ORIGINAL ARTICLE

Co-overexpression of lmbW and metK led to increasedlincomycin A production and decreased byproductlincomycin B content in an industrial strain of StreptomyceslincolnensisA.-P. Pang1,2,3, L. Du1,2,3,*, C.-Y. Lin1,2,3, J. Qiao1,2,3 and G.-R. Zhao1,2,3

1 Key Laboratory of Systems Bioengineering, Ministry of Education, Tianjin, China

2 Department of Pharmaceutical Engineering, School of Chemical Engineering and Technology, Tianjin University, Tianjin, China

3 SynBio Research Platform, Collaborative Innovation Center of Chemical Science and Engineering (Tianjin), Tianjin, China

Keywords

lincomycin, lmbW, metabolic engineering,

methyltransferase, Streptomyces lincolnensis,

synthetic biology.

Correspondence

Guang-Rong Zhao, Key Laboratory of Systems

Bioengineering, Ministry of Education, Tianjin

300072, China.

E-mail: grzhao@tju.edu.cn

*Present address: Qingdao Institute of

Bioenergy and Bioprocess Technology,

Chinese Academy of Sciences, Qingdao,

266101, China

2015/0645: received 31 March 2015, revised

18 July 2015 and accepted 19 July 2015

doi:10.1111/jam.12919

Abstract

Aims: To improve lincomycin A production and decrease the content of

byproduct lincomycin B in an industrial lincomycin-producing strain.

Methods and Results: The in silico analysis indicated that LmbW could be

involved in propylproline biosynthesis of lincomyin A. In this study, we

constructed an lmbW deletion mutant and found that the mutant lost the

ability to produce lincomycin A, but increased the accumulation of lincomycin

B. The loss of lincomycin A production can be restored by complementing the

mutant with the expression of lmbW gene. When lmbW and metK (encoding

S-adenosylmethionine synthetase) was co-overexpressed, lincomycin A titre was

1744�6 mg l�1, a 35�83% improvement over the original strain. Meanwhile, the

content of lincomycin B was reduced to 4�41%, a remarkable decrease of

34�76%, compared to that of the original strain.

Conclusions: lmbW encodes a C-methyltransferase involved in the biosynthesis

of lincomycin A but not lincomycin B. Co-overexpression of lmbW and metK

improved lincomycin A production and decreased the content of lincomycin B.

Significance and Impact of the Study: The engineered Streptomyces lincolnensis

strain shows promising application in the fermentation production of

lincomycin A, which may help cut production costs and simplify downstream

separation processes.

Introduction

Lincomycin A and its semi-synthetic antibiotic clin-

damycin are used in clinical practice for the treatment of

infective diseases caused by Gram-positive bacteria, the

genera Staphylococcus and Streptococcus in particular (Spi-

zek and Rezanka 2004a). Lincomycin A and clindamycin

are also used as alternatives to penicillin and its deriva-

tives in the treatment of upper respiratory tract infections

for patients with an allergy against penicillin (Spizek and

Rezanka 2004a). Lincomycin A is a major product of the

actinomycete Streptomyces lincolnensis during the fermen-

tation process. In addition, lincomycin B is also produced

in the fermentation broth. From the structural point of

view, both lincomycin A and lincomycin B carry an iden-

tical methylthiolincosamide, but they are different in their

amino acid moieties, where lincomycin A has a propyl-

proline (PPL) moiety while lincomycin B has an ethyl-

proline (EPL) moiety (Fig. 1). Although a minor

difference is one methylene group in the side chain of the

proline moiety, lincomycin B exhibits only 25% of the

antibiotic activity when compared with lincomycin A

(Spizek and Rezanka 2004b). Due to its lower bioactivity

and higher toxicity, lincomycin B is considered as an

impurity in lincomycin products. When the content of

lincomycin B exceeds 5% in the lincomycin formulation,

it is not allowed to be used as medicine or active phar-

maceutical ingredient, according to the guidelines of

Journal of Applied Microbiology 119, 1064--1074 © 2015 The Society for Applied Microbiology1064

Journal of Applied Microbiology ISSN 1364-5072

China and United States pharmacopeias. Since the con-

tent of byproduct lincomycin B in S. lincolnensis fermen-

tation broth is usually 7–10%, complicated steps must be

taken to remove lincomycin B in downstream separation

and purification process. To date, significant works have

been done to optimize the fermentation process to

improve the production of lincomycin A. Glucose, phos-

phate and amino acids of fermentation medium influ-

enced the mycelial growth and lincomycin A production.

Among various vegetable oils investigated, olive oil as the

sole carbon source was the most suitable for producing

lincomycin A and the productivity of lincomycin A was

higher than that when starch medium was used (Choi

and Cho 2004). By strictly feeding phosphorus into the

fermentation system, an increase in lincomycin A produc-

tion was achieved (Li et al. 2007). Moreover, supplemen-

tation of selected amino acids was beneficial to the

fermentation titre of lincomycin A (Ye et al. 2009). How-

ever, few researches have been conducted on reduction of

the content of lincomycin B in the fermentation broth by

genetic engineering.

Lincomycin biosynthetic gene cluster has been cloned

and contains 26 open reading frames (ORF) with putative

biosynthetic or regulatory functions and three resistance

genes (Koberska et al. 2008). The biosynthesis of lin-

comycin A occurs via a biphasic pathway from L-tyrosine

and two sugars to PPL and lincosamide (LSM), respec-

tively (Fig. 2). Several metabolic steps were clarified by

enzymatic reactions and genetic mutations. LmbB2

hydroxylates L-tyrosine to 3,4-dihydroxyphenylalanine

(Neusser et al. 1998; Novotna et al. 2013), which is sub-

sequently converted to 3,4-dihydropyrrole-2-carboxylic

acid by LmbB1 (Neusser et al. 1998; Novotna et al. 2004;

Colabroy et al. 2008, 2014). Although depropyl butyl- or

pentyl-lincomycin is produced in lmbX deletion strain by

feeding butyl- or pentyl-proline (Ulanova et al. 2010),

the following enzymatic reactions leading to PPL forma-

tion have not been elucidated. LmbR catalyses the

formation of the C8 backbone of LSM using fructose 6-

phosphate or sedoheptulose 7-phosphate as the C3 donor

and ribose 5-phosphate as the C5 acceptor (Sasaki et al.

2012). The conversion of octulose-8-phosphate to GDP-

octose is catalysed by LmbN, LmbP, LmbK and LmbO

(Lin et al. 2014). The sulphur of lincomycin A is incor-

porated via metabolic coupling of ergothioneine and

mycothiol (Zhao et al. 2015). Acting as a carrier to tem-

plate the molecular assembly, ergothioneine is glycosy-

lated by LmbT via S-transfer of GDP-LSM, generating

ergothiol-LSM, which is condensed with PPL by LmbC,

LmbN and LmbD. Then ergothiol of N-demethyl-S-

demethyl lincomycin A is exchanged with mycothiol that

serves as the sulphur donor, catalysed by LmbV and

LmbE. After the modification of C-S bond cleavage and

S- and N-methylations, the final product of lincomycin A

is achieved.

Three methyltransferase-coding genes are found in the

lincomycin biosynthetic gene cluster (Peschke et al.

1995). They are predicted to be involved in the metabolic

pathway of lincomycin A, each specific for C-, S- and N-

methylation, respectively. Among them, LmbJ has been

demonstrated to be an N-methyltransferase and converts

N-demethyllincomycin A to lincomycin A using S-adeno-

sylmethionine (SAM) as a methyl donor (Najmanova

et al. 2013), while the methyltransfer specificities of

LmbG and LmbW remain unclear. The fact that little is

known about the gene encoding C-methylation function-

ality in PPL biosynthetic pathway has restricted the

efforts to improve lincomycin A production. In this

paper, we for the first time confirmed that lmbW encodes

a C-methyltransferase, which is involved in the PPL

biosynthesis of lincomycin A by genetic and metabolic

evidences. We then used a metabolic engineering

approach to improve production of lincomycin A and

decrease biosynthesis of lincomycin B (Fig. 2), in which a

Lincomycin A

Lincomycin B Tomaymycin

OH

OH

HO

HO

HO

HO

HN

HN

HN N

NH

NH

HN

NO2

NO2

H

NH

N

O OO

O

O

OO O

O

NOH

CI

N

N OH

OH

O

N

N

O

N

N

OH

OH

SCH3

CH3

OCH3

SCH3 H2NOC (H3C)2NOC

OCH3

H3C

O O O

O

N

N OH

CH3

CH3

NHCH3

OH

OH

N

N

O

O

O

O

Anthramycin Porothramycin Sibiromycin

Hormaomycin

Figure 1 Structures of lincomycin, pyrrolobenzodiazepines and hormaomycin. Shaded moieties indicate branched proline derivatives.

Journal of Applied Microbiology 119, 1064--1074 © 2015 The Society for Applied Microbiology 1065

A.-P. Pang et al. Improvement of lincomycin A production

metK gene encoding SAM synthetase was cloned and

overexpressed to enrich the methyl donor pool for

lincomycin A production. Finally, co-overexpression of

lmbW and metK enhanced the production of lincomycin

A and simultaneously decreased the content of byproduct

lincomycin B in the engineered S. lincolnensis.

Materials and methods

Strains, plasmids and culture conditions

Strains and plasmids used in this study are described in

Table 1. Primers used in this study are listed in Table 2.

The spores of the S. lincolnensis were cultivated at 30°Con the modified Gauze’s Medium No.1 (MGM 1, con-

taining 2% soluble starch, 0�5% soybean, 0�1% KNO3,

0�05% NaCl, 0�05% MgSO4, 0�05% K2HPO4, 0�001%FeSO4, 2% agar, pH 7�0) for 7 days. For shake flask fer-

mentation, the spores were inoculated into 25 ml of seed

medium (containing 2% soluble starch, 1% glucose, 1%

soybean, 3% cream corn, 0�15% (NH4)2SO4, 0�4%CaCO3, pH 7�1) in 250 ml flask at 30°C and

250 rev min�1 for 2 days. Then 2 ml of the seed culture

were transferred into 25 ml of fermentation medium

(10% glucose, 2% soybean, 0�15% cream corn, 0�8%NaNO3, 0�5% NaCl, 0�6% (NH4)2SO4, 0�03% K2HPO4,

0�8% CaCO3, pH 7�1) in 250 ml flask and cultivated at

30°C and 250 rev min�1 for 7 days. Appropriate antibi-

otics were added in the medium when needed.

Escherichia coli stains were cultivated in Luria Bertani

(LB) medium. DNA isolation and manipulation in E. coli

were carried out by standard protocols. The genomic

DNA of Streptomyces was isolated by Kirby mix proce-

dure (Kieser et al. 2000). Conjugation between E. coli

and Streptomyces was conducted as previously described

(Du et al. 2012).

Plasmid constructions for gene inactivation,

complementation and overexpression

k-Red recombination method (Gust et al. 2004) was used

to construct vectors pLCY010 and the lmbW deletion vec-

tor pAP01. The apramycin resistance gene acc(3)IV on

pUWL201apr was replaced with the hygromycin resis-

tance gene hyg to generate the vector pLCY010.

For inactivation of lmbW, the in-frame deletion was

performed to exclude possible polar effects on down-

stream gene expression. The experimental outline was

briefly shown in Fig. 3a. The PCR fragment, from the

upstream (�892 bp) to the downstream (+1007 bp) of

lmbW, was amplified from the genomic DNA of S. lincol-

nensis and ligated to cosmid, generating the vector

NH2

NH2

NH2

NH2

H3NH3N

NH

CH3

CH3HOOC

HOOC

COOH

LmbR LmbN, P, K, O

LmbC, N, D

LmbL, M, S, F, Z

GTP

HO

HO HOHO

HOHO

HO

OH

COPO32–

OH

OH

OH

OH

OH

OHOHOH

OH

OH

HO

HOO

O

OH

S

HN COOH

OH

O

O OO S N

N

N+

OGDP OGDP

LmbT

EGT

GDP-octose

HO

HO

HO

OHOH

HN NH

O

O

O

S

HO

HO

OH

OH

OH

HN

NHAc

Lincomycin A

C-S bond cleavage

S-, N-methylation

SAM

H3C

CH3

CH3

HN

COOHLmbV, E

MSH

N+

NH H

O SN

NO

HO

Octulose-8-phosphate

COOH

COOH

COOH

COOH

NH

PPL

H3C

H3C H3C

L-tyrosine

Ribose-5-P

Fructose-6-Por

sedoheptulose-7-P

LmbB2 LmbB1HO

OH

L-DOPA

OHHO

LmbX, LmbW, LmbA, LmbY

O

O

N N

N N

PermE* PermE*

S

Methionine

HONH2

SHATP+MetK

SAM

SAM

metK ImbW

Figure 2 Putative biosynthetic pathway of lincomycin A in Streptomyces lincolnensis and the metabolic engineering strategy for enhancement of

lincomycin A production. Filled arrows mark the supposed methylation reactions. -CH3 is shaded. SAM, S-adenosylmethionine; PPL, propylproline;

EGT, ergothioneine; MSH, mycothiol.

Journal of Applied Microbiology 119, 1064--1074 © 2015 The Society for Applied Microbiology1066

Improvement of lincomycin A production A.-P. Pang et al.

pCosW. The forward primer QW-F (Table 2) contained

first 39-bp homologous sequence of lmbW gene from

ATG, and the reverse primer QW-R (Table 2) contained

39-bp homologous sequence of lmbW gene from 879 to

917 bp. Using pIJ773 as template, the fragment acc(3)IV-

oriT with 39-bp homologous sequence at each terminus

was amplified by primers QW-F and QW-R, and trans-

formed into E. coli BW25113/pIJ790/pCosW. The 839-bp

coding sequence of lmbW gene on pCosW was replaced

with acc(3)IV-oriT, and the resulting vector pAP01 was

used to delete lmbW of the original strain SyBE2901.

For complementation of lmbW, a 1850 bp DNA frag-

ment containing the coding region of lmbW gene was

amplified and ligated to pLCY010, generating pAP02. To

overexpress lmbW, the coding region of lmbW was ampli-

fied and ligated to pUWL201apr, generating pAP04.

To clone metK of S. lincolnensis, degenerate primers

were designed according to fourteen metK sequences of

Streptomyces, which had high similarities (>87%, Fig. S1).

The forward primer MetK-F was designed from the start

codon and designated sequence as 50-ACGCAAGCTTGTGTCCCGTCGYCTSTTCAC-30 (the HindIII site is under-

lined). The reverse primer MetK-R was designed from

stop codon and designated sequence as 50-GCCGGAATTCTTACAGSCCCGCSGCC-30 (the EcoRI site is under-

lined). The gene metK was amplified by PCR from the

genomic DNA of S. lincolnensis and ligated to pUW-

L201apr, generating pAP05. The nucleotide sequence of

metK has been deposited in the NCBI database under the

accession number KP225159.

To co-overexpress lmbW and metK, the lmbW fragment

with promoter PermE* was amplified from pAP04 and

ligated to pAP05, generating pAP06. The expression of

lmbW and metK was driven from two separate promoters.

Construction of engineered Streptomyces lincolnensis

strains

The vectors were introduced into S. lincolnensis by inter-

generic conjugation from E. coli ET12567/pUZ8002, fol-

lowing the procedures described previously (Du et al.

2012). For overexpression, the recombinant vectors

pAP04, pAP05 and pAP06 were introduced into the orig-

inal strain SyBE2901 to generate the strains SyBE2921,

SyBE2922 and SyBE2924, respectively.

To obtain the in-frame lmbW deletion strain, the dou-

ble-crossover homologous recombination mutant was

selected for kanamycin sensitivity and apramycin resis-

tance after pAP01 transformation. The 839-bp coding

sequence of lmbW gene on the genome of the original

strain SyBE2901 was replaced with acc(3)IV-oriT, and 39-

bp sequence at 50-terminus from the start codon of lmbW

and 175-bp sequence at 30-terminus from the stop codon

of lmbW were left behind on the mutant genome of

S. lincolnensis, resulting the strain SyBE2905 with the in-

frame deletion of lmbW. The vector pAP02 was intro-

duced into the mutant strain SyBE2905 to generate the

complementation strain SyBE2918.

Analysis of lincomycin in fermentation broth

The fermentation broth was centrifuged at �7140 9 g

for 10 min after cultivation. The supernatant was

extracted with 1�5 volumes of methanol at �20°C for

Table 1 Strains and plasmids used in this study

Strain or plasmid Characteristics

Reference

or source

Strains

Escherichia coli

DH5a General cloning host Invitrogen

BW25113/pIJ790 Host for k-Red

recombination

Gust et al.

(2004)

ET12567/pUZ8002 Donor strain for

intergeneric

conjugation

Kieser et al.

(2000)

Streptomyces lincolnensis

SyBE2901 Original strain for high

lincomycin-producer,

derived from

ATCC25466

ATCC25466

SyBE2905 SyBE2901 ΔlmbW This study

SyBE2918 SyBE2905 with pAP02 This study

SyBE2921 SyBE2901 with pAP04 This study

SyBE2922 SyBE2901 with pAP05 This study

SyBE2924 SyBE2901 with pAP06 This study

Plasmids

pIJ773 Contains the aac(3)IV

and oriT fragment

Gust et al.

(2004)

pUWL201 Expression vector in

Streptomycetes,

ampr, tsrr, carrying

PermE* promoter

Doumith et al.

(2000)

pUWL201apr pUWL201 derivative,

ampr, tsrr, aprr, carrying

PermE* promoter

Du et al. (2012)

pLCY010 pUWL201 derivative,

ampr, tsrr, hygr, carrying

PermE* promoter

This study

pAP01 Cosmid derivative

for deletion

of lmbW

This study

pAP02 pLCY010 with

PermE* lmbW

This study

pAP04 pUWL201apr with

PermE* lmbW

This study

pAP05 pUWL201apr with

PermE* metK

This study

pAP06 pAP05 with PermE*

lmbW

This study

Journal of Applied Microbiology 119, 1064--1074 © 2015 The Society for Applied Microbiology 1067

A.-P. Pang et al. Improvement of lincomycin A production

30 min. The supernatant was freeze-dried for 24 h until

no flowed liquid. The sample was dissolved in methanol

and filtered through 0�22 lm of nylon membrane. The

concentration of lincomycin A and B was measured by

the high pressure liquid chromatography (HPLC) (Agi-

lent 1200; Agilent Technologies Co. Ltd, Beijing, China)

with 18 alkylsilane bonded silica (250 9 4�6 mm, 5 lm;

Agela Technology, Tianjin, China) as the stationary phase

Table 2 Primers used in this study

Primers Sequence (50–30) Description

DW-F GCCGGAATTCTCCCGCACGAGCACACTGTC Cloning of lmbW gene fragment

DW-R GCCGGAATTCAGCGTCCTGGACAACCTGC

QW-F ATGACAGCCGTTCGGCAAAGCCCGGAAATCATCGAACTCTGTAGGCTGGAGCTGCTTCG acc(3)IV and oriT gene fragment

QW-R GTGAGGACGTGGATGAGGAAGAAGTCGTCGTCGTTCTCCATTCCGGGGATCCGTCGACC

QW-F2 CCGCAACTACGGTGAACGAG Identification of ΔlmbW

QW-R2 TCAGGGCACATGGAGTCTCG

HW-F GCCCAAGCTTTGGCCGACGTTGTACGCC Complementation of lmbW

HW-R CCAGTCTAGATCCGCGTGGTTCAGGGCACA

GW-F GCCCGAATTCCTTCAGACGGACCGAGGTGCC Overexpression of lmbW

GW-R GCCGGGATCCTCCGCGTGGTTCAGGGCACA

MetK-F ACGCAAGCTTGTGTCCCGTCGYCTSTTCAC Overexpression of metK

MetK-R GCCGGAATTCTTACAGSCCCGCSGCC

Thirty-nine basepairs homologous sequences are in boldface, restriction sites are underlined.

aac(3)IV +oriT

kan

kan

lmbW

Mutant strainSyBE2905 genome

S. lincolnensis genome

Cosmid pAP01

Cosmid pCosWlmbV lmrB

lmbV lmrB

39-bp homologous overhangs

lmbW lmrBlmbV

aac(3)IV +oriT lmrBlmbV

Double crossover

aac(3)IV +oriT

0

200

400

600

800

1000

1200

1400

SyBE2901 SyBE2905 SyBE2918

Linc

omyc

in p

rodu

ctio

n (

mg

l–1 )

(a)

(b) (c)M

8000500030002000

1000750

500

250100

1 2

Figure 3 Deletion and complementation of

lmbW gene. (a) Schematic representation of

the in-frame deletion of lmbW. A 839 bp

region of lmbW was replaced by the 1424 bp

aac(3)IV-oriT gene through double crossover.

(b) Confirmation of the lmbW deletion strain

SyBE2905 through PCR amplification. A

1965 bp product (lane 2) using the mutant

SyBE2905 genomic DNA as a template,

instead of 1380 bp (lane 1) using the original

SyBE2901 genomic DNA as a template was

amplified using primers QW-F2 and QW-R2.

(c) lincomycin production in the fermentation

of the original strain SyBE2901, the lmbW

deletion strain SyBE2905, and the lmbW

complementation strain SyBE2918. (□)

Lincomycin A and (■) Lincomycin B.

Journal of Applied Microbiology 119, 1064--1074 © 2015 The Society for Applied Microbiology1068

Improvement of lincomycin A production A.-P. Pang et al.

(Du et al. 2012). Ammonium acetate solution

(0�005 mol l�1, pH 9�0): methanol (with the ratio of

5 : 5, v/v) was used as the mobile phase. The flow rate

was set at 1�0 ml min�1. The injection volume was 10 ll.Lincomycin was detected at 214 nm at 25°C. The titres

of lincomycin A and B were separately calculated using the

calibration curves of lincomycin A standard (National

Institute for the Control of Pharmaceutical and Biological

Products, Beijing, China) and lincomycin B standard (An-

hui Wanbei Pharmaceutical Co. Ltd., Anhui, China). The

content of lincomycin A or B was calculated as titre of lin-

comycin A or B/(total titres of lincomycin A and B).

The sample was subjected to liquid chromatography-

mass spectrometry (LC-MS) analysis on a LCQ Advan-

tage mass spectrometer (Thermo Fisher Scientific, Shang-

hai, China). The spray capillary voltage for the

electrospray ionization was set to 5�0 kV and the temper-

ature of the heated capillary was kept at 300°C. The flow

rates of sheath gas (nitrogen) and auxiliary gas (nitrogen)

were 35 and 5 units respectively. The mass spectrometer

was operated in negative-scan mode (m/z 350–850).

Results

In silico analysis of the putative function of lmbW in

lincomycin biosynthetic pathway

The lincomycin biosynthetic gene cluster has been charac-

terized (Peschke et al. 1995; Koberska et al. 2008); how-

ever, identification of the key gene responsible for

discriminating the biosynthesis of lincomycin A from that

of lincomycin B has not been fully completed. In silico

comparative analysis was first employed to explore the

relationship of chemical structures and gene functions

among lincomycin and the relevant antibiotics. As shown

in Fig. 1, lincomycin, pyrrolobenzodiazepines and hor-

maomycin from Actinomycetes, have proline derivative

moieties, which are originated from precursor L-tyrosine.

Among them, the major differences in proline derivative

moieties are the length of the side chains: lincomycin A,

anthramycin, sibiromycin, porothramycin and hor-

maomycin carry three-carbon side chain, while lincomycin

B and tomaymycin contain two-carbon side chain. The six

homologous genes involved in biosynthesis of proline

derivative moieties (Hu et al. 2007; Koberska et al. 2008;

Li et al. 2009a,b; Hofer et al. 2011; Najmanova et al. 2014)

were compared. As predicted, the gene encoding C-methyl-

transferase is absent in the biosynthetic cluster of proline

derivative moiety of tomaymycin, but present in those of

anthramycin, sibiromycin, porothramycin, hormaomycin

and lincomycin A. Sequences of these putative proteins

were then aligned by ClustalW2 (Fig. S2). The amino acid

sequences of Orf5, Por10, SibZ and HrmC are 78�0, 74�0,

60�7 and 54�9% identical to that of LmbW, respectively,

suggesting that they may be functional homologues. More-

over, all of these proteins contain the conserved signature

motif of SAM-dependent methyltransferases, DUGCGx

GQL (U is a hydrophobic residue; Kagan and Clarke

1994). The in silico analyses suggested that LmbW may be

a C-methyltransferase involved in PPL biosynthetic path-

way, which led to production of lincomycin A, rather than

that of lincomycin B.

Functionality of lmbW leading to formation of

lincomycin A, not lincomycin B

To ascertain the function of lmbW, the in-frame lmbW

deletion strain SyBE2905 was constructed (Fig. 3a) and

confirmed by PCR using primers QW-F2 and QW-R2

(Fig. 3b). The sequence of the desired PCR fragment was

further verified by DNA sequencing.

The fermentation was conducted and lincomycin pro-

duction in broth was evaluated by HPLC (Fig. 4). The

results showed that the original strain SyBE2901 pro-

duced a large amount of lincomycin A with a small

amount of lincomycin B (Figs 3c and 4c). However, the

lmbW deletion strain SyBE2905 completely lost the ability

to produce lincomycin A and concomitantly increased

the production of lincomycin B in the fermentation broth

(Figs 3c and 4d), suggesting that the inactivation of

lmbW completely blocked the production of lincomycin

A, and the intermediate metabolite went through the fol-

lowing enzymatic steps to synthesize lincomycin B.

The identities of lincomycin A and B were also con-

firmed by LC-MS analysis. The original strain produced

mainly lincomycin A, eluting at 21�75 min with the char-

acteristic (M+H)+ at m/z = 407�2 (Fig. 4f), consistent

with lincomycin A molecular formulas C18H34N2O6S. The

mutant strain SyBE2905 produced lincomycin B, eluting

at 11�57 min with the characteristic (M+H)+ at

m/z = 393�2 (Fig. 4g), consistent with lincomycin B

molecular formulas C17H32N2O6S.

The crucial role of lmbW on the biosynthesis of lin-

comycin A was further validated by complementation of

lmbW in the mutant strain. When lmbW gene was rein-

troduced into the lmbW deletion strain SyBE2905, the

productivity of lincomycin A was restored (Fig. 4e) and

lincomycin A became the major product with the titre of

1103�3 mg l�1, reaching 85�9% of the original level

(Fig. 3c).

Increased production of lincomycin A and decreased

content of lincomycin B by overexpressing lmbW

We proposed that the limitation of C-methylation of

metabolite in PPL biosynthetic pathway would be

Journal of Applied Microbiology 119, 1064--1074 © 2015 The Society for Applied Microbiology 1069

A.-P. Pang et al. Improvement of lincomycin A production

partially relieved by increasing the expression level of

lmbW. To confirm this hypothesis, the lmbW gene was

overexpressed to improve the titre of lincomycin A and

decrease the content of lincomycin B in engineering

S. lincolnensis. Promoters are important for target gene

expression in the secondary metabolite production of

engineered strains (Siegl et al. 2013). Constitutive pro-

moter PermE* has been demonstrated to drive high-level

expression of heterologous genes efficiently in Strepto-

myces. Therefore, we overexpressed lmbW with promoter

PermE* and constructed the strain SyBE2921. As shown in

Table 3, compared to the original strain, the titre of lin-

comycin A was increased by 16�74% and the titre of lin-

comycin B was decreased by 15�05% in the engineered

strain SyBE2921. As a result, the content of lincomycin B

was decreased to 5�01% in strain SyBE2921, a 25�89%decrement of the original level.

Further improving lincomycin A titre with reduced

lincomycin B content by co-overexpressing lmbW and

metK

Radioactive labelling experiments showed that three

methyl groups (C-CH3, N-CH3 and S-CH3) of lin-

comycin A originate from L-methionine (Argoudelis

et al. 1969). SAM, a cofactor in cellular metabolism, pro-

vides methyl group that is incorporated into N-demethyl-

lincomycin via methyltransfer catalysed by LmbJ,

resulting in formation of lincomycin A (Najmanova et al.

2013). Although the sequence similarities of LmbW,

LmbG and LmbJ are low (Fig. S3), the existence of con-

served core motifs (DUGxGxGxU, U is a hydrophobic

residue) of SAM-dependent methyltransferases in these

proteins implied that LmbW and LmbG shared biochem-

ically homologous functions as LmbJ and could use SAM

600100

0200 300 400 500 600 700 800 900 1000

200 300 400 500 600 700 800 900 1000

835·1

m/z

m/z

807·0808·0

408·2

407·2

393·2

394·2

%

100

0

%

mAU, at 214 nm

Lincomycin B

Lincomycin A

(a) (f)

(b)

(c)

(d)

(g)

(e)

600

600

600

600

10 15 20 25 min

Figure 4 HPLC-MS analysis of lincomycin production in the fermentation. (a) Standard lincomycin A. (b) Standard lincomycin B. (c) Lincomycin A

and lincomycin B produced by the original strain SyBE2901. (d) Lincomycin B produced by the lmbW deletion strain SyBE2905. (e) Lincomycins A

and B produced by the complementation strain SyBE2918. (f) Electrospray ionization (ESI) spectrum of lincomycin A eluting at 21�75 min from

(c). (g) ESI spectrum of lincomycin B eluting at 11�57 min from (d).

Journal of Applied Microbiology 119, 1064--1074 © 2015 The Society for Applied Microbiology1070

Improvement of lincomycin A production A.-P. Pang et al.

as methyl donor to form C-CH3 and S-CH3 groups of

lincomycin A. SAM synthetase, which is encoded by the

metK gene, converts L-methionine and ATP into SAM in

the primary metabolism. The strategy of increasing SAM

pool was previously used to improve the productions of

methyl-containing antibiotics (Huh et al. 2004). By over-

expressing metK, productions of doxorubicin (Yoon et al.

2006), nosiheptide (Zhang et al. 2008) and novobiocin

(Zhao et al. 2010) were enhanced both in the native pro-

ducers and in the heterologous hosts.

The native metK gene was obtained from the genome

of S. lincolnensis using homologous cloning. The full

length of metK gene of S. lincolnensis contains an ORF of

1209 bp encoding a protein of 402 amino acids, which

has high identity with other streptomycetes MetKs

(>90%) (Fig. S4). Thus, we constructed the metK overex-

pression strain SyBE2922. Fermentation analysis showed

that the titre of lincomycin A was increased by 15�60%,

and the content of lincomycin B was decreased by

11�09% in the strain SyBE2922 (Table 3), indicating that

overexpression of metK could promote the production of

lincomycin A.

A strategy of combinatorial engineering was used to

further improve lincomycin A production. lmbW and

metK driven by two separate promoters were co-overex-

pressed in the original strain to generate the strain

SyBE2924. The titre of lincomycin A was 1744�6 mg l�1,

a remarkable increase by 35�83% of the original level and

the content of lincomycin B reduced to 4�41% in the

engineered strain SyBE2924, which represented a signifi-

cant decrease of 34�76% of the original level (Table 3).

Discussions

The industrial strain of S. lincolnensis produces a mixture

of lincomycin A and B in the fermentation broth, of which

lincomycin B is a toxic byproduct. The structural difference

between lincomycin A and B implies the different biosyn-

thetic pathways of proline derivative moieties. It was pro-

posed that the C-methylation of two-carbon side chain of

proline derivative moiety would lead to PPL; otherwise

EPL would be produced (Brahme et al. 1984). However,

the C-C cleavage of 3,4-dihydropyrrole-2-carboxylic acid

has not been fully understood at genetic and biochemical

levels (Hofer et al. 2011). Furthermore, the lack of the can-

didate substrate prevents the in vitro enzymatic determina-

tion of the C-methyltransferase. More recently, several

natural products are found to contain proline derivative

moieties and their biosynthetic gene clusters have been

cloned (Hu et al. 2007; Li et al. 2009a,b; Hofer et al. 2011;

Najmanova et al. 2014), thus allowing to predict the C-

methyltransferase encoding gene in PPL biosynthetic path-

way. Bioinformatic analysis of the deduced genes suggests

that lmbW, not lmbG, would be the putative C-methyl-

transferase encoding gene involved in PPL biosynthesis,

which was demonstrated by the abolished production of

lincomycin A and the accumulation of lincomycin B in

lmbW deletion mutant strain (Fig. 3). The complementa-

tion of lmbW gene in the corresponding mutant strain fur-

ther confirmed the C-methylation function of LmbW in

PPL biosynthetic pathway.

Production of lincomycin A belongs to the secondary

metabolism of S. lincolnensis. As the biosynthesis of lin-

comycin A is connected with intricate biosynthetic path-

ways where the availability of precursors L-tyrosine and

SAM from the primary metabolism is limited, a mixture

of lincomycin A and B with the divergent bioactivities

is typically produced. Due to the highly structural simi-

larities of lincomycin A and B, an increasing amount of

byproduct lincomycin B in the fermentation broth

would make the downstream separation process more

complex, costly and environmentally harmful. It is

attractive to improve the production of lincomycin A

and decrease lincomycin B content at the fermentation

stage.

Several strategies have been developed to decrease or

eliminate byproducts in antibiotic production (Baltz

2011). Random mutation and high throughput screening

Table 3 Lincomycin production in engineered Streptomyces lincolnensis strains

Strain Overexpressed gene(s) TLA (mg l�1) TLB (mg l�1) CLB* (%) TILA† (%) CDLB‡ (%)

SyBE2901 None 1284�4 � 28�2 93�0 � 1�6 6�76SyBE2921 lmbW 1499�4 � 40�2 79�0 � 2�8 5�01 16�74 25�89SyBE2922 metK 1485�4 � 46�3 95�0 � 3�2 6�01 15�60 11�09SyBE2924 lmbW and metK 1744�6 � 40�0 80�6 � 1�0 4�41 35�83 34�76

TLA, Titre of lincomycin A; TLB, Titre of lincomycin B; CLB, Content of lincomycin B; TILA, Titre increase in lincomycin A; CDLB, Content decrease

in lincomycin B.

All fermentation experiments were performed in triplicate.

*Calculated as [titre of lincomycin B/(titre of lincomycin A + B)] 9 100.

†Calculated as [(titre of lincomycin A in the recombinant strain – that in SyBE2901)/titre of lincomycin A in SyBE2901] 9 100.

‡Calculated as [(content of lincomycin B in SyBE2901 – that in the recombinant strain)/content of lincomycin B in SyBE2901] 9 100.

Journal of Applied Microbiology 119, 1064--1074 © 2015 The Society for Applied Microbiology 1071

A.-P. Pang et al. Improvement of lincomycin A production

are often used to improve production and to eliminate

byproducts of the secondary metabolism (Adrio and

Demain 2006). For example, the aveC gene of avermectin

biosynthetic gene cluster plays an essential role in the

production of doramectin and byproduct CHC-B2. Using

error-prone PCR and semi-synthetic DNA shuffling, the

mutated and shuffled aveC variants showed a remarkable

reduction to the ratio of CHC-B2: doramectin and the

desired strains for doramectin production were achieved

(Stutzman-Engwall et al. 2003, 2005). In recent years,

rationally engineering secondary metabolism showed

potential in the application to strain improvement for

high production of antibiotics and reduction of byprod-

ucts (Zhuo et al. 2010). When expression of eryK and

eryG was designed at a ratio of 3 : 2 and re-enforced into

the erythromycin pathway of Saccharopolyspora erythraea,

byproducts erythromycin B and C were nearly completely

eliminated and accordingly the titre of erythromycin A

was elevated in engineered Saccharopolyspora erythraea

(Chen et al. 2008). The functional elucidation of lmbW

gene encoding a C-methyltransferase allowed us to

improve the production of lincomycin A. When lmbW

was overexpressed, the metabolic flux into PPL pathway

would be enhanced and that into EPL pathway would be

limited. As expected, an increase in lincomycin A produc-

tion was observed, accompanied by concomitant decrease

in lincomycin B content in strain SyBE2921 (Table 3).

Additionally, the substrate affinity of LmbC involved in

activation of PPL and EPL could also affect lincomycin

production. The Km value of LmbC for PPL was 21-fold

lower than that for EPL, suggesting that PPL is the suit-

able natural substrate (Kadlcik et al. 2013). It is possible

that higher substrate specificity of LmbC to PPL could

contribute to high production of lincomycin A and low

content of lincomycin B in the original strain.

Engineering the primary metabolism has been explored

to supply more precursors for production of the sec-

ondary metabolites in Streptomyces (Kern et al. 2007).

Limitation of SAM supply was observed in production of

different antibiotics (Zhang et al. 2008; Zhao et al. 2010).

Overexpression of the native metK in S. lincolnensis was

found to increase mainly the production of lincomycin

A, and to have less effect on the production of lin-

comycin B (Table 3). The increase in lincomycin A pro-

duction would be resulted from the increase in the

intracellular SAM concentration in S. lincolnensis during

the antibiotic production phase, which was demonstrated

in other antibiotic production by overexpression of SAM

synthetases (Zhao et al. 2010). Co-overexpression of

lmbW and metK in engineered strain SyBE2924 showed a

synergic effect on a significantly increased production of

lincomycin A and a remarkably decreased formation of

lincomycin B (Table 3), which was consistent with

that C-methylation reaction of proline derivative

moiety could be the bottleneck for production of lin-

comycin A.

Lincomycin B would be eliminated if C-methylation

activity of LmbW matched perfectly to the substrate

fluxes between formation of PPL and availability of

methyl donor supply. In addition to LmbW, engineering

LmbC for high selectivity and fast reaction rate towards

PPL could be another approach for improving lin-

comycin A production and reducing lincomycin B forma-

tion. When the enzymes of lincomycin A biosynthetic

pathway are fully characterized, application of the systems

metabolic engineering (Weber et al. 2015) and synthetic

biology (Medema et al. 2011) would eliminate lincomycin

B formation, and improve the production of lincomycin

A in the future research.

In conclusion, we determined that lmbW of lincomycin

biosynthetic gene cluster was the dominant gene respon-

sible for production of lincomycin A instead of lin-

comycin B by genetic and metabolite analyses. lmbW was

shown to encode a C-methyltransferase involved in PPL

biosynthesis of lincomycin A. Increasing the supply of

methyl donor via the primary biosynthesis of SAM was a

useful strategy for lincomycin A production. Through a

metabolic engineering effort, co-overexpression of lmbW

and metK in a engineered strain significantly enhanced

the titre of lincomycin A to 1744�6 mg l�1 and decreased

the content of lincomycin B to 4�41% in fermentation

broth, which would simplify the downstream separation

processes in the industrial production of lincomycin A.

Our results have a great value in future application for

industrial production of lincomycin A with reduced

byproduct lincomycin B.

Acknowledgements

This study was supported by the National Basic Research

Program of China (2012CB721105), the National High-

Tech R & D Program of China (2012AA02A701) and the

National Natural Science Foundation of China

(31370092). We thank Professors Jun-An Ma and Wei-

wen Zhang, and the reviewers for their kind suggestions

to the manuscript.

Conflict of Interest

The authors declare no conflict of interest.

References

Adrio, J.L. and Demain, A.L. (2006) Genetic improvement of

processes yielding microbial products. FEMS Microbiol Rev

30, 187–214.

Journal of Applied Microbiology 119, 1064--1074 © 2015 The Society for Applied Microbiology1072

Improvement of lincomycin A production A.-P. Pang et al.

Argoudelis, A.D., Eble, T.E., Fox, J.A. and Mason, D.J. (1969)

Studies on the biosynthesis of lincomycin. IV. The origin

of methyl groups. Biochemistry 8, 3408–3411.Baltz, R.H. (2011) Strain improvement in actinomycetes in the

postgenomic era. J Ind Microbiol Biotechnol 38, 657–666.Brahme, N.M., Gonzalez, J.E., Rolls, J.P., Hessler, E.J., Mizsak,

S. and Hurley, L.H. (1984) Biosynthesis of the

lincomycins. 1. Studies using stable isotopes on the

biosynthesis of the propyl- and ethyl-L-hygric acid

moieties of lincomycins A and B. J Am Chem Soc 106,

7873–7878.Chen, Y., Deng, W., Wu, J., Qian, J., Chu, J., Zhuang, Y.,

Zhang, S. and Liu, W. (2008) Genetic modulation of the

overexpression of tailoring genes eryK and eryG leading to

the improvement of erythromycin A purity and

production in Saccharopolyspora erythraea fermentation.

Appl Environ Microbiol 74, 1820–1828.Choi, D. and Cho, K. (2004) Effect of carbon source

consumption rate on lincomycin production from

Streptomyces lincolnensis. J Microbiol Biotechnol 14, 532–539.

Colabroy, K.L., Hackett, W.T., Markham, A.J., Rosenberg, J.,

Cohen, D.E. and Jacobson, A. (2008) Biochemical

characterization of L-DOPA 2,3-dioxygenase, a single-

domain type I extradiol dioxygenase from lincomycin

biosynthesis. Arch Biochem Biophys 479, 131–138.Colabroy, K.L., Smith, I.R., Vlahos, A.H.S., Markham, A.J. and

Jakubik, M.E. (2014) Defining a kinetic mechanism for L-

DOPA 2,3 dioxygenase, a single-domain type I extradiol

dioxygenase from Streptomyces lincolnensis. Biochim

Biophys Acta 1844, 607–614.Doumith, M., Weingarten, P., Wehmeier, U.F., Salah-Bey, K.,

Benhamou, B., Capdevila, C., Michel, J.M., Piepersberg,

W. et al. (2000) Analysis of genes involved in 6-

deoxyhexose biosynthesis and transfer in Saccharopolyspora

erythraea. Mol Genet Genomics 264, 477–485.Du, L., Liu, R.-H., Ying, L. and Zhao, G.-R. (2012) An

efficient intergeneric conjugation of DNA from Escherichia

coli to mycelia of the lincomycin-producer Streptomyces

lincolnensis. Int J Mol Sci 13, 4797–4806.Gust, B., Chandra, G., Jakimowicz, D., Yuqing, T., Bruton,

C.J. and Chater, K.F. (2004) k Red-mediated genetic

manipulation of antibiotic-producing Streptomyces. Adv

Appl Microbiol 54, 107–128.Hofer, I., Crusemann, M., Radzom, M., Geers, B., Flachshaar,

D., Cai, X., Zeeck, A. and Piel, J. (2011) Insights into the

biosynthesis of hormaomycin, an exceptionally complex

bacterial signaling metabolite. Chem Biol 18, 381–391.Hu, Y.F., Phelan, V., Ntai, I., Farnet, C.M., Zazopoulos, E. and

Bachmann, B.O. (2007) Benzodiazepine biosynthesis in

Streptomyces refuineus. Chem Biol 14, 691–701.Huh, J.H., Kim, D.J., Zhao, X.Q., Li, M., Jo, Y.Y., Yoon, T.M.,

Shin, S.K., Yong, J.H. et al. (2004) Widespread activation

of antibiotic biosynthesis by S-adenosylmethionine in

streptomycetes. FEMS Microbiol Lett 238, 439–447.

Kadlcik, S., Kucera, T., Chalupska, D., Gazak, R., Koberska,

M., Ulanova, D., Kopecky, J., Kutejova, E. et al. (2013)

Adaptation of an L-proline adenylation domain to use

4-propyl-L-proline in the evolution of lincosamide

biosynthesis. PLoS ONE 8, e84902.

Kagan, R.M. and Clarke, S. (1994) Widespread occurrence of

three sequence motifs in diverse S-adenosylmethionine-

dependent methyltransferases suggests a common

structure of these enzymes. Arch Biochem Bicphys 310,

417–427.Kern, A., Tilley, E., Hunter, I.S., Legisa, M. and Glieder, A.

(2007) Engineering primary metabolic pathways of

industrial microorganisms. J Biotechnol 129, 6–29.Kieser, T., Bibb, M.J., Buttner, M.J., Chater, K. and Hopwood,

D.A. (2000) Practical Streptomyces Genetics. Norwich, UK:

The John Innes Foundation.

Koberska, M., Kopecky, J., Olsovska, J., Jelinkova, M.,

Ulanova, D., Man, P., Flieger, M. and Janata, J. (2008)

Sequence analysis and heterologous expression of the

lincomycin biosynthetic cluster of the type strain

Streptomyces lincolnensis ATCC 25466. Folia Microbiol

(Praha) 53, 395–401.Li, X.-B., Zhao, G.-R., Zheng, H. and Yuan, Y.-J. (2007)

Improved industrial fermentation of lincomycin by

phosphorus feeding. Process Biochem 42, 662–668.Li, W., Khullar, A., Chou, S., Sacramo, A. and Gerratana, B.

(2009a) Biosynthesis of sibiromycin, a potent antitumor

antibiotic. Appl Environ Microbiol 75, 2869–2878.Li, W., Khullar, A., Chou, S., Sacramo, A. and Gerratana, B.

(2009b) Cloning and characterization of the biosynthetic

gene cluster for tomaymycin, an SJG-136 monomeric

analog. Appl Environ Microbiol 75, 2958–2963.Lin, C.I., Sasaki, E., Zhong, A. and Liu, H.W. (2014) In vitro

characterization of lmbK and lmbO: identification of

GDP-derythro-a-D-gluco-octose as a key intermediate in

lincomycin A biosynthesis. J Am Chem Soc 136, 906–909.Medema, M.H., Breitling, R. and Takano, E. (2011) Synthetic

biology in Streptomyces bacteria. Methods Enzymol 497,

485–502.Najmanova, L., Kutejova, E., Kadlec, J., Polan, M., Olsovska,

J., Benada, O., Novotna, J., Kamenik, Z. et al. (2013)

Characterization of N-demethyllincosamide

methyltransferases LmbJ and CcbJ. ChemBioChem 14,

2259–2262.Najmanova, L., Ulanova, D., Jelinkova, M., Kamenik, Z.,

Kettnerova, E., Koberska, M., Gazak, R., Radojevic, B.

et al. (2014) Sequence analysis of porothramycin

biosynthetic gene cluster. Folia Microbiol (Praha) 59,

543–552.Neusser, D., Schmidt, H., Spizek, J., Peschke, U., Kaschabeck,

S., Tichy, P. and Piepersberg, W. (1998) The genes lmbB1

and lmbB2 of Streptomyces lincolnensis encode enzymes

involved in the conversion of L-tyrosine to propylproline

during the biosynthesis of the antibiotic lincomycin A.

Arch Microbiol 169, 322–332.

Journal of Applied Microbiology 119, 1064--1074 © 2015 The Society for Applied Microbiology 1073

A.-P. Pang et al. Improvement of lincomycin A production

Novotna, J., Honzatko, A., Bednar, P., Janata, J., Spizek, J. and

Kopecky, J. (2004) L-3,4-Dihydroxyphenyl alanine-

extradiol cleavage is followed by intramolecular cyclization

in lincomycin biosynthesis. Eur J Biochem 271, 3678–3683.Novotna, J., Olsovska, J., Novak, P., Mojzes, P., Chaloupkova,

R., Kamenik, Z., Spizek, J., Kutejova, E. et al. (2013)

Lincomycin biosynthesis involves a tyrosine hydroxylating

heme protein of an unusual enzyme family. PLoS ONE 8,

e79974.

Peschke, U., Schmidt, H., Zhang, H.Z. and Piepersberg, W.

(1995) Molecular characterization of the lincomycin-

production gene cluster of Streptomyces lincolnensis 78-11.

Mol Microbiol 16, 1137–1156.Sasaki, E., Lin, C.I., Lin, K.Y. and Liu, H.W. (2012)

Construction of the octose 8-phosphate intermediate in

lincomycin A biosynthesis: characterization of the

reactions catalyzed by LmbR and LmbN. J Am Chem Soc

134, 17432–17435.Siegl, T., Tokovenko, B., Myronovskyi, M. and Luzhetskyy, A.

(2013) Design, construction and characterization of a

synthetic promoter library for fine-tuned gene expression

in actinomycetes. Metab Eng 19, 98–106.Spizek, J. and Rezanka, T. (2004a) Lincomycin, cultivation of

producing strains and biosynthesis. Appl Microbiol

Biotechnol 63, 510–519.Spizek, J. and Rezanka, T. (2004b) Lincomycin, clindamycin

and their applications. Appl Microbiol Biotechnol 64,

455–464.Stutzman-Engwall, K., Conlon, S., Fedechko, R., Kaczmarek,

F., McArthur, H., Krebber, A., Chen, Y., Minshull, J. et al.

(2003) Engineering the aveC gene to enhance the ratio of

doramectin to its CHC-B2 analogue produced in

Streptomyces avermitilis. Biotechnol Bioeng 82, 359–369.Stutzman-Engwall, K., Conlon, S., Fedechko, R., McArthur,

H., Pekrun, K., Chen, Y., Jenne, S., La, C. et al. (2005)

Semi-synthetic DNA shuffling of aveC leads to improved

industrial scale production of doramectin by Streptomyces

avermitilis. Metab Eng 7, 27–37.Ulanova, D., Novotna, J., Smutna, Y., Kamenik, Z., Gazak, R.,

Sulc, M., Sedmera, P., Kadlcik, S. et al. (2010)

Mutasynthesis of lincomycin derivatives with activity

against drug-resistant Staphylococci. Antimicrob Agents

Chemother 54, 927–930.Weber, T., Charusanti, P., Musiol-Kroll, E.M., Jiang, X., Tong,

Y., Kim, H.U. and Lee, S.Y. (2015) Metabolic engineering

of antibiotic factories: new tools for antibiotic production

in actinomycetes. Trends Biotechnol 33, 15–26.Ye, R., Wang, Q. and Zhou, X. (2009) Lincomycin, rational

selection of high producing strain and improved

fermentation by amino acids supplementation. Bioprocess

Biosyst Eng 32, 521–529.

Yoon, G.S., Ko, K.H., Kang, H.W., Suh, J.W., Kim, Y.S. and

Ryu, Y.W. (2006) Characterization of S-

adenosylmethionine synthetase from Streptomyces

avermitilis NRRL8165 and its effect on antibiotic

production. Enzyme Microb Tech 39, 466–473.Zhang, X., Fen, M., Shi, X., Bai, L. and Zhou, P. (2008)

Overexpression of yeast S-adenosylmethionine synthetase

metK in Streptomyces actuosus leads to increased

production of nosiheptide. Appl Microbiol Biotechnol 78,

991–995.Zhao, X.Q., Gust, B. and Heide, L. (2010) S-

adenosylmethionine (SAM) and antibiotic biosynthesis:

effect of external addition of SAM and of

overexpression of SAM biosynthesis genes on

novobiocin production in Streptomyces. Arch Microbiol

192, 289–297.Zhao, Q., Wang, M., Xu, D., Zhang, Q. and Liu, W. (2015)

Metabolic coupling of two small-molecule thiols

programs the biosynthesis of lincomycin A. Nature 518,

115–119.Zhuo, Y., Zhang, W., Chen, D., Gao, H., Tao, J., Liu, M.,

Gou, Z., Zhou, X. et al. (2010) Reverse biological

engineering of hrdB to enhance the production of

avermectins in an industrial strain of Streptomyces

avermitilis. Proc Natl Acad Sci USA 107,

11250–11254.

Supporting Information

Additional Supporting Information may be found in the

online version of this article:

Figure S1 Alignments of the nucleotide sequences of

selected metKs of Streptomyces. Identical nucleotides are

shaded in grey.

Figure S2 Alignments of amino acid sequences

of among LmbW, Orf5, Por10 and SibZ. Identical

amino acids are shaded in grey. The conserved motif

of S-adenosylmethionine-dependent methyltransferases is

boxed.

Figure S3 Alignments of amino acid sequences of

LmbJ, LmbG and LmbW from S. lincolnensis. The full

length of LmbJ and LmbG, and the partial length of

LmbW are aligned. Identical amino acids are shaded in

grey. The conserved motif of S-adenosylmethionine-de-

pendent methyltransferases is boxed.

Figure S4 Alignments of amino acid sequences of

selected MetKs from Streptomyces. Identical amino acids

are shaded in grey.

Journal of Applied Microbiology 119, 1064--1074 © 2015 The Society for Applied Microbiology1074

Improvement of lincomycin A production A.-P. Pang et al.

本文献由“学霸图书馆-文献云下载”收集自网络，仅供学习交流使用。

学霸图书馆（www.xuebalib.com）是一个“整合众多图书馆数据库资源，

提供一站式文献检索和下载服务”的24 小时在线不限IP

图书馆。

图书馆致力于便利、促进学习与科研，提供最强文献下载服务。

图书馆导航：

图书馆首页 文献云下载 图书馆入口 外文数据库大全 疑难文献辅助工具