CONSTRUCTION OF A RECOMBINANT vmus BETWEEN POLIOVIRUS AND COXSACKIE A VIRUS 11

Andi Utama l and Hiroyuki Shimizu2

IRe earch Center jor Biotechnology. Indonesian Institute afSciences, JDepartment of Viro logy II, National Institute ofInfecUolis Diseases, Tokyo, Japan

E-mail: andiutama2002@yahoo.com

AB TRACT

Recent outbreaks of circulati ng vacci ne-derived pol iovirus (cVDPV) revealed the poss ibil ity of recombination between vaccine strains poliovirus (PV) and cluster C cnteroviru . Ba ed on genetic analysis, it is a umed that cox ackie vi rus 11 (CAV- I I), one f the cluster enterovirus, may natura lly recombine with pv. To elucidate th i hypothes i , the chimeric virus between PJl56, a type I cVDPV iso late i.olated from an acute flaccid paralys is (AFP) case in the Ph il ippines in 2001 , and CAV- I I (PJI56/CAV- l l ) was constructed by using long-PCR method. As the resul t , PJl56/CAV-ll was viable in HEp-2 cell line. The PJl 56/CAV- II exhibited mostly imilar phenotype with parental PJl 56 in term of p laque size, vi ral growth and neuroviruJence. These results suggested that recombination between PV and AV-I J might naturally occur during transmission of vaccine strains in the community. The effect of recombination on the viral phenotype is significantly depending on the counterpart virus .

Key words: Polio irus. recombination. CAV-II

ABS RAK

Wabah polio yan cii ebabkan oleh virus keturunan galur a r in (circulating vaccine-derived poliovirus, cVDPV) yang terj adi belakangan io i memperlihatkan kemungkinan rekombinasi antara virus polio galur vaksin dengan virus entero klaster C. BeTdasarkan analisa geoetika, diperkirakan virus coxsackie A I I (CAV-II), salah s tu virus entero klaster C, berekomb i.nasi dengan virus polio secara alami . Untuk membukt ikan hipotesa in i. vi ms kimera antar PJ156, tipe 1 cVDPV yang diiso lasi dari pasien polio di Fil ipina tahun 200 I dan CAV-l I (PJl 561 CAV-I I) dikonstruksi secara artifisial dengan t knik long-P R. ebagai hasiLnya PJl56/CAV-Il bisa hidup dan berkembangbiak di dalam sel H p-2. Vims rekombinan PJl56/CAV-ll memiJiki karaktersitik yang mirip dengan PJl 56 dalam hal ukuran plague, kecepatan pertumbuhan, dan vimlensi. Ha il ini membuktikan bahwa rekombinasi antara virus polio dan CAV-I I bi a tcrjadi eeara alami pad a saat galur vaksin menyebar dalam lla tu komunitas. Efek rekombinasi terhadap karakter virus sangat ditentukan oleh vims lawan rekombinas i.

Kata kUDCi : Poliovims, rekombinasi , AY- ll

INTRODUCTJON

Immu nization with the oral poliovirus vaccine COPY) i the cornerstone of the World Health Organization's program for the global eradication ofpoliomyelitis. The attenuated OPV strain of the three polioviru serotypes (Sabin 1, 2, and 3) replicat in the gut 0 OPV recipients and can efficientl induce type-specific humoral and mucosal immunity (Sutter el al. , 2003).

However, replication of OPV in humans is frequently accompanied by genetic change ofthe vaccine virus, including reversion mutations (Minor and Dunn, 1988; Bouchard et al., 1995) and intertypic recombination among OPV strains (Cammack et al. 1988; Furi one et aI., 1993). The phenotypic reversion of the OPV strains to neurovirulence is the underlying mechanism for the rare cases of vaccine-associated paralytic pol iomyeli tis (VAPP) among OPV recipients or

Annales Bogorienses n.s. vol. 10 no. J. 2005 15

lheir close contact (Min r and Almond, 2002; Streb leI 01., 1992; Sutter 101.,2003) .

The large majority of OPV i olate. from healthy individual ,the environment, or patient with VAPP arc clo ely related to the original OPY train (Sabin-l ike), diverging by < 1.0% of nucleotide sequences encoding tbe major capsid protein VP 1 (Mat utlra ef al., 2000). The low nllcle tide sequence diversitie from the re pectivc OPY strains are consistent with the hort duration of mo t poliovirus infections

(Alexander e l al.. 1997) and the 11 ually re tricted pread of OPV viru (Benyesh­Melnick el aI., 1967). [n fact. no paralytic poliomyelitis outbreak associated with uch recombinant virtl es ha occurred up to now However, incident- of paralytic poliol yeliti outbreaks due to circulating VDP (cYDPY) w re r ported recen t ly ; respectively in Dominican Republic and Haiti (Kew I 01., 2002). the Philippines ( hiIlliLU et al., 2004) , Egypt (Yang 'al., 2003), and Madaga car (Rous et el al.. 2003) . Sequence analy, is showed that those cYDP Vs were recombinant viru e between PY and unidcntitit;d enteroviru that underwent the recombination in non -cap. id region. Although the signifi ance and mechanism of natural genetic recombination are not till bviou, four recombinant cYDPV outbreaks might uggest a biological role of the genetic recombination in poliovirus evolution. e pecially for the prolonged circulation of PY­related PY.

Detail mechanism of PV recombination i ' not wcll known. However, ba ed on the current knowledge, the recombination occurs by copy

hoice mechani m with homologous genome templates (Wimm r et a f. , 1993). Accordingly, PV prefers to recombine with viruse belong to clu. ter C enterovirus, which compo ed by PY and :,ome coxsackie A viruses (CAY , ) . Furthermore, PV i a sumed to only recombine with me pecific CAYs w hich genetically clo ely related to them rather than with all CAV . Recent st11dy demon trated that among AY ' within clu t r C entero irus. CAY- ll , CAV- 17, and CAY-20 have a high hom logy with PV (>95%) in between 2B and 3D region (Brown et 01., 2003). From the e results, it is suggested that PV mIght recombine with CAV- II. CAV-17 or CAV-20 in between 2B and 3D region. So

far, however. there is no direct e idence to prove this hypothesis. In tills study we arti fi cially constructed and haracterized the chi meric vim between PY and CAV- I!.

MATERIALS AND METHODS

Viral RNA extraction and con truction of chimeric eDNA

PJ156 isolate, isolated from an AFP ca e in the Phi lippin es in 2001 (Shimizu et al., 2004), and CA -\1 tored in our lab ratory were used as parental iru e . Yiral RNAs were extract~d

[rom freeze-thaw lysate finfected cells culture upematants using High Pure Viral RNA Ki t

(Roche, Gennany) . himeric cDNAs between PJ I56andCAY-J I wa con tmcted yl ngPCR method (F ig. I) (Dekker et al.. 2000; Morita et aI., 200 I) . The 5 and 3' end of the genome of both v iruses were eparately amplified by RT­PCR rea tion lIsing T itan One Tube RT-PCR System (Rocbe). The primers were de igned to produce fracrments contained a smal l overlapping sequence. The primers were as follow; P3A, 5' -GAGGCATGCTAATAC A CTCACTATAGGTTAAAACAGCTCTG .G- ' (the underline is T7 promoter); P4, 5' GGGA ATTCT TTTTTTTTTTTTTTTTTTTTT CTC

GAAITAAAG-3';A,S'-CCGC-CAAGGA A T A CTGG T AG AAGTTCACCGAGG

TGCA ACGC-3'; B. 5'- GCGTTGCACGC CTCGGTG ACTT CTTGAG CCAGCTATC TCCITG GCGG-3'. Twenty five cycles ofPCR reaction wa performed after 40 min of RT reaction. mplitied cDNA fragment were gel­purified with Wizard SY cl and P R lean­Up System (Promega, Madi on, U A) and oncentraled by ethanol precipitation. These

fragment were then fused to ea h other in aPR reaction using ExpandT\\ Long Template PCR Sy tern (Ro he, Germany) without primer to obtain a target ofchimeric full-length eDNA. The fusion product were further amplified in another PCR reaction with 5'- and 3 '-end primer by the same PCR kit.

RNA transcription and transfection Full- length chimeric cDNAs were tran­

scribed, and were mixed with J 00 III of 0.5 mgl ml DEAE dextran in 1 x HeB S buffer (" giL of HEPES,8 L ofNaCl, 0.36 giL ofKCI, 0.125

Annales Bogorien:;cs n.s. 01. J0 no. 1, 2005

gIL ofNa~HP04·2H_O . 10 giL ofdextro' ) (Lu numbers were calcu lated after incubation at el al., 1995). The transcript-DEAE dextran mix­ 35.0"C for another I day. ture wer pread over HEp-2 cells in 24-well One-step growth curve and temperatureplates. The ells were then rocked on a shaker sen itivity analyses for 30 min at room temperature. The mixtures were a pirated off, and the cells were incubated One-step growth curve experiments were

at 3S.0"C in Oulbecco' modi fled Eagle's m - conducted by inJecting monolayerofHEp-2 cells

dium (OMEM) supplemented wilh 2% bovine with viru at a mul tiplicity of infect ion (MOl)

calf serum (maintenance medium). Cytophatic of J0 CCID j () per cell ( himizu e l al., 2004). At

effe t ( PE) was obs rved un ti l 7 day. Recom­ different time post infection, the ce lls an d

binant viruses which showed CPE were ubse­ supematant were collected, frozen and thawed

quenlly infected to HEp-2 cells to continn the three limes, and centrifuged to remove cell

infectivity of the viru es. If CPE wa not ob­ debris . Virus titers in th upernatant we re

served, a three time's blind pas age was per­ determined by the end-point dilution method in

furmed to confirm that no vim recovered from HEp-2 monolayer cultures in 6-weLl plates at

the RNA transfect ion . 35.0°C. To test the temperature sensitivity, one­sL p growth experiments were carried out at

Plaque purification of the recombinant virus 35.0°C and 39SC, respectively.

/\11 recovered viruses were cloned by plaque as. ay on HEp-_ cells monolayer (Arita euroviJ"uJence test

I!t LlI.. 2005). Tenfold 'crial dilution uf viru. cs Groups ofeight (follr male and Cour female)

prepared in maintenance medium Were 5-week-old PV receptor-transgenic (TgPvr) mice

inoculated in HEp-2 ells at 6-well plate. and were inoculated intracerebrally with 30 f.ll \ iru.

incubated at 35.0°C for 30 min. The cells were (ShimiZU ef aI., 2004) . Tenfold dilution oC .. iru

covered wilh 2 1111 of O.5 CYcl Agarose-ME in were made in the maintenance medium. and each

DMEM with 5% bovine ca l f serum. After mouse recei ed approximately 101 to 10(d of1

InCUbat101l at 3S .0°C for 3 days. plates wen! CCID<o' Mice were observed for 14 days for

tained with 2 ml of 0 .5% neutral red in paraly 'is and/or death. The amount of virus that

maintenance medium contaim;d 0.5% Agaro e­ caused 50% paralysis andlor death do e (PO'II)

ME. Plaquc size was measured. and plaque " a ' calculat d.

~~t~~==~==~~==~~==~r " ' II' \:>--{=:~==='--t./====. " ::::::;.,II\ '

~~--------------~I

1 ,1 I ­I I

I J 'l.~ II, ... I I I

II

~ I '1 mt."1~ II PI, "l(. I \\ II

Figure J. Strategy lor construction )f chimeric virus P JJ 56/C AV- l l

Annale ' Bogorienses n.s. vo l. 10 no. I. 2005 17

RESULTS

Construction chimeric virus PJ156/CAV-11 Chimeric cDNA between PJ 156 and CAV­

I l (PJl56/CAV-l I) with crossover site in 2C­cod ing region (amino ac id no. 8 of 2C) was constructed. After RNA transfection to HEp-2 cells following by incubation at 35 .0QC, PJ 156/ CAV- ll showed CPE, implied that the vinas wa v iable . T hese results su ggested that recombination could occur between PJl56 and CAV- ll in 2C region. After plaque purification, DNA equence of VP I , 3D, and surrounding crossover site of the rec mb inant v iru were detenn ined. Sequence ana lysis showed that no mutat ion was found in VP I reg ion of PJ 156/ CAV- II (Table I). One mutation wa found in recombination site; however this mutation was silent mutation . Only one amino acid ubstitution

was fo und in 3D region ofPJ156/CAV-l j . None of these amino acid substitutions was cruc ial for viral g rowth, as we ll as for other phenotype including neurovi ruJence.

Plaque assay of recombinant PJ156/CAV-1 1 Plaque assay of recovered recomb inant

P1156/CAV- 11 viru along with par ntal PV such as Sabin I , Maboney, and P1I56 was performed to analyze the effect of recombinat ion on viral phenotype. As the result, the recombinant P 11 56/ CAV-l l expr sed similar plaque size (1 -5 mm) with parenta l PJ156, recombinant viru es PJl56/ Sab in 1 and PJ I 56/Mahoney (Fig. 2). The recombinant virus also showed similar virus titer with parental P J 156 and both P J 156/Sabin I and PJl56/Mahoney recombinant vi ruses ( 1.4 x IOH pfu/mJ) (Table J).

Table 1. Plaque phenotype and amino ac id sub tilution in some regions of each recombinant virus

Nucleotide mutation in Location of Plaque size Titer

Virus crossover site8 (pfu/ml)(mm) Crossover 30 b

site bVP1/1

PJ156 - -6.6 x108 -1-5 -

PJ156/Sab 1.5 x1 0828 (39) 1-5 1 (1) 0 (0) 2 (0) in 1

PJ156/Ma honey 28 (39) 1-5 1.4 x108 1 (0) 5 (2) 2 (0)

PJ156/CA­11 1-5 1 (0) 2C (8) 1.4 x 108 0 (0) 5 (1)

UNo. ill parenthesis describes no. of amino acid in each protein hNo. in parenthe j de eribes no . of amino acid substitution in entire VP J and 3D region . and 1.52 kb of surrounding eros over site, CNot detennined, dNot applicable

PJ I 56 PJl561SaMII J PJ 1561Mahoney PJI561 IW-J/

Figure 2. Plaque sizes of the parental and recombuJant viruses.

Annales Bogori cnses n.s. vol. 10 no. I. 2005 18

One-step growth of recombinant viruses One-s tep growth xperiment f th e

recombinant viruse along wi th parental PJ 156 virus at 35.0°C and 39.5°C wa conducted to identify the effect of recombination on viral growth and temperature sensitivity. PJ lS6/CAY­11 showed mostly imi lar growth compared parental PJ 156 both at 3S.0°C and 39.SoC (Fig. 3). 0 significant difference of growth between two different temperatures. Th se results implied that recombinant PJ156/CAY- ll was no t temperature ensitive.

Neurovirulence test To analyze the effect of recombination on

iral neurovirulence, groups of 8 PY receptor­expressed tran genic nli ce (TgPvr mice) were inrracerebrally inoculated with tbe recombinant virus. As shown in Table 2A, PI) 56/Mahoney

exhibited 50% paralysis andlor death do e (PDso) of 3.3 , wh ich mos tly simi lar with Mohaney strain. In another experiment, it wa shown that parental P J 156 possessed a similar PD valueso with Mahon y strain (Table 2B). The e results suggest that recombination of PJ156 with Mahoney did not cause any pathogenic cbange.

PJl56/Sabin 1 showed PD v lues of 4.8, so il ldicating lower neurovirulence than that of Mahoney train (Table 2A). The recomb inant PJl56/CAY- 11 showed a PD:;o of 5.3, which higher lhan that of PJ156/ abin 1 (Table 2A). These re ul ts ugge ted that recombination with CAY II make PI 156 become less neuroviruJence, even though if compar d with recombination with Sabin 1 (vaccine rain) . T he e results also suggested that the neurovirulence of recombinant viru es were detemlined by the counterparts ofrecombination.

If) o PJ156 35"C 2

C PJtSOfCAV· H . 35"C :> 102

• PJ l 56 395"C

• PJ156JCAV·17. 395°C

01------r-----+------~----4_-----r~

o 2 4 6 8 10 Time post infection (h)

Figure 3. One-, t p growth of lhe recombinant viru

Table 2. Neurovirulence of recombinant vimses on Tg-mou e

(A)

Virus Dose (log CCIOsofmouse) POsoc 7.28 6.28 5.28 4.28 3.28 2.28 1.28

Sabin 1 218 ' NOb NO NO NO NO NO >7.53

Mahoney NO NO NO 7/8 3/8 1/8 3.41

PJ156/CA­11

NO 8/8 4/8 0/8 0/8 0/8 ND 5.28

Annales Bogorienses n.s. vol. 10 no. J, 2005 19

(B)

Dose (log CCIDsoimouse) PDsoc

Virus 8.18 5.78 4.78 3.78 2.78 1.78 0.78

Sabin 1 5/8 .. NOb NO NO NO NO NO >8.06

PJ156 NO NO NO 5/8 0/8 0/8 0/8 3 .66

• o. of paralyzed r dead mice/no. of total mice. b Not determined, • POlV wa calcul ted by the Karber formula

DISCUSSION

Ana\y i of four independent incidents of paralyti c pol iomyelitis outbreaks due to circulating VDPVs (cVDPVs) in Dominican Republic and Haiti, Egypt, Philippines and Madaga car revealed that those cVDPVs were recombinant iru es between vaccin strains and non-polio enterovirus that underwent recombination in non-cap id region (Yang et a/., 2003; Rousset et al.. 2003; Shimizu el a/., 2004). However. the exact counterparts of recombination were not identified for those recombinant viruses. Because the recombination occur by copy choice mechanism with homol gous genome templates (Wimmer ef al., 1993) PV including vaccine strain prefer to recombine with viru es which belong to cluster C enterovims, which composed by PV and some coxsackie A viruses (CAV ).

The complete genom ic sequence data of most CAYs which belong to clu ter C enterovirus, which recenlly determined (Brown ef al., 2003), allows us to compare the homology between PVs. including cVDPVs, and tho e CAY . Similarity plot ha demonstrated that

AV-II have a high homology with cVDPV in between 28 and 3D regions. It is uggested that vaccine strain might recombine with CAV- II in between 2B and 3D regions; however, there

no direct evidence to prove this hypothesis. By using long PCR method, a recombinant virus between PV (cVDPV) and AV-I l was constructed. As the re ult, recombinant iru ' PJL56/CAV- l l was viable. Sequence analysis of resulted recombinant virus showed very few

mutation in VP I and 3D regions as well as surrounding cro over s ite, uggesti ng tha t

iability of viruse did not affected by those mutation . These re o ults also suggest that recomb ination can occur between PJ 156 and CAV-Il in this region in nature, consistent with the initial hypothe i . These are the fi rst direct e idence that confirm recombination between PV and CAV- Il.

No significant p laque ize d ifference betw en recombinant PJ l56/ CAV- Il and parental P J 156, and recombinants P J I 56/Sabin 1 and PJl 56/Mahoney as well (Table 1 & Fig. 2) . Likewise. the PJ156/CAV- 11 expre sed similar virus titer (Table 1) and vira l growth (Fig. 3) with PJl56 and recombinant vi ruses PJl561 Sabin 1 and PJ I 56/Mahoney.

The effect of re ombination counterpart sequences also can be seen in neurovirulent characteri tic . Recombinant P J I 56/Mahoney exhibited PD which wa mo tly similar with so Mohaney strain (Table 2B). This result sugge ted that recombination of PJ 156 with Mahoney did not cau e any pathogenic change. PJ156/Sabin 1 showed PD values of 4.6, indicating lower so neurovirulenee than that of Mahoney strain. Moreover, the PJl56/CAV- l l did showed PDsl! values of 5.3 . The e results ind icated that recombination with Sabin I, a well as with CAV- I I. made parenta l PJl56 become les neurovirulence. It was assumed that by recombining with other enteroviruses, VDPV may acquire the neurovirulence and transmission haracteristics s imilar with the wild type PY.

Annale Bogorien e n. . 01. 10 no. I, 2005

i

20

Since PJl56/CAV-1 1 did not expres ed extreme neurovirulence on TgPvr mice it is sugge ted that not al l recombination re u lts in acqui rement of wild type characteristics. However more studie need to be done in order to elucidate the contribution ofrecombination on PV phenotype.

ACKNOWLEDGEMENTS

This research was supported by the Japanese Society for Promotion of Sciences (JSPS) Postdoctoral gran to AU.

REFERENCES

Alexander J.P., J .... H.E. Gary, Jr. & M.A. PaUanscb. 1997. Duration of poliovirus excretion and its implications for acute flaccid paralysis urvei llance: a review of the literature. 1. Inject.

Dis. l75(Suppl. I ): S 176-S 182. Arita, M., H. himizu, N. Nagata, Y. Ami. Y. Suzaki,

T. Sata, T. Jwasaki & T Miyamura. 200 . Temperature-sensiti e mutant of enterovirus 71 hov attenuation in cynomolgu monkeys. 1. Gen. Viro/. 86: 1391 - 140 I .

Ben. e h-Melnick. M., J.L. Melnick, w.E. Rawls, I. Wimberley, J . Barrera- Oro, E. Ben-Porath & V. Rennick . 1967 . Studies on the immunogenicity, communicability, and genetic stability of' oral poliovaccLne admiDlslcred during the w inter. Am. 1. Epidemiol. 86: 112­136.

Bouchard, M.J., D.H. Lam & Y.R. Racaruello. 1995. Determinant of attenuation and temperature ensitiv ity in the type I poliovirus Sabin strain .

1. Viral. 69: 49 2-4978 . Brown, B., M.. Oberste, K . Maher & M.A.

Pallans h. 2003 . Complete genomic sequencing hows that poliov iru se and members of human enterovirus species C are closely related in th noncapsid coding region. J. Vim!. 77: 8973-8984.

Cammack, N., A. Phillips. G. Dunn, V Patel & P.O. M inor. 1988 . Intertypic genomic rearrangements of poliovirus s trains in vaccinees . Virology 167: 507-514.

Dekker, A., c.I-I. Leendert. e, . van Poelwijk, J.M.J . Rebel & R.J .M. Moormann. 2000. Chimeric swine ve icular disea e vi.ruses produced by fusion PCR: a new method for epitope mapping. 1. Viml. Melhvds 86: IJ 1- 14 1.

Furione, M., S. Guillot. D. Ote l a, J . Baianant, A. Candrea & R. ra inic. 1993. Polio iruscs with

natural recombinant genomes isol ted fTOm vaccine-associated para lytic poliomyel itis. Virolo~ 196: 199-208.

Kew, 0., V Morris-Glasgow, M. Landaverde, C. Burns, J . haw, Z. G r ib, J . An dre, E. Blackman, C.J. Freeman, J. l orba R. Sutter, G Tambini , L. VenczeL. C. Pedreira F. Laender, H. Shimizu T. Yoneyama, T. Miyamura, H. van Der Avoort, M.S. Oberste, D. Kilpatri 'k, S.

och i, M. Pallansch & C. de Quadros. 2002 . Outbreak of poliomyel it is in H ispan iola as ociated with c irculat ing type I vaccine­derived poliovirus. Sdence 296: 356-359.

Lu, H.H., L. Alexander & E. Wimmer. 1995 . Construction and genetic analy is ofdicistronic polioviru es containing open reading frames for epitopes of human immunodeficiency virus type 1 gp 120. J. Viral 69: 4797~806 .

Matsuura, K., M. Ishilrura. H. Yoshida, T. Nakayama, S. Hasegawa, . Ando, H. Horie, T. Miyamura & T. Kitamura. 2000. A e ment ofpoliovirus eradication in Japan: genom ic ana lysis of pol ioviru es i o lated from ri ver water and sewage in toyama prefecture. App/. Environ. Microbiol. 6: 5087-509 [.

Minor, P.D. & G Dunn. 1988. The effect of cquence in the 5 noncoding region on tbe replication ofpo li o~iruses in the human gut. J. Gen. Vim!. 69: 1091-1096.

Mino.., P.O. & J .W. Almond. 2002. Poliovirus vaccines: mol cu lar bio logy and immune response, p. 381-390. III B. 1. Semler and E. Wimmer (ed.), Molecular bio logy of picomaviruses. ASM Press, Washington, D.C.

Morita, K., M. Tadano, . akaji. K. Ko ai, E.G.M. Mathenge. B.D. Pandey, F. Hasebe, S. Inoue & A. Igarashi . 200 ). Locus of a virus neutralization pi tope on the Japanese encephaliti virus envelope protein determined by use of long PCR-ba, ed region- pecific random mutagenesis. Virology 287: 4 17-426.

Rou set, D., M . Rakoto-A nd ri an arivelo , R. Razafindratsimandresy, B.Randriamanalina, S. Guillot. l . Balanant , P. Maucle 're & F. Delpeyroux . 2003 . Recombinan t vaccinc ­derived poliovirus in Madagascar. Emerg. infect. Dis. 9: 885- 887 .

Sbimizu, H., B. 111Orley, F.J. Paladin. K.A. Brussen, V. Stambos, 1. Yucn, A. Utama, Y. Tano M. Arita. H. Yoshida, T. Yoneyarna, A. Benegas, S. Roe el. M . Pallan eh , .M. Kew & T. Miyamura. 2004. Circulation oftype 1 vaccine­derived poliovirus in th Philippines in 200 1. 1. Vird. 78 : 13512- 13521.

Annale Bogoriense. n . . vol. 10 no. I, 2005 2J

trebel P.M., R.W Sutter, S.L. Cochi, R.J. Biell ik, E.W Brink, O.M. Kew M.A. Pa llansch, WA. Orenstein & A .R. Hinma n. 1992 . Epidemi logy of poliomyelitis in the Uni ted States one decade after th last reported case of indigenou w ild v irus-associat d d i ease. Clin. In ec;l . Dis. 14: 56R- 579.

utter, R.W., O.M . Kew & S.L. Cochi . 2003. Poliovirus accine-Iive, p. 65 1·- 705 . In S. A. Plotkin and W. A. Orenstein (cd.), Vaccines, 4th ed. W B. Saunders C mpan • Philaddphia, Pa.

Wimmer: E., C.U.T. Hellen & X. Cao. 1993 . Oen ti C.! of poliovirus. Anml . Rev. Gen 1. 27 : 353-436.

Yang, C.-F. T. Naguib, S.-J. Yang, E. asr J. Jorba, N. Ahmed, R. Campagnoli. H. van d r Avoort, H. Shimizu, T. Yoneyama. T. Miyamura, M.A. Pallansch & O. Kew. 2003. C ircula tion of endemic type 2 vacc in -derived polio irus in Egypt. 1983 to 1993. J Viro t.77 :836 377 .

Annales Bogorieose. n.s. vol. 10 no. I, 2005 22