Companion Biotechnologhy Text

• Concepts and processes of biotechnology research and manufacturingin the areas of pharmaceuticals, agriculture, industrial products, andinstrumentation

• Principles and techniques of genomics, recombinant DNA technology,microarrays, proteomics, and other key topics

• Futuristic information on advances in drug discovery, gene therapy,forensics, and horticulture

• Thought-provoking sidebars on bioethics, recent biotech discoveries,regulations, emergent trends, and cutting-edge research

• Information on career options in the exciting field of biotechnology

Packaged with an interactive multimedia CD that presents key Lab Skill Tutorials using graphics, audio, and video. . .plus Quizzes, a complete Glossary with related images, Flash Cards, and Crossword Puzzles

• Companion Biotechnologhy Text of 14 chapters with nearly 100 step-by-step lab activities—available separately or packaged with the textbook

• Laboratory Notebook to document scientifically the results of experiments and activities—available separately or packaged with the text, lab manual or both

• Internet Resource Center with materials and tools for both studentsand instructors (www.emcp.com)

www.emcp.com104665 (Text)

05665 (Text + Encore CD)

Biotech_FM.qxd 12/20/05 10:56 AM Page i

Senior Developmental Editor Sonja M. BrownArt Editor Courtney Kost

Cover and Text Designer Leslie AndersonIllustrator Precision Graphics

Compositor Precision GraphicsEditorial Assistant Susan Capecchi

Copyeditor Colleen DuffyProofreader Joy McComb

Indexer Nancy Fulton

Reviewers: The author, editor , and publisher wish to thank the following individuals for their insightful feedback during thedevelopment of this text:

• Dr. Jim DeKloe, Co-Director, Biotechnician Program, Solano Community College• Dr. Toby Horn, Co-Director, Carnegie Academy for Science Education, Carnegie Institute of Washington• Brian Robinson, Biochemistry Research Associate, Genentech, Inc.

Care has been taken to verify the accuracy of information presented in this book. However, the author, editor, and publishercannot accept any responsibility for Web, e-mail, newsgroup, or chat room subject matter or content, or for consequencesfrom application of the information in this book, and make no warranty, expressed or implied, with respect to its content.

Trademarks: Some of the product names and company names included in this book have been used for identification pur-poses only and may be trademarks or registered trademarks of their respective manufacturers and sellers. The author, editor,and publisher disclaim any affiliation, association, or connection with, or sponsorship or endorsement by, such owners.

© 2007 by Paradigm Publishing Inc.Published by EMC Corporation875 Montreal WaySaint Paul, MN 55102(800) 535-6865E-mail: [email protected] Site: www.emcp.com

All rights reserved. No part of this book may be reproduced, stored in a retrieval system, or transmitted, in any form or byany means, electronic, mechanical photocopying, recording, or otherwise, without prior written permission of ParadigmPublishing, Inc.

Printed in the United States of America10 9 8 7 6 5 4 3 2 1

Biotech_FM.qxd 12/20/05 10:56 AM Page ii

v

Preface. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ixAcknowledgments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xi

Chapter 1 What Is Biotechnology? . . . . . . . . . . . . 2Biotech Careers: Quality Control Analyst ...........2Learning Outcomes..........................................................31.1 Defining Biotechnology......................................3

Section 1 Review Questions .............................101.2 The Increasing Variety of Biotechnology

Products .........................................................10Biotech Online: The GloFish™.........................13Section 1.2 Review Questions ..........................14

1.3 How Companies Select Products to Manufacture...............................................14

Biotech Online: Genentech, Inc’s Product Pipeline ............................................18

Section 1.3 Review Questions ..........................191.4 Doing Biotechnology: Scientific Methodology

in a Research Facility.....................................19Section 1.4 Review Questions ..........................23

1.5 Careers in the Biotechnology Industry ............23Biotech Online: Finding “Hot Jobs” .................26Section 1.5 Review Questions ..........................26

1.6 Biotechnology with a Conscience?Bioethics....27Biotech Online: Examining a Code of

Business Conduct ..........................................29Section 1.6 Review Questions ..........................29

Chapter Review ..............................................................30Speaking Biotech ..............................................30Summary: Concepts ..........................................30Summary: Lab Practices ....................................31Thinking Like a Biotechnician..........................31Biotech Live Activities.......................................32Bioethics: Using Animals in Science

and Industry...................................................34

Chapter 2 The Raw Materials of Biotechnology . . . . . . . . . . . . . . . . . . . 36

Biotech Careers: Biochemist/Research Assistant .......................................................36

Learning Outcomes........................................................372.1 Organisms and Their Components ..................37

Biotech Online: Keeping the Kimchi Coming...39Biotech Online: Picking the Right Tool for

the Job ............................................................41Section 2.1 Review Questions ..........................42

2.2 Cellular Organization and Processes................42Section 2.2 Review Questions ..........................47

2.3 The Molecules of Cells......................................48Biotech Online: Computer-generated

Molecular Models ..........................................48

Section 2.3 Review Questions ..........................572.4 The New Biotechnology ...................................57

Biotech Online: Biotech Products Make a Difference .........................................58

Section 2.4 Review Questions ..........................59Chapter Review ..............................................................60

Speaking Biotech ..............................................60Summary: Concepts ..........................................60Summary: Lab Practices ....................................61Thinking Like a Biotechnician..........................61Biotech Live Activities.......................................62Bioethics: Stop! You cannot use

THOSE cells ...................................................65

Chapter 3 The Basic Skills of the Biotechnology Workplace . . . . . . . . . 66

Biotech Careers: Materials Management ..........66Learning Outcomes........................................................673.1 Measuring Volumes in a

Biotechnology Facility...................................67Biotech Online: Bet You Can’t Hit

a 150-Meter Homer........................................70Section 3.1 Review Questions ..........................75Biotech Online: Positive Displacement

Micropipets ....................................................753.2 Making Solutions...............................................75

Section 3.2 Review Questions ..........................783.3 Solutions of a Given Mass/Volume

Concentration ................................................78Section 3.3 Review Questions ..........................80

3.4 Solutions of Differing % Mass/Volume Concentrations ...............................................80

Section 3.4 Review Questions ..........................823.5 Solutions of Differing Molar Concentrations ...82

Section 3.5 Review Questions ..........................853.6 Dilutions of Concentrated Solutions ................85

Section 3.6 Review Questions ..........................87Chapter Review ..............................................................88

Speaking Biotech ..............................................88Summary: Concepts ..........................................88Summary: Lab Practices ....................................89Thinking Like a Biotechnician..........................90Biotech Live Activities.......................................91Bioethics: Is Honesty Always the

Best Policy? ....................................................96

Chapter 4 Introduction to Studying DNA . . . . . 98Biotech Careers: Molecular Biologist/Professor ........................................98

Learning Outcomes........................................................994.1 DNA Structure and Function ............................99

Section 4.1 Review Questions ........................103

Biotech_FM.qxd 12/20/05 10:56 AM Page v

vi

4.2 Sources of DNA...............................................103Biotech Online: Know Your Genome............108Biotech Online: A Baldness

Gene. . .Beautiful.........................................112Section 4.2 Review Questions ........................112

4.3 Isolating and Manipulating DNA....................112Biotech Online: Party Bacteria. . .

Green Party That Is .....................................114Biotech Online: Two Therapies Are

Better Than One ..........................................115Section 4.3 Review Questions ........................115

4.4 Using Gel Electrophoresis to Study Molecules...........................................116

Biotech Online: Chop and Go Electrophoresis ......................................120

Section 4.4 Review Questions ........................120Chapter Review ............................................................122

Speaking Biotech.............................................122Summary: Concepts.........................................122Summary: Lab Practices ..................................123Thinking Like a Biotechnician........................124Biotech Live Activities .....................................124Bioethics: The Promise of Gene Therapy......128

Chapter 5 Introduction to Studying Protein. . .130Biotech Careers: Staff Research Associate ......130Learning Outcomes ......................................................1315.1 The Structure and Function of Proteins .........131

Biotech Online: Antibody-Producing Companies ...................................................137

Section 5.1 Review Questions ........................1385.2 The Production of Proteins.............................138

Biotech Online: Couch Potatoes, Relax .........142Section 5.2 Review Questions ........................143

5.3 Enzymes: Protein Catalysts .............................143Biotech Online: Enzymes—Catalysts

for Better Health ..........................................147Section 5.3 Review Questions ........................147

5.4 Studying Proteins.............................................147Section 5.4 Review Questions ........................150

5.5 Applications of Protein Analysis.....................150Biotech Online: Protein Sequencers ..............152Section 5.5 Review Questions ........................153

Chapter Review ............................................................154Speaking Biotech.............................................154Summary: Concepts.........................................154Summary: Lab Practices ..................................155Thinking Like a Biotechnician........................155Biotech Live Activities .....................................156Bioethics: Who Owns the Patent on the

Genetic Code for Your Proteins?.................159

Chapter 6 Identifying a Potential BiotechnologyProduct . . . . . . . . . . . . . . . . . . . . . . . . . 160

Biotech Careers: Sales Representative............160Learning Outcomes ......................................................161

6.1 Sources of Potential Products .........................161Section 6.1 Review Questions ........................165

6.2 The Use of Assays ...........................................165Section 6.2 Review Questions ........................166

6.3 Looking for Products in Nature ......................166Biotech Online: Amazon Hide and Seek .......169Section 6.3 Review Questions ........................171

6.4 Studying Plant Proteins as Possible Products..171Biotech Online: Monsanto Company’s

Plant Research..............................................172Biotech Online: Not in My Backyard! ............173Section 6.4 Review Questions ........................175

6.5 Producing Recombinant DNA (rDNA) Protein Products ..........................................175


Speaking Biotech.............................................178Summary: Concepts.........................................178Summary: Lab Practices ..................................179Thinking Like a Biotechnician........................180Biotech Live Activities .....................................180Bioethics: Limited Medication—Who gets it? ..186

Chapter 7 Spectrophotometers and Assays forBiotechnology Products . . . . . . . . . 188

Biotech Careers: Lab Technician .....................188Learning Outcomes ......................................................1897.1 Using the Spectrophotometer to

Detect Molecules .........................................189Biotech Online: FTIR ......................................194Section 7.1 Review Questions ........................194

7.2 Introduction to pH ..........................................194Biotech Online: The Beginner’s Guide

to pH ............................................................197Section 7.2 Review Questions ........................198

7.3 Buffers..............................................................198Section 7.3 Review Questions ........................200

7.4 Using the Spectrophotometer to Measure Protein Concentration..................................200


Speaking Biotech.............................................202Summary: Concepts.........................................202Summary: Lab Practices ..................................203Thinking Like a Biotechnician........................204Biotech Live Activities .....................................204Bioethics: Test Results—Who Should

Get Access to Them? ...................................205

Chapter 8 The Production of a RecombinantBiotechnology Product . . . . . . . . . . 208

Biotech Careers: Molecular Biologist ..............208Learning Outcomes ......................................................2098.1 An Overview of Genetic Engineering ............209

Biotech Online: GDF8 Is a Real Knockout! ...214

Tab le o f Con ten ts

Biotech_FM.qxd 12/20/05 10:56 AM Page vi

Tab le o f Con ten ts vii

Section 8.1 Review Questions ........................2148.2 Transforming Cells ..........................................215

Biotech Online: BACs versus YACs................216Biotech Online: Endonucleases:

Real Cut-Ups ................................................218Biotech Online: RFLPs Can Reveal

Disease Mutations........................................219Biotech Online: Resistant Bacteria—

Better Yet, Resistant Mammals! ...................222Section 8.2 Review Questions ........................222

8.3 After Transformation .......................................223Biotech Online: You Can Try

This at Home ...............................................226Section 8.3 Review Questions ........................226

8.4 Fermentation, Manufacturing, and GMP........226Section 8.4 Review Questions ........................230

8.5 Retrieving Plasmids after Transformation ......230Section 8.5 Review Questions ........................233

Chapter Review ............................................................234Speaking Biotech.............................................234Summary: Concepts.........................................234Summary: Lab Practices ..................................235Thinking Like a Biotechnician........................236Biotech Live Activities .....................................236Bioethics: NSF Funding Committee—

Who Should Get Funded? ...........................238

Chapter 9 Bringing a Biotechnology Product to Market . . . . . . . . . . . . . . . . . . . . . . . 240

Biotech Careers: Lab Technician, QC ...............240Learning Outcomes ......................................................2419.1 Harvesting a Protein Product..........................241

Section 9.1 Review Questions ........................2459.2 Using Chromatography to Study

and Separate Molecules...............................245Section 9.2 Review Questions ........................249

9.3 Column Chromatography: An Expanded Discussion ............................249

Biotech Online: Got Gas? ...............................253Section 9.3 Review Questions ........................254

9.4 Product Quality Control ..................................254Biotech Online: Products in the Pipeline ......256Section 9.4 Review Questions ........................257

9.5 Marketing and Sales ........................................257Biotech Online: Approved

Biotechnology Drugs...................................259Section 9.5 Review Questions ........................259

Chapter Review ............................................................260Speaking Biotech.............................................260Summary: Concepts.........................................260Summary: Lab Practices ..................................261Thinking Like a Biotechnician........................262Biotech Live Activities .....................................262Bioethics: How Do YOU Decide

Who Lives and Who Dies? ..........................264

Chapter 10 Introduction to PlantBiotechnology . . . . . . . . . . . . . . . . .266

Biotech Careers: Plant Biologist.....................266Learning Outcomes ......................................................26710.1 Introduction to Plant Propagation..................267

Biotech Online: Seeds Really Get Around.....269Section 10.1 Review Questions ......................272

10.2 Basic Plant Anatomy .......................................272Biotech Online: Pros and Cons of

Fertilizer Use ................................................273Biotech Online: Whatever Happened to

the FlavRSavR® Tomato? ..............................275Section 10.2 Review Questions ......................275

10.3 Plant Growth, Structure, and Function ..........275Section 10.3 Review Questions ......................278

10.4 Introduction to Plant Breeding.......................279Section 10.4 Review Questions ......................284

10.5 Statistical Analysis of Data ..............................284Section 10.5 Review Questions ......................289

Chapter Review ............................................................290Speaking Biotech.............................................290Summary: Concepts.........................................290Summary: Lab Practices ..................................291Thinking Like a Biotechnician........................292Biotech Live Activities .....................................293Bioethics: Monarchs—What’s All the

Fuss About? ..................................................297

Chapter 11 Biotechnology in Agriculture. . . . . 298Biotech Careers: Plant Biologist.....................298 Learning Outcomes ......................................................29911.1 Cloning Plants..................................................299

Biotech Online: Codes of Ethics.....................302Section 11.1 Review Questions ......................302

11.2 Cloning by Plant Tissue Culture.....................303Biotech Online: HEPA, a Heap

of Filtering Power ........................................306Section 11.2 Review Questions ......................306

11.3 New Applications of Biotechnology in Agriculture and Horticulture...................306

Biotech Online: Well, Hello Dolly, Dolly, and Dolly? ....................................................307

Biotech Online: Hydroponics Out of This World....................................................309

Biotech Online: What Is ARS?.........................311Section 11.3 Review Questions ......................311

11.4 Isolating DNA from Plant Cells.......................311Section 11.4 Review Questions ......................313

11.5 Plant Genetic Engineering ..............................313Section 11.5 Review Questions ......................315

Chapter Review ............................................................316Speaking Biotech.............................................316Summary: Concepts.........................................316Summary: Lab Practices ..................................317Thinking Like a Biotechnician........................318

Biotech_FM.qxd 12/20/05 10:56 AM Page vii

viii Tab le o f Con ten ts

Biotech Live Activities .....................................318Bioethics: Alien DNA in Your Food? ..............323

Chapter 12 Biotechnology in Medicine . . . . .324Biotech Careers:Associate Director,

Medicinal Chemistry .............................................324Learning Outcomes ......................................................32512.1 Drug Discovery ...............................................325

Biotech Online: Pancreatitis—What a Pain!...326Biotech Online: Penicillin—One of the

Best Finds in Nature ....................................327Section 12.1 Review Questions ......................329

12.2 Creating Pharmaceuticals through Combinatorial Chemistry.............................329

Section 12.2 Review Questions ......................33112.3 Creating Pharmaceutical through

Peptide and DNA Synthesis ........................332Section 12.3 Review Questions ......................333

12.4 Creating Pharmaceutical by Protein/Antibody Engineering ....................334

Biotech Online: Eating Your Vegetables Could Be Even More Important..................336

Biotech Online: Getting Sick Is No Laughing Matter .....................................337

Section 12.4 Review Questions ......................337Chapter Review ............................................................338

Summary: Concepts.........................................338Summary: Lab Practices ..................................338Thinking Like a Biotechnician........................339Biotech Live Activities .....................................339Bioethics: Animal Testing of

Pharmaceuticals ...........................................341

Chapter 13 Making DNA Molecules . . . . . . . .342Biotech Careers: Forensic

Scientist/DNA Analyst .................................342Learning Outcomes ......................................................34313.1 Making DNA Molecules—DNA Synthesis ......343

Biotech Online: Tell Me About Telomeres ....347Biotech Online: Snip Snip Here,

Snip Snip There ...........................................349Section 13.1 Review Questions ......................349

13.2 DNA Synthesis Products .................................349Section 13.2 Review Questions ......................353

13.3 Polymerase Chain Reaction ............................354Section 13.3 Review Questions ......................357

13.4 Applications of PCR Technology....................357

Biotech Online: CSI—Your Town ..................361Section 13.4 Review Questions ......................361

Chapter Review ............................................................362Speaking Biotech.............................................362Summary: Concepts.........................................362Summary: Lab Practices ..................................363Thinking Like a Biotechnician........................364Biotech Live Activities .....................................365Bioethics: Designer Babies .............................366

Chapter 14 Advanced Biotechnology Techniques . . . . . . . . . . . . . . . . . . . .368

Biotech Careers: Research Scientist ...............368Learning Outcomes ......................................................36914.1 Advanced DNA Topics?DNA Sequencing ......369

Biotech Online: Growing Up Too Fast ..........370Biotech Online: Mitochondria

Have Sequences, Too..................................374Section 14.1 Review Questions ......................374

14.2 Advanced DNA Studies_Genomics ................374Biotech Online: The Buzz Is That the

Bee Genome Is Almost Done .....................375Biotech Online: Companies into

Shutting Down.............................................376Section 14.2 Review Questions ......................377

14.3 Advanced Protein Studies ...............................377Biotech Online: Protein Shape Is the Key .....380Section 14.3 Review Questions ......................385

14.4 Other Advances and Applications of Biotechnology .........................................386

Biotech Online: A Medicine Just for You.......387Biotech Online: Marine Biotechnology:

What Is All the Flap About? ........................388Biotech Online: Clearly, I See a

Future in Nanotechnology ..........................389Section 14.4 Review Questions ......................389

Chapter Review ............................................................390Speaking Biotech.............................................390Summary: Concepts.........................................390Summary: Lab Practices ..................................391Thinking Like a Biotechnician........................391Biotech Live Activities .....................................392Bioethics: Give Us Your DNA Sample,

Like It or Not? ..............................................396Glossary.......................................................................397Index ...........................................................................409

Biotech_FM.qxd 12/20/05 10:56 AM Page viii

131

Introduction to Studying Proteins5Learning Outcomes• Describe the structure of proteins, including the significance of amino

acid R-groups and their impact on the three-dimensional structure ofproteins

• Explain the steps of transcription and translation in protein synthesis • Discuss the role of naturally occurring proteins and recombinant

proteins in biotechnology• Differentiate proteins that function as part of structure, as antibodies,

and as enzymes• Describe the structure of antibodies and explain the relationship

between antibodies and antigens• Discriminate among the classes of enzymes and discuss the effect of

reaction conditions on enzyme activity• Summarize polyacrylamide gel electrophoresis and identify its

usefulness for studying proteins

5.1 The Structure and Function of Proteins Virtually all of the many different kinds of biotechnology products havesomething to do with proteins. Many biotechnology products, includingrecombinant insulin (rhInsulin), are actually whole protein molecules.Other products contain protein molecules as a key ingredient, such asthe enzymes found in contact lens cleaner. Some products contain partsof protein molecules. For example, the artificial sweetener aspartame iscomposed of two linked amino acids. Many biotechnology products arewhole organisms characterized by making a new or novel protein. Oneexample is Roundup Ready® soybeans, by Monsanto, Inc, that containan added protein for herbicide resistance. Some products are instrumentsused to study or synthesize proteins, for example, the AppliedBiosystems, Inc protein synthesizer. Protein production is so important inbiotechnology that many biotech companies may employ over half oftheir scientific staff in protein chemistry or protein process development.

To produce a protein product, researchers must learn about the struc-ture and function of the protein, as well as the amino-acid sequence.Several instruments and techniques are used. One important determination

Biotech_ch05.qxd 12/9/05 9:46 AM Page 131

is the molecular mass of a protein molecule, which is achieved using an instrumentcalled a mass spectrometer (see Figure 5.1).

It is also important to know the three-dimensional structure of a protein. This isaccomplished through x-ray crystallography and computer analysis of the x-ray dif-fraction data. An x-ray beam is shined on a very pure crystal of the protein of inter-est. As the beam hits the atoms of a protein molecule in the crystal, the x-ray light isdiffracted off the atoms. A detector records the pattern of x-ray diffracted light. Atrained technician with the aid of a computer can interpret the x-ray diffraction dataand generate a three-dimensional image of the protein molecule (see Figure 5.2).Several computer-generated images, determined through x-ray crystallography, areshown in this chapter.

In an effort to research and develop new products, scientists also study the chemi-cal behavior of a protein, such as its activity, solubility, and electrical charge. Oncethe structure and function of a protein are ascertained, researchers develop andimprove methods of isolating, purifying, and analyzing the protein. It takes a greatdeal of lab work and understanding of the protein to develop a reliable process forproducing the protein on a commercial scale.

Protein Molecule StructureProtein molecules are polymers composed of amino acids. Amino acids are relativelysmall molecules (see Figure 5.3). Each has a central carbon atom with a carboxyl(COOH) group on one side and an amino group (NH2) on the other side. Each aminoacid has an R-group that distinguishes it from other amino acids. The R-group is attached

at the central carbon and varies in length andshape. “R” is used in molecular formulas to indi-cate a nonspecified side chain. It is the R-groupthat determines an amino acid’s interaction withother amino acids in a protein chain.

Twenty different amino acids are found inproteins. They are categorized based on thechemical nature of their R-groups. The R-groups may be charged (+ or -), polar (watersoluble), or uncharged (not water soluble) at aneutral pH (see Table 5.1).

132 Chap ter 5

Figure 5.1. Mark Cancilla, a protein scientist at Sunesis, Inc.,uses a mass spectrometer to shoot samples through an ionizer.The sample travels at a rate proportional to its mass andcharge. This allows the user to determine the molecular massof the molecule(s) in a sample, which is important fordetermining the protein composition and purity of a sample.Photo by author.

Figure 5.2. This is a computer-generated model of thestructure of acetylcholinesterase, an enzyme that breaks down molecules (acetylcholine into acetate and choline) in the junction betweeen nerve cells. This process is important for the regulation of nerve impulses.© Corbis.

x-ray crystallography (x-raycrys•tal•log•ra•phy) a tech-nique used to determine the three-dimensional structure of a protein

polar (po•lar) the chemicalcharacteristic of containing both apositive and negative charge onopposite sides of a molecule

Figure 5.3. Structure of an Amino Acid.

CO

OHH

HH

R-groupcarboxyl

groupamino group

Every amino acid has the samebasic structure, differing only in

"R-group."

N C


Most proteins contain tens or hundreds of amino acids chained together by peptidebonds. A peptide bond is formed between the carboxyl group of one amino acid andthe amino group of an adjacent one. The bonding of amino acids, through peptidebonds, into long polypeptide molecules occurs at a cell’s ribosomes. A polypeptidechain is referred to as a protein’s primary structure (Figure 5.4). It is the messengerribonucleic acid (mRNA) instructions, from one or more genes (DNA) on the cell’schromosomes, that detail which amino acids are to be placed into the polypeptidechain and in what order. Protein synthesis is discussed in more detail in a later section.

As the polypeptide chain is assembled, it begins to fold into a protein. The three-dimensional folding of a protein, which is so vital to its function, depends complete-ly on how the different amino acids in the chain interact with each other. In thepolypeptide chain, hydrogen bonding between hydrogen, oxygen, and nitrogenatoms results in helices (each called an alpha helix) and folds (beta sheets) as shownin Figures 5.5 and 5.6. These folds and helices make up what is called the second-ary structure.

Additional folding in proteins is called tertiary structure. Tertiary folding is duemainly to the presence of charged or uncharged R-groups. For example, amino acidswith charges are attracted by amino acids of an opposite charge and repelled bythose of the same charge.Thus, positively chargedarginine molecules areattracted to negativelycharged aspartic acid mol-ecules and repelled by his-tidine molecules. Sectionsof a strand are pulled orpushed as these chargedamino acids try to getcloser to or farther fromeach other.

Introduction to Studying Proteins 133

Figure 5.4. Peptide Chain. A peptide bond forms when thecarbon of one amino acid’s carboxyl group bonds to the nitrogen ofanother amino acid.

C

H

HH O

amino (N)terminal end

carboxyl (C)terminal end

N C C

H

CH2

C

H

N

CH3

N

H

COO

CH2

Ph

O

C OH

O

C

H

R-group

peptide bonds

R-groupFigure 5.5. Alpha Helix. Tightcoils due to hydrogen bondingcan be found in several proteins,resulting in helices as shown here.The diagram represents H-bondsby tiny dashes between carbon,oxygen, or nitrogen atoms and ahydrogen atom.

CC

N C CN

CCN

H

CCNC

H

O

H

H

OO

CN C C

N

CCNCCN

H

O

H

H

O

H

O

primary structure (pri•mar•ystruc•ture) the order and typeof amino acids found in a polypep-tide chain

secondary structure(se•con•dar•y struc•ture) thestructure of a protein (alpha helixand beta sheets) that results fromhydrogen bonding

tertiary structure (ter•ti•ar•ystruc•ture) the structure of aprotein that results from severalinteractions, the presence ofcharged or uncharged “R” groups,and hydrogen bonding

Amino Acid R-Group Chemical Nature

alanine CH3- uncharged, nonpolarvaline (CH3)2-CH- uncharged, nonpolarisoleucine CH3-CH2-CH(CH3)- uncharged, nonpolarleucine (CH3)2-CH-CH2- uncharged, nonpolarproline NH-(CH2)3- uncharged, nonpolarmethionine CH3-S-(CH2)2- uncharged, nonpolarphenylalanine Ph-CH2- uncharged, nonpolartryptophan Ph-NH-CH=C-CH2- uncharged, nonpolarglycine H- polarcysteine HS-CH2- polar, -SH bonds between -SH groupsserine HO-CH2- polarthreonine CH3-CH(OH)- polartyrosine HO-p-Ph-CH2- polarasparagine H2N-CO-CH2- polarglutamine H2N-CO-(CH2)2- polararginine HN=C(NH2)-NH- basic (positively charged)histidine NH-CH=N-CH=C-CH2- basic (positively charged)lysine H2N-(CH2)4- basic (positively charged)aspartic acid HOOC-CH2- acidic (negatively charged)glutamic acid HOOC-(CH2)2- acidic (negatively charged)

Table 5.1. Amino Acids Found in Proteins


Equally important to tertiary folding are the interactions between polar and nonpo-lar amino acids. Folding occurs when nonpolar amino acids (which are hydrophobicand repelled from water) crowd together. In contrast, polar amino acids (which arehydrophilic and attracted to water) move away from polar or hydrophobic regionsand toward the outside of the molecule. Polar amino acids attract other polar aminoacids and repel nonpolar ones. Thus, glycine, serine, and tyrosine molecules will tryto move close to each other, while leucine, proline, and tryptophan will move awayfrom the polar molecules and try to clump up with other nonpolar molecules.Nonpolar amino acids clump together and try to get away from water molecules sur-rounding the protein.

Finally, disulfide bonds, which occur between cysteine molecules, also produceand stabilize tertiary folding in and between polypeptide chains. Within a polypep-tide chain, disulfide bonds can make large loops. In proteins with more than onepolypeptide chain, such as hemoglobin, disulfide bonds hold the chains to eachother. This is called quaternary structure.

Most of the folding pattern characteristic of a specific protein results from theattraction and repulsion of amino acids within and between polypeptide chains (terti-ary and quaternary structures). Therefore, the amino-acid order coded for on theDNA is critical to determining the ultimate structure and function of a protein.

Function of Structural ProteinsChapter 2 introduced protein structure and function relative to several important pro-tein groups, including enzymes and hormones. This and later sections present addi-tional information on the structure and function of some important protein groups.

Several proteins demonstrate well the relationship between structure and function.A good example is a viral recognition protein, glycoprotein 120 (gp120). A glycopro-tein is a protein on which sugar groups have been added. Glycoprotein 120 exists onthe surface of the human immunodeficiency virus (HIV), the virus that causesacquired immunodeficiency syndrome (AIDS). For an HIV particle to recognize,attach, and infect a T-helper cell, the gp120 structure must be a precise shape andmust exactly match its human cell membrane receptors (see Figure 5.7).

Glycoprotein 120 is a single polypeptide chain of hundreds of amino acids foldedinto five looped domains. The loops are formed because of several disulfide bondsthat stabilize the shape of the functional protein. The chains are highly glycosylated

134 Chap ter 5

Figure 5.6. Beta-pleated Sheets. Hydrogen bonding may also result in folds, or beta(beta-pleated) sheets.

CC

CC N

N CC

CC N

N CC

CC N

N CC

CC N

O

H

O

H

O

H O HN

O

H

O

H

O

H

O

H

N

HN

H

N

H

O

C

O

CC

OC

O

OO

N

H

N

HN

H

N

H

CCCC C C

quaternary structure(qua•ter•na•ry struc•ture) thestructure of a protein resulting fromthe association of two or morepolypeptide chains

glycoprotein (gly•co•pro•tein)a protein which has had sugargroups added to it

glycosylated (gly•co•sy•lat•ed)descriptive of molecules to whichsugar groups have been added


(bound with sugar groups) projecting out from the amino acids at regular intervals.The loops, which jut out from the center, act as recognition sites. These regionsmatch protein receptors on the CD4 cells that HIV infects. Antibodies also recognizethese HIV looped domains.

One of the looped domains has a shape that is an exact match to the CD4 mole-cule, which is a recognition protein on the surface of human white blood cells(WBCs). When the HIV’s gp120 surface protein bumps into a CD4 molecule, it trig-gers a set of reactions that results in the HIV particle being taken up by the cell. Inthis way, HIV infects cells.

The HIV has a protein coat covered by gp120 proteins. The protein coat sur-rounds the genetic information found inside. HIV is a retrovirus containing two mol-ecules of RNA, as the genetic material, plus two reverse transcriptase enzymes,which make viral DNA. When HIV infects a cell, the RNA is reverse-transcribed intoa DNA molecule by the reverse transcriptase enzymes. The resulting “viral” DNAincorporates into the infected cell’s chromosome and begins directing viral proteinproduction, as represented in the following diagram:


Figure 5.7. Scientists usecomputer modeling to study andunderstand the precise shapesand interactions betweenmolecules. Molecular recognitionis important in viral infection andtherapies.© Lester Lefkowitz/Corbis.

reverse incorporated at the cell’stranscriptase into infected cell’s DNA ribosome

HIV RNA ➔ HIV cDNA ➔ gp120 RNA ➔ gp120 ➔ into a new HIV virus

The primary structure of the HIV gp120 polypeptide is coded for on the virus’RNA. When the viral DNA incorporates into the host cell’s chromosome, the gp120gene is read and gp120 mRNA is produced, leading to gp120 protein production forthe next generation of viruses.

Reverse transcriptase is an inaccurate enzyme making many mistakes per transcrip-tion. The result is variations in the gp120’s looped domains. The differences in thegp120 amino-acid sequence cause differences in the primary structure, and, then, differ-ences in folding and tertiary structures. The mutations in the HIV viral DNA producenew strains of HIV (including the strains Chiang Mai, MN, and IIIb) that some antibod-ies may no longer recognize. Since a person fights infection bymaking antibodies that recognize foreign proteins, the high muta-tion rate in HIV surface proteins makes it particularly challengingto manufacture a vaccine to treat HIV. Even so, many companiesare trying to develop vaccines that will cause the body to pro-duce antibodies to one or more of these common strains.

Function of Antibody ProteinsAnother group of proteins, the antibodies, is structurally inter-esting and functionally very important. The function of an anti-body is to recognize and bind foreign proteins or other mole-cules (antigens), ultimately for removal from the body. Sincethere are potentially thousands of different foreign invaders,the body must be able to make thousands of different antibod-ies to recognize them.

Each type of antibody has the same basic shape. Antibodiesare composed of four polypeptide chains (quaternary structure)attached through disulfide bonds (see Figure 5.8). The chainsare arranged into a shape resembling the letter “Y.” There arefour polypeptide chains: two heavy chains and two light chains.

The base of each antibody has an identical primarysequence of amino acids. This area is called “the constantregion.” The variability seen in antibodies, which allows themto recognize different molecules, is found at the top of the “Y,”

Figure 5.8. Antibody Structure. Thousand of antibodiesare produced in the body by using the same genetic code as astarting sequence. Then, by shuffling DNA sections, newvariable regions are created to produce thousands of differentkinds of antibodies.

S:S

S:S

constantregion

variableregion

light chain

heavy chain

CD4 cells (CD4 cells) referringto human white blood cells, whichcontain the cell surface recognitionprotein CD4

reverse transcriptase (re•versetran•scrip•tase) an enzyme thattranscribes a complementary strandof DNA from a strand of RNA

antigens (an•ti•gens) foreignproteins or molecules that are thetarget of binding by antibodies


in the variable region. The DNA code for the primary sequence of this region is shuf-fled to produce an infinite variety of A, C, G, T codes. Thus, there are an infinitenumber of amino-acid sequences that produce thousands of different recognitionsites for the ends of antibodies.

Most antibodies are very specific, binding only to distinct molecules (see Figure5.9) or specific regions, called epitopes, on a specific molecule. In the lab, antibod-ies may be used to recognize and bind certain molecules. Antibody specificity is par-ticularly useful in the purifying of proteins from cell cultures. Under the right condi-tions, a single protein can be isolated from a mixture of hundreds of proteins usingan antibody chromatography column. In a column, beads with antibodies are used asa means of separating a target molecule from a mixture. The antibodies attach only toa matched molecule, allowing all other undesirable molecules to pass through thecolumn. Chapter 9 discusses column chromatography in detail.

Often, antibodies are used as commercial testing reagents or as test kits duringresearch and manufacturing (see Figure 5.10). Pregnancy tests are an example of acommercial testing kit that uses antibodies to detect proteins, in this case, proteinsassociated with pregnancy.

A common test used to determine the presence and concentration of a protein insolution is an enzyme-linked, immunoabsorbent assay (ELISA) (see Figure 5.11). Inan ELISA, a sample that is suspected to contain a particular protein is tested with aspecial antibody-enzyme complex that recognizes the protein of interest. When theantibody recognizes and binds to the protein in solution, the attached enzyme causesa color change in a reagent. The amount of color change depends on the amount ofantibody that bound to the protein in the sample. ELISAs are very important in pro-tein studies and manufacturing. They are discussed in more detail in Chapter 14.

A special group of antibodies is the monoclonal antibodies. Monoclonal antibod-ies are produced in cells made by fusing immortal tumor cells with specific antibody-producing WBCs (B-cells). The resulting cells, called hybridomas, grow and grow,making large amounts of the specific antibodies that were coded for in the original B-cells. The advantage of monoclonal antibody technology is that many identical anti-bodies to specific epitopes are produced in large quantities. These can be used ingenetic testing and research (see Figure 5.12).

At several biotechnology companies, many interesting antibodies are currentlybeing produced through genetic engineering. One, the anti-HER2 antibody

136 Chap ter 5

Figure 5.9. Immunoglobulin E (IgE) is one class of the antibodiesthat circulate in mammals. IgEs are strongly attracted to and bind tothe mast cells in blood cells, skin, and connective tissues. Whenpollen grains (gold) attach to the IgEs at the tips of the top of the“Y,” the allergen (pollen)-IgE combination triggers the mast cells torelease granules (tiny blue dots), causing an inflammatory response.© Alfred Pasieka/Science Photo Library.

Figure 5.10. Rapid antibody-antigen assays for the detectionof several viruses, bacteria, or other disease-causing agents,including HIV, Mad Cow disease, and influenza, are nowcommercially available. In this anthrax antibody test kit, testsolutions contain an antibody to a protein found on thesurface of the anthrax bacterium.© Pallava Bagla/Corbis Sygma.

epitope (ep•i•tope) the specificregion on a molecule that an anti-body binds to

ELISA (E•LI•SA) short forenzyme-linked immunospecificassay, a technique that measuresthe amount of protein or antibodyin a solution

monoclonal antibody(mon•o•clon•al an•ti•bod•y)a type of antibody that is directedagainst a single epitope

hybridoma (hy•brid•om•a) ahybrid cell used to generate mono-clonal antibodies that results fromthe fusion of immortal tumor cellswith specific antibody-producingwhite blood cells (B-cells)

Biotech_ch05.qxd 12/9/05 9:46 AM 6

(Herceptin® by Genentech, Inc), recognizes an overproduction of the HER2 protein,which is a growth factor protein found in abnormally large amounts on the surfaceof cells responsible for an aggressive form of breast cancer. About 25% to 30% ofpatients with breast cancer have this aggressive form.

The anti-HER2 antibody variable region matches and binds only to the HER2 pro-tein epitope. Since the match is so precise, the antibody can be used to diagnose andtreat the forms of breast cancer expressing these proteins. In afflicted patients, theHER2 protein genes are present in multiple copies. Since HER2 proteins are involvedin regulating growth, numerous copies of the gene cause an excess of HER2 proteinproduction. That, in turn, speeds tumor growth and the progression of the cancer.

Through genetic engineering technology, the human HER2 antibody has beenproduced in, and purified from, Chinese hamster ovarian (CHO) cells. The antibodyattaches only to cells expressing the HER2 protein and blocks or inactivates them.These antibodies only target certain cells, resulting in treatment that is more effective,with fewer side effects than traditional chemotherapies. The anti-HER2 antibody dra-matically illustrates how the tertiary structure of an antibody is critical to its function.


Figure 5.11. An ELISA recognizes the presence andconcentration of a particular molecule in a sample. A sample isput into each well. An antibody that recognizes a protein in thesample is added to each well. The antibody has an enzymebound to it that causes a color change when a certain othersubstrate is added. The more protein in a sample, the more theantibody binds to the protein, and the darker the color change.© Lester V. Bergman/Corbis.

Figure 5.12. Researchers have developed monoclonalantibodies that detect two disease-causing organisms, Bagesiaequii and Babesia caballi. These pathogens cause the diseasepiroplasmosis, or equine babesiosis, which is deadly to horses.Fortunately, at this time, these diseases do not exist in theUnited States.Photo courtesy of Scott Bauer, ARS/USDA.

Antibody-Producing Companies Many companies manufacture and sell antibodies for pharmaceuticals or research and development.

Conduct an Internet search to locate a company that makes antibodies. Findinformation to answer the following questions:

• What are the company’s name, location, and Web site address?• Identify one of the antibodies that the company makes. What is the function of the

antibody and what is the market for it?• Give two additional interesting facts about the company or the antibody.• List one additional Web site that would be of interest to someone studying

the antibody.

T OD O


Section 5.1 Review Questions1. How many different kinds of amino acids are found in proteins? What

distinguishes one amino acid from another?2. What causes polypeptide chains to fold into functional proteins?3. How many polypeptide chains are found in an antibody, and how are

they held together in a protein?4. What is the value of monoclonal antibody technology?

138 Chap ter 5

5.2 The Production of ProteinsUntil fairly recently, proteins could be made only in cells. Now, with new technolo-gies, small polypeptide chains can be synthesized in the laboratory (see Figure 5.13).These have been used mostly in research to understand how cells and tissues work,and how molecules interact. Recently, though, some small peptides are also beingused in medicinal applications and therapies.

Proteins are very long and complex molecules that require cellular apparatus fortheir synthesis. Biotechnologists exploit cells’ protein-making abilities to producehigh yields of native proteins or novel, different proteins. The proteins are harvestedfrom large volumes of cell cultures and are used for a variety of applications.

Overview of Protein SynthesisCells are protein-producing powerhouses. Proteins are so vital to every cellular activitythat protein synthesis occurs continuously throughout a cell’s life. At any givenmoment, thousands of genes are being decoded into millions of protein molecules.Over a typical cell’s lifetime, it will produce more than 2000 different kinds of proteins.

Although prokaryotes and eukaryotes are different in many ways, the basicprocess of protein synthesis is strikingly similar in all cells. DNA molecules code forprotein production, mRNA is decoded off DNA sections, and mRNA is processed atribosomes to make polypeptide chains (see Figure 5.14).

In cells, the instructions for building a protein are stored within one or morestructural genes on a DNA molecule of a chromosome. A typical chromosome hashundreds or thousands of genes. During gene expression, a structural gene is

rewritten in the form of a short messenger molecule,mRNA. Depending on the protein to be synthesized, oneor many mRNA transcripts may be made. The mRNAtranscripts may be used “as is,” or may have intronsremoved to create functional mRNA strands. The func-tional mRNA strand floats to a ribosome, where thenucleotide code is translated, and a polypeptide strandof amino acids is compiled. The polypeptide chain thenspontaneously folds into a protein due to the attractionand repulsion of the amino acid’s R-groups. The proteinmay remain and function inside the cell, or it may betransported outside the cell to work locally. If it is a mul-ticellular organism, the protein may function in a distinctpart of the body.

Transcription and TranslationProtein synthesis occurs in a two-step process. First, thegenetic code must be rewritten onto a messenger molecule

Figure 5.13. Hanson Chan, a lab technician at CS Bio, MenloPark, CA, operates a high-performance liquid chromatographyinstrument. CS Bio makes peptides to order for their clients.They also make and sell peptide synthesizers. The HPLC is usedto check the purity of peptides before they are shipped.Photo by author.

protein synthesis (pro•teinsyn•the•sis) the generation ofnew proteins from amino acid sub-units; in the cell, it includes tran-scription and translation

transcription (tran•scrip•tion)the process of deciphering a DNAnucleotide code and converting itinto an RNA nucleotide code; theRNA carries the genetic message toa ribosome for translation into aprotein code


(mRNA). This step is a process called transcription (see Figure 5.15).During transcription, sections of DNA (genes) are unwound. The tran-scription enzyme, RNA polymerase, attaches to a promoter region at thebeginning of a gene. The RNA polymerase reads the structural gene andbuilds a nucleic acid chain (mRNA), which is a complement to thestrand being transcribed.

Transcription results in an mRNA molecule with a complementarycode of a structural gene on the DNA strand. If the DNA contains a G(guanine), the mRNA transcript will receive a C (cytosine). If the DNAcontains a C, the mRNA transcript will receive a G. If the DNA con-tains a T (thymine), the mRNA transcript will receive an A (adenine).If the DNA contains an A, the mRNA transcript will receive a U(uracil). The RNA molecule is very similar to the DNA strand, exceptthat it is single-stranded, has ribose molecules instead of deoxyribosemolecules, and instead of thymine, it uses uracil as a complementarybase for adenine.

If the gene to be transcribed had the following sequence (remem-ber, only one side of the DNA is read):

TAC TTG GGC TCC CTT CTG GGG CAT ACT DNA strand,

the mRNA molecule produced would have the complementary codereplacing thymine nucleotides with uracil nucleotides as follows:

AUG AAC CCG AGG GAA GAC CCC GUA UGA mRNA strand.

In eukaryotic cells, transcription takes place in the nucleus.Posttranscriptional excision of introns may occur before the mRNAtranscript moves out of the nucleus on its way to a ribosome.

If the cell is a prokaryote, where there is no nucleus, transcriptionoccurs on the DNA floating in the cytoplasm. Ribosomes move to themRNA strands and begin translating them immediately, three


Figure 5.14. Protein Synthesis in a Eukaryotic Cell. In a eukaryotic cell, DNA islocated within chromosomes in the nucleus. The mRNA transcripts carry the DNAcode out to the ribosomes, which translate the code into a strand of amino acids.

nucleuscytoplasm

ribosome

tRNA chain

amino acid

new polypeptide chain

mRNARNA

polymerase

DNA

Figure 5.15. Transcription Process in ProteinSynthesis. The mRNA is a complementary code tothe DNA at the structural gene; A transcribes to U, G toC, T to A, and C to G.

transcribed mRNA

gene

RNApolymerase

GGAAGACCCCGUAUGA

CCCAAGUA

GAG

TA

CTTGGGCTCCCTTCTGGGGCATACT


nucleotides at a time. Each group of three nucleotides, called a codon, codes for anamino acid in the eventual protein chain.

During the second step of protein synthesis, called translation, the mRNAnucleotide code is rendered into a sequence of amino acids. Translation begins whenthe strand attaches to the bottom unit of a ribosome. An mRNA molecule usuallybegins with the code AUG, the “start” codon, which attaches to the bottom ribosomalsubunit. Six nucleotides at a time fit in the ribosome, but the code is read threenucleotides (a codon) at a time (see Figure 5.16). Each codon corresponds to one ofthe 20 amino acids.

Transfer RNA (tRNA) molecules pick up amino acids in the cytoplasm and shuttlethem into the ribosome. When a tRNA molecule brings the correct amino acid intoplace, a resident enzyme in the ribosome, peptidyl transferase, bonds the aminoacids together with a peptide bond. The ribosome shifts to the next triplet codon andallows the next tRNA-amino-acid complex to attach. Another bond is made by thepeptidyl transferase, and so on, until the mRNA transcript has been completely read.

It is the code on the mRNA that determines which tRNA-amino-acid complex willbond, in which order, in the ribosome. The mRNA codon chart (see Table 5.2) showsthe amino acid that will be added to the polypeptide strand for a given codon on themRNA strand. To read the chart, look down the left column, then across the top, andthen down the right column. For example, if the mRNA code is AAG, find A in theleft column, A along the top, and G in the right column. Where they intersect is theamino acid, lysine.

Every time another amino acid is added to a growing polypeptide chain, the ribo-some shifts one codon down the mRNA strand. Then another amino acid is added,and so on, until the ribosome reaches a “stop” codon. When the ribosome reaches a

140 Chap ter 5

Figure 5.16. Translation Process in Protein Synthesis. The genetic language of nucleotides used inDNA and RNA molecules is translated into a new language of amino acids in a protein.

amino acids

ribosome

Peptidyl transferase forms peptidebonds between amino acids.

transfer RNA-amino acids

complex

mRNA

polypeptide chain of amino acids

codon (co•don) a set of threenucleotides on a strand of mRNAthat codes for a particular aminoacid in a protein chain

translation (trans•la•tion) theprocess of reading an mRNAnucleotide code and converting itinto a sequence of amino acids

tRNA (tRNA) a type of ribonucle-ic acid (RNA) that shuttles aminoacids into the ribosome for proteinsynthesis

peptidyl transferase (pep•tid•yltrans•fer•ase) an enzyme foundin the ribosome that buildspolypeptide chains by connectingamino acids into long chainsthrough peptide bonds


UAA, UAG, or UGA, the polypeptide chain disconnects. After translation, thepolypeptide folds into a final three-dimensional configuration. Some proteins mayneed posttranslational modifications, such as the addition of sugar groups (glycosyla-tion). Once folded and modified correctly, so that it is functional, the polypeptide isconsidered a protein. Figure 5.17 illustrates protein synthesis in a bacteria cell.


Figure 5.17. Bacteria Protein Synthesis. Protein synthesis occurs in the cytoplasm. As the mRNArolls off the DNA, ribosomes attach and start to assemble the protein. Determine what mRNA strandand what polypeptide would be produced from the outer DNA strand in this diagram.

mRNA

circular single chromosome

ribosome

growing polypeptide

tRNA-AAcomplexes

T AC

TT

TG

GGTTACCA

AT

T

A CGTTTCC

AA

G

TGGTTA

A

2nd Base ➔

1st Base U C A G 3rd Base

UUU\ phenylalanine UCU UAU\ tyrosine UGU\ cysteine U

U UUC/ UCC serine UAC/ UGC/ CUUA\ leucine UCA UAA\ stop UGA- stop AUUG/ UCG UAG/ UGG- tryptophan G

CUU CCU CUA\ histidine CGU U

C CUC leucine CCC proline CAC/ CGC arginine CCUA CCA CAA\ glutamine CGA ACUG CCG CAG/ CGG G

AUU\ ACU AAU\ asparagine AGU\ serine U

A AUC isoleucine ACC threonine AAC/ AGC/ CAUA/ ACA AAA\ lysine AGA\ arginine AAUG methionine ACG AAG/ AGG/ G

GUU GCU GAU\ aspartic acid GGU U

G GUC valine GCC alanine GAC/ GGC glycine CGUA GCA GAA\ glutamic acid GGA AGUG GCG GAG/ GGG G

➔

Table 5.2. Codons in mRNA


In cells, virtually every protein is made in the fashion described above. Once apolypeptide folds, it may be further modified by additional groups attaching. Such isthe case with gp120. Recall that the “gp” in gp120 stands for glycoprotein. After thepolypeptide is constructed, enzymes add sugar groups (glyco-) to some of the aminoacids. Other posttranslational modifications include phosphorylation (adding phos-phate groups) or cleavage (splitting the polypeptide into one or more strands).Insulin is an example of a protein that is cleaved from proinsulin (a larger, inactiveform) to insulin (a shorter, active form).

The Importance of Proteins in Biotech R&DThe ability to synthesize and modify peptides or proteins is crucial to the productionof virtually every biotechnology product (see Figure 5.18). Sometimes a protein is thedesired marketable product of a company, as in the case with the proteases (protein-digesting enzymes) manufactured by Genencor International, Inc or protein hor-

mones by Genentech, Inc. But even for companies whoseproducts are not proteins, these important moleculeshave many uses in research and product development.

One very important group of proteins is the enzymes.Just as enzymes catalyze (speed up) nearly every chemi-cal reaction in cells, enzymes also control most steps inthe production or breakdown of a biotechnology prod-uct. Enzymes are added to reactions performed in testtubes to mimic reactions that could normally only occurin cells. In this way, scientists can make cellular productsin test tubes. Such is the case with Taq polymerase,used for a polymerase chain reaction (PCR). During PCR,a fragment of DNA is copied and recopied to producemillions of identical DNA fragments. Taq polymerase isthe enzyme that actually assembles the new DNA strandsduring PCR. In nature, DNA is only synthesized in divid-ing cells, but by using the Taq polymerase enzyme, thou-sands of identical DNA pieces can be made in test tubes,within a few hours, for research or diagnosis purposes.

A large segment of the biotechnology industry is cur-rently making enzymes for commercial purposes.Enzymes are so important that they are the focus of thenext section of this chapter.

142 Chap ter 5

Figure 5.18. Peptide synthesizers can synthesize smallpeptide chains. These machines use samples of amino acidsand other reagents to make peptides that are 2 to 25 aminoacids long. The peptides may be used in research anddevelopment, or as therapeutic molecules.Photo by author.

phosphorylation(phos•phor•y•la•tion) addingphosphate groups

cleavage (cleav•age) process ofsplitting the polypeptide into twoor more strands

Taq polymerase (Taqpo•ly•mer•ase) a DNA synthe-sis enzyme that can withstand thehigh temperatures used in PCR

Couch Potatoes, RelaxIt is well known that physical exercise offers many benefits, but some people arenot able to exercise for medical reasons and, thus, cannot enjoy those benefits.Scientists recently have discovered a biochemical pathway (a series of enzymaticreactions) that could bestow the benefits of exercise without actually exercising.

Access a medical database to learn about enzymes with medicalapplications.

Go to the Duke University Medical Center Web site at:http://dukemednews.duke.edu/news/article.php?id=5445 Describe their recent discovery and how it may lead to a new drugthat could improve people’s quality of life.

T OD O

Photo by Paul Robinson.


Section 5.2 Review Questions1. Distinguish between transcription and translation.2. If a structural gene’s code is “TAC GGC ATG CCC TTA CGC ATC,” what

will the mRNA transcript be?3. If the mRNA transcript from question No. 2 were translated into a pep-

tide, what would the amino-acid sequence of the peptide be?4. What is the name of the machine that can make small sections of amino-

acid chains?


5.3 Enzymes: Protein CatalystsEnzymes are proteins that act as catalysts. They speed up biochemical reactions, buildingup or breaking down other molecules. DNA polymerase is an example of an enzymethat speeds a synthesis reaction. DNA polymerase puts nucleotides together into a grow-ing DNA strand. On the other hand, DNase is an enzyme that speeds the breakdown ofDNA into short chains of nucleotides or all the way down to individual nucleotides.

Enzymes are involved in virtually every reaction in a cell. Without them, cellswould die waiting for reactions to happen. When scientists conduct reactions in testtubes, enzymes are usually involved. Usually, only tiny volumes of enzymes areneeded since they are not used up in the reaction. Some enzymes are sensitive toenvironmental conditions such as high temperatures. Technicians must learn howhandle enzymes to ensure maximum enzyme activity.

Since enzymes are made only in living cells, if an enzyme is needed in significantamounts for research or manufacturing, it must be extracted from existing or engi-neered cells. Manufactured enzyme products are produced in large fermentation tanks,which ensures that concentrations and volumes are high enough to generate revenue.

Many companies have focused on producing enzymes for sale. For example,Genzyme Corporation produces an enzyme called Cerezyme®. Cerezyme® is usedto replace an enzyme (glucocerebrosidase) that is lacking in patients withGaucher disease, an inherited disorder that causes fatty buildup in cells.Depending on the type of Gaucher’s disease, patients can have almost no symp-toms, or, in some severe cases, life expectancy may not extend beyond childhood.Glucocerebrosidase is a lipase that breaks down fats and makes fat removal possi-ble from the afflicted cells. Cerezyme® is a recombinant form of glucocerebrosi-dase, which can be given to patients who do not produce their own glucocere-brosidase. Producing replacement enzyme therapy, such as Cerezyme®, is a strate-gy of several biotechnology companies.

Enzymes and Their SubstratesThe molecules upon which enzymes act are called substrates. Enzymes are usuallyhighly specific in that each enzyme catalyzes only one type of chemical reaction andhas one or only a few substrates. Some enzymes, such as proteases, break downlarge protein molecules into smaller ones, as shown in the following equation:

proteasekeratin ➔➔➔ amino acid1 + amino acid2 + etc.

Some enzymes build larger molecules. These biosynthetic enzymes produce the mol-ecules needed in organisms for structural purposes or other chemical reactions. In ribo-somes, peptidyl transferase builds polypeptide chains by bonding amino acids into longchains. DNA polymerase bonds nucleotides into DNA strands during DNA replication.

substrate (sub•strate) the mole-cule that an enzyme acts on


Enzymes are usually named for their substrates or for the function they perform,with the suffix “-ase” added to the end of the name (see Table 5.3). For example,DNase decomposes DNA. Another enzyme, lipase, acts on lipids, degrading them toglycerol and fatty acids. Some of the first enzymes discovered were not named in thisway. Among them is the enzyme pepsin (a protease), which breaks down proteins inthe stomachs of mammals.

Many enzymes require additional units, called cofactors, to operate. Cofactors canbe as simple as an ion, such as calcium, or a large organic compound, called a coen-zyme. The coenzyme is often a vitamin or part of a vitamin. Modified thiamin andniacin vitamin molecules are common coenzymes. Some enzymes require ions, suchas Ca2+ or Mg2+, as cofactors. For example, DNA polymerase and many of the DNAdegrading enzymes require Mg2+ ions to be active. Amylase, which breaks downstarch into sugar units, requires Ca2+ ions.

Most enzymes are huge molecules consisting of hundreds of amino acids andsometimes containing multiple polypeptide chains. Enzymes are produced in thesame manner as other proteins. The genes of a species control the kinds of enzymesits members make. Enzyme genes are expressed when mRNA is transcribed off theenzyme gene and the enzyme is assembled at a ribosome.

The catalytic action of enzymes occurs in a small region on the enzyme called theactive site, where the substrate and the enzyme fit together (see Figures 5.19 and5.20). This accounts for an enzyme’s specificity for a particular substrate. When

144 Chap ter 5

Figure 5.19. Adenosine deaminase (green molecule) binds one of its substrates, 6-hydroxy-1, 6-dihydro purine nucleoside (red). Zinc ions (white) are a required cofactor foradenosine deaminase activity. Adenosine deaminase is of critical importance in humans. Ifit is not present or does not function correctly, the immune system cannot fight infections.© Corbis.

cofactors (co•fac•tors) an atomor molecule that an enzymerequires to function

Enzyme Group General Function Example

hydrolases split their substrates with the aid of water amylase, pepsin, lipase, sucrase,maltase, and DNase

lyases split their substrates without aid pectase lyasetransferases transfer chemical groups between different molecules hexokinaseisomerases rearrange the molecules of their substrates fructose isomeraseoxidoreductases transfer hydrogen ions peroxidasesynthetases bring molecules together to create larger ones ATP synthetase, DNA polymerases,

and RNA polymerases

Table 5.3. Enzyme Groups and FunctionsEnzymes are divided into six categories based on their function.


attached at the active site, a substrate either combines with another or is brokendown, depending on the enzyme’s action on the substrate’s bonds.

There are two theories that describe enzyme catalysis, or how enzymes function.One, the lock and key model, suggests that the enzyme and substrate make anexact molecular fit at the active site, which triggers catalysis. More recently, aninduced fit model was proposed. In this model, a substrate squeezes into an activesite, inducing the enzyme’s activity.

Factors That Affect Enzyme ActivitySeveral factors affect enzyme activity, which are important considerations for techni-cians working with enzymes in a research lab. For example, the amount of substratein a solution affects how quickly enzymes work. The higher the substrate concentra-tion, the more likely it will be for a substrate and enzyme to meet.

The temperature of a reaction has a significant impact on enzyme activity. Eachenzyme has an optimum temperature for maximum activity (see Figure 5.21). Atthis temperature, the enzyme is acting on a maximum number of substrate mole-cules. For salivary amylase, the maximum number of starch molecules is brokendown into glucose units at about 35°C. The optimum temperature for the enzyme,pepsin, is approximately 37°C. As the temperature decreases, fewer substrate mole-cules bump into enzyme molecules. At high temperatures, too much stress is placed


lock and key model (lock andkey mod•el) a model used todescribe how enzymes function, inwhich the enzyme and substratemake an exact molecular fit at theactive site, triggering catalysis

induced fit model (in•duced fitmod•el) a model used todescribe how enzymes function, inwhich a substrate squeezes into anactive site and induces theenzyme’s activity

optimum temperature(op•ti•mum tem•per•a•ture)the temperature at which anenzyme achieves maximum activity

Figure 5.20. This representation of a computer-generated model ofcellulase shows the secondary and tertiary structure that gives cellulase itsfunctional shape. Do you see the seven alpha helices and the beta(pleated) sheet?


on the H-bonds holding the enzyme’s shape, and the enzyme may beginto unravel. The process of proteins losing their structure is called denat-uration. In the lab, most enzymes are kept cold to decrease the chancethat they may denature (see Figure 5.22).

Another factor affecting enzyme activity is pH, the degree of acidity oralkalinity. In solutions of high or low pH, charged ions may interferewith an enzyme’s activity or cause it to denature. Pepsin is an enzyme

that works best at a low pH, such as a pH of 1.5. Most other enzymes prefer a moreneutral pH. Amylase works best at a pH of 7.5. The pH at which an enzyme shows themost activity is called the optimum pH (see Figure 5.23). Enzymes are stored in buffersthat maintain an enzyme at a desired pH. Chapter 7 discusses pH in more detail.

Protein chemists and research associates spend months or years determining theoptimum conditions for the enzymes they are producing. They try to optimize theactivity of the enzyme at certain concentrations, temperatures, and pH levels. A goodexample is the protein subtilisin. Subtilisin is a protease that degrades proteins inclothing stains, such as gravy or blood. Companies manufacture subtilisin and sell itto laundry detergent manufacturers as an additive to make the detergent more effec-tive. When Genencor International, Inc scientists learned how to clone and purify theenzyme subtilisin, they first had to determine how subtilisin degrades proteins undernormal conditions. Next, they determined the optimum conditions for subtilisin activi-ty. Finally, they manipulated the enzyme’s genetic code to change its structure so that

146 Chap ter 5

Figure 5.23. The Effect of pH on Enzyme Activity.Each enzyme has a pH at which it works best. This iscalled the optimum pH. In this example, theoptimum pH is close to 7. At a pH much higher orlower, enzyme activity drops off rapidly. At pH valuesabove and below the optimum pH, enzyme activitycan decrease dramatically.

enzy

me

activ

ity

pH

1 2 3 4 5 6 7 8 9 10 11 12 13 14

optimumpH

Figure 5.21. Effect of Temperature on EnzymeActivity. Each enzyme has a temperature atwhich it works best. Enzyme activity decreasessubstantially at a pH much higher or lower thanthe optimum one. At colder temperatures,enzymes do not come into as much contact withtheir substrate, so enzyme activity is low. Keepsamples on ice to decrease the decomposition ofvaluable DNA and protein samples by enzymes.

enzy

me

activ

ity

temperature

optimumtemperature

Figure 5.22A-B. Most proteins are kept at cold temperaturesto prevent degradation. They are stored in refrigerators, coldrooms, or freezers. This cold room is maintained at 4°C. Thedoor is kept closed (A, top), and electronic monitors keep trackof temperature fluctuations. Inside the cold room (B, bottom),samples are stored and some experiments are conducted.Photos by author.

denaturation(de•na•tur•a•tion) the processin which proteins lose their confor-mation or three-dimensional shape

optimum pH (op•ti•mum pH)the pH at which an enzymeachieves maximum activity


Section 5.3 Review Questions1. Name three examples of enzymes and their substrates.2. What happens if an enzyme is at a temperature significantly above its

optimum temperature? 3. What happens if an enzyme is at a pH significantly above or below its

optimum level?4. What would an enzyme be called if it moved methyl groups (-CH3)

between molecules?


Enzymes: Catalysts for Better HealthSome diseases or disorders are due to missing or faulty enzymes. Many medicinal therapies use enzymes fromnatural or genetically engineered sources.

Use Internet resources to fill in the remainder of the chart that identifies theenzymes involved in some diseases or disorders.

T OD O

Description of Enzyme Treatments/Disease/Disorder Disease/Disorder Involved Therapies Web Site

phenylketoneuria (PKU)

galactosemia

protein kinase C (PKC)

glutaric acidemia

alkaptonuria black urine

it would still work in the less-than-optimal conditions of detergents and washingmachines (high temperature and high pH). You can imagine how it takes years ofexperimentation to produce enzymes for sale that work just right.

5.4 Studying ProteinsProteins are usually colorless molecules that are always submicroscopic. To be stud-ied, researchers must separate them from other molecules and determine their specificcharacteristics. There are thousands of different kinds of proteins, but all of them havecertain characteristics in common. Each protein has a complicated three-dimensionalstructure. A protein’s polypeptide chain is composed of 20 different amino acids insome specific length and order. The number and arrangement of amino acids in thepolypeptide determines a specific folding pattern for each polypeptide. Since someamino acids are charged, proteins have a characteristic overall “net charge,” or totalcharge, on the whole molecule, positive or negative, depending on which aminoacids make up the protein. Knowing the net charge and other characteristics, techni-cians can separate the protein during research and manufacturing.

To develop a process for purifying a protein, a researcher must learn the protein’ssize, shape, amino-acid composition, overall charge, and solubility. There are several


sophisticated techniques for studying protein characteris-tics, including amino-acid sequencing, mass spectrometry,and column chromatography. A good first step is to “run”a sample on a gel (see Figure 5.24).

Using gel electrophoresis, a technician can easily sepa-rate charged molecules by size and shape. Medium-sizedDNA molecules are separated and studied using horizontalagarose gel electrophoresis. Proteins usually are not run onagarose gels because protein molecules are much smallerthan most DNA fragments. On an agarose gel, most pro-teins would quickly pass through the spaces in the gel withlittle or no separation.

Proteins and small DNA molecules are most commonlyseparated on vertical gels made of the polymer, polyacry-lamide. This process is called polyacrylamide gel elec-trophoresis (PAGE). Polyacrylamide gels have a high con-centration of molecules ranging from 4% to 18%, so they

have a greater ability to separate or resolve small molecules. Although PAGE gels canbe made from scratch and poured in the lab, commercially prepared, prepoured gelsare now more routinely purchased and used. This is because liquid polyacrylamide ishighly toxic and time consuming to prepare. PAGE gels can be purchased in concentra-tions from 4% to 18%, depending on the size of the molecules to be resolved (seeFigure 5.25). Smaller molecules are run on higher-concentration gels; larger ones arerun on lower-concentration gels. Gels can also be purchased with gradients of poly-acrylamide. A 4–16% gel is more concentrated on the bottom of the gel than on thetop. Depending on the mixture of proteins to be separated, a gradient gel often worksbest, especially if you are not sure of the size of the protein(s) of interest.

Vertical gels are run in vertical gel boxes. Like horizontal gel boxes, these haveelectrode wires at opposite ends of the box (see Figure 5.26). When an appropriatebuffer is placed in the box and a power supply is attached, an electric field is estab-lished in the box. The samples in vertical gel electrophoresis must have a net nega-tive charge to be able to move into the gel and travel through it toward the positiveside. As in horizontal electrophoresis, the longer the molecule, the more difficulty it

148 Chap ter 5

Figure 5.24. A technician loads protein samples on a verticalgel. Vertical gel boxes operate in a fashion similar to horizontalgel boxes.

Figure 5.25. Gels of Different Concentrations. A vertical gel box holds gels up and down. The samples are addedto wells at the top of the gel. When electric current is applied, the samples run down the gel. The molecules movetoward the positive electrode, with the smallest ones moving the fastest. The concentration of the gel affects the speedat which the molecules separate. The same three protein samples were added to all three gels, along with the same MWstandards. Notice the different migration patterns in each gel.

250 kD

8% TRIS-Glycine Gel 18% TRIS-Glycine Gel 6-18% TRIS-Glycine Gel

wells

+

–

protein #1

protein #2

protein #3

MW

standards

98 kD64 kD50 kD36 kD

30 kD16 kD

6 kD4 kD

250 kD

+

–

protein #1

protein #2

protein #3

MW

standards

98 kD64 kD50 kD36 kD30 kD16 kD6 kD4 kD

250 kD

+

–

protein #1

protein #2

protein #3

MW

standards

98 kD64 kD

50 kD36 kD

30 kD

16 kD6 kD4 kD

PAGE (PAGE) short for polyacry-lamide gel electrophoresis, aprocess in which proteins andsmall DNA molecules are separatedby electrophoresis on vertical gelsmade of the synthetic polymer,polyacrylamide

Photo by author.


has moving through the gel matrix. Thus, given the same amount of time, smallermolecules travel farther in a gel than do larger ones.

Samples are most commonly prepared for PAGE with a special sample buffer con-taining a denaturing agent, such as sodium dodecyl sulfate (SDS). SDS linearizes, ordenatures, the protein to polypeptide chains so that each protein’s size is based onthe number of amino acids it contains, not on its shape.

SDS also coats the polypeptide with a negative charge so that all the proteins havethe same charge. Thus, the rate at which the polypeptide chains move to the positiveelectrode is determined solely by their size. The buffer and gels used also containSDS. These gels are called “denaturing gels” since the proteins are unwound to theirprimary structure when run. When these samples are loaded into the wells and thepower is turned on, the polypeptides travel to the positive electrode at a rate propor-tional to their molecular weight. The smaller the molecule, the faster it movesthrough the gel (see Figure 5.27).

Since most proteins are colorless, loading dye must be addedto monitor the loading and running of samples. Prestained stan-dards of known molecular weight are usually run in other lanes.These help the technician to monitor the progress of the gel run.After staining, the standards are used in molecular weight deter-mination of the unknown protein samples.

Gels are usually run at around 35 mAmp. Depending on thesize of the gel, its composition, and its concentration, a gel mayrun for 1 to 3 hours. The proteins in the gel are usually colorlessand must be visualized. After the gel is run, it is stained.

Several stains exist for visualizing proteins. The most popularones are Coomassie® Blue by QIAGEN (see Figure 5.28) andsilver stain (see Figure 5.29). Silver stain is more sensitive(down to microgram amounts) than Coomassie® Blue (down tomilligrams), but it is more expensive to use, and it requires muchmore time and labor. For these reasons, Coomassie® Blue stain ismore often used.

After staining, the technician observes the protein-banding pat-tern for each sample to determine how many peptide chains orproteins are present in a sample and the differences in the proteins’sizes. The molecular weight of the unknown bands can be deter-mined by comparison to the protein molecular weight standards.


Figure 5.26. Vertical Gel Electrophoresis. Although vertical gel boxes vary from one manufacturer to another, allare basically of the same design. The gel cassettes are snapped or screwed in place (right). Running buffer is addedbehind the gel, covering the wells. Buffer is poured in front of the gel cassette to cover the front opening. When the topis placed on the box (left) and the power is turned on, electricity flows from top (negative charge) to bottom (positivecharge). Negatively charged samples move down the gel toward the positive electrode.

pre-pouredTRIS-Glycine

PAGE Gelin plastic cassettes

red

tape coveringopening for

current electrode

Make sure buffercovers the wells

of the gel.powersupply

gel box top

redelectrode(anode)

blackelectrode(cathode)

samplewells

black

+–

+–

35 mAvolts

mAmps

Figure 5.27. PAGE with Standards. The smaller thepeptide chain, the faster it moves through the gel. Protein-sizing standards can be used to determine the size of unknownsamples. Proteins sizes are reported in kilodaltons (kD).

myosin = 250 kD

12% TRIS-Glycine Gel

wells

protein with2 polypeptidechains

+

–

sample #1

sample #2

sample #3

MW

standards

albumin = 98 kD64 kD50 kD36 kD

30 kD16 kD

6 kDinsulin (beta chain) = 4 kD

Coomassie® Blue (coo•mas•sieblue) a dye that stains proteinsblue and allows them to be visual-ized

silver stain (sil•ver stain) astain used for visualizing proteins


Section 5.4 Review Questions1. What does “PAGE” stand for, and what samples are studied using PAGE?2. What separates molecules on a PAGE gel? 3. PAGE gels are usually run at what amount of current?4. A technician has a stock protein solution with a concentration of

1 mg/mL. He prepares a 1:4 serial dilution of the stock and runs the sam-ples on a PAGE gel. What is the preferred method of staining and why?

150 Chap ter 5

5.5 Applications of Protein AnalysisThroughout the chapter, you have learned how the study of proteins in biotechnolo-gy labs has led to the development of such products as contact-lens cleaners, deter-gent boosters, and herbicide-resistant soybeans. Tests for pregnancy and influenzaare examples of the results of protein research in the human health area, which isperhaps the area of greatest significance to the average citizen. Biotechnologyresearchers worldwide are experimenting with proteins and gathering information todevelop therapies to combat a range of serious diseases.

One area of studies focuses on the protein profile of cells and tissues. The goalof a protein profile is to identify and quantify all the proteins present in a sample.Comparing the protein profile of one type of cell to another may explain anyobserved differences in the structure or function of the tissue or cells. Thisapproach could help researchers understand a cell-structure-related disease, suchas sickle cell disease. People with this disease have abnormally shaped RBCs thatdo not function normally (see Figure 5.30). Analyzing how the protein compositionor structure of normal RBCs varies from that of abnormal, “sickled” cells might leadto a corrective therapy.

Sometimes a scientist may be interested in a particular protein’s structurebecause it helps explain the protein’s function. In muscle cells, for example, thereis an abundance of the protein, myosin. To understand how a muscle does its job

Figure 5.28. The process of staining and destaining proteingels (Coomassie® Blue stain is shown here) takes about 3 hours.Photo by author.

Figure 5.29. Silver stain is much more sensitive thanCoomassie® Blue. When samples have low concentrations ofprotein or DNA, silver-staining is the method of choice.Photo by author.


of contracting and relaxing, a researcher must understand the structure of myosin.With data gathered from protein studies, researchers can create computer-generat-ed models of the protein’s structure and, therefore, better understand the functionof myosin in the muscle cell.

Many scientists study proteins to understand the chemical processes in cells.Thousands of metabolic reactions occur in cells while millions of molecules are com-bining and breaking down. Enzymes and other regulatory proteins control thesereactions. Ascertaining which protein is made, and when, helps explain the growth,development, and aging of cells, tissues, organs, and organisms. For example, in thelast decade, several biotechnology companies began to study the proteins involvedin angiogenesis, or blood vessel growth (see Figure 5.31). Certain proteins triggerangiogenesis in tumors, and certain tumors are known to produce proteins thatencourage angiogenesis. By blocking these proteins, tumors may be starved of theirblood supply and die. Understanding which proteins are present, at what concentra-tion, and when during angiogenesis is the first step in developing a therapeutic prod-uct to inhibit blood vessel growth in tumors.

It requires sophisticated equipment and techniques to learn the characteristicsof a protein, but this knowledge provides a wealth of information that can beapplied to developing products. To understand a protein’s function and mode ofaction, its amino-acid sequence (protein sequencing), three-dimensional structure(x-ray crystallography and computer images), charge, and size (PAGE) must beknown. For example, it has been known for a long time that insulin is involvedin sugar metabolism. But it was not until the structure of insulin was determinedthat scientists could fully explain its mode of action and develop therapies totreat diabetes.


Figure 5.30. Scientists are working on new gene therapies tocorrect the cause of the abnormal shape seen in red blood cells(left) of sickle cell disease patients. One DNA nucleotidemistake causes a single amino-acid substitution, which, in turn,causes an incorrect polypeptide folding and protein shape.This was discovered because the single amino-acid substitutionin the B-chain of “sickle cell” hemoglobin caused a differentbanding pattern than is normal during electrophoresis.© Bettmann/Corbis. Figure 5.31. Lior Tamir, a former lab technician

at Angiogenix, Inc, in Burlingame, CA, studiesproteins involved in angiogenesis. Here, hephotographs proteins from cell cultures thathave been run on a PAGE gel and silver stained.Photo by author.


The activity, or lack of activity, of various proteins is the cause of virtually allgenetic disorders. For example, an abnormal cell membrane transport protein isresponsible for cystic fibrosis. Sickle cell disease results from a single mistake in theamino-acid composition of the protein, hemoglobin. Determining the differencesbetween normal and defective proteins is an expansive area of biomedical research.

Protein studies are often conducted to understand evolution and taxonomic rela-tionships. Since proteins are coded for on DNA, studying the similarities and differ-ences in proteins gives clues to the similarities and differences in DNA molecules. Adifference in proteins implies that there are differences in the DNA sequence. Thus,the more different the proteins of two species are, the more likely it is that the DNAwill be different. Changes in DNA indicate speciation and evolutionary change.Determining the degree of similarity in proteins allows scientists to make inferencesabout the evolutionary history of different species.

An example of how protein structure indicates evolutionary relationships is seen inthe hemoglobin molecule. The sequence of amino acids in human hemoglobin mole-cules is 98% the same as in chimpanzee hemoglobin. When compared to gorillahemoglobin, the two are 96% similar. Horse hemoglobin has only a 76% similarity tohuman hemoglobin. These protein studies reveal a closer ancestry between humansand chimps than between humans and gorillas or horses. Anatomical and DNA stud-ies have confirmed these conclusions. Scientific information on protein sequences, aswell as DNA sequences, is available on the Web site of the National Center forBiotechnology Information (NCBI) at: www.ncbi.nlm.nih.gov (see Figure 5.32).

Hundreds of biotechnology companies focus on the production of one or moreproteins for commercial purposes, including drugs, industrial products, agriculturalcrops, and research and manufacturing instruments and reagents. Many studies mustbe conducted on proteins to understand how to store and use them to maintain prop-er structure and function (see Figure 5.33). Identifying the chemical behavior of aprotein in different environments is critical for designing purification, assay, and man-ufacturing protocols.

152 Chap ter 5

Protein SequencersKnowing the amino-acid sequence helps scientists understand the three-dimensionalstructure of a protein and how it works.

Go to the following Applied Biosystems, Inc BioBeat® Web siteand read about how three proteins work together to increaseanti-HIV activity in laboratory experiments:

www.appliedbiosystems.com/biobeat/index.jsp?articleId=f18b099e-6942-1955-e015299074219e49&type=0.

Summarize the article. Include information on which proteins appear involved in theanti-HIV activity described and the instrument used to identify the proteins.

T OD O

taxonomic relationships(tax•o•nom•icre•la•tion•ships) how speciesare related to one another in termsof evolution

Photo by author.



Figure 5.32. Protein and DNA sequences are stored on databases and sharedamong scientists at the NCBI site.

Figure 5.33. Molly He, a staff scientist at SunesisPharmaceuticals, concentrates proteins forexperiments to discover their structure. She willbe running PAGE gels and conducting othercharacterizations. The proteins she studies couldbecome cancer therapeutics.Photo by author.

biomanufacturing(bi•o•man•u•fac•tur•ing)industry focusing on the produc-tion of proteins and other productscreated by biotechnology

Protein research is critical to all fields of biotechnology. At a typical biotechnologycompany, a majority of the scientific staff is involved in some aspect of protein science.Thousands of jobs in protein analysis, protein engineering, and protein manufacturingexist in these companies. As a relatively young biotechnology industry gets older andbetter established, it is moving rapidly from a research and development focus towarda product-manufacturing focus, or biomanufacturing. This trend is also leading to agrowing demand for protein-manufacturing technicians in private industry as well as inresearch labs at universities and government agencies.

Government agencies conduct and fund a significant amount of basic research.Nonprofit foundations also may provide research funds. Scientists usually write grantproposals seeking financial support for specific projects. The National ScienceFoundation, for example, funds thousands of research labs and researchers. TheAmerican Cancer Society distributes funds for basic research on the cellular mechanismsof cancer.

Section 5.5 Review Questions1. What causes the difference between normal and sickled cells in sickle

cell disease?2. Give an example of proteins studied to understand evolutionary

relationships. 3. What is NCBI, how can you access it, and what important information is

found there?4. Do all protein scientists work at biotechnology companies? Explain.


154

SummaryConcepts• Most biotechnology products are proteins or protein-related products.• Protein structure is determined by several techniques, including x-ray crystallography, protein

sequencing, and PAGE.• Proteins are composed of some assortment of the 20 amino acids, held together by peptide

bonds. The DNA code on the structural gene determines both the number and arrangementof amino acids in a protein.

• The 20 different amino acids vary by the type of R-group, which can be charged, uncharged,or polar.

• R-groups interact with other R-groups to cause the folding pattern characteristic of a protein.Interactions include H-bonding, disulfide bonds, and nonpolar interactions.

• The HIV coat protein, gp120, has a 3-D structure that is complementary to the 3-D structurefound on CD4 cells of the human immune system. The gp120 structure mutates so quicklythat it is difficult to develop an antibody vaccine to fight it.

• Antibodies are complex proteins composed of four chains. Antibodies recognize and bindspecific antigen molecules. The tips of the chain are variable in the amino-acid sequence andare specific, unique antigens.

• Antibodies are used in research and diagnostic testing, including tests for pregnancy, contami-nation, or disease. Monoclonal antibody technology can produce many identical antibodiesfor these purposes.

• An ELISA is a test that uses antibodies to recognize and quantify the amount of a specific pro-tein in a sample.

• Protein synthesis is similar in all cells and occurs in two steps: transcription and translation.During transcription, an mRNA molecule is made at a chromosome. The mRNA moves to aribosome, where it is read, and a peptide chain of amino acids is produced. The ribosomereads the mRNA three nucleotides at a time (codon). The ribosome facilitates the correcttRNA-AA (amino acid) complex to bring in the next amino acid. Peptidyl transferase bindsadjacent amino acid. Due to the secondary and tertiary interactions, the lengthening polypep-tide chain folds spontaneously.

• Enzymes are proteins that speed the synthesis or decomposition of substrate molecules.Enzymes are named by their substrate or a function they perform, and with an “-ase” ending.

• Enzymes and their substrates have to get very close for catalysis to occur. Two models ofenzyme-substrate action are the lock and key model and the induced fit model. Certain

Chap ter 5

antigens, 135biomanufacturing, 153CD4 cells, 135cleavage, 142codon, 140cofactors, 144Coomassie® Blue, 149denaturation, 146ELISA, 136epitope, 136glycoprotein, 134glycosylated, 134

hybridoma, 136induced fit model, 145lock and key model, 145monoclonal antibody, 136optimum pH, 146optimum temperature, 145PAGE, 148peptidyl transferase, 140phosphorylation, 142polar, 132primary structure, 133protein synthesis, 138

quaternary structure, 134reverse transcriptase, 135secondary structure, 133silver stain, 149substrate, 143Taq polymerase, 142taxonomic relationships, 152tertiary structure, 133transcription, 138translation, 140tRNA, 140x-ray crystallography, 132

Speaking Biotech Page numbers indicate where terms are first cited and defined.



enzymes require cofactor ions or molecules. Because enzymes are sensitive to temperatureand pH, technicians need to know the optimum temperature and pH for a molecule they arestudying.

• Protein size, the number of polypeptide chains in a protein, and the approximate concentra-tion of proteins in a solution can be determined by running a PAGE.

• Researchers study proteins to understand the structure and function of cells, tissues, andorganisms, as well as their behavior and processes. Protein studies also identify evolutionaryrelationships and some species. Understanding diseases and how to treat them is perhaps theresearch focus of greatest interest to scientists and consumers.

Lab Practices• Enzymes speed reactions and are often the result of biotechnology product development.

Several commercial enzymes are available that make paper softer, remove stains fromclothes, make meat tender, and clarify juices. Cellulase and pectinase are two enzymes thatincrease the amount of juice released from apple cells. Increasing the enzyme concentrationin a juicing sample will increase juice yield, up to a point.

• An enzyme assay can be designed to indicate the presence and activity of an enzyme. A validassay results in measurable data.

• An indicator, Biuret reagent, turns violet-blue in the presence of protein. The higher the pro-tein concentration, the darker violet-blue the Biuret reaction is. The lower the concentration,the lighter violet-blue the Biuret result is. Eventually the concentration is so low that a Biuretcannot detect it. Biuret is not a protein indicator of choice for many applications because theprotein precipitates in the reaction.

• Syringe sterilization filters bacteria and fungi out of protein samples for long-term storage.Filter sterilizing removes unwanted or contaminating microorganisms without increasing thetemperature of a sample.

• PAGE can be used to understand the function or behavior of a sample by determining theprotein composition of cells or tissues.

• PAGE denaturing gels are used to estimate the size and number of polypeptide chains in apure protein sample. From the size data, the number of amino acids in a protein can be esti-mated. Similar tissues should have similar protein content.

• PAGE is performed in vertical gel boxes. Prepoured commercial TRIS-glycine gels are mostcommonly used to analyze protein samples. Samples are loaded at the top of the gel and moveto the bottom of the gel (positive electrode) at a rate proportional to their sizes. PAGE gels arecommonly run at about 35 mAmp. Loading dye is added to track the progress of the gel.

• SDS is added to samples in denaturing gels to linearize the polypeptide chains. The gel isstained with either Coomassie® Blue or silver stain to visualize colorless proteins.

• Laemmli buffer is a common running buffer for PAGE. It contains SDS to denature the pro-tein samples.

• As the concentration of a protein sample decreases below about 1 mg/mL, it is difficult to seeit using Coomassie® Blue and silver staining may be required. Too high a concentration ofprotein on a gel causes large blobs or smears.

• Molecular weight sizing standards are used to estimate the molecular weight of peptide chains.

Thinking Like a Biotechnician1. How do the 20 amino acids differ from each other?2. What bonds or forces hold a protein together in a functional three-dimensional shape?3. Enzyme solutions are always prepared using a buffer at a specific pH as the solvent. Why

is a buffered solvent important for enzymes and other protein solutions?4. Describe the relationship between an antibody and an antigen. Explain how the human

body can make so many antibodies.


156

5. A technician needs to determine the size and shape of a protein. Which of these methodscould be used to gain the appropriate data for protein size and shape determinations?a. Mass spectrophotometryb. PAGEc. Protein indicator testingd. X-ray crystallographye. Protein sequencingf. Protein synthesisg. Visible spectrophotometry

6. If a structural gene has the code TAC CCC ATG GGG TAA GGC GTC, what mRNA transcriptwill be made, and what peptide will be produced?

7. If a mutation occurs, substituting the “A” with a “G” at the seventh nucleotide in the struc-tural gene, what are the consequences of the mutation?

8. A technician prepares a 1-mg/mL hemoglobin solution and leaves it on the lab bench overthe weekend. When the concentration of the sample is checked on Monday, its value is sig-nificantly less than expected. What might have caused the difference in concentrationbetween Friday and Monday? How should the solution have been stored?

9. DNase is an enzyme that chops DNA into tiny pieces. It is evident that DNase is workingwhen a thick mucus-like, DNA-containing solution becomes watery and runny. Design anexperiment that would determine the optimum temperature for DNase activity.

10. Protein is an important food nutrient. A technician working at a food company is interestedin the nutritional content of seeds/nuts. She runs a PAGE with samples from two differentseed extracts. She runs multiple lanes of the samples. The gel is stained with Coomassie®

Blue. Seed Extract No. 1 has three faint bands (at 25, 30, and 35 kD). Extract No. 2 has twobands (at 25 and 35 kD), and the bands are very dark. What might she conclude from herresults about the nutritional value of the seed extracts?

Biotech Live Gathering Information on the Structure and Function of ProteinsWhen designing experiments to identify and characterize a protein, scientists need to find outwhat is already known about a protein or other related proteins. They conduct background liter-ature searches to find articles published in scientific journals, such as The Journal of Cell Biology,or on the Internet in scientific databases, such as Medline. Scientists report the results of structur-al and functional analysis of many proteins. From these reports, further studies can be planned.One database that allows scientists to report and find information about Web sites is the NCBIat: www.ncbi.nih.gov. At this site, you can query for a protein’s structural information, includingamino-acid composition and protein size.

Find existing information on the size, structure, and function of a protein.

Create an informational poster about the protein’s structure and function.

1. The instructor will assign a protein of interest from the list in Table 5.4.2. Use the Internet to collect information about the protein of interest. Include the following

information in your literature search:a. Where the protein can be found in nature, including photographs or diagrams, if possible.b. Specific functions of how the protein works or what it does, including any diagrams or

photos, if possible.c. Details on the structure of the protein molecule, including the number of polypeptide

chains, number of amino-acid residues, molecular weight (in kilodaltons), and its three-dimensional structure.

d. Two or more additional interesting facts about the protein structure or function.3. Cut and paste photos, diagrams, and other information from Web sites into a document you

create in Microsoft® Word®. From this document, cut, print, and paste the information ontoa poster board. Be sure to record the reference/source of each piece of information.

Chap ter 5

Activity 5.1

T OD O



Determining the Amino-Acid Sequence of InsulinInspired by an activity by Charles Zaremba in Activities-to-Go, Access Excellence. © The National Health Museum, www.accessexcellence.org.

In 1953, Fredrick Sanger developed a method to determine the amino-acid sequence of a polypep-tide chain. The Sanger Method involves breaking the disulfide bonds holding the tertiary structureof the protein. Then, some peptide bonds between amino acids are hydrolyzed (water is added atthe bond that breaks). Next, short fragments of the polypeptide are sequenced by enzymatic orchemical hydrolysis. The number and types of amino acids are then determined. The peptidesequences are compared for overlaps, and the entire polypeptide sequence is determined. TheSanger Method is a laborious process that has recently been automated.

Insulin was the first protein to be sequenced using Sanger’s method, and in 1958 he receivedthe Nobel Prize for developing the process. Insulin is a hormone involved in sugar metabolism.It enhances the transport of glucose from blood, across the cell membrane, into cells. Producedonly in mammals, it is a small protein with a molecular weight of about 5500 daltons (D). It ismade after a precursor molecule, proinsulin, is synthesized and a 36-amino-acid section isremoved.

The final form of bovine insulin has two polypeptide chains, an α chain of 21 amino acidsand a β chain of 30 amino acids. Three disulfide bonds hold the chains together and keep themfolded into the functional protein.

Activity 5.2

Type of Protein (Function) Examples of Specific Proteins with These Functions

collagenstructural fibrin

keratin

amylaseenzyme alcohol dehydrogenase

lysozyme

hemoglobintransport cytochrome C

low-density lipoprotein

myosincontractile actin

tubulin

insulinhormone human growth hormone

adrenaline (peptide)

HER2 antibodyantibody gamma globulin

immunoglobulin E

melaninpigment rhodopsin

hemoglobin

gp120recognition CD4

MHC proteins

Table 5.4. Protein Groups and Their Functions


158

The DNA sequence of a proinsulin gene is shown below. The sequence of proinsulin can bedetermined by transcribing the gene sequence into an mRNA molecule and translating it into theamino-acid sequence:

TACAAACATTTAGTTGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACAC-CGCTCGCGCCGAAAAAGATATGGGGGTTTTGGTCTTCCCTCGCGCTCCTAAACGTTCAACCG-GTTCAACTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTGATGCGAATCTCCCATCA-GACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCT-

TAATGACGTTAACT

By excising amino acids No. 30 through 66, the insulin sequence is revealed.

Determine the amino-acid sequence of insulin.

Determine the number of amino acids in the final protein.

Determine where disulfide bonds may be found in the final protein.

1. Examine the sequence of nucleotides that represents the DNA code for proinsulin. Writedown the mRNA code that would be transcribed from this gene. Draw a line after everythird nucleotide in the mRNA sequence so that the codons are easy to read.

2. Using the mRNA codon/amino-acid chart (Table 5.2, page 141), determine the name of theamino acid for which each RNA codon “codes.” Write the three-letter abbreviation of theamino acids in the polypeptide chain, in their proper order.

3. The protein sequenced above is called proinsulin. Proinsulin is the inactive form of insulin.To operate in the body, a segment of the proinsulin, between amino acids No. 30 and 66,must be removed. The remaining two polypeptide sections (chains α and β) are reconnect-ed to form insulin. On separate pieces of paper, write down the amino-acid sequence ofthe A and B chains of insulin. Arrange them so that three disulfide bonds can be drawnbetween cysteine molecules on each chain.

4. Place a “+” by each of the positively charged amino acids (at pH 7). Place a “–” by each ofthe negatively charged amino acids (at pH 7). At pH 7, what is the overall charge on aninsulin molecule? The charge on a protein is interesting for purification purposes.

5. How many amino acids long is the insulin molecule? If a typical amino acid has a molecu-lar weight of about 137 daltons (137 D), then what is the expected molecular weight of theinsulin molecule sequenced above?

6. Knowing the sequence, size, and charge of a protein, such as insulin, devise some methodby which you could isolate insulin molecules from other proteins found in insulin cells.

Chap ter 5

T OD O



Who Owns the Patent on the Genetic Code for Your Proteins?With the recent decoding of the human genetic sequence (the Human Genome Project), it isfeasible that in the future everyone could have their own DNA sequenced. This would give a“DNA fingerprint” of all the genes and, therefore, all the proteins a person synthesizes. Who willdecide who should have access to this genetic information? Is genetic information private or is itimportant for the public good?

For each issue listed below, provide a three-part answer that includes (a) asupporting argument for when, if ever, the genetic code should be available;(b) a supporting argument for when, if ever, the genetic code should not beavailable; and (c) an explanation of any conditions that would be an excep-tion to your position.

Issue: Should medical authorities get your genetic fingerprint?Issue: Should insurance agencies get your genetic fingerprint?Issue: Should the military get your genetic fingerprint? Issue: Should insurance agencies get your genetic fingerprint?Issue: Should prospective spouses get your genetic fingerprint?Issue: Should employers get your genetic fingerprint? Should some employers have the rightto the genetic fingerprint and others not?Issue: Should scientists conducting gene therapy/corrective therapy get your genetic finger-print? Should you get royalties on your genetic information if it is used to correct faulty orinferior DNA?

T OD O


Companion Biotechnologhy Text

Documents

Transcript of Companion Biotechnologhy Text