International Immunopharmacology 10 (2010) 1249–1260

Contents lists available at ScienceDirect

International Immunopharmacology

j ourna l homepage: www.e lsev ie r.com/ locate / in t imp

CpG oligodeoxynucleotide promotes protective immunity in the enteric mucosaand suppresses enterotoxigenic E. coli in the weaning piglets

Qing Cheng a,1, Zhenggu Jiang b, Chenchao Xu a,1, Huazhou Li b, Ding Cao a, Zhaihan Yang b,Guangjun Cao a, Zhang Linghua a,⁎a College of Life Sciences, South China Agricultural University, Guangzhou 510642, Chinab Swine Seed Breeding Center of Guangzhou, Guangzhou 510540, China

⁎ Corresponding author. Microbiological Staff Room,China Agricultural University, Wushan Road, Tianhe Di510642, China. Tel.: +86 20 85281389; fax: +86 20852

E-mail address: lhzhang73212000@yahoo.com.cn (Z1 These authors contributed equally to this work.

1567-5769/$ – see front matter © 2010 Elsevier B.V. Aldoi:10.1016/j.intimp.2010.07.006

a b s t r a c t

a r t i c l e i n f o

Article history:Received 21 April 2010Received in revised form 28 June 2010Accepted 7 July 2010

Keywords:PigletsCpG ODNEnterotoxigenic Escherichia coliInnate immunity

CpG oligodeoxynucleotide (CpG ODN) has been described as an effective activator of the innate immunesystem, with potential to protect against infection caused by a range of pathogens in a non-specific manner.We therefore investigated if intranasal (IN), oral (OR)-mucosal, and intramuscular (IM)-systemicadministrations of CpG ODN without antigen codelivery could all enhance innate immunity in the entericmucosa and control the extent of enterotoxigenic Escherichia coli (ETEC) infection in weaning piglets. Hereour data showed that CpG ODN dosed by IN, OR or IM routes protected weaning piglets against a subsequentchallenge with ETEC. The level of protection was greater when CpG ODN was administered IN and OR thanIM, demonstrating a clear relationship between the route of CpG dosing and protection. IN and ORtreatments with CpG ODN reduced bacterial load in the phases at days 3–5 post challenge. The CXCchemokine (CXCL10 and CXCL11) and CC chemokine (CCL4 and CCL5) mRNA expressions were elevated inthe intestinal tissues from animals treated IN or OR with CpG ODN compared to untreated controls.Significantly enhanced mRNA expressions for cathelicidins (PR-39 and protegrin-1), but moderately for β-defensin (pBD1 and pBD2), were observed in IN or OR CpG-treatments. Also, significant production ofcytokines (IL-12, IFN-γ, and MCP-1) and F4-specific antibodies (IgG/IgA) was detected in intestinal washingsfollowing IN and OR CpG-treatments. In contrast, IM delivery induced marked production of sera F4-specificantibodies. It was possible that these chemokines, cytokines, cathelicidins and antibodies played a role in theclearance of ETEC. These findings suggested that IN or OR administration of CpG ODN without antigencodelivery might represent a valuable strategy for induction of innate immunity against ETEC infection.

College of Life Sciences, Southstrict, Guangzhou, GuangDong82180.. Linghua).

l rights reserved.

© 2010 Elsevier B.V. All rights reserved.

1. Introduction

Weaning piglet diarrhea which is caused by enterotoxigenicEscherichia coli (ETEC) is a disease often encountered in modernswine production 3–10 days after weaning of aged 3–5 weeks,resulting in high economic losses in many piggeries. Diarrhea can bethe result in a time of depressed feed intake and growth performance[1], and of further increased diarrhea and other diseases [2], bacterialovergrowth, villus atrophy [3,4] and mortality.

Antibiotics have been popularly used in the pig industry. However,the continuous use and misuse of antibiotics have led to theemergence of drug-resistance [5] and antibiotic-residue in the poultryproduct [6]. Antibiotic resistance in pathogenic bacteria has become a

great concern [7–9]. Hence, new therapeutic strategies are requiredfor the control of ETEC.

Unmethylated CpG dinucleotides within bacterial DNA or syn-thetic oligodeoxynucleotides (ODNs) can activate immune cells [10].These sequence motifs are underrepresented in vertebrates, and it hasbeen proposed that immune activation by CpG DNA has evolved as aresult of evolutionary selections, contributing to host defensemechanisms that recognize invading microbial agents [11]. CpGmotifs can stimulate B cells, NK cells, T cells, and macrophages tosecrete cytokines [12]. A number of studies indicated that CpG canswitch on T helper 1 (Th1) immunity with the production ofimmunoglobulins of class G2a (IgG2a) and a Th1-dominated cytokineprofile [13,14].

Various biological functions of CpG have received extensiveattention, especially at host defense and resistance against infectionsin mice [15–19]. In piglets, it was reported by Van der Stede thatintramuscular (IM) immunization of piglets with F4 during thesuckling period could protect against oral challenge with F4+-E. coli,addition of B-class CpG ODN could improve this protection [20].However, it is still not clear whether or not CpG ODN alone, but not

Table 1Sequences of primer pairs for the quantitative real-time sequence detection systemused in this study.

Targetgene

Primerprobe

Sequence (5′–3′) Nucleotideposition

Length ofthe PCRproduct(bp)

IP-10 Forwardprimer

CTGTTCGCTGTACCTGCATCA 137–158 125

Reverseprimer

TCAGACATCTTTTCTCCCCATTC 283–261

I-TAC Forwardprimer

GCAGTGAAAGTGGCAGATATTGAG 115–139 119

Reverseprimer

TTGGGATTTAGGCATCTTCGTC 211–233

RANTES Forwardprimer

GGCAGCAGTCGTCTTTATCACC 237–259 119

Reverseprimer

GCTCAAGGCTTCCTCCATCC 335–355

MIP-1β Forwardprimer

TCCCACCTCCTGCTGCTTC 118–136 130

Reverseprimer

GACCTGCCTGCCCTTTTTG 229–247

PR-39 Forwardprimer

CTGGTCACTGTGGCTTCTGCT 53–74 127

Reverseprimer

GAGATTAGCTTCCGAGGACTGC 157–179

Protegrin-1

Forwardprimer

AACGGGCGGGTGAAACAGT 301–320 95

Reverseprimer

CCCCTGACACCTTGAACCTCA 374–395

pBD1 Forwardprimer

TCATGGTCCTGTTACCTGTGC 44–65 119

Reverseprimer

GCCGATCTGTTTCATCTTTGGA 140–162

pBD2 Forwardprimer

TCTGCTTGCTGCTGCTGACTG 62–83 100

Reverseprimer

CATATGTAGTGGTCGGACCTCTGG 137–161

β-Actin Forwardprimer

ATCGTGCGGGACATCAAGG 256–274 109

Reverseprimer

GGCAGCTCGTAGCTCTTCTC 345–364

1250 Q. Cheng et al. / International Immunopharmacology 10 (2010) 1249–1260

together with antigen, can also induce protective immune responsesagainst ETEC.

Host defense peptides (HDPs), also called antimicrobial peptides(AMPs), include a wide range of proteins that can be classified intodefensins and cathelicidins. HDPs have both direct, broad-spectrumantimicrobial activity and the ability to modulate immune responsesagainst bacteria, fungi, parasites, and even viruses in a wide variety ofspecies [21]. Therefore, HDPs were also the components of the innateimmune response. To date, there is still no information on theefficiency of CpG ODN on the HDP expression when challenged withETEC in weaning piglets.

It was recently demonstrated in our laboratory that repeatedadministrations of CpG D19 could effectively activate mucosal innateimmune responses by recruitment of dentritic cells (DCs) andmacrophage cells [22]. Recognizing CXC and CC chemokines, Th1type cytokines, as well as HDPs in protective innate immuneresponses, and where after development of antigen-specific anti-bodies was important against bacterial infection, therefore, in thecurrent study, we investigated the IM, IN and OR administrations of A-class CpG D19 alone on induction of CXC and CC chemokines, Th1 typecytokines, HDPs (cathelicidins: PR-39 and protegrin-1; β-defensin:pBD1 and pBD2) and F4-specific antibody responses in the intestinalmucosa and examined the impact of D19 treatment on control ofdiarrhea in weaning piglets.

2. Materials and methods

2.1. Reagents

CpGODNwas synthesized in the TaKaRa Biotech Co., and the porcine-specificmotif, whichwas used in the present study, was the equivalent ofsequence D19 used by Kamstrup et al. [23], in which phosphodiesternucleotides were shown in upper case and phosphorothioate nucleotideswere shown in lower case. CpG ODN (5′-ggTGCATCGATTTATCGATG-CAGggggg-3′) was resuspended in phosphate buffer saline (PBS) at aconcentration of 2 mg/ml, and stored at−20 °C. Commercial kit—SVTotalRNA Isolation Systemwas purchased fromMRC, Ltd., and RevertAid FirstStrand cDNA synthesis kit was purchased fromMBI Fermentas. Real-timePCR commercial reagent kit was purchased fromApplied Biosystems, andFicoll-Paque was from Amersham Biotech, Uppsala, Sweden. Swine IL-4,IL-6, IL-12, IFN-α, IFN-γ, and TNF-α immunoassay kits were purchasedfrom R&D International Inc., andMCP-1 kit was purchased from RapidbioInc. Emulsigen (EM) was purchased fromMVP Lab, 96 well high bindingmicrotest plates were from Coring Ltd., and bovine serum albumin (BSA),tetramethyl benzidine (TMB) and halothane were purchased from SigmaCo. Ltd. Goat anti-porcine IgG:HRP (AAI41P) and goat anti-porcine IgA:HRP (AAI40P) were purchased from Serotec International Inc. ETEC 196strain (O8:K88ac) and F4 antigen were obtained from China Institute ofVeterinary Drug Control.

2.2. Animals and administration of CpG ODN

Seventy-two Landrace×Yorkshire×Durok 14-day-old pigletswhich were from one closed farm (Swine Breeding Center ofGuangdong LiZhu) were used in this study. At 22 days of age theywere weaned, transported to the faculty where they were housed inisolation units and obtained water and food ad libitum. These pigletswere F4-seronegative as determined by ELISA. Four groups ofeighteen 14-day-old piglets divided randomly were treated intra-muscularly (IM) or intranasally (IN) or orally (OR). Group A wasadministered IN with phosphate-buffered saline (PBS) formulated in20% EM, group B was administered IN with 100 μg/kg body weightCpG ODN formulated in 20% EM, group C was administered IM with100 μg/kg body weight CpG ODN formulated in 20% EM, and group Dwas administered OR with 500 μg/kg body weight CpG ODNformulated in 20% EM. Seven days later, piglets were re-administered

with the same formulations. All formulations were delivered in a totalvolume of 1 ml. Three days post the second administration, all the pigswere challenged orally with a dose of 1010 CFU per piglet of thechallenge strain. Clinical signs and morbidity were examined daily for14 days post challenge. All animals were manipulated according toprocedures and consistent with the policies of the local animal carecommittee. The dosages of 100 and 500 μg/kg body weight CpG ODN,20% EM codelivery and challenge regimens were used for IN, IM andOR administrations since we have previously found these to yieldbetter mucosal immune responses in piglets in our experiments andNichani et al.'s findings [22,24–27].

2.3. Strain inoculation

ETEC strain propagated for 24 h at 37 °C in Brain Heart InfusionBroth (Oxoid, Unipath, Drongen, Belgium). Bacteria were collected bycentrifugation, washed and suspended in PBS to a concentration of1010 CFU/ml.

2.4. Sample collection

Four piglets per group at day 3post the second administration andday3 post challenge and 2 piglets per group at day 0 post challenge, wereeuthanized by bleeding under anaesthesia by intravenous injection ofhalothane (24 mg/kg), and intestinal washings were carried out aspreviously described [28], therefore, at day 3post challenge 8pigletswere

1251Q. Cheng et al. / International Immunopharmacology 10 (2010) 1249–1260

left for clinical observation and antibody examination. At the end ofexperiment (at day 15 post challenge) all remaining piglets (8 pigletsper group) were euthanized as above, and intestinal washings werealso collected. All washing samples were stored at−20 °C until assayedby ELISA for IL-4, IL-6, IL-12, IFN-α, IFN-γ, TNF-α, and MCP-1, andwashing samples at days 0, 3 and 15post challengewere also be assayedby ELISA for IgG and IgA. Intestinal tissues (jejunum)were collected alsorespectively at day 3 post the second administration and day 3 postchallenge. All samples were stored at −70 °C until assayed byquantitative real-time PCR (qRT-PCR) sequence detection system forchemokine (CXCL10, CXCL11, CCL5 and CCL4) and HDP (cathelicidins:PR-39 andprotegrin-1;β-defensin: pBD1 andpBD2)mRNAexpressionsin intestinal tissues. Post challenge, piglets were checked twice daily fordiarrhea. Faecal shedding of the inoculated bacteria was monitored byfaecal sampling at days 1, 3, 5, and 7 post challenge and the faecalconsistency was scored daily at sampling on a scale from 1 to 7. Thescore definitionswere 1: hard, dry and cloddy, 2: firm, 3: soft but able toretain some shape, 4: soft and unable to retain any shape, 5: watery anddark, 6: watery and yellow, and 7: foamy and yellow. A faecal

Fig. 1. The production of (A) TNF-α, (B) IFN-γ, (C) IFN-α, (D) IL-12, (E) IL-6 and (F)MCP-1 in porcgroups of weaning piglets were treated intramuscularly (IM) or intranasally (IN) or orally (OR). Sesecondadministration; all of the pigletswere challenged orallywith a dose of 1010 CFUper piglet ofby ELISA as described under Section 2. Each bar represents the group mean (N=4)±SEM of cyto

consistency score N3 was defined as clinical signs of diarrhea. At days3, 7, 10, and 14 post challenge, the experiment bloodwas sampled fromthe jugular vein, and serum was collected by blood centrifugation at5500×g. All serum samples were stored at −20 °C until assayed byELISA.

2.5. Microscopical adhesion assay for the F4R using 196-E. coli

In order to know the F4-receptor status (F4R) of the pigs, theywere all euthanatized on day 15 post challenge by an intravenousinjection of halothane (24 mg/kg). Thereafter small intestinal villiwere collected to detect the presence of F4R. A villous adhesion assaywas determined in vitro as previously described [29].

2.6. IL-4, IL-6, IL-12, IFN-α, IFN-γ, TNF-α and MCP-1 assays

The presence of porcine IL-4, IL-6, IL-12, IFN-α, IFN-γ, TNF-α andMCP-1 in intestine washings was determined by commercial swine

ine intestinewashings at day 3 post the second administration and day 3 post challenge. Fourven days later, piglets were re-administeredwith the same formulations. Three days post thethe challenge strain. The concentrations of cytokines in the intestine extractweredeterminedkine levels determined in triplicate. *pb0.05 vs PBS group, **pb0.01 vs PBS group.

Fig. 1 (continued).

1252 Q. Cheng et al. / International Immunopharmacology 10 (2010) 1249–1260

immunoassay kits according to the manufacturer's directions. Suppliedstandards were used to generate a standard curve.

2.7. A quantitative real-time sequence detection system to measureporcine chemokine and HDP mRNA expression

A real-time sequence detection system was applied for thequantitative measurement of chemokine mRNAs as previouslyreported [30].Total RNA was isolated from cells or tissues usingcommercial kit—SV Total RNA Isolation System, and reverse-tran-scribed into cDNA with RevertAid First Strand cDNA synthesis kit.Expression of mRNA was quantified with real-time PCR (Opticon-II,MJ, Germany) using a commercial reagent kit. For each of targetedgenes, a pair of oligonucleotide primers was designed by PrimerPremier 5.0 software (Table 1), based on the sequences registered inGenBank database (GenBank/EMBL/DDBJ accession number: CXCL10,DQ372065; CXCL11, EU682377; CCL5, NM_001129946; CCL4,NM_213779; PR-39, NM_214450; protegrin-1, NM_001123149;pBD1, AF031666; pBD2, NM_214442; and β-actin, U07786). Valuesfor each target genewere normalized using porine β-actin. Expressionvalues were calculated using the 2−ΔΔCt method [31].

2.8. Detection and quantitation of bacteria in faeces

For quantitative bacteriology of E. coli, faecal samples were collectedby swab from the rectum, stored on ice and processed within 2 h ofcollection. A 10-fold serial dilution in PBS was performed from faecalsamples in plates, and 100 μl of each dilution was transferred intriplicates on MacConkey (MacConkey, MAC) agar (Difco) plates. Allplates were incubated for 24 h at 37 °C under aerobic conditions. If redcolonieswere present,fivewere tested for agglutinationwith O-antigenantiserum, to confirm the quantity of ETEC.

2.9. ELISA for E. coli 196-specific IgG, IgA serum and intestinal washingantibodies

F4-specific IgA and IgG titersweredetermined in an indirect ELISA asdescribed by our experimental procedure [25,32]. Briefly, F4 antigenwas diluted to optimal concentration (10 μg/ml) in 0.05 M carbonatebuffer (15 mM Na2CO3, 35 mM NaHCO3, pH 9.6). And samples werecontinuously dilutedby 2-foldwith1%BSA/PBS-T (PBS containing0.05%Tween 20). Plates were coated at 4 °C with 100 μl per well swine F4 at10 μg/ml in 0.05 M carbonate buffer. Plates were washed five times inPBS-T prior to blocking with 200 μl per well 1% BSA/PBS-T for 1 h at

37 °C. After washing five times, 2-fold dilutions of pig samples wereadded for 1 h at 37 °C. After washing five times, 100 μl per wellperoxidase conjugated goat anti-pig IgA at 1:10,000 or goat anti-pig IgGat 1:4000 in 1% BSA/PBS-T was added for 1 h at 37 °C. Followingwashing, plates were developed with 50 μl per well TMB substrate andstopped with addition of 50 μl per well 1 M H2SO4. The reaction wasvisualized after 60 min incubation with TMB. End-point titers weredefined as the highest dilution that resulted in an OD450 value greaterthan that of themean+three times the standarddeviationof theopticaldensities of the 1/10 diluted samples measured at day 0 post challenge.

2.10. Clinical observation

Post challenge, piglets were checked twice daily for diarrhea. Faecalshedding of the inoculated bacteria and the faecal consistency weremonitored as in Sections 2.4 and 2.8.

2.11. Statistical analysis

Data were analyzed using the statistical software program Systat 11(SPSS). Distribution of data was determined using descriptive statistics.Datawhichwerenotnormallydistributedwere transformedby ranking.Means of the rank were compared using Tukey's multiple comparisontests. A p-value of b0.05 was considered significant.

3. Results

3.1. IL-4, IL-6, IL-12, IFN-α, IFN-γ, TNF-α and MCP-1 in intestine washings

It is well known that cytokine networks play important roles in theinnate immunity to infection. Hence, we measured the production ofcytokines at day 3 post the second administration and day 3 postchallenge respectively. The levels of IFN-γ and IL-12 in intestinewashings were significantly higher in IN-100 μg/kg CpG ODN/20% EMand OR-500 μg/kg/20% EM CpG groups compared with the controlgroup (pb0.05), and moderate levels of IFN-γ and IL-12 in intestinewashings were detected in the IM-100 μg/kg CpG ODN/20% EM group.CpG had no significant effect on the levels of IFN-α, TNF-α and IL-6 inporcine intestine washings compared with levels found in only PBS-inoculated piglets (Fig. 1A–E). As expected, IL-4 was not detected inintestine washings from CpG-treated animals or from PBS controlanimals.

Chemokine (MCP-1) was also been examined by ELISA, for onlycommercial porcine chemokine kit could be available. At day 3 post the

1253Q. Cheng et al. / International Immunopharmacology 10 (2010) 1249–1260

second administration, a marked higher level of MCP-1 was detected inthe intestine of IN-100 μg/kg CpG/20% EM-treated piglets. IntestinalMCP-1 level of this treatment remained markedly elevated at day 3 postchallenge, while at this timepoint a similar significantly higher level ofMCP-1 was also detected in the OR-500 μg/kg CpG/20% EM-treatedpiglets; however, this level was not increased in PBS treatment or IM-100 μg/kg CpG/20% EM-treatment (Fig. 1F).

3.2. Chemokine and HDP mRNA expression

Tobetter characterize the inflammatory responses induced inweaningpiglets by CpG ODN treatment, chemokines and HDPs, respectivelyinvolved in inflammation regulation and antimicrobial activity, weremeasured by qRT-PCR assay. We found rapid induction of intestinalCXCL10, CXCL11, CCL5 and CCL4 mRNA expressions at day 3 post thesecond administration, in accordwith the results of our prior studies [22].Except for CXCL11, the levels of CXCL10, CCL5 and CCL4 mRNA weregreater in IN and OR CpG-treatments than in IM CpG-treatment both atday3post the secondadministrationandday3post challenge (Fig. 2A–D).

Fig. 2. (A) IP-10, (B) I-TAC, (C) RANTES, (D) MIP-β, (E) PR-39, (F) protegrin-1, (G) pBD1 andFour groups of weaning piglets were treated intramuscularly (IM) or intranasally (IN) or oThree days post the second administration; all of the pigs were challenged orally with a dosemRNAwere determined by relative quantitative RT-PCR using β-actin gene expression as hoshown. Data was statistically analyzed for differences among treatment groups at day 3 posfrom all other groups (pb0.05). & indicates significant difference between groups (pb0.05)

Similar to the chemokine responses, cathelicidin (PR-39 andprotegrin-1) mRNA levels were also elevated markedly, but lowerthan chemokine mRNA levels. However, β-defensin (pBD1 and pBD2)mRNA levels were just enhanced mildly compared with cathelicidins(Fig. 2E–F). Also, cathelicidin responses induced by IN and OR routeswere stronger than those by IM route in the intestine. Taken together,these results showed thatweaning piglets respondedmore efficiently toIN and OR deliveries of CpG ODN than IM delivery in the intestine.

3.3. Humoral immune responses post challenge

All piglets were F4-seronegative prior to the start of theexperiment. The kinetics of the F4-specific serum antibody responseswas shown in Fig. 3A–B. The control group showed mild antibodyresponses post challenge infection, and a moderate increase inbaseline value was observed. However, the F4-specific sera IgG andIgA antibody titers all peaked 7 days post challenge in all 3 CpG-treated groups, where after it reached a plateau at day 10 postchallenge. As shown in Fig. 3A–B, the F4+-E. coli challenge resulted in

(H) pBD2 relative gene expressions in intestinal tissues following CpG or PBS treatment.rally (OR). Seven days later, piglets were re-administered with the same formulations.of 1010 CFU per piglet of the challenge strain. Relative quantities of chemokines and HDPusekeeping gene. Mean relative quantity of chemokine and HDPmRNA (N=4)±SEM ist the second administration and day 3 post challenge. $ indicates significant difference.

Fig. 2 (continued).

1254 Q. Cheng et al. / International Immunopharmacology 10 (2010) 1249–1260

a strong increase of the sera IgG and IgA titers in the IM-100 μg/kgCpG/20% EM group with significantly higher (pb0.05) titers than inthe control group at days 3, 7, and 10 post challenge. An increase ofthe F4-specific sera IgG and IgA titers was also observed in the IN-100 μg/kg CpG/20% EM and OR-500 μg/kg CpG/20% EM groups, butwas only statistically significantly different from the control group inthe IN-100 μg/kg CpG/20% EM group (sera IgG at day 7 postchallenge). Un-similar with sera antibody responses, statisticallysignificant differences of intestinal washing antibody responses wereonly observed in IN-100 μg/kg CpG/20% EM group, but not in the IM-100 μg/kg CpG/20% EM group (Fig. 3C–D).

3.4. Faecal shedding of 196-E. coli

To study the impact of CpG ODN administration on the course ofETEC infection, all of the piglets were challenged orally with a dose of1010 CFU per piglet of the challenge strain. Before challenge (day 0post challenge) all animals had no 196-E. coli excretion and no pigletsshowed diarrhea. A significantly lower D/T (number of diarrheapiglets/total piglets) was observed only in IN-100 μg/kg CpG/20% EM-treatment at day 2 post challenge. Significantly lower D/T also wasalso seen in IM-100 μg /kg CpG/20% EM and OR-500 μg /kg CpG/20%EM-treatments. Although significantly lower faecal score was only

seen in IN-100 μg/kg CpG/20% EM-treatment at day 4 post challenge,there was a tendency that lower faecal score was obtained in IN-100 μg/kg CpG/20% EM-treatment compared with other CpG-treat-ments (Table 2).

In the control group, a peak in the faecal E. coli excretion (mean E.coli/gram faeces of 106 to 108) was seen on day 3 post challengefollowed by a gradual decrease. Seven days post challengemeans 196-E. coli/gram faeces of 102 to 104 E. coli could be isolated from the faecesof PBS control piglets.

All CpG-immunized groups showed a reduced E. coli excretion, thiswas most significant for the IN-100 μg/kg/20% EM CpG group on days3–5 post challenge (Fig. 4).

The duration of E. coli excretion (7 days) was not significantlydifferent between the groups. But IN-100 μg/kg/20% EM CpG-treatedpiglets recovered from diarrhea most quickly in all piglets (Table 2),which was in accord with faecal E. coli excretion.

3.5. Microscopical adhesion test

Due to sample preparation, 8 euthanized piglets per group(respectively 4 piglets at day 3 post the second administration and 4piglets at day 3 post challenge) were not examined in the in vitroadhesion assay. For the remaining piglets, all piglets in this study

1255Q. Cheng et al. / International Immunopharmacology 10 (2010) 1249–1260

expressed the F4R, which confirmed that the reduced number ofexcreting and diarrheic piglets was due to CpG protection.

4. Discussion

Bacterial DNA, as well as short oligonucleotides containing CpGODN, is a potent immune modulator in both human and animalspecies. CpG ODN signal through TLR9, as well as their immunomod-ulatory activity, either as ‘stand alone’-innate immune treatments oras vaccine adjuvants, has been shown by numerous investigators in avariety of species. [14,33]. Pretreatment of mice with CpG ODN wasshown to elicit protective immunity against infection with Plasmodi-um yoelii [34], Listeria monocytogenes [35,36], Leishmania major [37],or H. pylori [38]. Despite the documented effects of CpG ODN onsystemic or mucosal immunity, little is known about the impact ofCpG ODN without antigen codelivery on mucosal immunity against

Fig. 3. Kinetics of the F4-specific (A) IgGand(B) IgA in sera, (C) IgGand(D) IgA in intestinalwashingroups of weaning piglets were treated intramuscularly (IM) or intranasally (IN) or orally (OR). Sesecond administration; all of pigs were challenged orally with a dose of 1010 CFU per piglet of thintestinal washings samples)±SEM for titers of F4-specific antibodies as determined in triplicate

ETEC in weaning piglets by IM, IN and OR routes. In the present study,we found that IN and OR administered immunostimulatory CpG ODNcould strongly promote innate immunity and accelerate the develop-ment of F4-specific Abs in the porcine intestinal tract mucosa.Importantly, IN and OR administrations of CpG ODN without anybacterial antigen codelivery could suppress bacterial colonization inthe intestine of piglets with ETEC infection.

Cytokines are potent activators of innate immune system.Analysis ofcytokine induction in humans and mice by CpG ODN is an importantparameter for characterization of CpG ODN-induced activity [13,39]. Inthe present study, significant production of IFN-γ and IL-12 wasdetected in intestinalwashings followingOR and IN-CpG-treatments. Incontrast, IM delivery did not induce any obvious production of IFN-γand IL-12. In addition, recent studies showed that systemic administra-tion of CpG ODN improved recovery of mice infected with the Friendleukemia virus and senescent mice infected with the influenza virus

g responses followingCpGODNadministrations andchallenge infectionwithF4+-E. coli. Fourven days later, piglets were re-administeredwith the same formulations. Three days post thee challenge strain. Each data represents the group mean (N=8 for sera samples, N=4 forby end-point dilution ELISA assay. *pb0.05 vs PBS group, **pb0.01 vs PBS group.

Fig. 3 (continued).

1256 Q. Cheng et al. / International Immunopharmacology 10 (2010) 1249–1260

[17,40]. These protections in all cases were linked to induction of a Th1response. Our data presented here showed that CpG indeed induced aTh1-type immune responses (Th1-type cytokines— IFN-γ and IL-12) inintestinalmucosa. Our observationwas consistentwithfindings of Krieget al., whoobserved rapid elevatedproductionof IFN-γ and sustained IL-12 were important for the protective effects of CpG DNA againstinfection by L. monocytogenes [36]. Similar findings had also beenreported by Gramzinski et al. who described mice challenged with P.yoelii sporozoites could be completely protected against malariasporozoite challenge when pretreated with CpG ODN and thatprotective effects were dependent on IL-12 and IFN-γ [34]. So, theseinnate immune responses apparently permitted time for the develop-

ment of specific, T cell-dependent immune responses that ultimatelycontrolled infection and cleared the pathogen.

Innate immunity against pathogens is in part orchestrated by theordered release of different chemokines that function as chemoat-tractants and activators of various immune cells, a property thatenables immune cells to serve as the first line of cell-mediated hostdefense against infections. Of the different chemokines studied todate, members of the CXC and CC chemokine subfamilies appeared tohave the greatest effects on the recruitment of various immune cells,such as natural killer (NK) cells, polymorphonuclear cells, dendriticcells, macrophages, and lymphocytes, to the site of infection [41]. Inthe present study, following IN or OR-mucosal or IM-systemic

Table 2The daily faecal score for each individual animal in the different treatment groups.a

Groups Faecal scoreb

Days post challenge

0 1 2 3 4 5 6 7 8 9

IN-PBS/20% EM

3 4 4 6 –c – – – – –

2 3 4 3 – – – – – –

2 2 2 2 – – – – – –

3 3 2 1 – – – – – –

3 3 3 2 5 3 3 3 3 22 3 3 3 3 3 2 1 2 13 6 6 6 6 6 5 6 4 23 3 4 5 3 3 2 3 3 22 6 7 7 6 3 2 3 3 31 4 3 4 6 6 3 2 3 32 6 6 6 6 6 4 3 2 21 3 3 4 7 6 3 3 3 2

Total score 27 46 47 49 42 36 24 24 23 17D/Td 0/12 5/12 6/12 7/12 6/8 4/8 2/8 1/8 1/8 0/8IN-100 μg/kgCpG/20% EM

2 2 3 3 – – – – – –

1 1 3 2 – – – – – –

1 3 1 2 – – – – – –

2 3 2 1 – – – – – –

2 2 2 3 3 3 3 2 2 22 2 3 2 2 2 2 1 1 12 2 3 3 3 3 2 1 1 23 4 3 3 2 3 2 1 2 13 6 4 4 2 2 2 2 1 12 5 3 3 2 2 2 2 1 12 2 3 2 3 2 3 1 2 22 4 4 2 3 2 2 2 2 2

Total score 24 36 34 30 20⁎ 19 18 12 12 12D/T 0/12 4/12 2/12⁎ 1/12⁎⁎ 0/8⁎ 0/8⁎⁎ 0/8⁎ 0/8 0/8 0/8IM-100 μg /kgCpG/20% EM

1 4 5 4 – – – – – –

2 3 3 2 – – – – – –

2 3 2 2 – – – – – –

3 2 2 2 – – – – – –

2 5 3 3 3 3 2 2 1 12 2 2 2 2 1 1 2 2 23 6 6 6 4 3 2 3 3 32 6 6 3 3 2 3 2 2 32 3 3 6 4 2 1 3 2 33 6 6 5 3 2 1 1 3 22 3 3 3 3 4 3 2 2 22 3 2 2 2 2 2 2 2 1

Total score 26 46 43 40 24 19 15 17 17 17D/T 0/12 5/12 4/12 4/12⁎ 2/8⁎ 1/8⁎⁎ 0/8⁎ 0/8 0/8 0/8OR-500 μg/kgCpG/20% EM

2 3 2 2 – – – – – –

3 4 5 4 – – – – – –

3 3 2 2 – – – – – –

1 3 3 2 – – – – – –

2 3 3 3 3 2 2 2 1 12 5 5 3 3 3 2 1 1 33 3 3 3 3 2 3 2 3 13 3 5 3 3 2 3 3 2 22 2 3 3 3 2 2 2 1 23 7 7 6 4 3 2 2 2 22 6 6 3 3 2 1 2 2 13 2 3 3 2 3 2 2 3 2

Total score 29 44 47 37 24 19 17 16 15 14D/T 0/12 4/12 5/12 2/12⁎ 1/8⁎ 0/8⁎⁎ 0/8⁎ 0/8 0/8 0/8

a Four groups of weaning piglets were treated intramuscularly (IM) or intranasally (IN) or orally (OR). Seven days later, piglets were re-administered with the same formulations.Three days post the second administration, all of pigs were challenged orally with a dose of 1010 CFU per piglet of the challenge strain.

b Faecal score: 1: hard, dry and cloddy, 2: firm, 3: soft but able to retain some shape, 4: soft and unable to retain any shape, 5: watery and dark, 6: watery and yellow, and 7: foamyand yellow. A faecal consistency score N3 was defined as clinical signs of diarrhea.

c Pigs were killed for the intestinal analysis.d D/T: Number of diarrhea piglets/total piglets.⁎ pb0.05 vs PBS group.⁎⁎ pb0.01 vs PBS group.

1257Q. Cheng et al. / International Immunopharmacology 10 (2010) 1249–1260

delivery of CpG ODN,we observed significant induction of CXCL10 andCXCL11 mRNA expression 3 days post the second administration and3 days post challenge in the intestine. Since the CXC chemokinereceptor is mainly expressed on Th1 cells, it seems reasonable tospeculate that these chemokines preferentially recruit Th1 cells to thegastric mucosa [41], which may in turn contribute to induction of

protective immunity against ETEC infection. In addition to CXCL10and CXCL11, we found that IN, IM and OR administrations of CpG ODNin piglets triggered the local production of the CC chemokinesmacrophage inflammatory protein 1β (CCL4), monocyte chemoat-tractant protein-1 (CCL2) and regulated upon activation normal T cellexpressed and secreted (CCL5). These CC chemokines can be secreted

Fig. 4. Mean faecal excretion of E. coli/gram faeces (log10±SEM) per group at each timepoint post challenge. Four groups of weaning piglets were treated intramuscularly (IM) orintranasally (IN) or orally (OR). Seven days later, piglets were re-administered with the same formulations. Three days post the second administration, all of the pigs werechallenged orally with a dose of 1010 CFU per piglet of the challenge strain. *pb0.05 vs PBS group.

1258 Q. Cheng et al. / International Immunopharmacology 10 (2010) 1249–1260

by a variety of cell types, including macrophages, activated NK cells,and T cells [42]. The common receptor for all three CC chemokines,CCR5 [43], is expressed on macrophages, dendritic cells, NK cells, andactivated Th1 cells and could thus recruit these immunocompetentcells into the intestinal mucosa of piglets that received CpG ODN[44,45]. Recently, it was shown that a repeated IN-mucosal dose ofCpG ODN could effectively upregulate CXC and CC chemokines in theintestinal tissues, and thereafter recruited dentritic cells (DCs) andmacrophage cells into the intestinal mucosa of piglets [22]. Thus, itappears that mucosal (IN and OR) administrations of CpG ODN areboth capable of inducing strong innate immunity at intestinal mucosalsurfaces against enteric bacterial infection.

It is now well recognized that the mucosal and systemiccompartments of the immune system display a significant degree ofmutual independence. Several studies have shown that there is also acompartmentalization within the mucosal immune system itself, sothat mucosal immunization induces stronger immune responses at oradjacent to the site of induction than at distant sites [46]. Most of theearly studies that assessed the immunoprotective effects of CpG ODNused the IM route, and recent studies have favored compartmental-ized delivery of CpG ODN in the prevention of a localized infection[47]. In our studies, IN and OR-mucosal administrations of CpG ODNindeed both triggered strong Th1-type innate immune responses atintestinal mucosa, as well better protection against ETEC, whencompared with IM administration. These results further mirrored thatcompartmentalized delivery of CpG ODN could improve the protec-tion of piglets challenged by enteric bacteria.

In the intestine, the first line of defense against invading pathogens,such as ETEC, is provided by the innate immune system [48]. Part of thisimmune response is the release of HDPs into the lumen of the intestinaltract. These peptides are capable of directly killing a wide variety ofbacterial and viral pathogens. It was also reported that cathelicidins(PR-39, and protegrin-1) were more important to growth andimmunity of weaning piglet in the growing phase [49]. As expected,enhanced PR-39 and protegrin-1 mRNA levels were observed in INand OR CpG-treatments, but lower in IM CpG-treatment. Surpris-ingly, only mild elevations of β-defensins were seen post all CpG-treatments. Since the characteristics (including hydrophobicity,

charge, conformation and structure) of cathelicidins are significantlydifferent from defensins, their gene regulation mechanism may bedifferent too. These dissimilarities could account for the differences inthe intensity of HDP (cathelicidins and defensins) responses observedfollowing CpG administration. Therefore, IN and OR deliveries of CpGODN could both effectively stimulate expression of cathelicidins andimprove the innate immune system to strengthen the host defenses.Increased production of cathelicidinsmight contribute to improve ETECresistant.

Except for the induction of innate immune responses, the rapiddevelopment of adaptive immunity is also important for recoveryfrom ETEC infection. Following challenge, significantly higher levels ofIgG and IgA in intestinal washings were detected in IN and OR CpG-treatments, compared with the control group. IM route could inducestrong IgG and IgA responses in sera, but not in intestinal washings.Van den Broeck et al. [50] demonstrated that F4-specific intestinal IgAtiter is a useful measure for the mucosal immune response in pigletsafter an oral F4-immunization since they are induced at the gut-associated lymphoid tissue (GALT). The IgA response after anintramuscular immunization of pigs was mainly induced in systemiclymphoid tissues so that the F4-specific IgA titer was less correlatedwith the IgA in the gut mucosa, which could explain the betterprotection observed in the IN and OR CpG groups, while not in the IMCpG group. The enhanced mucosal antibody responses were at leastpartly due to the migration of antigen-pulsed dendritic cells from thePeyer's patches, where the activation and differentiation of antigen-specific B cells is initiated [51]. This might explain the protection aswell as the enhanced IgA response in intestinal washings using IN andOR routes upon F4+-E. coli challenge.

Even though there is no linear correlation between the animal sizeand CpG ODN dose, it is obvious that higher doses are needed for CpGODNs to be effective in larger species. For example, in piglets, theamount of CpG ODN required to induce a good immune response wasbetween 10 and 1000 μg/kg body for IN and IM routes, and muchhigher (500–2 mg/ kg body) in the oral route [22,24–27]. Althoughthe cost of CpG ODN may not be a major factor for human vaccines,such high doses of CpG ODN would be uneconomical in animalvaccine. This makes it even more important to formulate CpG ODN

1259Q. Cheng et al. / International Immunopharmacology 10 (2010) 1249–1260

with a co-adjuvant as this may reduce the dose of CpG required toinduce immune responses. Recently, Taghavi et al. evaluated threeformulations (polyphosphazenes, Emulsigen and liposomes) for theircapacity to enhance the protective effects of CpG ODN in a chickenmodel of E. coli infection. Addition of PCPP and PCEP to CpG ODNresulted in an enhancement of the protective effects of CpG ODN asindicated by a reduction in mortality [52]. Also, Ioannou et al.observed that formulation of tgD with CpG ODN and an oil-in-wateradjuvant, Emulsigen, significantly enhanced serum neutralizingantibody responses and protection from BHV-1 challenge in calveswhen compared to formulation with CpG ODN only; indeed, even ifthe CpGODNwere formulatedwith Emulsigen at a low dose of 250 μg,the immune responses and protection were still stronger than with25 mg CpG ODN alone [53]. These demonstrated that in addition toimprovements in the immune responses and protection induced, it ispossible that formulation of CpG ODNwith a co-adjuvant can lead to areduction in the dose and hence the cost of CpG ODN.

These results presented here suggested that CpG ODN delivered bymucosal routes offered potential for the prevention of disease caused byETEC delivered by the oral route. Taken togetherwith published reportsof the protective effect of similar CpGODN to other organisms as diverseas Ebola virus [54], B. anthracis [54], L. monocytogenes [35], Francisellatularensis [35] and Plasmodium yoelli [34], these results suggested thatCpG therapyhad great potential as a generic immunomodulator, againsta range of infectious agents. Further studies will be required todetermine the protective efficacy of CpG ODN delivered by mucosalroutes against other pathogens delivered to the enteric tract. This maylead to development of a generic immunomodulator, which may betrigger protective innate immunity shortly before infection takes place.

Acknowledgments

This study was supported by Guangdong Province AgriculturalTechnological Project (NO: 2009B020307010), Guangzhou Sciences andTechnologies Project (NO: 2010-Z1), and Project and Key Laboratory ofAnimal Disease Control and Prevention of the Ministry of Agriculture.

References

[1] Odle J, Zijlstra T, Donovan SM. Intestinal effects of milkborne growth factors inneonates of agricultural importance. J Anim Sci 1996;74:2509–22.

[2] Frydendahl K. Prevalence of serogroups and virulence genes in Escherichia coliassociated with post-weaning diarrhea and edema disease in pigs and acomparison of diagnostic approaches. Vet Microbiol 2002;85:169–82.

[3] Hampson DJ. Alternations in piglet small intestinal structure at weaning. Res VetSci 1986;40:32–40.

[4] Hampson DJ, Kidder DE. Influence of creep feeding and weaning on brush borderenzyme activities in the piglet small intestine. Res Vet Sci 1986;40:24–31.

[5] Monroe S, Polk R. Antimicrobial use and bacterial resistance. Curr Opin Microbiol2000;3:496–501.

[6] Schwarz S, Kehrenberg C, Walsh TR. Use of antimicrobial agents in veterinarymedicine and food animal production. Int J Antimicrob Agents 2001;17:431–7.

[7] Murray BE. New aspects of antimicrobial resistance and the resulting therapeuticdilemmas. J Infect Dis 1991;163:1185–94.

[8] Neu HC. The crisis in antibiotic resistance. Science 1992;257:1064–73.[9] Levy SB. The challenge of antibiotic resistance. Sci Am 1998;278:32–9.[10] Krieg AM. The role of CpGmotifs in innate immunity. Curr Opin Immunol 2000;12:

35–43.[11] Krieg AM, Yi A, Matson S, Waldschmidt TJ, Bishop GA, Teasdale R, et al. CpG motifs

in bacterial DNA trigger direct B-cell activation. Nature 1995;374:546–8.[12] Klinman DM, Yi AK, Beaucage SL, Conover J, Krieg AM. CpG motifs present in

bacteria DNA rapidly induce lymphocytes to secrete interleukin 6, interleukin 12,and interferon gamma. Proc Natl Acad Sci USA 1996;93:2879–83.

[13] Krieg AM. CpG motifs in bacterial DNA and their immune effects. Annu RevImmunol 2002;20:709–60.

[14] Krieg AM. Therapeutic potential of Toll-like receptor 9 activation. Nat Rev DrugDiscov 2006;5:471–84.

[15] Harandi AM, Eriksson K, Holmgren J. A protective role of locally administeredimmunostimulatory CpG oligodeoxynucleotide in a mouse model of genitalherpes infection. J Virol 2003;77(2):953–62.

[16] Ashkar AA, Bauer S, Mitchell WJ, Vieira J, Rosenthal KL. Local delivery of CpGoligodeoxynucleotides induces rapid changes in the genital mucosa and inhibitsreplication, but not entry, of herpes simplex virus type 2. J Virol 2003;77(16):8948–56.

[17] Olbrich AR, Schimmer S, Heeg K, Schepers K, Schumacher TN, Dittmer U. Effectivepostexposure treatment of retrovirus-induced disease with immunostimulatoryDNA containing CpG motifs. J Virol 2002;76(22):11397–404.

[18] Verthelyi D, Gursel M, Kenney RT, Lifson JD, Liu S, Mican J, et al. CpGoligodeoxynucleotides protect normal and SIV-infected macaques from Leish-mania infection. J Immunol 2003;170(9):4717–23.

[19] Juffermans NP, Leemans JC, Florquin S, Verbon A, Kolk AH, Speelman P, et al. CpGoligodeoxynucleotides enhance host defense during murine tuberculosis. InfectImmun 2002;70(1):147–52.

[20] Van der Stede Y, Cox E, Verdonck F, Vancaeneghem S, Goddeeris BM. Reducedfaecal excretion of F4+-E. coli by the intramuscular immunisation of sucklingpiglets by the addition of 1a, 25-dihydroxyvitamin D3 or CpG-oligodeoxynucleo-tides. Vaccine 2003;21:1023–32.

[21] Hancock RE, Sahl HG. Antimicrobial and host-defense peptides as new anti-infective therapeutic strategies. Nat Biotechnol 2006;24:1551–7.

[22] Cheng Q, Xu CC, Zhang LH, Li JQ, Cao T, Zhang MR. Administered CpGOligodeoxynucleotide induces mRNA expression of CXC and CC chemokines at theintestinal mucosa and PBMCs in piglets. Int Immunopharmacol 2010;10:611–8.

[23] Kamstrup S, Daniela V, Dennis MK. Response of porcine peripheral bloodmononuclear cells to CpG-containing oligodeoxynucleotides. Vet Microbiol2001;78(4):353–62.

[24] Zhang LH, Tian XS, Zhou FZ. In vivo immunostimulatory effects of CpG ODN innewborn piglets. Mol Immunol 2007;44(6):1238–44.

[25] Zhang LH, Tian XS, Zhou FZ. In vivo oral administration effects of variousoligodeoxynucleotides containing synthetic immunostimulatory motifs in theimmune response to pseudorabies attenuated virus vaccine in newborn piglets.Vaccine 2008;26:224–33.

[26] Nichani AK, Kaushik RS, Mena A, Popowych Y, Dent D, Townsend HG, et al. CpGoligodeoxynucleotide induction of antiviral effector molecules in sheep. CellImmunol 2004;227:24–37.

[27] Nichani AK, Mena A, Kaushik RS, Mutwiri GK, Townsend HG, Hecker R, et al.Stimulation of innate immune responses by CpG oligodeoxynucleotide innewborn lambs can reduce bovine herpesvirus-1 shedding. Oligonucleotides2006;16:58–67.

[28] Michael JM, Risini DW, Arthur MK, Heather LD. CpG ODN is an effective oraladjuvant to protein antigens in mice. Vaccine 2001;19:950–7.

[29] Giardeau JP. A new in vitro technique for attachment to intestinal villi usingenteropathogenic Escherichia coli. Ann Microbiol 1980;131B:31–7.

[30] Asmi CM, Tassakka AR, Savan R, Watanuki H, Sakai M. The in vitro effects of CpGoligodeoxynucleotides on the expression of cytokine genes in the common carp(Cyprinus carpio L.) head kidney cells. Vet Immunol Immunopathol 2006;110(1–2):79–85.

[31] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-timequantitative PCR and the 2−ΔΔCt method. Methods 2001;25:402–8.

[32] Zhang LH, Guo Y, Tian XS, Zhou FZ. CpG oligodinucleotides induce strong humoraland cellular responses to swine streptococcic septicemia vaccine in piglets in vivo.Int Immunopharmacol 2006;6(3):342–50.

[33] Wilson HL, Dar A, Napper SK. Marianela Lopez A, Babiuk LA, Mutwiri GK. Immunemechanisms and therapeutic potential of CpG oligodeoxynucleotides. Int RevImmunol 2006;25:183–213.

[34] Gramzinski RA, Doolan DL, Sedegah M, Davis HL, Krieg AM, Hoffman SL.Interleukin-12- and gamma interferon-dependent protection against malariaconferred by CpG oligodeoxynucleotide in mice. Infect Immun 2001;69:1643–9.

[35] Elkins KL, Rhinehart-Jones TR, Stibitz S, Conover JS, Klinman DM. Bacterial DNA,containing CpGmotifs stimulates lymphocyte-dependent protection of mice againstlethal infection with intracellular bacteria. J Immunol 1999;162(4):2291–8.

[36] Krieg AM, Love-Homan L, Yi AK, Harty JT. CpG DNA, induces sustained IL-12expression in vivo and resistance to Listeria monocytogenes challenge. J Immunol1998;161(5):2428–34.

[37] Zimmermann S, Egeter O, Hausmann S, Lipford GB, RockenM,Wagner H, et al. CpGoligodeoxynucleotides trigger protective and curative Th1 responses in lethalmurine leishmaniasis. J Immunol 1998;160(8):3627–30.

[38] Raghavan S, Nystro¨m J, FredrikssonM,Holmgren J, Harandi AM. Orally administeredCpG oligodeoxynucleotide induces production of CXC and CC chemokines in thegastric mucosa and suppresses bacterial colonization in a mouse model ofHelicobacter pylori infection. Infect Immun 2003;71(12):7014–22.

[39] Gursel M, Verthelyi D, Gursel I, Ishii KJ, Klinman DM. Differential and competitiveactivation of human immune cells by distinct classes of CpG oligodeoxynucleotide.J Leukoc Biol 2002;71:813–20.

[40] Dong L, Mori IM, Hossain BL, Kimura Y. An immunostimulatory oligodeoxynucleo-tide containing a cytidine–guanosine motif protects senescence-accelerated micefrom lethal influenza virus by augmenting the T helper type 1 response. J Gen Virol2003;84:1623–8.

[41] Zlotnick A, Yoshie O. Chemokines: a new classification system and their role inimmunity. Immunity 2000;12:121–7.

[42] Baggiolini M, Dewald B, Moser B. Interleukin-8 and related chemotactic cytokines—CXC and CC chemokines. Adv Immunol 1994;55:97–179.

[43] Moser B, Loetscher P. Lymphocyte traffic control by chemokines. Nat Immunol2001;2:123–8.

[44] Taub DD, Conlon K, Lloyd AR, Oppenheim JJ, Kelvin DJ. Preferential migration ofactivated CD4 and CD8T cells in response to MIP-1 alpha and MIP-1 beta. Science1993;260:355–8.

[45] Uguccioni M, Apuzzo MD, Loetscher M, Dewald B, Baggiolini M. Actions of thechemotactic cytokines MCP-1, MCP-2, MCP-3, RANTES, MIP-1 alpha and MIP-1beta on human monocytes. Eur J Immunol 1995;25:64–8.

1260 Q. Cheng et al. / International Immunopharmacology 10 (2010) 1249–1260

[46] Johansson EL, Rask C, Fredriksson M, Eriksson K, Czerkinsky C, Holmgren M.Antibodies and antibody-secreting cells in the female genital tract after vaginal orintranasal immunization with cholera toxin B subunit or conjugates. InfectImmunol 1998;66(2):514–20.

[47] Deng JC, Moore TA, Newstead MW, Zeng X, Krieg AM, Standiford TJ. CpGoligodeoxynucleotides stimulate protective innate immunity against pulmonaryKlebsiella infection. J Immunol 2004;173:5148–55.

[48] Beutler B. Innate immunity: an overview. Mol Immunol 2004;40:845–59.[49] Bosi P, Gremokolini C, Trevisi P. Dietary regulations of the intestinal barrier

function at weaning. Asian-australas J Anim Sci 2003;16:596–608.[50] Van den Broeck W, Cox E, Goddeeris BM. Receptor-dependent immune responses

in pigs after oral immunisation with F4 fimbriae. Infect Immun 1999;67:520–6.[51] Enioutina EY, Visic D, Daynes RA. The induction of systemic and mucosal immune

responses to antigen-adjuvant compositions administered into the skin: altera-

tions in the migratory properties of dendritic cells appears to be important forstimulating mucosal immunity. Vaccine 2000;18:2753–67.

[52] Taghavi A, Allan B, Mutwiri G, Foldvari M, Van Kessel A, Willson P, et al.Enhancement of immunoprotective effect of CpG ODN by formulation withpolyphosphazenes against E. coli septicemia in neonatal chickens. Curr Drug Deliv2009;6:76–82.

[53] Ioannou XP, Griebel P, Hecker R, Babiuk LA, van Drunen Littel-van den Hurk S. Theimmunogenicity and protective efficacy of bovine herpesvirus 1 glycoprotein Dplus Emulsigen are increased by formulation with CpG oligodeoxynucleotides. JVirol 2002;76:9002–10.

[54] Klinman DM, Verthelyi D, Takeshita F, Ishii KJ. Immune recognition of foreignDNA: a cure for bioterrorism. Immunity 1999;11:123–9.