Research ArticleComparison of DNA Extraction Protocols andMolecular Targets to Diagnose Tuberculous Meningitis

Flavia Silva Palomo12 Martha Gabriela Celle Rivero1

Milene Gonccedilalves Quiles1 Fernando Pereira Pinto2

Antonia Maria de Oliveira Machado2 and Antonio Carlos Campos Pignatari1

1Special Clinical Microbiology Laboratory (LEMC) Federal University of Sao Paulo (UNIFESP) Sao Paulo SP Brazil2Central Laboratory of Sao Paulo Hospital Federal University of Sao Paulo (UNIFESP) Sao Paulo SP Brazil

Correspondence should be addressed to Flavia Silva Palomo fla_biohotmailcom

Received 18 January 2017 Revised 22 March 2017 Accepted 27 April 2017 Published 30 May 2017

Academic Editor Carlo Garzelli

Copyright copy 2017 Flavia Silva Palomo et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

Tuberculous meningitis (TBM) is a severe form of extrapulmonary tuberculosis The aims of this study were to evaluate in-housemolecular diagnostic protocols of DNA extraction directly from CSF samples and the targets amplified by qPCR as an accurateand fast diagnosis of TBM One hundred CSF samples from 68 patients suspected of TBM were studied Four DNA extractiontechniques (phenol-chloroform-thiocyanate guanidine silica thiocyanate guanidine resin and resin with ethanol) were comparedandCSF sampleswere used to determine the best target (IS6110MPB64 and hsp65 KDa) by qPCRThe extraction protocol using thephenol-chloroform-thiocyanate guanidine showed the best results in terms of quantification and sensitivity of PCR amplificationpresenting up to 10 times more DNA than the second best protocol the silica guanidine thiocyanate The target that showed thebest result for TBM diagnosis was the IS6110 This target showed 91 sensitivity and 97 specificity when we analyzed the resultsby sample and showed 100 sensitivity and 98 specificity when we analyzed the results by patient The DNA extraction withphenol-chloroform-thiocyanate guanidine followed by IS6110 target amplification has been shown to be suitable for diagnosis ofTBM in our clinical setting

1 Background

Tuberculosis is a serious infectious contagious disease thatusually affects the lungs but can also affect other organs suchas kidney bone and central nervous system (CNS) [1] In2011 cases of extra pulmonary tuberculosis in Brazil reachedalmost 16 of all cases of the disease [2] and about 63 ofthese (13 of the total) were TBM [3]

The TBM is the most severe form of extra pulmonarytuberculosis that has a high morbidity and mortality [45] The definitive diagnosis of TBM depends on the Mtuberculosis agent detection from cerebrospinal fluid (CSF)Routinely the survey ofM tuberculosis in CSF is carried outby conventional microbiological methods including Ziehl-Neelsen smear which has low sensitivity (0ndash20) and cul-ture which requires until 65 days to final result [1 6]

The sensibility for detection of M tuberculosis in CSFsamples can be substantially increased from 70 to 100and the time required to release laboratory results can besignificantly decreased with the use molecular methodsincluding the polymerase chain reaction (PCR) The rapididentification of TBM through molecular analysis of CSFis an important factor for proper and early institution ofantimicrobial treatment [7ndash9]

The aims of this study were to evaluate in-house molecu-lar diagnostic protocols of DNA extraction directly fromCSFsamples and the targets amplified by qPCR as an accurate andfast diagnosis of TBM

2 Methods

21 Clinical CSF Samples We utilized the CSF samples sentfor mycobacteria culture at the Central Laboratory of Sao

HindawiTuberculosis Research and TreatmentVolume 2017 Article ID 5089046 6 pageshttpsdoiorg10115520175089046

2 Tuberculosis Research and Treatment

Table 1 Real time PCR targets primers

Target Primer Sequence (51015840-31015840) Product Reference

IS6110 IS-Fw CGTGAGGGCATCGAGGTGGC 245 bp [9]IS-Rv CGCTAGGCGTCGGTGACAAA

Hsp 65KDa hsp65-Fw GAGATCGAGCTGGAGGATCC 383 bp [7]hsp65-Rv AGCTGCAGCCCAAAGGTGTT

MPB64 MPB64-Fw TCCGCTGCCAGTCGTCTTCC 240 bp [7]MPB64-Rv GTCCTCGCAGTCTAGGCCA

Note Fw forward Rv reverse bp base pairs of nucleotidis

Paulo Hospital Federal University of Sao PauloUNIFESPBrazil in the period from January 2011 to June 2014 Aliquotswere frozen at minus20∘C and submitted to molecular testsafter being thawed and centrifuged These samples werealso subjected to biochemical and cytological analysis anddetermination of adenosine deaminase (ADA) levels

The samples were classified as true positive and negativeafter a survey in the database ldquoBrazilianTBwebrdquo other labo-ratory CSF data and evaluation of medical records

22 Microbiological Diagnostic of CSF Samples The micro-bial diagnosis of CSF samples was made in the CentralLaboratory of Sao Paulo Hospital Federal University ofSao PauloUNIFESP Brazil For each CSF a Ziehl-Neelsensmear andmycobacterium culture in Lowenstein Jensen solidmedium were done

23 DNA Extraction Protocols Four extraction methodswere analyzed phenol-chloroform with guanidine thio-cyanate (Brazol LabTrade Brazil) silica-guanidine plusthiocyanate plus guanidine thiocyanate (QIAmpDNAMiniKit Qiagen USA) resin (Chelex 100 resin BioRad USA)and resin precipitated with ethanol

Comparison of extraction was determined by a serial 10-fold dilutions prepared in four different diluents (ultrapurewater turbid xanthochromic and hemorrhagic CSF poolsknown negative for TBM) from a 05 McFarland (15 times108 CFUmL) suspension ofM tuberculosis ATCC 25177

The extracted DNA was measured and analyzed byNanoVue ND-100 (Thermo Fisher Scientific WilmingtonUSA) and the amplification sensitivity was determined byIS6110 target The DNA extraction protocol presenting thebest results was chosen for target and clinical samplesanalysis

Phenol-Chloroform-Thiocyanate Guanidine (Brazol Lab-Trade Brazil) DNA Extraction An aliquot of 200 120583L CSFsample sedimentwas added to amicrotube containing 500120583Lof Brazol and mixture Then ice-cold chloroform (300 120583L)was added The mixture was homogenized and centrifugedat 12000 rpm for 15 minutes at 8∘C The supernatant wasremoved and transferred to another microtube containing500 120583L of cold absolute ethanol The mixture was stirred for3ndash5 seconds by vortexing and centrifuged at 12000 rpm for 15minutes at 8∘CThe supernatant was removed and the ldquopelletrdquowas washed with 500 120583L of ice-cold ethanol and centrifuged

at 12000 rpm for 15 minutes at 8∘C The supernatant wascarefully removed and discarded The ldquopelletrdquo was incubatedat room temperature to dryness and then dissolved in 30 120583Lof ultrapure water (Invitrogen Life Technologies USA) andallowed to dissolve at 65∘C for 30 minutes The samples werefrozen at minus20∘C when not used immediately

Silica-Guanidine Thiocyanate (QIAamp DNA Mini Kit Qia-gen USA) DNA Extraction The protocol recommended bythe manufacturer was used with 200 120583L of the CSF sediment

Resin (Resin Chelex100 BioRad USA) DNA Extraction A200120583L aliquot of the CSF sample pellet was placed in 300 120583Lof a 10 solution Chelex This mixture was homogenized invortex for 10 seconds centrifuged quickly to remove excessfluid from the cover and incubated at 95∘C for 30 minutesin a heat block The tube was homogenized for 15 sec andcentrifuged for 5 minutes at 13000 rpm The supernatantcontaining the extracted DNA was transferred to a new tubeWhen not used immediately the sample was frozen at minus20∘C

Resin Precipitated with Ethanol (Chelex100 Resin BioRadUSA) DNA Extraction A 200 120583L aliquot of the CSF pelletwas placed in 300 120583L of 10 solution Chelex This mixturewas homogenized in vortex for 10 seconds and centrifugedquickly to remove excess fluid from the cover This mixturewas incubated at 95∘C for 30minutes in a heat blockThe tubewas homogenized for 15 sec and centrifuged for 5 minutes at13000 rpm The supernatant containing the extracted DNAwas transferred to a new tube and 500120583L of cold absoluteethanol was added The mixture was stirred for 3ndash5 secondsby vortexing and centrifuged at 12000 rpm for 15 minutesat 8∘C The ldquopelletrdquo was washed with 500 120583L of ice-coldethanol and centrifuged at 12000 rpm for 15 minutes at 8∘CThe supernatant was carefully removed and discarded Theldquopelletrdquo was incubated at room temperature to dryness andthen dissolved in 30 120583L of ultrapure water (Invitrogen LifeTechnologies USA) and allowed to dissolve at 65∘C for 30minutesThe samples were frozen at minus20∘Cwhen not utilizedimmediately

24 Targets and PCR Protocols Three different targets wereanalyzed for M tuberculosis detection by real time PCRIS6110 gene 65 kDa Heat Shock Protein gene (hsp65 KDa)and the MPB64 protein encoding gene (MPB64) (Table 1)The reaction was performed on Rotor-Gene 5 plexHRM

Tuberculosis Research and Treatment 3

Table 2 List of microorganisms used as negative control

Microorganisms OriginAcinetobacter baumannii ATCC 19606Candida spp Known strainCryptococcus neoformans Known strainEnterococcus faecalis ATCC 29212Enterococcus faecium Known strainEscherichia coli ATCC 35218Haemophilus influenzae Known strainHaemophilus spp Known strainKlebsiella pneumoniae Known strainListeria monocytogenes Known strainMycobacterium chelonae Known strainMycobacterium abscessus Known strainMycobacterium avium Known strainMycobacterium gordonae Known strainMycobacterium intracellulare Known strainMycobacterium kansasii Known strainMycobacterium lentiflavum Known strainNeisseria meningitidis Known strainNeisseria spp Known strainNocardia spp Known strainProteus mirabilis ATCC 29245Pseudomonas aeruginosa ATCC 27853Salmonella enterica ATCC 14028Shigella flexneri ATCC 12022Staphylococcus aureus ATCC 29213Staphylococcus epidermidis ATCC 12228Staphylococcus saprophyticus ATCC 43867Streptococcus agalactiae ATCC 12386Streptococcus pneumoniae ATCC 49619Streptococcus pyogenes ATCC 19615ATCC American Type Collection Culture

platform (Qiagen USA) by melting analyses (QuantiFastSYBRGreen PCR (Qiagen USA)) on 20 120583L final volumeThelimit of detection (LoD) was determined by a serial sevenfolddilutions prepared in ultrapure water (Sigma-Aldrich CoLtd Saint Louis US)

The target specificity was carried out by testing thenegative control group andCSF samplesThenegative controlgroup was made up by ATCC and known strains of bacteriayeasts and other mycobacteria (Table 2)

25 Real Time PCR Protocol A reaction containing 10 120583L ofQuantiFast SYBRGreen PCR (Qiagen USA) 05mMof eachprimer and 2 120583L of sample was used forM tuberculosisDNAdetection directly from the CSF sample Thermocycling wasperformed in the PCR system in the real time Rotor-Gene Q5plex Platform (QiagenUSA) using the following conditionsan initial cycle of five minutes at 95∘C followed by 45 cyclesof 30 seconds at 94∘C and 45 seconds at the respectiveannealing temperature for IS6110 (65∘C) hsp65KDa (62∘C)and MPB64 (61∘C) At the conclusion of cycling a melting

step ranging from 72∘C to 95∘C with an increase of 05∘C persecond was added for each gene

26 Statistical Analysis The results obtained were comparedand evaluated clinically and analytically For each test sen-sitivity (119878) specificity (SP) positive predictive value (PPV)negative predictive value (NPV) and accuracy (119860) werecalculated The Kappa index (119896) was used to analyze thecorrelation between the tests For analytical comparisonmycobacteria culture was considered as gold standard Forclinical analysis the patients and their respective sampleswereclassified as true positive and true negative in accordancewith the result of mycobacterium culture and clinical andlaboratory data Clinical data of patients were collected fromelectronic medical records and laboratory reports providedby the Central Laboratory of Hospital Sao Paulo and recordsin Brazilian TBweb (httpwwwcvetbsaudespgovbr)

3 Results

Among 100 clinical CSF samples collected from 68 patients35 from 16 patients were considered true positive and 65 sam-ples from 52 patients were true negative by clinical parame-ters

The DNA extraction protocol using the phenol-chlo-roform-thiocyanate guanidine presented the highest finalDNA concentration among fourmethods evaluated (Table 3)

From 35 clinical samples considered true positive byclinical parameters for TBM diagnosis IS6110 PCR was ableto detect 32 of them followed by culture and hsp65 KDa (16samples) andMPB64 (12 samples) (Table 4)

Sixty-five samples were considered as true negative byclinical parameters for TBM diagnosis and culture wasnegative for all of them while 63 samples were negative byIS6110MBP64 and hsp65 KDa PCR (Table 4)

From 16 patients considered true positive by clinicalparameters for TBM diagnosis IS6110 was able to correctlydetect all of them followed by hsp65 KDa (11 patients) culture(10 patients) andMBP64 (7 samples) (Table 5)

From 52 patients considered true negative by clinicalparameters for TBM diagnosis the culture was able to detectall of them as negative followed by IS6110 (51 patients) hsp65and MBP64 (50 samples) (Table 5)

LoD efficiency Ct (cycle threshold) median and 119879m(temperature of melting) median for IS6110 MPB 64 andhsp65KDa are presented in Table 6The primers were specificfor M tuberculosis and did not show cross reactivity againstdifferent microorganisms tested

4 Discussion

Over the years several studies proposed and validated molec-ular techniques for diagnosis of TBM [8ndash14] These studiesconsidered the importance of developing a simple techniquethat was easily reproduced in laboratories with minimalresources [10 11 13 15 16]The choice of themost appropriateextraction method and the target to be amplified are criteria

Tuberculosis Research and Treatment 3

Table 2 List of microorganisms used as negative control

Microorganisms OriginAcinetobacter baumannii ATCC 19606Candida spp Known strainCryptococcus neoformans Known strainEnterococcus faecalis ATCC 29212Enterococcus faecium Known strainEscherichia coli ATCC 35218Haemophilus influenzae Known strainHaemophilus spp Known strainKlebsiella pneumoniae Known strainListeria monocytogenes Known strainMycobacterium chelonae Known strainMycobacterium abscessus Known strainMycobacterium avium Known strainMycobacterium gordonae Known strainMycobacterium intracellulare Known strainMycobacterium kansasii Known strainMycobacterium lentiflavum Known strainNeisseria meningitidis Known strainNeisseria spp Known strainNocardia spp Known strainProteus mirabilis ATCC 29245Pseudomonas aeruginosa ATCC 27853Salmonella enterica ATCC 14028Shigella flexneri ATCC 12022Staphylococcus aureus ATCC 29213Staphylococcus epidermidis ATCC 12228Staphylococcus saprophyticus ATCC 43867Streptococcus agalactiae ATCC 12386Streptococcus pneumoniae ATCC 49619Streptococcus pyogenes ATCC 19615ATCC American Type Collection Culture

platform (Qiagen USA) by melting analyses (QuantiFastSYBRGreen PCR (Qiagen USA)) on 20 120583L final volumeThelimit of detection (LoD) was determined by a serial sevenfolddilutions prepared in ultrapure water (Sigma-Aldrich CoLtd Saint Louis US)

The target specificity was carried out by testing thenegative control group andCSF samplesThenegative controlgroup was made up by ATCC and known strains of bacteriayeasts and other mycobacteria (Table 2)

25 Real Time PCR Protocol A reaction containing 10 120583L ofQuantiFast SYBRGreen PCR (Qiagen USA) 05mMof eachprimer and 2 120583L of sample was used forM tuberculosisDNAdetection directly from the CSF sample Thermocycling wasperformed in the PCR system in the real time Rotor-Gene Q5plex Platform (QiagenUSA) using the following conditionsan initial cycle of five minutes at 95∘C followed by 45 cyclesof 30 seconds at 94∘C and 45 seconds at the respectiveannealing temperature for IS6110 (65∘C) hsp65KDa (62∘C)and MPB64 (61∘C) At the conclusion of cycling a melting

step ranging from 72∘C to 95∘C with an increase of 05∘C persecond was added for each gene

26 Statistical Analysis The results obtained were comparedand evaluated clinically and analytically For each test sen-sitivity (119878) specificity (SP) positive predictive value (PPV)negative predictive value (NPV) and accuracy (119860) werecalculated The Kappa index (119896) was used to analyze thecorrelation between the tests For analytical comparisonmycobacteria culture was considered as gold standard Forclinical analysis the patients and their respective sampleswereclassified as true positive and true negative in accordancewith the result of mycobacterium culture and clinical andlaboratory data Clinical data of patients were collected fromelectronic medical records and laboratory reports providedby the Central Laboratory of Hospital Sao Paulo and recordsin Brazilian TBweb (httpwwwcvetbsaudespgovbr)

3 Results

Among 100 clinical CSF samples collected from 68 patients35 from 16 patients were considered true positive and 65 sam-ples from 52 patients were true negative by clinical parame-ters

The DNA extraction protocol using the phenol-chlo-roform-thiocyanate guanidine presented the highest finalDNA concentration among fourmethods evaluated (Table 3)

From 35 clinical samples considered true positive byclinical parameters for TBM diagnosis IS6110 PCR was ableto detect 32 of them followed by culture and hsp65 KDa (16samples) andMPB64 (12 samples) (Table 4)

Sixty-five samples were considered as true negative byclinical parameters for TBM diagnosis and culture wasnegative for all of them while 63 samples were negative byIS6110MBP64 and hsp65 KDa PCR (Table 4)

From 16 patients considered true positive by clinicalparameters for TBM diagnosis IS6110 was able to correctlydetect all of them followed by hsp65 KDa (11 patients) culture(10 patients) andMBP64 (7 samples) (Table 5)

From 52 patients considered true negative by clinicalparameters for TBM diagnosis the culture was able to detectall of them as negative followed by IS6110 (51 patients) hsp65and MBP64 (50 samples) (Table 5)

LoD efficiency Ct (cycle threshold) median and 119879m(temperature of melting) median for IS6110 MPB 64 andhsp65KDa are presented in Table 6The primers were specificfor M tuberculosis and did not show cross reactivity againstdifferent microorganisms tested

4 Discussion

Over the years several studies proposed and validated molec-ular techniques for diagnosis of TBM [8ndash14] These studiesconsidered the importance of developing a simple techniquethat was easily reproduced in laboratories with minimalresources [10 11 13 15 16]The choice of themost appropriateextraction method and the target to be amplified are criteria

4 Tuberculosis Research and Treatment

Table 3 Nanovue results form four extraction protocols

Diluent Extraction method Sensitivity amplification DNA [ng120583L] A260280

Ultrapure water

Phenol Chloroform 10-10 245 153Silica 10minus9 23 118Resin 10minus7 12 093

Resin ethanol 10minus4 03 036

Turbid CSF

Phenol Chloroform 10-10 285 159Silica 10-10 222 145Resin 10minus7 19 108

Resin ethanol 10minus3 01 001

Xanthochromic CSF

Phenol Chloroform 10-10 53 156Silica 10minus9 21 18Resin 10minus7 245 109

Resin ethanol 10minus6 012 14

Hemorrhagic CSF

Phenol Chloroform 10-10 645 155Silica 10-10 608 176Resin 10minus7 67 122

Resin ethanol 10minus6 01 219

Table 4 Culture and real time PCR results for 100 samples included on the study

119878 SP PPV NPV 119860 119870

Culture 46 100 100 77 81 052 (Weak)INS6110 91 97 94 95 95 089 (Strong)MPB64 34 97 86 73 75 036 (Minimal)hsp65KDa 46 97 89 77 79 048 (Weak)Note 119878 sensitivity SP specificity PPV positive predictive value NPV negative predictive value119860 accuracy 119896 Kappa index

Table 5 Culture and real time PCR results for 100 samples included on the study

119878 SP PPV NPV 119860 119870

Culture 63 100 100 90 91 072 (moderate)INS6110 100 98 94 100 99 096 (almost perfect)MPB64 44 96 78 85 84 047 (weak)hsp65KDa 69 96 85 91 90 069 (moderate)Note 119878 sensitivity SP specificity PPV positive predictive value NPV negative predictive value119860 accuracy 119896 Kappa index

Table 6 LoD efficiency Ct and Tm results for real time PCR

Target LoD (CFU) Efficiency Ct 119879mMedian Median

IS6110 100 107 3109 898Hsp 65KDa 102 102 2578 868MPB64 103 107 3507 907LoD limit of detection Ct cycle threshold 119879m temperature of melting

that improve the precision sensitivity and specificity of thePCR test [16ndash18]

The complexity of rich cell wall lipids of mycobacteriais a limiting factor for the success of some DNA extractiontechniques [19ndash22] besides the fact that the microorganism

is an intracellular pathogen which can hinder the isolationof these microorganisms in clinical samples [19 22] Sincethe CSF samples from patients with TBM are usually pau-cibacillary it is recommended to recover the greatest amountof DNA as possible

Tuberculosis Research and Treatment 5

The extraction protocol using the phenol-chloroform-thiocyanate guanidine showed the best results in terms ofquantification and sensitivity of PCR amplification present-ing up to 10 times more DNA than the second best protocolthe silica guanidine thiocyanate

The techniques using phenol-chloroform silica and thio-cyanate guanidine are described as excellent choices for DNAextraction in different biological materials in addition tobeing inexpensive and simple [8ndash13]

The methodology of phenol-chloroform extraction andDNA purification utilized the Brazol which has in itscomposition in addition to phenol guanidine thiocyanate achaotropic agent that inactivates endonucleases and preventsDNA binding to other molecules and facilitates the sepa-ration of cellular debris [23ndash26] Furthermore the phenolwhich is a potent proteolytic agent corrosive and causticcontributes to lysis of the cell envelope of mycobacteria Inphenol extraction solubilization anddenaturation of proteinsand lipids occur efficiently [26] The chloroform used inthis method is also a good protein denaturing detergentand a major solvent of fats which probably contributed tothe removal of the lipid layer of the mycobacteria cell wallRegarding the biohazard risk of phenol-chloroform all testswere done following the biosafety manuals and chemicalwaste disposal regulations of our country

The target that showed the best amplification results wasthe IS6110 qPCR with a sensitivity of 100 and specificityof 79 when compared to culture The sample analysis forIS6110 qPCR amplification showed 91 sensitivity and 97specificity with the clinical diagnosis When this analysiswas grouped by patient we showed a very good agreementwith the clinical diagnosis with 100 sensitivity and 98specificity

These results can be explained since the gene encodingtheMPB64 protein and the encoding gene heat shock protein(hsp65KDa) have single copies in mycobacteria genomewhile the insertion gene IS6110 has multiple copies whichmakes the reaction more sensitive [7ndash9]

The IS6110 target sequence is a repetitive insertion of1350 base pairs present in M tuberculosis complex specieswith different numbers of copies integrated into variouschromosomal sites [9 27 28]Thismolecular target promotesan increase in the sensitivity of the technique which isan advantage over other targets Only three patients hadpositive CSF samples for target IS6110 undiagnosed for TBMbut when we evaluated other laboratory criteria or clinicalcharacteristics of these patients two of them had TBM andonly one remained doubtful

Commercial molecular tests for pulmonary tuberculosisdiagnosis such as XpertMTBRIF represent a significantadvance since it is automated and provides fast results How-ever for TBM diagnosis its sensitivity is around 60 to 80[29ndash31] Other targets also can be used for M tuberculosismolecular diagnosis including the TRC4 primer a conservedrepetitive elementwith specificity forM tuberculosis complex[32]

There are few reports ofM tuberculosis lacking the IS6110that eventually could be responsible for false negative results[32 33] however we considered that the benefit of a greater

sensitivity of the IS6110 gene that can be found repeatedly inthe genomeM tuberculosis justifies its use [11 32 33]

Thus we believe we have demonstrated the feasibility of amolecular test for the diagnosis of TBM by an in-house realtime PCR with analytical and clinical correlation to be usedin laboratories with adequate cost benefit Studies comparingothermolecularmethods ofDNAextraction othermoleculartargets in-house protocols and commercial platforms arewarranted

5 Conclusion

The combination of DNA extraction by phenol-chloroformand guanidine thiocyanate (Brazol) and qPCR by IS6110 tar-get amplification could be an effective tool forM tuberculosisdiagnosis directly from CSF samples

Conflicts of Interest

The authors declare that they have no conflicts of interest

Acknowledgments

This study was supported by a grant from Coordenacao deAperfeicoamento de Pessoal de Nıvel Superior Capes Brazil

References

[1] G E Thwaites T T H Chau K Stepniewska and etalldquoDiagnosis of adult tuberculousmeningitis by use of clinical andlaboratory featuresrdquo The Lancet vol 360 no 9342 pp 1287ndash1292 2002

[2] T C de Oliveira ldquoImplementacao de acoes de vigilanciaepidemiologica em nıvel regionalrdquo Revista de Saude Publicavol 23 no 1 pp 79ndash81 1989

[3] D M Mota H B M Beltrao T M Lanzieri L C Vieira andM Machado ldquoAvaliacao economica da rubeola e de estrategiade controle em situacao de surto em Fortaleza (Ceara)rdquo Saudee Sociedade vol 20 no 3 2011

[4] A Cherian and S VThomas ldquoCentral nervous system tubercu-losisrdquo African Health Sciences vol 11 no 1 2011

[5] D H Kennedy and R J Fallon ldquoTuberculous meningitisrdquoJournal of AmericanMedical Association vol 241 no 3 pp 264ndash268 1979

[6] D Heemskerk J Day T T H Chau et al ldquoIntensified treatmentwith high dose rifampicin and levofloxacin compared to stan-dard treatment for adult patients with tuberculous meningitis(tbm-it) protocol for a randomized controlled trialrdquo Trials vol12 no 1 2011

[7] L M Wildner C L Nogueira da Silva Souza B S G SennaR M da Silva and M L Bazzo ldquoMicobacterias epidemiologiae diagnosticordquo Revista De Patologia Tropical vol 40 no 3 pp207ndash230 2011

[8] BW Lee J A M A Tan S CWong et al ldquoDNA amplificationby the polymerase chain reaction for the rapid diagnosis oftuberculous meningitis Comparison of protocols involvingthree mycobacterial DNA sequences IS6110 65 kDa antigenand MPB64rdquo Journal of the Neurological Sciences vol 123 no1 pp 173ndash179 1994

6 Tuberculosis Research and Treatment

[9] A W Mir A Kirmani R Eachkoti and M A Siddiqi ldquoIm-proved diagnosis of central nervous system tuberculosis byMPB64-target PCRrdquo Brazilian Journal of Microbiology vol 39no 2 pp 209ndash213 2008

[10] P W Hermans D Van Soolingen J W Dale et al ldquoInsertionelement IS986 from Mycobacterium tuberculosis a useful toolfor diagnosis and epidemiology of tuberculosisrdquo Journal ofClinical Microbiology vol 28 no 9 pp 2051ndash2058 1990

[11] L Chaidir A R Ganiem A vander Zanden et al ldquoComparisonof real time IS6110-PCR microscopy and culture for diagnosisof tuberculous meningitis in a cohort of adult patients inindonesiardquo Plos ONE vol 7 no 12 Article ID e52001 2012

[12] S Haldar N Sharma V K Gupta and J S Tyagi ldquoEfficientdiagnosis of tuberculous meningitis by detection of Mycobac-terium tuberculosis DNA in cerebrospinal fluid filtrates usingPCRrdquo Journal of Medical Microbiology vol 58 no 5 pp 616ndash624 2009

[13] F C D Q Mello and J Fonseca-Costa ldquoA utilidade da biologiamolecular no diagnostico dardquo Jornal Brasileiro De Pneumologiavol 31 no 3 188 pages 2005

[14] T Takahashi M Tamura Y Asami et al ldquoNovel wide-rangequantitative nested real-time PCR assay for Mycobactenumtuberculosis DNA clinical application for diagnosis of tuber-culous meningitisrdquo Journal of Clinical Microbiology vol 46 no5 pp 1698ndash1707 2008

[15] T Takahashi M Tamura and T Takasu ldquoThe PCR-baseddiagnosis of central nervous system tuberculosis up to daterdquoTuberculosis Research and Treatment 2012

[16] V R Bollela D N Sato and B A L Fonseca ldquoProblems inthe standardization of the polymerase chain reaction for thediagnosis of pulmonary tuberculosisrdquo Revista de Saude Publicavol 33 no 3 pp 281ndash286 1999

[17] C M Baratto and F Megiolaro ldquoComparacao de diferentesprotocolos de extracao de dna de bacterias para utilizacao emRAPD-PCRrdquo Ciencia-ACET vol 3 no 1 pp 121ndash130 2012

[18] A P Adams S R Bolin A E Fine C A Bolin and J BKaneene ldquoComparison of PCR versus culture for detection ofMycobacterium bovis after experimental inoculation of variousmatrices held under environmental conditions for extendedperiodsrdquo Applied and Environmental Microbiology vol 79 no20 pp 6501ndash6506 2013

[19] J Sambrook andDW RussellMolecular Cloning A LaboratoryManual Cold Spring Harbor Laboratory Press New York NYUSA 3rd edition 2001

[20] M J Zumarraga V Meikle A Bernardelli et al ldquoUse of touch-down polymerase chain reaction to enhance the sensitivity ofmycobacterium bovis detectionrdquo Journal of Veterinary Diagnos-tic Investigation vol 17 no 3 pp 232ndash238 2005

[21] Z-Q Zhang and M Ishaque ldquoEvaluation of methods forisolation of DNA from slowly and rapidly growing mycobac-teriardquo International Journal of Leprosy and Other MycobacterialDiseases vol 65 no 4 pp 469ndash476 1997

[22] M Jaber A Rattan A Verma J Tyagi and R Kumar ldquoA simplemethod of DNA extraction frommycobacterium tuberculosisrdquoTubercle and Lung Disease vol 76 no 6 pp 578ndash581 1995

[23] B J Wards D M Collins and G W de Lisle ldquoDetection ofmycobacterium bovis in tissues by polymerase chain reactionrdquoVeterinary Microbiology vol 43 no 2 pp 227ndash240 1995

[24] R BoomC SolM Beld JWeel J Goudsmit and PWertheim-Van Dillen ldquoImproved silica-guanidiniumthiocyanate DNA

isolation procedure based on selective binding of bovine alpha-casein to silica particlesrdquo Journal of Clinical Microbiology vol37 no 3 pp 615ndash619 1999

[25] I N De Almeida W Da Silva Carvalho M L Rossetti E RD Costa and S S De Miranda ldquoEvaluation of six differentDNA extraction methods for detection of Mycobacteriumtuberculosis by means of PCR-IS6110 preliminary studyrdquo BMCResearch Notes vol 6 no 1 Article 561 2013

[26] P Chomczynski and N Sacchi ldquoSingle-step method of RNAisolation by acid guanidinium thiocyanate-phenol-chloroformextractionrdquo Analytical Biochemistry vol 162 no 1 pp 156ndash1591987

[27] A S Goldsborough andM R BatesUS Patent Application No14193 p 680 2014

[28] D Van Soolingen P W Hermans P E W De Haas D RSoll and J D A Van Embden ldquoOccurrence and stability ofinsertion sequences in Mycobacterium tuberculosis complexstrains evaluation of an insertion sequence-dependent dnapolymorphism as a tool in the epidemiology of tuberculosisrdquoJournal of Clinical Microbiology vol 29 no 11 pp 2578ndash25861991

[29] N C S De Assis M L Lopes N C Cardoso M M DaCosta C D O Sousa and K V B Lima ldquoMolecular diagnosisof pulmonary tuberculosisrdquo Jornal Brasileiro De Patologia EMedicina Laboratorial vol 43 no 1 pp 1ndash7 2007

[30] N T Q Nhu D Heemskerk T T H Chau et al ldquoEvaluation ofGeneXpert MTBRIF for diagnosis of tuberculous meningitisrdquoJournal of Clinical Microbiology vol 52 no 1 pp 226ndash233 2014

[31] V B Patel GTheron L Lenders et al ldquoDiagnostic accuracy ofquantitative PCR (Xpert MTBRIF) for tuberculous meningitisin a high burden setting a prospective studyrdquo PLoSMed vol 10no 10 Article ID e1001536 2013

[32] A N I Sattar S K Setu A A Saleh and S Ahmed ldquoTRC4gene based PCR assay in diagnosis of tuberculous meningitisrdquoJournal of Medical Microbiology vol 8 no 2 pp 19ndash22 2017

[33] A Berwal K Chawla S Vishwanath and V P Shenoy ldquoRole ofmultiplex polymerase chain reaction in diagnosing tubercularmeningitisrdquo Journal of Laboratory Physicians vol 9 no 2 pp145ndash147 2017

Submit your manuscripts athttpswwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

Tuberculosis Research and Treatment 5

The extraction protocol using the phenol-chloroform-thiocyanate guanidine showed the best results in terms ofquantification and sensitivity of PCR amplification present-ing up to 10 times more DNA than the second best protocolthe silica guanidine thiocyanate

The techniques using phenol-chloroform silica and thio-cyanate guanidine are described as excellent choices for DNAextraction in different biological materials in addition tobeing inexpensive and simple [8ndash13]

The methodology of phenol-chloroform extraction andDNA purification utilized the Brazol which has in itscomposition in addition to phenol guanidine thiocyanate achaotropic agent that inactivates endonucleases and preventsDNA binding to other molecules and facilitates the sepa-ration of cellular debris [23ndash26] Furthermore the phenolwhich is a potent proteolytic agent corrosive and causticcontributes to lysis of the cell envelope of mycobacteria Inphenol extraction solubilization anddenaturation of proteinsand lipids occur efficiently [26] The chloroform used inthis method is also a good protein denaturing detergentand a major solvent of fats which probably contributed tothe removal of the lipid layer of the mycobacteria cell wallRegarding the biohazard risk of phenol-chloroform all testswere done following the biosafety manuals and chemicalwaste disposal regulations of our country

The target that showed the best amplification results wasthe IS6110 qPCR with a sensitivity of 100 and specificityof 79 when compared to culture The sample analysis forIS6110 qPCR amplification showed 91 sensitivity and 97specificity with the clinical diagnosis When this analysiswas grouped by patient we showed a very good agreementwith the clinical diagnosis with 100 sensitivity and 98specificity

These results can be explained since the gene encodingtheMPB64 protein and the encoding gene heat shock protein(hsp65KDa) have single copies in mycobacteria genomewhile the insertion gene IS6110 has multiple copies whichmakes the reaction more sensitive [7ndash9]

The IS6110 target sequence is a repetitive insertion of1350 base pairs present in M tuberculosis complex specieswith different numbers of copies integrated into variouschromosomal sites [9 27 28]Thismolecular target promotesan increase in the sensitivity of the technique which isan advantage over other targets Only three patients hadpositive CSF samples for target IS6110 undiagnosed for TBMbut when we evaluated other laboratory criteria or clinicalcharacteristics of these patients two of them had TBM andonly one remained doubtful

Commercial molecular tests for pulmonary tuberculosisdiagnosis such as XpertMTBRIF represent a significantadvance since it is automated and provides fast results How-ever for TBM diagnosis its sensitivity is around 60 to 80[29ndash31] Other targets also can be used for M tuberculosismolecular diagnosis including the TRC4 primer a conservedrepetitive elementwith specificity forM tuberculosis complex[32]

There are few reports ofM tuberculosis lacking the IS6110that eventually could be responsible for false negative results[32 33] however we considered that the benefit of a greater

sensitivity of the IS6110 gene that can be found repeatedly inthe genomeM tuberculosis justifies its use [11 32 33]

Thus we believe we have demonstrated the feasibility of amolecular test for the diagnosis of TBM by an in-house realtime PCR with analytical and clinical correlation to be usedin laboratories with adequate cost benefit Studies comparingothermolecularmethods ofDNAextraction othermoleculartargets in-house protocols and commercial platforms arewarranted

5 Conclusion

The combination of DNA extraction by phenol-chloroformand guanidine thiocyanate (Brazol) and qPCR by IS6110 tar-get amplification could be an effective tool forM tuberculosisdiagnosis directly from CSF samples

Conflicts of Interest

The authors declare that they have no conflicts of interest

Acknowledgments

This study was supported by a grant from Coordenacao deAperfeicoamento de Pessoal de Nıvel Superior Capes Brazil

References

[1] G E Thwaites T T H Chau K Stepniewska and etalldquoDiagnosis of adult tuberculousmeningitis by use of clinical andlaboratory featuresrdquo The Lancet vol 360 no 9342 pp 1287ndash1292 2002

[2] T C de Oliveira ldquoImplementacao de acoes de vigilanciaepidemiologica em nıvel regionalrdquo Revista de Saude Publicavol 23 no 1 pp 79ndash81 1989

[3] D M Mota H B M Beltrao T M Lanzieri L C Vieira andM Machado ldquoAvaliacao economica da rubeola e de estrategiade controle em situacao de surto em Fortaleza (Ceara)rdquo Saudee Sociedade vol 20 no 3 2011

[4] A Cherian and S VThomas ldquoCentral nervous system tubercu-losisrdquo African Health Sciences vol 11 no 1 2011

[5] D H Kennedy and R J Fallon ldquoTuberculous meningitisrdquoJournal of AmericanMedical Association vol 241 no 3 pp 264ndash268 1979

[6] D Heemskerk J Day T T H Chau et al ldquoIntensified treatmentwith high dose rifampicin and levofloxacin compared to stan-dard treatment for adult patients with tuberculous meningitis(tbm-it) protocol for a randomized controlled trialrdquo Trials vol12 no 1 2011

[7] L M Wildner C L Nogueira da Silva Souza B S G SennaR M da Silva and M L Bazzo ldquoMicobacterias epidemiologiae diagnosticordquo Revista De Patologia Tropical vol 40 no 3 pp207ndash230 2011

[8] BW Lee J A M A Tan S CWong et al ldquoDNA amplificationby the polymerase chain reaction for the rapid diagnosis oftuberculous meningitis Comparison of protocols involvingthree mycobacterial DNA sequences IS6110 65 kDa antigenand MPB64rdquo Journal of the Neurological Sciences vol 123 no1 pp 173ndash179 1994

6 Tuberculosis Research and Treatment

[9] A W Mir A Kirmani R Eachkoti and M A Siddiqi ldquoIm-proved diagnosis of central nervous system tuberculosis byMPB64-target PCRrdquo Brazilian Journal of Microbiology vol 39no 2 pp 209ndash213 2008

[10] P W Hermans D Van Soolingen J W Dale et al ldquoInsertionelement IS986 from Mycobacterium tuberculosis a useful toolfor diagnosis and epidemiology of tuberculosisrdquo Journal ofClinical Microbiology vol 28 no 9 pp 2051ndash2058 1990

[11] L Chaidir A R Ganiem A vander Zanden et al ldquoComparisonof real time IS6110-PCR microscopy and culture for diagnosisof tuberculous meningitis in a cohort of adult patients inindonesiardquo Plos ONE vol 7 no 12 Article ID e52001 2012

[12] S Haldar N Sharma V K Gupta and J S Tyagi ldquoEfficientdiagnosis of tuberculous meningitis by detection of Mycobac-terium tuberculosis DNA in cerebrospinal fluid filtrates usingPCRrdquo Journal of Medical Microbiology vol 58 no 5 pp 616ndash624 2009

[13] F C D Q Mello and J Fonseca-Costa ldquoA utilidade da biologiamolecular no diagnostico dardquo Jornal Brasileiro De Pneumologiavol 31 no 3 188 pages 2005

[14] T Takahashi M Tamura Y Asami et al ldquoNovel wide-rangequantitative nested real-time PCR assay for Mycobactenumtuberculosis DNA clinical application for diagnosis of tuber-culous meningitisrdquo Journal of Clinical Microbiology vol 46 no5 pp 1698ndash1707 2008

[15] T Takahashi M Tamura and T Takasu ldquoThe PCR-baseddiagnosis of central nervous system tuberculosis up to daterdquoTuberculosis Research and Treatment 2012

[16] V R Bollela D N Sato and B A L Fonseca ldquoProblems inthe standardization of the polymerase chain reaction for thediagnosis of pulmonary tuberculosisrdquo Revista de Saude Publicavol 33 no 3 pp 281ndash286 1999

[17] C M Baratto and F Megiolaro ldquoComparacao de diferentesprotocolos de extracao de dna de bacterias para utilizacao emRAPD-PCRrdquo Ciencia-ACET vol 3 no 1 pp 121ndash130 2012

[18] A P Adams S R Bolin A E Fine C A Bolin and J BKaneene ldquoComparison of PCR versus culture for detection ofMycobacterium bovis after experimental inoculation of variousmatrices held under environmental conditions for extendedperiodsrdquo Applied and Environmental Microbiology vol 79 no20 pp 6501ndash6506 2013

[19] J Sambrook andDW RussellMolecular Cloning A LaboratoryManual Cold Spring Harbor Laboratory Press New York NYUSA 3rd edition 2001

[20] M J Zumarraga V Meikle A Bernardelli et al ldquoUse of touch-down polymerase chain reaction to enhance the sensitivity ofmycobacterium bovis detectionrdquo Journal of Veterinary Diagnos-tic Investigation vol 17 no 3 pp 232ndash238 2005

[21] Z-Q Zhang and M Ishaque ldquoEvaluation of methods forisolation of DNA from slowly and rapidly growing mycobac-teriardquo International Journal of Leprosy and Other MycobacterialDiseases vol 65 no 4 pp 469ndash476 1997

[22] M Jaber A Rattan A Verma J Tyagi and R Kumar ldquoA simplemethod of DNA extraction frommycobacterium tuberculosisrdquoTubercle and Lung Disease vol 76 no 6 pp 578ndash581 1995

[23] B J Wards D M Collins and G W de Lisle ldquoDetection ofmycobacterium bovis in tissues by polymerase chain reactionrdquoVeterinary Microbiology vol 43 no 2 pp 227ndash240 1995

[24] R BoomC SolM Beld JWeel J Goudsmit and PWertheim-Van Dillen ldquoImproved silica-guanidiniumthiocyanate DNA

isolation procedure based on selective binding of bovine alpha-casein to silica particlesrdquo Journal of Clinical Microbiology vol37 no 3 pp 615ndash619 1999

[25] I N De Almeida W Da Silva Carvalho M L Rossetti E RD Costa and S S De Miranda ldquoEvaluation of six differentDNA extraction methods for detection of Mycobacteriumtuberculosis by means of PCR-IS6110 preliminary studyrdquo BMCResearch Notes vol 6 no 1 Article 561 2013

[26] P Chomczynski and N Sacchi ldquoSingle-step method of RNAisolation by acid guanidinium thiocyanate-phenol-chloroformextractionrdquo Analytical Biochemistry vol 162 no 1 pp 156ndash1591987

[27] A S Goldsborough andM R BatesUS Patent Application No14193 p 680 2014

[28] D Van Soolingen P W Hermans P E W De Haas D RSoll and J D A Van Embden ldquoOccurrence and stability ofinsertion sequences in Mycobacterium tuberculosis complexstrains evaluation of an insertion sequence-dependent dnapolymorphism as a tool in the epidemiology of tuberculosisrdquoJournal of Clinical Microbiology vol 29 no 11 pp 2578ndash25861991

[29] N C S De Assis M L Lopes N C Cardoso M M DaCosta C D O Sousa and K V B Lima ldquoMolecular diagnosisof pulmonary tuberculosisrdquo Jornal Brasileiro De Patologia EMedicina Laboratorial vol 43 no 1 pp 1ndash7 2007

[30] N T Q Nhu D Heemskerk T T H Chau et al ldquoEvaluation ofGeneXpert MTBRIF for diagnosis of tuberculous meningitisrdquoJournal of Clinical Microbiology vol 52 no 1 pp 226ndash233 2014

[31] V B Patel GTheron L Lenders et al ldquoDiagnostic accuracy ofquantitative PCR (Xpert MTBRIF) for tuberculous meningitisin a high burden setting a prospective studyrdquo PLoSMed vol 10no 10 Article ID e1001536 2013

[32] A N I Sattar S K Setu A A Saleh and S Ahmed ldquoTRC4gene based PCR assay in diagnosis of tuberculous meningitisrdquoJournal of Medical Microbiology vol 8 no 2 pp 19ndash22 2017

[33] A Berwal K Chawla S Vishwanath and V P Shenoy ldquoRole ofmultiplex polymerase chain reaction in diagnosing tubercularmeningitisrdquo Journal of Laboratory Physicians vol 9 no 2 pp145ndash147 2017

Submit your manuscripts athttpswwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

6 Tuberculosis Research and Treatment

[9] A W Mir A Kirmani R Eachkoti and M A Siddiqi ldquoIm-proved diagnosis of central nervous system tuberculosis byMPB64-target PCRrdquo Brazilian Journal of Microbiology vol 39no 2 pp 209ndash213 2008

[10] P W Hermans D Van Soolingen J W Dale et al ldquoInsertionelement IS986 from Mycobacterium tuberculosis a useful toolfor diagnosis and epidemiology of tuberculosisrdquo Journal ofClinical Microbiology vol 28 no 9 pp 2051ndash2058 1990

[11] L Chaidir A R Ganiem A vander Zanden et al ldquoComparisonof real time IS6110-PCR microscopy and culture for diagnosisof tuberculous meningitis in a cohort of adult patients inindonesiardquo Plos ONE vol 7 no 12 Article ID e52001 2012

[12] S Haldar N Sharma V K Gupta and J S Tyagi ldquoEfficientdiagnosis of tuberculous meningitis by detection of Mycobac-terium tuberculosis DNA in cerebrospinal fluid filtrates usingPCRrdquo Journal of Medical Microbiology vol 58 no 5 pp 616ndash624 2009

[13] F C D Q Mello and J Fonseca-Costa ldquoA utilidade da biologiamolecular no diagnostico dardquo Jornal Brasileiro De Pneumologiavol 31 no 3 188 pages 2005

[14] T Takahashi M Tamura Y Asami et al ldquoNovel wide-rangequantitative nested real-time PCR assay for Mycobactenumtuberculosis DNA clinical application for diagnosis of tuber-culous meningitisrdquo Journal of Clinical Microbiology vol 46 no5 pp 1698ndash1707 2008

[15] T Takahashi M Tamura and T Takasu ldquoThe PCR-baseddiagnosis of central nervous system tuberculosis up to daterdquoTuberculosis Research and Treatment 2012

[16] V R Bollela D N Sato and B A L Fonseca ldquoProblems inthe standardization of the polymerase chain reaction for thediagnosis of pulmonary tuberculosisrdquo Revista de Saude Publicavol 33 no 3 pp 281ndash286 1999

[17] C M Baratto and F Megiolaro ldquoComparacao de diferentesprotocolos de extracao de dna de bacterias para utilizacao emRAPD-PCRrdquo Ciencia-ACET vol 3 no 1 pp 121ndash130 2012

[18] A P Adams S R Bolin A E Fine C A Bolin and J BKaneene ldquoComparison of PCR versus culture for detection ofMycobacterium bovis after experimental inoculation of variousmatrices held under environmental conditions for extendedperiodsrdquo Applied and Environmental Microbiology vol 79 no20 pp 6501ndash6506 2013

[19] J Sambrook andDW RussellMolecular Cloning A LaboratoryManual Cold Spring Harbor Laboratory Press New York NYUSA 3rd edition 2001

[20] M J Zumarraga V Meikle A Bernardelli et al ldquoUse of touch-down polymerase chain reaction to enhance the sensitivity ofmycobacterium bovis detectionrdquo Journal of Veterinary Diagnos-tic Investigation vol 17 no 3 pp 232ndash238 2005

[21] Z-Q Zhang and M Ishaque ldquoEvaluation of methods forisolation of DNA from slowly and rapidly growing mycobac-teriardquo International Journal of Leprosy and Other MycobacterialDiseases vol 65 no 4 pp 469ndash476 1997

[22] M Jaber A Rattan A Verma J Tyagi and R Kumar ldquoA simplemethod of DNA extraction frommycobacterium tuberculosisrdquoTubercle and Lung Disease vol 76 no 6 pp 578ndash581 1995

[23] B J Wards D M Collins and G W de Lisle ldquoDetection ofmycobacterium bovis in tissues by polymerase chain reactionrdquoVeterinary Microbiology vol 43 no 2 pp 227ndash240 1995

[24] R BoomC SolM Beld JWeel J Goudsmit and PWertheim-Van Dillen ldquoImproved silica-guanidiniumthiocyanate DNA

isolation procedure based on selective binding of bovine alpha-casein to silica particlesrdquo Journal of Clinical Microbiology vol37 no 3 pp 615ndash619 1999

[25] I N De Almeida W Da Silva Carvalho M L Rossetti E RD Costa and S S De Miranda ldquoEvaluation of six differentDNA extraction methods for detection of Mycobacteriumtuberculosis by means of PCR-IS6110 preliminary studyrdquo BMCResearch Notes vol 6 no 1 Article 561 2013

[26] P Chomczynski and N Sacchi ldquoSingle-step method of RNAisolation by acid guanidinium thiocyanate-phenol-chloroformextractionrdquo Analytical Biochemistry vol 162 no 1 pp 156ndash1591987

[27] A S Goldsborough andM R BatesUS Patent Application No14193 p 680 2014

[28] D Van Soolingen P W Hermans P E W De Haas D RSoll and J D A Van Embden ldquoOccurrence and stability ofinsertion sequences in Mycobacterium tuberculosis complexstrains evaluation of an insertion sequence-dependent dnapolymorphism as a tool in the epidemiology of tuberculosisrdquoJournal of Clinical Microbiology vol 29 no 11 pp 2578ndash25861991

[29] N C S De Assis M L Lopes N C Cardoso M M DaCosta C D O Sousa and K V B Lima ldquoMolecular diagnosisof pulmonary tuberculosisrdquo Jornal Brasileiro De Patologia EMedicina Laboratorial vol 43 no 1 pp 1ndash7 2007

[30] N T Q Nhu D Heemskerk T T H Chau et al ldquoEvaluation ofGeneXpert MTBRIF for diagnosis of tuberculous meningitisrdquoJournal of Clinical Microbiology vol 52 no 1 pp 226ndash233 2014

[31] V B Patel GTheron L Lenders et al ldquoDiagnostic accuracy ofquantitative PCR (Xpert MTBRIF) for tuberculous meningitisin a high burden setting a prospective studyrdquo PLoSMed vol 10no 10 Article ID e1001536 2013

[32] A N I Sattar S K Setu A A Saleh and S Ahmed ldquoTRC4gene based PCR assay in diagnosis of tuberculous meningitisrdquoJournal of Medical Microbiology vol 8 no 2 pp 19ndash22 2017

[33] A Berwal K Chawla S Vishwanath and V P Shenoy ldquoRole ofmultiplex polymerase chain reaction in diagnosing tubercularmeningitisrdquo Journal of Laboratory Physicians vol 9 no 2 pp145ndash147 2017

Submit your manuscripts athttpswwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

Submit your manuscripts athttpswwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom