BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions,research libraries, and research funders in the common goal of maximizing access to critical research.

Courtship Patterns in the Drosophila montium Species Subgroup: Repeated Lossof Precopulatory Courtship?Author(s): Chuan-Cheng Chen, Masayoshi Watada, Hitoshi Miyake, Takehiro K. Katoh, Zheng Sun,Yi-Feng Li, Michael G. Ritchie and Shuo-Yang WenSource: Zoological Science, 30(12):1056-1062. 2013.Published By: Zoological Society of JapanDOI: http://dx.doi.org/10.2108/zsj.30.1056URL: http://www.bioone.org/doi/full/10.2108/zsj.30.1056

BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological,and environmental sciences. BioOne provides a sustainable online platform for over 170 journals and bookspublished by nonprofit societies, associations, museums, institutions, and presses.

Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance ofBioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use.

Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercialinquiries or rights and permissions requests should be directed to the individual publisher as copyright holder.

2013 Zoological Society of JapanZOOLOGICAL SCIENCE 30: 1056–1062 (2013)

Courtship Patterns in the Drosophila montium Species Subgroup:

Repeated Loss of Precopulatory Courtship?

Chuan-Cheng Chen1, Masayoshi Watada2, Hitoshi Miyake2, Takehiro K. Katoh2,

Zheng Sun1, Yi-Feng Li1, Michael G. Ritchie3, and Shuo-Yang Wen1*

1Department of Entomology, South China Agricultural University, Guangzhou 510642, China2Graduate School of Science and Engineering, Ehime University, 3 Bunkyo-Cho,

Matsuyama, Ehime 790-8577, Japan3School of Biology, University of St Andrews, St Andrews, Fife KY16 9TH, UK

During precopulatory courtship, male Drosophila typically produce wing vibration to generate spe-

cies-specific songs before mounting females. Three species in the lini clade of the montium spe-

cies subgroup have been found to produce species-specific sine song only after mounting and

during copulation. Here we investigated and analyzed the courtship behavior of 29 species in the

montium subgroup from video and song recordings and measured the duration of wing vibration.

We describe a great diversity of courtship behavior in the montium subgroup. The courtship pat-

terns can be categorized into four types in the montium subgroup: 1) type P/C, species with both

precopulatory and copulatory courtship, such as D. parvula and D. nikananu, 2) type P-/C, species

with sporadic precopulatory and mainly copulatory courtship, such as D. auraria and D. triauraria.

3) type C, species with only copulatory courtship, such as D. tani and D. pectinifera, 4) type C-,

species with only very brief copulatory courtship, such as D. rufa and D. asahinai. According to a

phylogenetic tree based on sequences of mitochondrial COI and COII, and the nuclear Adh, both pre-

copulatory courtship and copulatory courtship were present in the most basal species D. parvula.

Each of two branches in the montium subgroup contains four types of courtship behavior. Type C

is present in each sub-branch. These results suggest that the courtship behavior initially involved

both precopulatory and copulatory courtship, but that subsequently precopulatory courtship has

gradually been lost in the montium subgroup. We suggest reasons why precopulatory behavior

might come to be lost in the montium subgroup.

Key words: the montium species subgroup, wing vibration, precopulatory courtship, copulatory courtship,

evolution

INTRODUCTION

Drosophila courtship has been well studied as a model

system from both behavioral and neurogenetic perspectives.

The typical Drosophila courtship involves precopulatory

courtship rituals in which males display behaviors to females

before mounting. Although different sensory modalities can

be involved in courtship (Gleason et al., 2012; Giglio and

Dyer, 2013), male wing vibration is often a central element

(Sturtevant, 1915; Spieth, 1952). Species-specific courtship

songs are produced by wing vibration of males (Ritchie and

Gleason, 1995), females receive such specific songs with

the funiculus and the arista in the distal antennae and the

Johnston’s organ in the pedicel antennae, and transduce

antennal modulations into neural signals to the central ner-

vous system (Gopfert and Robert, 2002). The antenna–

Johnston’s organ system shows species-specific active tun-

ing to spectral components of male song (Riabinina et al.,

2011). As early as the 1950s, the mating behavior of 101

Drosophila species was systematically investigated (Spieth,

1952). We further reviewed 135 species from 30 species-

groups according to available literature on Drosophila court-

ship and found a great diversity of courtship behavior in the

genus Drosophila (Wen and Li, 2011).

Drosophila melanogaster is the best-studied species. Its

elaborate courtship repertoire includes elements of orient-

ing, tapping, scissoring, circling, wing-vibrating, licking, and

attempting to copulate. During courtship, males and females

can send and/or receive visual, chemical, tactile and acous-

tic signals (Greenspan and Ferveur, 2000). Some of ele-

ments are common to most species in the genus Drosophila

(Greenspan and Ferveur, 2000), but the loss or gain of cer-

tain elements in courtship behavior is very common. About

74% of known species in the subgenus Drosophila do not

involve any element of wing display (scissoring, flicking,

waving, or rowing) which can serve as a visual stimulus, per-

haps at distance (Wen and Li, 2011). In the subgenus

Sophophora, only the montium subgroup and three species

of the saltans species group do not use wing displays (see

Table 1 in the review of Wen and Li, 2011). Very unusually,

the courtship of some species of the montium subgroup has

* Corresponding author. Tel. : +86-20-85280309;

Fax : +86-20-85280291;

E-mail: shywen@scau.edu.cn

doi:10.2108/zsj.30.1056

Courtship Patterns in the montium Subgroup 1057

been found not to include any of the precopulatory courtship

elements, such as tapping, licking, circling, wing display and

wing vibration before mounting, as seen in most Drosophila

species (Spieth and Hsu, 1950; Spieth, 1952; Tomaru and

Oguma, 1994; Hoikkala and Crossley, 2000; Li, 2011; Wen

et al., 2011). However, wing vibration occurs during copula-

tion in these species (Tomaru and Oguma, 1994; Hoikkala

and Crossley, 2000; Wen et al., 2011; Li et al., 2012).

The montium species-subgroup is the largest subgroup

of the melanogaster species group, comprising a total of 91

species from Asia and Africa (Lemeunier et al., 1986). Sev-

eral groups of very closely related species have been rec-

ognized as species complexes: auraria, bakoue, bocqueti,

jambulina, nikananu, serrata and kikkawai (Zhang et al.,

2003; Wen, 2004; DaLage et al., 2007). Courtship behavior

and species-specific courtship songs were also found to be

unique in the lini clade of the kikkawai species complex.

Three closely related species of the lini clade display copu-

latory courtship in which males vibrate wings after mounting,

and females use species-specific sine song to recognize

their mates during copulation (Wen et al., 2011; Li et al.,

2012). These appear to influence female preferences (Li et

al., 2012). Three species of the kikkawai clade also show

copulatory courtship (Li, 2011). Moreover, copulatory court-

ship is observed more often than precopulatory courtship in

D. serrata, D. birchii and species of

the auraria complex (Tomaru and

Oguma, 1994; Hoikkala and

Crossley, 2000).

In this study, we recorded videos

and songs and systematically ana-

lyzed elements of courtship behav-

ior and the wing vibration duration

of 29 species of the montium sub-

group. We focus on the timing of

wing vibration and tried to under-

stand the phylogenetic distribution of

copulatory courtship in the montium

subgroup. We used a phylogeny to

examine any evolutionary trends in

the distribution of precopulatory and

copulatory courtship.

MATERIALS AND METHODS

Flies

Most of the fly stocks were from

Ehime-Fly (NBRP) and UC San Diego

Drosophila Species Stock Center, and

D. pseudobaimaii was given by H.

Takamori (Tokyo Gakugei University).

Flies were maintained on cornmeal-malt

medium at 20°C under a 12:12 h light

cycle. Virgin flies were collected and

sexually separated without anesthesia

within 12 h of emergence. Male flies

were kept individually in vials (9.5 cm

height × 1.5 cm diameter) containing

culture medium to avoid male-male

courtship before the experiment, while

females were maintained in groups of

five in vials. The detail information of

stocks is shown in Table 1.

PCR amplification, sequencing and phylogenetic tree construc-

tion

Two mitochondrial loci (cytochrome oxidase subunits I, COI;

cytochrome oxidase subunits II, COII) and a nuclear locus (Alcohol

dehydrogenase; Adh) were used for construction of a phylogenetic

tree of the 29 species of the montium subgroup. DNA was extracted

from one or five females of each strain using DNAzol (Invitrogen)

following the supplier’s protocol. To amplify the full length of COI,

two primer sets were used: COI-F1 (ATCGCCTAAACTTCAGC-

CAC) and COI-M1(CCAGCGGGAGGAGGAGATCC), and COI-F2

(TCTATTGCACTAATCTG-CCA) and COI-M2 (CCTGATTCTT-

GTCTAATAATATG). The primers COII-a (ATATGGCAGATTAGTG-

CAA) and COII-b (TTGCTTTCAGTCATCTAATG) were used to

amplify a region of the mitochondrial COII from the start codon to

the position 645. ADH-1 (AACAAGAACGTGATTTTCGT) and ADH-

2 (TAGATGCCGGAGTCCCAGTG) were used to amplify part of the

Adh gene, which included truncated exon 1 to exon 3 (Chia et al.,

1985, Moses et al., 1985). Another primer set (TGATTTTCGTTGC-

CGGTCTGGGAGG and CAGGGTGCCCAAGTCCAGTTTCCAGA)

was used for amplification of the Adh gene in D. pseudobaimaii

(Goto et al., 2004), which was not amplified by the ADH-1 and ADH-

2 primers. PCR amplification was carried out with Taq DNA poly-

merase (Invitrogen) under standard conditions and cycle profiles as

recommended by the supplier. Amplified DNA products were diluted

to 1 ng/μl and used as sequencing templates after their sizes were

determined. We used the same primers for sequencing as that for

PCR amplification. All sequence reactions were performed with the

Table 1. Stocks used in this study and their accession numbers.

Species Strain code LocalityAccession number

COI COII Adh

D. auraria A662 Japan AB669696 AB243375 AB669826

D. triauraria T544 Japan AB669711 AB243399 AB669841

D. biauraria B16 Japan AB669697 AB243382 AB669827

D. subauraria ONM29 Japan AB669707 AB243396 AB669837

D. rufa rufa-OGM Japan AB669705 AB243394 AB669835

D. asahinai AM2K-1 Japan AB669693 AB243378 AB669823

D. lacteicornis IR96-1 Japan AB830535 AB243385 AB830534

D. tani tani-YF China AB669709 AB669770 AB669839

D. pectinifera OGS98m Japan AB669761 AB243389 AB669891

D. baimaii 14028-0481.00 Malaysia AB669750 AB669807 AB669880

D. pseudobaimaii K41 Malaysia AB669762 AB669818 AB669892

D. lini BG3146.1 Taiwan AB669737 AB669794 AB669867

D. ogumai RGN3 Myanmar AB669739 AB669796 AB669869

D. ohnishii MMY326 Myanmar AB669742 AB669799 AB669872

D. kikkawai NAHA1 Japan AB669734 AB669791 AB669864

D. leontia AO-2 Thailand AB669735 AB669792 AB669865

D. bocki IR2-37 Japan AB669730 AB669787 AB669860

D. serrata Q122 Philippines AB669749 AB669806 AB669879

D. birchii 14028-0521.00 Australia AB669745 AB669802 AB669875

D. mayri 14028-0591.00 Papua New Guinea AB669756 AB669813 AB669886

D. barbarae 14028-0491.01 Malaysia AB669727 AB669784 AB669857

D. truncata RGN179 Myanmar AB669764 AB669820 AB669894

D. seguyi K59 Kenya AB669716 AB669775 AB669846

D. vulcana 14028-0711.00 Zimbabwe AB669718 AB669777 AB669848

D. burlai L6 Kenya AB669719 AB669778 AB669849

D. diplacantha 14028-0586.00 Cameroon AB669732 AB669789 AB669862

D. nikananu 14028-0601.00 Ivory Coast AB669743 AB669800 AB669873

D. parvula SHL17 India AB669759 AB669816 AB669889

D. bunnanda 14028-0721.00 Australia AB669747 AB669804 AB669877

D. pseudoobscura 14011-0121.94 USA AB669765 AB669821 M60981

D. tsukubaensis tsuk-TKM Japan AB669766 AB669822 AB669895

C.-C. Chen et al.1058

BigDye Terminator Cycle Sequencing Kit (ABI) using an ABI PRISM

310 and 3130 Genetic Analyzer. PCR products of Adh in the three

species (D. ohnishii, D. bicornuta and D. pseudobaimaii) could not

be sequenced directly, and were cloned into the pCR2.0 vector

using the TOPO TA-cloning Kit (Invitrogen). DNA from several inde-

pendent clones was extracted using the QIAprep Mini Kit (QIAGEN).

Cloned DNA of Adh was sequenced in both the 5′ and 3′ orientations

using the standard primers T7 and M13 reverse. D. pseudoobscura

and D. tsukubaensis were used as outgroups.

Phylogenetic analysis of the sequence data was performed

using the MEGA5 software package (Tamura et al., 2011). COI,

COII and Adh sequences were aligned using the ClustalW program

(Thompson et al., 1994) included in MEGA5. Because of problems

aligning introns of Adh sequences, only exon regions of this gene

were used for constructing the phylogenetic tree. Combined aligned

sequences were used to construct phylogenetic trees using the

maximum-likelihood (ML) method. ML analyses were conducted

using MEGA5, and bootstrap values from ML method were obtained

after 1000 replications.

Video recording, song recording and data analysis

The video and song recordings were

done separately with different facilities.

The video recordings were used for ana-

lyzing courtship behavioral elements.

The song recordings were for the dura-

tion of wing vibration and the mounting

duration.

Reproductively mature 6–11 day

old virgin flies were used for video

recording of courtship behavior. For

each recording, one virgin male and one

virgin female were introduced into a mat-

ing cell (1 cm × 3.5 cm) under a Motic

Stereo Microscope equipped with a

microscope digital camera (OPLENIC,

Pro-MicroScan #5821) and linked to a

computer.

The courtship songs of 6–11 day-old

unanaesthetized virgin fly pairs were

recorded in an insulated anechoic room

from 0830 to 1530 at 23.2°C (lights on

0700–1900). The system comprised a

mating chamber (12 mm inside diameter,

2.5 mm internal height with acoustically

transparent nylon net floors) placed in an

Insectavox microphone which was con-

nected to a filter (EF5-04 LP/HP Filter) to

remove frequencies below 50 Hz and

above 700 Hz. A recorder with a sampling

frequency of 8 kHz was linked to one

channel of the software (DataView ver-

sion 8.6.1, http://www.st-andrews.ac.uk/

~wjh/dataview/). Digital song files were

subsequently analyzed for the duration

of wing vibration. We also observed the

courtship behavior and timed the mount-

ing duration when we recorded the court-

ship songs.

Mounting duration was determined

from the time the male first mounted to

the time the pair separated. For species

without copulatory courtship, the wing

vibration while a male was trying to

mount was included in the duration of

precopulatory wing vibration. On the

other hand, the wing vibration while a

male is trying to mount was included in the duration of copulatory

wing vibration for the species with copulatory courtship. Data were

analyzed with Microsoft Excel 2010.

RESULTS

Phylogenetic tree

Sequences of two mitochondrial genes and a nuclear

gene of the montium subgroup were submitted to DDBJ

and the accession numbers are shown in Table 1.

Sequences of three genes were combined to construct a

maximum-likelihood (ML) tree (Fig. 1). As Figure 1 shows,

the most basal species of the montium subgroup is D.

parvula, and other species then split into two branches, one

included D. pectinifera, D. baimaii, D. pseudobaimaii and

the auraria complex, the other included the kikkawai, the

serrata and the bokoue complexes and the remainder.

Courtship types

The categories and main elements of courtship behavior

Fig. 1. Phylogenetic tree and courtship types of the montium subgroup. Sequences of COI, COIIand Adh were combined to construct a maximum-likelihood (ML) tree by using MEGA5, bootstrap

values from ML method were obtained after 1000 replications. We superimposed the courtship types on the phylogenetic tree with different color. Green indicated the type P/C, in which flies display precopulatory courtship as often as copulatory courtship. Blue for the type P-/C, flies dis-play mainly copulatory courtship and sporadically precopulatory courtship. Black for the type C, flies show only copulatory courtship. Orange for the type C-, flies display sporadically copulatory courtship. *: Referred to Tomaru and Oguma (1994).

Courtship Patterns in the montium Subgroup 1059

of each type are shown in Table 2. Figure 2

illustrates the main features of courtship

types in the montium subgroup. Four types of

courtship behavior were categorized accord-

ing to the timing of wing vibration. All inves-

tigated species in the montium subgroup dis-

played copulatory courtship, but to a different

extent. Only a few species showed precopu-

latory courtship. Some species displayed

precopulatory courtship as often as that of

copulatory, such as D. parvula, D. nikananu

and D. biauraria. They were categorized as

type P/C. Some species, such as D. triauraria,

D. leontia, D. serrata, D. mayri, D. barbarae

and D. diplacantha, showed mainly copula-

tory courtship and sporadically precopulatory

courtship. Most individuals of these species

showed wing vibration after mounting, and a

few individuals of each species before

mounting, so these were categorized as

type P-/C. Most species in the montium sub-

group displayed only copulatory courtship,

never singing before mounting; this type of

courtship was categorized as type C. Three

species (D. rufa, D. asahinai, and D. burlai)

did not sing often either before mounting or

after mounting. The courtship types of the

montium subgroup are definitely different

from typical Drosophila precopulatory court-

ship.

Courtship duration

Wing vibration is the main courtship ele-

ment of the montium subgroup. Wing vibra-

tion before mounting has been recognized as

one of major precopulatory courtship ele-

ments, while wing vibration after mounting

and during copulation is a copulatory court-

ship behavior. Therefore, we timed wing

vibration before and after mounting respec-

tively and the mounting duration (Table 3).

The mounting duration is different among spe-

cies. However, it must have evolved rapidly,

as this is apparently unrelated to the phylo-

genetic position of the species. There are

large differences even among species in the

Table 2. Courtship types and the behavioral elements in the montium subgroup.

Type SpeciesBehavioral elements

Before mounting After mounting

P/C D. parvula, D. nikananu, D. biaurariaTapping/circling/(waving)/

(scissoring)/(licking)/wing vibrationWing vibration

P-/CD. triauraria, D. leontia, D. serrata, D. mayri, D. barbarae, D. diplacantha, D. montium*

wing vibration/(waving) Wing vibration

C

D. lacteicornis, D. tani, D. pectinifera, D. baimaii, D. pseudobaimaii, D. lini, D. ohnishii, D. ogumai, D. kikkawai, D. bocki, D. bunnanda, D. birchii, D. truncate, D. seguyi, D. vulcana

No Wing vibration

C- D. rufa, D. asahinai, D. burlai No Sporadically wing vibration

P: Most individuals displayed precopulatory courtship. P-: Precopulatory courtship was decreased, C: Most individuals displayed copula-tory courtship. C-: Copulatory courtship was decreased. (): indicated the element presents in some species but not in others. *: according to the description in Spieth (1952).

Fig. 2. Main poses of courtship types in the montium subgroup. Type P/C: flies display precopulatory (P) courtship as often as copulatory (C) courtship. Representative spe-cies: D. parvula. Type P-/C: flies display mainly copulatory courtship and, sporadically, precopulatory courtship. Representative species: D. serrata. Type C: flies show only copulatory courtship. Representative species: D. kikkawai, D. truncata. Type C-: flies

display sporadically copulatory courtship. Representative species: D. asahinai, D. burlai.

C.-C. Chen et al.1060

same clade of the species-complex, from 425.91 sec of D.

ogumai to 1319 sec of D. lini in the lini clade of the kikkawai

species complex (Table 3).

For species of type P/C, most individuals sang both pre-

copulatory and copulatory songs. 85.7–100% of individuals

displayed precopulatory courtship, and 80–100% showed

copulatory courtship. Drosophila nikananu and D. parvula

sang precopulatory songs (mean duration, 23.86 sec and

25.40 sec, respectively) more often than copulatory songs

(12.71 sec and 7.3 sec respectively). The reverse was true

for D. biauraria; this species sang more copulatory songs

(17.21 sec) and fewer precopulatory songs (6.5 sec).

For species of type P-/C, the number of individuals

which sang precopulatory songs was decreased. 18.2–50%

displayed precopulatory courtship, and 80–100% showed

copulatory courtship. All species, except D. serrata, sang

more copulatory courtship (16.59–68.25 sec) than precopu-

latory courtship (1.33–15.75 sec).

For species of type C, all investigated individuals sang

only copulatory songs. The duration of singing is from 11.17

sec of D. bunnanda in the serrata complex to 143.86 sec of

D. ohnishii in the kikkawai complex.

For species of type C-, 25–67% individuals sang very

brief copulatory songs, from 0.69 sec in 25% of D. asahinai

to 31.2 sec in 50% of D. burlai.

Courtship types on the phyloge-

netic tree

We superimpose the court-

ship types on the phylogenetic

tree with different colors (Fig. 1).

Green indicates the type P/C,

blue for the type P-/C, black for

the type C and orange for the type

C-. We see that copulatory court-

ship is predominant in the montium

subgroup. 13.8% of species are

type P/C, 24.1% of species are

type P-/C, 51.7% of species are

type C and 10.4% of species are

type C-. The most basal D. parvula

has courtship of the type P/C.

Two branches of montium sub-

group contained types P/C, P-/C,

C and C-. The species of type C

are found in each sub-branch. The

auraria species-complex in the

branch A contained all four types:

D. biauraria and D. subauraria

were type P/C, D. auraria and D.

triauraria were type P/-C, D. tani

and D. lactericornis were type C.

D. rufa and D. asahinai were

type C-. Other species-complexes

were type C except D. leontia in

the kikkawai species complex and

D. serrata in the serrata species-

complex. Hence song types con-

tinue to change rapidly within this

phylogenic group.

DISCUSSION

Drosophila courtship behavior has been well studied

since 1952 (Spieth, 1952). Recently, an overlooked courtship

element, quivering, was found with males of D. melanogaster

(Fabre et al., 2012). This quivering behavior plays a very

important role in causing females to stop walking. Moreover,

flies of three species of the D. virilis phylad and one species

of the D. montana phylad display prolonged touching or lick-

ing and shorter singing (Vedenina et al., 2013). Many ele-

ments of Drosophila courtship may be much more variable

than imagined.

Diversity of courtship behavior in the montium subgroup

The Drosophila montium species subgroup is a very

interesting subgroup containing many species complexes

(Zhang et al., 2003; Wen, 2004; DaLage et al., 2007). In this

study, we found that there is a large diversity of courtship

behavior but with copulatory courtship being most wide-

spread. We categorized the courtship behavior of all inves-

tigated species into four types according to the timing of the

wing vibration of the major courtship element, wing vibration

before mounting and wing vibration after mounting. We tried

to identify how many types of courtship are shown by spe-

Table 3. Duration of wing vibration and mounting in precopulatory and copulatory courtship.

Courtship

typeSpecies N

Duration of wing vibration (sec) Mounting duration

(sec)Precopulatory (n%) Copulatory (n%)

P/C

D. parvula 10 25.40 ± 28.90 (90) 7.30 ± 5.81 (80) 371.00 ± 108.85

D. nikananu 7 23.86 ± 9.37 (100) 12.71 ± 8.24 (100) 696.29 ± 250.05

D. biauraria 14 6.5 ± 6.32 (85.7) 17.21 ± 9.08 (100) 474.29 ± 130.85

P-/C

D. triauraria 15 1.33 ± 0.58 (20) 29.07 ± 16.28 (100) 407.8 ± 85.07

D. leontia 16 15.75 ± 9.50 (50) 68.25 ± 47.91 (100) 318.88 ± 125.76

D. serrata 14 22.75 ± 22.93 (28.5) 14.12 ± 8.70 (100) 303.64 ± 129.81

D. mayri 22 15.5 ± 23.69 (18.2) 16.59 ± 4.92 (100) 98.19 ± 15.43

D. barbarae 10 4.67 ± 3.06 (30) 20.00 ± 20.65 (80) 583.50 ± 321.58

D. diplacantha 21 8.57 ± 6.35 (33) 18.71 ± 8.43 (100) 487.19 ± 167.46

C

D. lacteicornis 11 0 (0) 16.18 ± 7.22 (100) 555.63 ± 157.56

D. tani 16 0 (0) 34.13 ± 16.67 (100) 1395.63 ± 288.81

D. pectinifera 10 0 (0) 31.80 ± 16.27 (100) 479.50 ± 181.88

D. baimaii 11 0 (0) 29.82 ± 14.18 (100) 409.64 ± 129.82

D. pseudobaimaii 9 0 (0) 59.56 ± 37.75 (100) 542.44 ± 166.38

D. lini 12 0 (0) 110.83 ± 66.56 (100) 1319.00 ± 511.27

D. ohnishii 14 0 (0) 143.86 ± 41.74 (100) 788.64 ± 213.97

D. ogumai 11 0 (0) 49.55 ± 19.47 (100) 425.91 ± 69.86

D. bocki 8 0 (0) 31.86 ± 33.92 (100) 182.14 ± 61.56

D. kikkawai 19 0 (0) 49.63 ± 28.60 (100) 309.53 ± 232.50

D. bunnanda 23 0 (0) 11.17 ± 6.04 (100) 278.65 ± 50.84

D. birchii 16 0 (0) 32.38 ± 19.11 (100) 249.44 ± 80.5

D. truncata 12 0 (0) 35.42 ± 16.06 (100) 193.25 ± 35.66

D. seguyi 17 0 (0) 62.35 ± 53.33 (100) 318.47 ± 133.21

D. vulcana 21 0 (0) 23.24 ± 9.96 (100) 445.24 ± 115.06

C-

D. rufa 15 0 (0) 3.33 ± 5.25 (67) 298.13 ± 61.56

D. burlai 10 0 (0) 31.2 ± 28.85 (50) 254.10 ± 80.55

D. asahinai 16 0 (0) 0.69 ± 1.99 (25) 380.44 ± 165.41

N: Number of investigated individuals. n%: Percentage of individuals showed wing vibration

among investigated individuals. P: Precopulatory courtship, 80–100% individuals displayed pre-

copulatory courtship. P-: Precopulatory courtship was decreased, about 18–50% individuals dis-

played precopulatory courtship. C: 80–100% individuals displayed copulatory courtship. C-:

Copulatory courtship was decreased, about 25–67% individuals displayed copulatory courtship.

Courtship Patterns in the montium Subgroup 1061

cies in the montium subgroup, and if any species displays

typical precopulatory courtship as that in D. melanogaster.

We found four types of courtship patterns with copulatory

courtship and gradually decreasing precopulatory courtship

in this subgroup. All species in the montium subgroup dis-

play copulatory courtship, and no species display only the

typical precopulatory courtship.

The parameters of courtship song have been well stud-

ied as characters influencing mate recognition in Drosophila

(Ritchie et al., 1999; Tomaru et al., 2004; Riabinina et al.,

2011). However, the timing of singing courtship song during

the courtship ritual has gained less attention. The courtship

types in the montium subgroup are diverse and rapidly

evolving; the timing of wing vibration is a crucial element of

the diversity of the courtship. It is therefore important to con-

sider whether the timing of songs is an important aspect of

the courtship behavior of Drosophila, and what the causes

and consequences of variation in this might be.

Loss or gain of precopulatory courtship in the montiumsubgroup

Mating in flight is thought to be the ancestral Dipteran

mating pattern in some primitive Dipteran species, such as

mosquitoes (Downes, 1969). In Drosophila, mating always

occurs on food substrates and male flies display postures

and movements before attempting to mount and copulate

(Spieth, 1952). In the subgenus Sophophora, most species

initiate courtship with tapping, and then follow with wing

displays and wing vibration, courtship elements known as

precopulatory courtship elements (Spieth, 1952). In the

montium subgroup, only three of the species investigated

frequently display both precopulatory courtship and copula-

tory courtship. Six investigated species sporadically showed

precopulatory courtship and mainly copulatory courtship. In

other words, among 29 species, only nine species had pre-

copulatory courtship. Which occurred first in the montium

subgroup, the loss of precopulatory courtship or the gain of

copulatory courtship?

Based on the phylogenetic tree in Fig. 1, the most basal

species of the montium subgroup, D. parvula, produced

more precopulatory songs than copulatory songs (Type P/C).

Within the montium subgroup, branch B has a species with

type P/C courtship, D. nikananu, which sang more songs

before mounting than after mounting, like D. parvula. Branch

A contains a species with type P/C courtship, D. biauraria,

which sang more copulatory songs than precopulatory

songs. In branch A, there are five, three and two species

with type C, type P-/C and type C- courtships, respectively.

There are ten, five and one species with type C, type P-/C

and type C- courtships, respectively in branch B. Such a

phylogenetic distribution of courtship types in the montium

subgroup suggests that the precopulatory courtship is fre-

quently being lost in each of branch. Interestingly, in species

with type P-/C, some individuals only display copulatory

courtship, for example, in D. serrata, 28.5% of individuals

sang before mounting (Table 3). As Hoikkala and Crossley

(2000) mentioned, males of this species retain the ability to

sing before mounting, but appear not to use it frequently.

This suggests that precopulatory courtship is being lost in

these species.

Why might P/C and type P-/C flies switch from precop-

ulatory courtship to copulatory courtship? What benefits

might be obtained from copulatory over precopulatory court-

ship? Males of many animals display copulatory courtship

and it may function to induce responses in female reproduc-

tive behavior and physiology, increasing sperm utilisation

(Eberhard, 1996; Peretti and Eberhard, 2010), or it could be

a form of extended mate guarding. Males of the spider

Physocyclus globosus perform copulatory courtship by

vibrating their abdomen to bias sperm dumping (Peretti and

Eberhard, 2010). If copulatory courtship is associated with

sperm competition, it might be used more often in species

which a female is mated with multiple males. Multiple mating

is widespread throughout Drosophila and may influence

many aspects of ejaculate evolution. It is unknown whether

there is generally higher re-mating or other unusual aspects

of sperm competition in the montium subgroup, though D.

serrata has unusually high levels of polyandry (Frentiu and

Chenoweth, 2008) and an EST library includes some semi-

nal accessory proteins (Frentiu et al., 2009). Further studies

of the mating system of this group are needed to evaluate

the causes and consequences of a switch from precopula-

tory to copulatory courtship.

ACKNOWLEDGMENTS

We deeply thank Professor Masanori J. Toda for the long-term

support of our work on the montium subgroup. We appreciate two

anonymous reviewers’ crucial suggestions for improving this paper.

This work is supported by NSFC to S. Y. W. (Grant no. 31372187)

and partially supported by JSPS to M. W. (Grant no. 21570096).

REFERENCES

Chia W, Savakis C, Karp R, Pelham H, Ashburner M (1985) Mutation

of the Adh gene of Drosophila melanogaster containing an

internal tandem duplication. J Mol Biol 186: 679–688

DaLage JL, Kergoat GJ, Maczkowiak F, Silvain JF, Cariou ML,

Lachaise D (2007) A phylogeny of Drosophilidae using the

Amyrel gene: questioning the Drosophila melanogaster speceis

group boundaries. J Zool Syst Evol Res 45: 47–63

Downes JA (1969) The swarming and mating flight of Diptera. Annu

Rev Entomol 14: 271–298

Eberhard WG (1996) Female control: sexual selection by cryptic

female choice. Princeton University Press, Princeton, NJ

Fabre CC, Hedwig B, Conduit G, Lawrence PA, Goodwin SF, Casal

J (2012) Substrate-borne vibratory communication during court-

ship in Drosophila melanogaster. Curr Biol 22: 2180–2185

Frentiu FD, Chenoweth SF (2008) Polyandry and paternity skew in

natural and experimental populations of Drosophila serrata. Mol

Ecol 17: 1589–1596

Frentiu FD, Adamski M, Mcgraw EA, Blows MW, Chenoweth SF

(2009) An expressed sequence tag (EST) library for Drosophila

serrata, a model system for sexual selection and climatic adap-

tation studies. BMC Genomics 10: 40

Giglio EM, Dyer KA (2013) Divergence of premating behaviors in the

closely related species Drosophila subquinaria and D. recens.

Ecol Evol 3: 365–374

Gleason JM, Pierce AA, Vezeau AL, Goodman SF (2012) Different

sensory modalities are required for successful courtship in two

species of Drosophila willistoni group. Anim Behav 83: 217–

227

Gopfert MC, Robert D (2002) The mechanical basis of Drosophila

audition. J Exp Biol 205: 1199–1208

Goto H, Inomata N, Szmidt AE, Yamazaki T (2004) Nucleotide vari-

ation of seven genes in Drosophila kikkawai. Genes Genet Syst

79: 19–26

C.-C. Chen et al.1062

Greenspan RJ, Ferveur JF (2000) Courtship in Drosophila. Annu

Rev Genet 34: 205–232

Hoikkala A, Crossley S (2000) Copulatory courtship in Drosophila

behavior and songs of D. birchii and D. serrata. J Insect Behav

13: 71–76

Lemeunier F, David JR, Tsacas L, Ashburner M (1986) The

melanogaster species group. In “The Genetics and Biology of

Drosophila” Ed by M Ashburner, HL Carson, J Thompson,

Academic Press, London and Orlando, pp 147–256

Li YF (2011) Role of sine song in Drosophila lini clade and its

genetic control. PhD thesis. South China Agriculture University

Li YF, Wen SY, Ritchie MG (2012) Copulatory song in three species

of the Drosophila montium subgroup extends copulation and

shows unusual genetic control. Anim Behav 83: 233–238

Moses K, Heberlein U, Ashburner M (1990) The Adh gene promot-

ers of Drosophila melanogaster and Drosophila orena are func-

tionally conserved and share features of sequence structure

and nuclease-protected sites. Mol Cell Biol 10: 539–548

Peretti AV, Eberhard WG (2010) Cryptic female choice via sperm

dumping favours male copulatory courtship in a spider. J Evol

Biol 23: 271–281

Riabinina O, Dai M, Duke T, Albert JT (2011) Active process medi-

ates species-specific tuning of Drosophila ears. Curr Biol 21:

658–664

Ritchie MG, Gleason JM (1995) Rapid evolution of courtship song

pattern in Drosophila willistoni sibling species. J Evol Biol 8:

463–479

Ritchie MG, Halsey EJ, Gleason JM (1999) Drosophila song as a

species-specific mating signal and the behavioural importance

of Kyriacou & Hall cycles in D. melanogaster song. Anim Behav

58: 649–657

Spieth HT (1952) Mating behaviour within the genus Drosophila

(Diptera). Bull Amer Mus Nat Hist 99: 401–474

Spieth HT, Hsu TC (1950) The influence of light on the mating

behavior of seven species of the Drosophila melanogaster spe-

cies group. Evolution 4: 316–325

Sturtevant AH (1915) Experiments on sex recognition and the prob-

lem of sexual selection in Drosophila. J Anim Behav 5: 351–366

Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S

(2011) MEGA5: molecular evolutionary genetics analysis using

maximum likelihood, evolutionary distance, and maximum par-

simony methods. Mol Biol Evol 28: 2731–2739

Thompson JD, Higgins DG, Gibson TJ (1994) ClustalW: improving

the sensitivity of progressive multiple sequence alignment

through sequence weighting, position-specific gap penalties

and weight matrix choice. Nucleic Acids Res 22: 4673–4680

Tomaru M, Oguma Y (1994) Differences in courtship song in the

species of the Drosophila auraria complex. Anim Behav 47:

133–140

Tomaru M, Yamada H, Oguma Y (2004) Female mate recognition

and sexual isolation depending on courtship song in Drosophila

sechellia and its siblings. Genes Genet Syst 79: 145–150

Vedenina VY, Ivanova TI, Lazebny OE (2013) Analysis of courtship

behavior in closely related species of Drosophila virilis group: a

new approach arises new questions. J Insect Behav 26: 402–

415

Wen SY (2004) Studies on the speciation of Drosophila lini and its

related species. PhD thesis. South China Agricultural University

Wen SY, Li YF (2011) An evolutionary view on courtship behavior of

Drosophila: from a comparative approach. Low Temp Sci 69:

87–100

Wen SY, Yamada H, Li YF, Kimura MT, Oguma Y, Sawamura K,

Toda MJ (2011) Copulatory courtship behavior and sine song

as a mate recognition cue in Drosophila lini and its sibling spe-

cies. Zool Sci 28: 469–475

Zhang Z, Inomata N, Cariou ML, Da LJ, Yamazaki T (2003) Phylogeny

and the evolution of the Amylase multigenes in the Drosophila

montium species subgroup. J Mol Evol 56: 121–30

(Received June 18, 2013 / Accepted July 26, 2013)