ura3 gene of G. lucidum 260125 and G. lingzhi was successfully disrupted by the codon-optimized Cas9 and in vitro transcribed gRNA. This work may help to provide a widely applicable approachof gene disruption in higher fungi.

© 2017 Elsevier Ltd. All rights reserved.

anoderma lucidum

. Introduction

Mushrooms, as an important group of higher fungi, can formarge fruit bodies, septate hyphae, and produce spores during sex-al reproduction. Mushrooms are able to synthesize various kindsf natural products, such as polysaccharides, steroids, alkaloids,erpenes, which have been proved to have anti-tumor, antibac-erial and other important biological activities [1,2]. Therefore,

ushrooms have received much attention from both academia andndustry as promising cell factories for producing unique valuableatural products [1,2].

However, it is evident that currently there is a lack of matureenetic manipulation methods, such as gene disruption. This factas not only restricted the understanding of the metabolic regu-

ation of higher fungi (including mushrooms), but also hinderedurther strain improvement by rational genetic approach. Until

ow, there have been only a few examples of gene disruptions inigher fungi (mushrooms), which were mainly based on homolo-ous recombination (HR) with low efficiencies. For example, the

∗ Corresponding authors.E-mail addresses: smallhan@sjtu.edu.cn (H. Xiao), jjzhong@sjtu.edu.cn

J.-J. Zhong).1 Co-first authors with equal contribution.

ttp://dx.doi.org/10.1016/j.procbio.2017.02.012359-5113/© 2017 Elsevier Ltd. All rights reserved.

number of transformants with a gene deletion was only one (formyn6, reg1 or sc15 gene) or two (for spc33) when transformed with107 protoplasts of Schizphylhls commne [3]. In another mushroomPleurotus ostreatus, only three mutants with mnp4 deletion wereobtained when transformed with 108 protoplasts [4]. In attemptto improve the HR efficiency, Nimomiya et al. knocked out theku80/ku70 gene to reduce the incidence of the HR competitive path-way − non-homologous end joining (NHEJ) in Neurospora [5]. Usingthis approach, gene disruption was achieved in S. commune [6] andP. ostreatus [7]. However, the deletion of ku80/ku70 in advance isinevitable. For organisms with very low HR efficiencies, apparentlyit would be difficult to get a ku80/ku70 knockout strain. Meanwhile,the lack of ku80 gene would greatly reduce the protoplast regener-ation rate of higher fungi, and may lead to a severe growth defect[6]. Therefore, until now there is a need to develop the gene dis-ruption technology in mushrooms, such as Ganoderma lucidum [8],Poria cocos [9], and Lentinus edodes [10], in which no gene disruptionreports are available.

Clustered regularly interspaced short palindromic repeats(CRISPR)-CRISPR associated protein 9 (Cas9) is one of the mostfamous genome editing tools. The CRISPR-Cas9 system introduces

double stranded breaks (DSBs) by Cas9 and a special guide RNA(gRNA) [11], which will boost HR and/or NHEJ for repairing the DSBsand assist further genome editing. With its high efficiency and easyhandling, the CRISPR-Cas9 system has recently been successfully

5 iochem

atmto

pmoths

2

2

afnlGd

2

dgp(1altPTfwTp(p

2

(aT

2p

vpTMA1bi1P

8 H. Qin et al. / Process B

pplied to many species including animals, plants, yeasts, filamen-ous fungi, and a higher fungus Ustilago maydis, a yeast-like fungal

aize pathogen [12–16]. However, to the best of our knowledge,here are yet no reports on CRISPR-Cas9 based gene manipulationf mushrooms.

In this study, by adopting CRISPR-Cas9 from Streptococcusyogenes [11], we developed a gene disruption technology forushrooms by taking Ganoderma species, which produce gan-

deric acids with anti-tumor and anti-metastasis activities, asypical examples. The work, as an initial exploration, is expected toelp provide a useful platform for in-depth biological and appliedtudies on mushrooms in future.

. Materials and methods

.1. Strains and preculture

Escherichia coli strain DH5� (Tiangen, Beijing, China) was useds cloning host. G. lucidum strain 260125 [17], which was a giftrom the Institute of Medicinal Plant Development (IMPLAD), Chi-ese Academy of Medical Sciences (Beijing, China), and Ganoderma

ingzhi [18–20], were used as the hosts for gene disruption. Theanoderma cells were grown in the preculture medium at 30 ◦C asescribed earlier [21].

.2. Construction of plasmids

The gRNAs, including two ura3 gene targeting sequences, wereriven by T7 promoter. The gRNA cassettes were cloned from theRNA expression plasmid of Trichoderma reesei [15] by primerairs of GLURA3F1 and ble-R, GLURA3F2 and ble-R, respectivelyTable 1). These cassettes were separately linked into the pMD-8T vector (Takara, Dalian, China) to generate the plasmid pgRNA-1nd pgRNA-2, respectively. The cas9 gene codon-optimized for G.ucidum (glcas9) was driven by a constitutive promoter Pgpd anderminated by Tpdc. The Pgpd promoter was cloned by primergpd-F and Pgpd-R from the genomic DNA of G. lucidum (Table 1).he Tpdc terminator was cloned by primer Tpdc-F and Tpdc-Rrom the genomic DNA of T. reesei (Table 1). The marker gene sdhBas cloned by primer sdh-F and sdh-R from the pJW vector [21].

he Pgpd, glcas9, Tpdc and sdhB cassettes were ligated into theMD-18T vector using the ClonExpress MultiS One Step Cloning KitVazyme, Nanjing, China) to generate the cas9 expression vector,MD-Glcas9.

.3. In-vitro transcription of gRNA

The gRNAs were amplified by primer 18T-F and TgRNA-RTable 1) from the plasmids pgRNA-1 and pgRNA-2, respectively,nd then transcribed using the MEGAscript T7 Kit (Ambion, Austin,X, USA) as previously reported [15].

.4. Polyethylene glycol (PEG)-mediated transformation ofrotoplasts

The PEG-mediated transformation method was modified as pre-iously described [22,23]. The mycelia of Ganoderma grown in thereculture medium were collected and washed by 0.6 M mannitol.hen, they were digested with 2% (w/v) lywallzyme (Guangdongicrobiology Culture Center, China) for 2.5 h at 30 ◦C, 100 rpm.

bout 5 × 107 protoplasts were mixed thoroughly with 5 �g DNA,00 �g heparin sodium, 5 �l of 50 mM spermidine and 50 �l PTC

uffer (60% PEG4000, 10 mM Tris-HCl at pH 7.5, 50 mM CaCl2)

n 160 �l STC buffer (0.55 M sorbitol, 10 mM Tris-HCl at pH 7.5,0 mM CaCl2), and incubated on ice for 30 min. One milliliter ofTC buffer was added and incubated at 28 ◦C for another 30 min.

istry 56 (2017) 57–61

Then, the transformation solution was washed and resuspended in1 ml of precooled CYM medium [21]. Subsequently, the 1 ml trans-formation solution was poured onto the solid CYM medium. Forscreening cas9 expressed Ganoderma colonies, the CYM mediumcontaining 1% (w/v) low melting point agarose and 4 �g ml−1 car-boxin (Sangon, Shanghai, China) was spread on the surface ofsolid CYM medium after overnight incubation, while the mush-room minimal medium (20 g l−1 glucose, 2 g l−1 L- asparagine, 0.5 gl−1 MgSO4·7H2O, 0.46 g l−1 KH2PO4, 1 g l−1 K2HPO4, 0.125 mg l−1

vitamin B1, 109.3 g l−1 mannitol) containing 400 ng �l−1 5-FOA(Sangon, Shanghai, China) and 0.1 g l−1 uridine was used for screen-ing the ura3 disrupted strains. The plate was incubated at 30 ◦Cfor 15-30 days. Colonies were subcultured individually onto a freshselective medium.

3. Results and discussion

3.1. Expression of Cas9 in G. lucidum

To avoid the insufficient uptake of foreign fragments via co-transformation of cas9 and gRNA, the cas9 was firstly transformedinto G. lucidum by PEG-mediated transformation. Here, the cas9of S. pyogenes was codon-optimized (glcas9) to ensure success-ful expression in G. lucidum (http://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi?species=5315). With a SV40 nuclear localiza-tion signal (PKKKRKV) at C-terminal, the glcas9 was driven by theconstitutive promoter Pgpd (gene gpd encoding glyceraldehyde-3-phosphate dehydrogenase) of G. lucidum and terminated by theterminator Tpdc (gene pdc encoding pyruvate decarboxylase) of T.reesei. The mutated sdhB (encoding succinate dehydrogenase iron-sulfur protein) offered carboxin resistance (cbx) [21], which waschosen as the selective marker (Fig. 1A). The Cas9 expression cas-sette was completely integrated into the chromosome in 4 out of 6randomly picked transformants, and such an entire cas9 expressedstrain was accordingly named as Gl-cas9. For the other two trans-formants, one had no Cas9 expression cassette as detected, whileanother was with only Pgpd region and 500 bp sequence at the 5′

ends of glcas9 detected. Since cbx was solely involved in the selec-tion of Cas9-expressing G. lucidum, other regions which were notresponsible for the cbx expression could be lost after integration.Flanking the Cas9 expression cassette with two selectable mark-ers might be able to increase the chance of obtaining entire cas9expressed strains.

3.2. CRISPR-Cas9 mediated ura3 mutagenesis in Gl-cas9

Due to the lack of well-identified RNA polymerase III promot-ers in G. lucidum, in vitro transcribed gRNAs [15] were thereforeadopted for transformation into Gl-cas9. As proof of concept, gRNAwas designed to target ura3, the disruption phenotype of which was5-FOA resistant and could be easily observed. Two guide sequencestargeting 535 bp (site URA3.a) and 591 bp (site URA3.b) down-stream of the start codon of ura3 were selected with criteria toensure the targeting specificity and efficiency [24]. After transfor-mation of 100 �g gRNA into Gl-cas9, three and one 5-FOA resistantmutants were obtained when targeting at URA3.a and URA3.b,respectively. For targeting at URA3.a, 90 bp insertion and 32 bpinsertion were detected in two mutants, which were located at3 bp upstream of the PAM, while no change of ura3 sequence wasfound in another mutant (Fig. 1B). For targeting at URA3.b, one5-FOA resistant mutant with 83 bp insertion at 3 bp upstream of

the PAM was sequence confirmed (Fig. 1B). These insertion siteswere consistent with the cleavage site of Cas9 [11], indicating DSBwas introduced by CRISPR-Cas9 and further repaired by the NHEJ.By contrast, no colony was observed on 5-FOA containing plates

H. Qin et al. / Process Biochemistry 56 (2017) 57–61 59

Table 1Primers used in the study.

Name Sequence (5′ to 3′) Description

ble-R ACACGACCTCCGACCACTCGGCGTACAGCTCGTCCAGGCCGCGCACCCACACCCAG gRNA reverse primerGLURA3F1 TAATACGACTCACTATAGGAGCAGAAGCCCCCTGCCAGTTTTAGAGCTAGAAATAGC gRNA forward primer targeting at URA3.aGLURA3F2 TAATACGACTCACTATAGGCCTCTTCCGTGTATGAGCGTTTTAGAGCTAGAAATAGC gRNA forward primer targeting at URA3.b18T-F TCGCGCGTTTCGGTGATGAC forward primer of in-vitro transcription of gRNATgRNA-R AAAAGCACCGACTCGGTGCC reverse primer of in-vitro transcription of gRNACura-F GCCACCAGACATCCCAACC Forward primer inside ura3 from 37 to 55 bpPgpd-F ACCCGGGGATCCTCTAGAGATTCCAAAGCCGCTCTCATGGCAT gpd promoter forward primerPgpd-R GGCCGATGCTGTACTTCTTGTCCATGTTGAGAGGGGGATGAAGAGT gpd promoter reverse primerCas-F ATGGACAAGAAGTACAGCATCG glcas9 forward primerCas-R TTAGACCTTGCGCTTCTTCTTG glcas9 reverse primerTpdc-F AAGAAGCGCAAGGTCTAACCCGGCATGAAGTCTGACCG pdc terminator forward primerTpdc-R TGGACGCCTCGATGTCTTCC pdc terminator reverse primerSdh-F TGCCTGCAGGTCGACGATTGCGGCCGCTCTGCTCTTCCCGATTGCTGC sdhB forward primerSdh-R TGGACGCCTCGATGTCTTCCTGCTCTATGTCTTGCCTTGT sdhB reverse primer

F n of Co ence ot en ta

iC

pdatcidcasta

ig. 1. CRISPR-Cas9 system mediated ura3 mutagenesis in G. lucidum. (A) The desigf ura3 gene in 5-FOA resistant mutants of Gl-cas9. WT, the partial ura3 gene sequargeting at URA3.a. d, the partial ura3 gene sequence of 5-FOA resistant mutant wh

n the absence of gRNA. Taken together, these results showed theRISPR-Cas9 assisted gene disruption was established in G. lucidum.

Although the 5-FOA selection displayed a certain rate of falseositives (Fig. 1B), it could directly readout the number of ura3isrupted strains. In our preliminary experiments, cas9 (with cbxs selective marker) and in-vitro transcribed gRNA were also co-ransformed into Gl-cas9, but the number of the cbx containingolonies was similar to that with the sole transformation of cas9nto the Gl-cas9. The results suggested that the addition of gRNAidn’t change the transformation efficiency of cas9. Even with theo-transformation of cas9 and gRNA, unfortunately the colonies

ppeared on the carboxin containing plates were found to be 5-FOAensitive, i.e., no 5-FOA resistant mutants were obtained via the co-ransformation. These results may be attributed to the low uptakeffinity towards short gRNAs by G. lucidum cells and the instability

as9 plasmid and gRNA. PAM sequences are shown underline. (B) Partial sequencef G. lucidum. a–c, the partial ura3 gene sequence of 5-FOA resistant mutants whenrgeting at URA3.b. (C) Subculture of strain a, b and d on 5-FOA plate.

of gRNAs inside the cells. To address this problem, in vivo transcrip-tion of gRNA may be a reasonable approach, but unfortunately wecould not yet identify endogenous RNA polymerase III promotersfor it, which are responsible for gRNA transcription in eukaryotes.In another aspect, a recent study showed that construction of syn-thetic promoters, incorporating the ribozyme sequences into RNApolymerase II transcript, could efficiently release gRNA and restorethe CRISPR-Cas9 activity in filamentous fungi [25]. This may be analternative solution to realize in vivo transcription of gRNA in G.lucidum.

3.3. Application of CRISPR-Cas9 in G. lingzhi

To evaluate whether the CRISPR-Cas9 system was also applica-ble to other Ganoderma species, the gRNA was designed to target

60 H. Qin et al. / Process Biochemistry 56 (2017) 57–61

F rtial up

uerTfraotdmwpredf

wCmroTs

itg1T(Hrnocect

wg1aaacaiaoAfi

ig. 2. Partial sequence of ura3 gene in 5-FOA resistant mutant of lz-cas9. WT, the paicked nine 5-FOA resistant mutants.

ra3 gene of strain lz-cas9, which was G. lingzhi [20] with Cas9xpressed. Except one base pair change at 509 bp, the rest codingegion of the ura3 gene of G. lingzhi was identical as G. lucidum.o increase the probability of obtaining ura3 disrupted strains, dif-erent amounts of gRNA were adopted. Four, six and ten 5-FOAesistant colonies were obtained after transformation of 100, 150nd 200 �g gRNA targeting at URA3.b, respectively. Finally, 8 outf 9 randomly selected mutants had insertions or deletions closeo the PAM of URA3.b, while no change of ura3 sequence wasetected in only one mutant (Fig. 2). In contrast, two 5-FOA resistantutants appeared in the case without addition of gRNA, but thereas no change of ura3 sequence as confirmed. To determine theroportions of insertion and deletion mutagenesis, sixteen 5-FOAesistant transformants were randomly picked in another repeatedxperiment. Ten were found to be insertion mutants, and two wereeletion mutants. No mutagenesis on ura3 were detected in anotherour transformants (Sequencing data not shown).

The increasing number of 5-FOA resistant colonies was observedith the increased amount of gRNA addition, suggesting the currentRISPR-Cas9 system for assisting gene disruption in Ganodermaay be limited by the availability of gRNA in vivo. This may be

elated to the loss of in-vitro added gRNA, which could be the resultf gRNA degradation during transformation and in-vivo targeting.o avoid such a problem, as discussed in last section, in vivo tran-cription of gRNA may be appropriate.

The ura3 gene disruption efficiency in G. lucidum was 0.4 and 0.2n 107 protoplasts when targeting at URA3.a and URA3.b, respec-ively (Fig. 1). Taken into account the false positives, the ura3ene disruption efficiency in G. lingzhi was approximately 0.71-.78 in 107 protoplasts when different amounts of gRNA were used.he ura3 gene disruption efficiencies in these Ganoderma species0.2–1.78 in 107 protoplasts) were comparable to the traditionalR-based gene disruption efficiencies as reported in other mush-

ooms (0.3–2 in 107 protoplasts) [3,4]. It must be pointed out thato ura3 disrupted mutants were obtained by HR based technol-gy in our Ganoderma species, implying the CRISPR-Cas9 systeman be a valuable tool to help gene disruption in mushrooms withxtremely low HR efficiencies. Moreover, no obvious difference inell growth and regeneration rate of protoplasts was observed inhe cas9 expressed Ganoderma compared with its wild type.

Interestingly, the 83 bp (Fig. 1B) and 61 bp inserts (Fig. 2)ere identical to G. lucidum genomic loci gi|392498461 and

i|392498581, respectively, and no sequence matching the last2 bp of guide sequence-PAM was discovered in regions 1 kb up-nd down-stream of these loci. Given the fact that one bp mismatcht the last 12 bp of the guide sequence could block the cleavagectivity of CRISPR-Cas9 [11], the insertion sequences may not beaptured by the extra activity of CRISPR-Cas9 at these regions. Inddition, insertions larger than 50 bp are likely to repair the DSBntroduced by CRISPR-Cas9 in Ganoderma cells. For CRISPR-Cas9ssisted NHEJ, small deletions and insertions (<10 bp) frequently

ccurred in many species, including lower fungi T. reesei andspergillus oryzae [15,26], and mammalian cells [11]. But in anotherlamentous fungus Aspergillus nidulans, two larger inserts (60 bp

[

ra3 gene sequence of G. lingzhi. No. 1–9, the partial ura3 gene sequence of randomly

and 84 bp) were also discovered in ten yA gene mutations guidedby CRISRP-Cas9 [25].

In conclusion, the gene disruption in the higher fungus Gano-derma was achieved by employing the CRISPR-Cas9 system withcodon-optimized Cas9 and in vitro transcribed gRNA. Here, thedisruption of ura3 gene of both G. lucidum and G. lingzhi wassuccessfully demonstrated. For disruption of other genes withoutselectable phenotypes, the co-presence of all functional CRISPR-Cas9 elements in one cell is required. To achieve this, in vivocontinuous transcription of gRNA, as discussed above, could bethe promising solution, but unfortunately we have not yet suc-ceeded in achieving this although tried many times. This alsoreflects the CRISPR-Cas9 technology is not so easily applied to themushrooms, and we are making further efforts along this line.Besides gene disruption, the CRISPR-Cas9 could help to establishother gene editing technologies, such as gene replacement, geneknockout, site-directed mutagenesis, accompanied by homology-directed repair (HDR) donor. With continuous efforts along this line,we believe that more sophisticated and easier handling manipula-tions could be enabled, which will surely result in extensive impactson genome engineering and biosynthetic mechanism studies onmushrooms.

Acknowledgements

This work was supported by the National Natural ScienceFoundation of China (no. 31600071) and the Scientific ResearchFoundation for the Returned Overseas Chinese Scholars of the Min-istry of Education of China.

References

[1] J.J. Zhong, J.H. Xiao, Secondary metabolites from higher fungi: discovery,bioactivity, and bioproduction, Adv. Biochem. Eng. Biotechnol. 113 (2009)79–150.

[2] H. Xiao, J.J. Zhong, Production of useful terpenoids by higher-fungus cellfactory and synthetic biology approaches, Trends Biotechnol. 34 (2016)242–255.

[3] R.A. Ohm, J.F. de Jong, E. Berends, F. Wang, H.A. Wosten, L.G. Lugones, Anefficient gene deletion procedure for the mushroom-forming basidiomyceteSchizophyllum commune, World J. Microbiol. Biotechnol. 26 (2010) 1919–1923.

[4] T.M. Salame, D. Knop, D. Tal, D. Levinson, O. Yarden, Y. Hadar, Predominanceof a versatile-peroxidase-encoding gene, mnp4, as demonstrated by genereplacement via a gene targeting system for Pleurotus ostreatus, Appl. Environ.Microbiol. 78 (2012) 5341–5352.

[5] Y. Ninomiya, K. Suzuki, C. Ishii, H. Inoue, Highly efficient gene replacements inNeurospora strains deficient for nonhomologous end-joining, Proc. Natl. Acad.Sci. U. S. A. 101 (2004) 12248–12253.

[6] J.F. de Jong, R.A. Ohm, C. de Bekker, H.A. Wosten, L.G. Lugones, Inactivation ofku80 in the mushroom-forming fungus Schizophyllum commune increases therelative incidence of homologous recombination, FEMS Microbiol. Lett. 310(2010) 91–95.

[7] T.M. Salame, D. Knop, D. Levinson, O. Yarden, Y. Hadar, Redundancy amongmanganese peroxidases in Pleurotus ostreatus, Appl. Environ. Microbiol. 79(2013) 2405–2415.

[8] J.W. Xu, W. Zhao, J.J. Zhong, Biotechnological production and application ofganoderic acids, Appl. Microbiol. Biotechnol. 87 (2010) 457–466.

[9] S. Cheng, I. Eliaz, J. Lin, A. Thyagarajan-Sahu, D. Sliva, Triterpenes from Poriacocos suppress growth and invasiveness of pancreatic cancer cells through thedownregulation of MMP-7, Int. J. Oncol. 42 (2013) 1869–1874.

10] R.X. You, J.Y. Liu, S.J. Li, L. Wang, K.P. Wang, Y. Zhang, Alkali-solublepolysaccharide, isolated from Lentinus edodes, induces apoptosis and G2/M

ochem

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[for genetic engineering of filamentous fungi, PLoS One 10 (2015) e0133085.

[26] T. Katayama, Y. Tanaka, T. Okabe, H. Nakamura, W. Fujii, K. Kitamoto, J.Maruyama, Development of a genome editing technique using the

H. Qin et al. / Process Bi

cell cycle arrest in H22 cells through microtubule depolymerization,Phytother. Res. 28 (2014) 1837–1845.

11] L. Cong, F.A. Ran, D. Cox, S. Lin, R. Barretto, N. Habib, P.D. Hsu, X. Wu, W. Jiang,L.A. Marraffini, F. Zhang, Multiplex genome engineering using CRISPR/Cassystems, Science 339 (2013) 819–823.

12] P. Mali, L. Yang, K.M. Esvelt, J. Aach, M. Guell, J.E. DiCarlo, J.E. Norville, G.M.Church, RNA-guided human genome engineering via Cas9, Science 339 (2013)823–826.

13] W. Jiang, H. Zhou, H. Bi, M. Fromm, B. Yang, Weeks DP Demonstration ofCRISPR/Cas9/sgRNA-mediated targeted gene modification in Arabidopsis,tobacco, sorghum and rice, Nucleic Acids Res. 41 (2013) e188.

14] J.E. DiCarlo, J.E. Norville, P. Mali, X. Rios, J. Aach, G.M. Church, Genomeengineering in Saccharomyces cerevisiae using CRISPR-Cas systems, NucleicAcids Res. 41 (2013) 4336–4343.

15] R. Liu, L. Chen, Y. Jiang, Z. Zhou, G. Zou, Efficient genome editing infilamentous fungus Trichoderma reesei using the CRISPR/Cas9 system, CellDiscov. 1 (2015) 15007.

16] M. Schuster, G. Schweizer, S. Reissmann, R. Kahmann, Genome editing inUstilago maydis using the CRISPR-Cas system, Fungal Genet. Biol. 89 (2016)3–9.

17] S. Chen, J. Xu, C. Liu, Y. Zhu, D.R. Nelson, S. Zhou, C. Li, L. Wang, X. Guo, Y. Sun,H. Luo, Y. Li, J. Song, B. Henrissat, A. Levasseur, J. Qian, J. Li, X. Luo, L. Shi, L. He,L. Xiang, X. Xu, Y. Niu, Q. Li, M.V. Han, H. Yan, J. Zhang, H. Chen, A. Lv, Z. Wang,M. Liu, D.C. Schwartz, C. Sun, Genome sequence of the model medicinalmushroom Ganoderma lucidum, Nat. Commun. 3 (2012) 913.

18] Z.H. Wei, Y.Y. Duan, Y.Q. Qian, X.F. Guo, Y.J. Li, S.H. Jin, Z.X. Zhou, S.Y. Shan, C.R.Wang, X.J. Chen, Y. Zheng, J.J. Zhong, Screening of Ganoderma strains withhigh polysaccharides and ganoderic acid contents and optimization of thefermentation medium by statistical methods, Bioprocess. Biosyst. Eng. 37(2014) 1789–1797.

istry 56 (2017) 57–61 61

19] L.W. Zhou, Y. Cao, S.H. Wu, J. Vlasak, D.W. Li, M.J. Li, Y.C. Dai, Global diversityof the Ganoderma lucidum complex (Ganodermataceae, Polyporales) inferredfrom morphology and multilocus phylogeny, Phytochemistry 114 (2015)7–15.

20] D.H. Zhang, N. Li, X. Yu, P. Zhao, T. Li, J.W. Xu, Overexpression of thehomologous lanosterol synthase gene in ganoderic acid biosynthesis inGanoderma lingzhi, Phytochemistry 134 (2017) 46–53.

21] J.W. Xu, Y.N. Xu, J.J. Zhong, Enhancement of ganoderic acid accumulation byoverexpression of an N-terminally truncated 3-hydroxy-3-methylglutarylcoenzyme A reductase gene in the basidiomycete Ganoderma lucidum, Appl.Environ. Microbiol. 78 (2012) 7968–7976.

22] G. Li, R. Li, Q. Liu, Q. Wang, M. Chen, B. Li, A highly efficient polyethyleneglycol-mediated transformation method for mushrooms, FEMS Microbiol.Lett. 256 (2006) 203–208.

23] X. Yu, S.L. Ji, Y.L. He, M.F. Ren, J.W. Xu, Development of an expression plasmidand its use in genetic manipulation of Lingzhi or Reishi medicinal mushroom,Ganoderma lucidum (higher Basidiomycetes), Int. J. Med. Mushrooms 16(2014) 161–168.

24] Z. Bao, H. Xiao, J. Liang, L. Zhang, X. Xiong, N. Sun, T. Si, H. Zhao,Homology-integrated CRISPR-Cas (HI-CRISPR) system for one-step multigenedisruption in Saccharomyces cerevisiae, ACS Synth. Biol. 4 (2015) 585–594.

25] C.S. Nodvig, J.B. Nielsen, M.E. Kogle, U.H. Mortensen, A CRISPR-Cas9 system

CRISPR/Cas9 system in the industrial filamentous fungus Aspergillus oryzae,Biotechnol. Lett. 38 (2016) 637–642.