Developmental Biology 222, 135-146 (2000) available online at http://www.idealibrary.com on | B ~ ~ ® doi:l 0.1006/dbio.2000.9702,

Combinatorial Activity of Pair-Rule Proteins on the Drosophila gooseberry Early Enhancer

®

Maxime Bouchard, ~'2 Jos4e St-Amand, and Serge C6t6 3 Cel~tre de Recherche de L'H6tel-Dieu de Qudbec, 11 C6te du Palais, QuEbec, QuEbec, Canada G1R 2J6

The early expression of the Drosophila segment polarity gene gooseberry (gsb) is under the control of the pair-rule genes. We have identified a 514-bp enhancer which reproduces the early gsb expression pattern in transgenic flies. The transcription factor Paired (Prd) is the main activator of this enhancer in all parasegments of the embryo. It binds to paired- and homeodomain-binding sites, which are segregated on the enhancer. Using site-directed mutagenesis, we have identified sites critical for Prd activity. Negative regulation of this enhancer is mediated by the Even-skipped protein (Eve) in the odd-numbered parasegments and by the combination of Fushi-tarazu (Ftz) and Odd-skipped proteins in the even-numbered parasegments. The organisation of the Prd-binding sites, as well as the necessity for intact DNA binding sites for both paired- and homeodomains, suggests a molecular model whereby the two DNA-binding domains of the Prd protein cooperate in transcriptional activation of gsb. This positive activity appears to be in competition with Eve and Ftz on Prd homeodomain-binding sites. © 2000 Academic Press

Key Words: gooseberry; transcriptional control; cooperativity; pair-rule genes; segmentation; Drosophila.

INTRODUCTION

The first visible signs of segmentation during Drosophila embryogenesis appear at stage 10 of development (Turner and Mahowald, 1977) and suggest a definite identity for every cell along the anterior-posterior axis of the embryo. The genetic hierarchy of genes responsible for this cellular determination is well known. From the products of the maternal coordinate genes deposited in the embryo, the broad gap gene domains are specified. The latter then activate the pair-rule genes in narrower domains, them- selves responsible for the regulation of the fourth class of segmentation genes, the segment polarity genes, expressed at single-cell precision (Ingham, 1988; Fujioka et al., 1995). Most of the maternal, gap, and pair-rule genes are transcrip- tion factors. The cascade of segmentation genes, up to the activation of the segment polarity genes, thus seems largely based on the regulatory interactions among these transcrip- tion factors. Different molecular mechanisms such as co-

t Present address: Institute for Molecular Pathology, Bohrgasse 7, A-1030, Vienna, Austria.

To whom correspondence should be addressed. Fax: 00 (43) 1 798 7153. E-mail: bouchard@ntimp.univie.ac.at.

3 Present address: H6ma-Qu4bec, 2535, Boulevard Laurier, Ste- Foy, Qu4bec, Canada G1V4M3.

0012-1606/00 $35.00 Copyright © 2000 by Academic Press All rights of reproduction in any form reserved.

operativity, competitive DNA binding, or quenching have been proposed for these interactions (Levine and Manley, 1989; Johnson, 1995).

The early activation of the zygotic segment polarity genes in the ectoderm depends on the interactions of the tran- scription factors encoded by the pair-rule genes. This regu- lation is thought to be combinatorial in that a given combination of pair-rule proteins would generate specific information allowing the activation of the segment polarity genes (Gergen et al., 1986; Morrissey et ai., 1991). This model is essentially based on expression patterns and ge- netic studies. The cases of wingless (wg) and engrailed (en) are especially well documented in this regard. The activa- tion of wg, for example, is dependent on paired (prd) and odd-paired (opa) in the even- and odd-numbered paraseg~ ments, respectively (Ingham and Hidalgo, 1993; Benedyk et ai., 1994), while its borders are specified by fushi-tarazu (ftz), odd-skipped (odd), and even-skipped (eve) repression (Ingham, 1988; Mullen and DiNardo, 1995; Ingham and Hidalgo, 1993; Fujioka et al., 1995). On the other hand, the initiation of en expression is driven by ftz and prd (Hoey and Levine, 1988; Han et al., 1989; Ananthan et aI., 1993) and seems to be defined posteriorly by the action of odd and eve according to the double-negative model whereby Eve would repress odd in the anteriormost cell of the even-

135

136 Bouchard, St-Amand, and C£)td

numbered parasegments , enabling en expression (Coulter et aI., 1990; Manouk ian and Krause, 1992; Fuj ioka et aI., 1995). The anterior boundary of at2 expression appears to be specified by sloppy-paired (sip; Cadigan et aI., 1994).

Ano the r segment polar i ty gene, gooseberry (gsb; also referred to as gooseberry-distal), is c losely re la ted to wg and en by its m u t a n t cut icular pheno type (Hooper and Scott, 1992), as well as i ts expression domain. I t is expressed across every parasegmenta l boundary, in a domain overlap- ping the wg expression domain, and in the an te r io rmos t ez2-expressing cells (Gutjahr et al., 1993b}. The regula tory region of gsb consists of an early and a late control e lement dependent on the pair-rule genes and wg, respect ive ly (Li et aL, i993). The early local isa t ion of gsb seems to be cr i t ical for proper CNS format ion since i t is responsible for the specif icat ion of row 5 neuroblas t iden t i ty in the neuroecto- derm by stage 8 of embryogenesis (Zang et aL, 1994; Skeath et al., 1995; Duman*Scheel et al., 1997). The involve lnen t of gsb in epidermis specification, as reflected by the larval cut ic le defects (N/isslein-Volhard et al., 1980; C8t6 et al., 1987), seems to be a la ter requirement . Indeed, gsb is needed 6 h after egg laying for wg n :a in tenance through an auto- regulatory loop (Li and Noll , 1993; Dumal : -Scheel et al., 1997). The loss of wg expression seems therefore respon* sible for the cut icular defects observed in the gsb mutan t .

Based on sequence s imilar i ty , gsb is the homologue of the ver tebra te Pax-3 and Pax-7 genes and a paralogue of the Dros(\phila paired and gooseberry~neuro (gsbn) genes (Baumgartner et al., 1987; Wal ther et al., 1991; Noll , 1993). These t ranscr ip t ion factors share the paired domain and the pai red- type homeodomain , two d is t inc t sequence-specif ic D N A binding motifs (Boppe t al., 1986; Tre i sman et al., 1991). The paired-type h o m e o d o m a i n recognises an AT-r ich sequence usual ly conta ining the T A A T core motif , consis- ten t w i th previously character ised homeodomain -b ind ing sites (Treism.an et aI., 1991; Wi lson et al., 1993). The paired domain recognises the core GTCACG(G/C) consensus (Czerny et al., 1993; Jun and Desplan, 1996). However , mos t of the specific b inding sequences for these domains have been ident i f ied in vitro, while only a few in vivo target sites are known.

Although. i t is known that gsb t ranscr ip t ion is ac t iva ted by the pair-rule prote ins (Li and Noll , 1993), a sys temat ic analysis of this regula t ion at the molecu la r level is miss ing so far. In this paper, we invest igate the factors and the molecu la r mechan i sms involved in the early regula t ion of gsb. We find that prd act ivates gsb in every parasegment by using both its paired~ and its homeodomains cooperat ively. The binding occurs on a 514-bp enhancer located 5 kb ups t ream of the t ranscr ip t ion in i t i a t ion site. This early regula tory e lement is down-regulated by compe t i t ion of Eve and Ftz for Prd horneodomain-b inding sites. This e l emen t presents a molecu la r example of the combina tor ia l ac t iv i ty of pair~rule t ranscr ip t ion factors in the regula t ion of the segment polar i ty genes.

MATERIALS A N D M E T H O D S

Germ-Line Transformation

Fragment IV vectors were generated by inserting the 0.5-kb BgJlI-HindIII "lu~t~d fragment into the BglII-NotI b:~:~d cloning sites of pWHiZ. The pWHiZ vector was made with the blunted 4.5-kb H~ndIII fragment of pHZ50PL (Hiromi and Gehring, 1987), contain- ing a minimal hsp 70 promoter and the LacZ gene, cloned into the blunted EcoRI site of pW6 (Ktelnenz et a7., 1987), containing the Drosophila white gene and P-element terminal repeats. Fly trans- formation was performed according to standard protocols (Rubin and Spradling, 1982). The constructs and the helper vector pvr25,7wc (Karess and Rubin, 1984) were injected at a 2.5:1 ratio into w nls flies. For every construct, two to six independent lines were tested in order to identify insertion site effects.

Transient Transfection Assays Transfections were performed in 60-tuna petri dishes using the

calcium-phosphate technique (Di Nocera and Dawid, 1983). Schneider L2 cells were grown at 24°C in M3 medium + 10% heat-inactivated foetal calf serum. Calcium-phosphate-DNA pre* cipitates were added to 2 ml of M3 medium containing 3-4 × 10 ~ cells. Five to six hours after precipitate addition, 8 ml of M3 medium + pen-strep (50 U/ml penicillin-50/~g/ml streptomycin) was added to the transfections. Cells were harvested 36 h after precipitate addition, washed once with PBS, and resnspended in 0.15 ml of 0.25 M Tris--HC], pH 7.8. Extraction was performed by freezing (dry ice/EtOH) and thawing (37°C) the extracts three times followed by a centrifugation of 5 rain at 13,000 rpm at 4°C. The supernatant was tested for/9-galactosidase (Han et al., 1989) and for CAT activity by the phase-extraction method (Seed and Sheen, 1988) with some modifications. Each transfection assay contained 2 to 4/xg of pC4copcat vector (Thummel et al., 1988) as internal control, 1 /xg of reporter vector, the indicated amount of effector vector (pPac5C-x), and the amount of pPac vector alone to stan- dardise the amount of actin promoter per transfection. The effector vectors used were pPac-Eve, pPac-Ftz, pPac-Prd (Han et aI., 1989), and pPac-Odd, made by insertion of the end~filled 1.95-kb EcoRI fragment of the odd eDNA into the end-filled BamHI cloning site of pPac5C.

Expression in Mutant Embryos The fly stocks used in. this study w e r e prd 24:;J7, eve I~'~, f tz w2s,

odd rL, and odd ~'~:~6 (described in Lindsley and Zil~m, 1992), Typi~ cally, homozygous transgenic lines were crossed with the mutant flies. F1 flies not carrying the balancer chromosome were crossed among themselves and the embryos were collected for staining.

Immunohistochemistry and in Situ Staining The embryos collected on grape juice-agar petri dishes were

dechorionated for 4 rain in 50% bleach, rinsed, and transferred at the interphase of heptane:PBS-5 % formaldehyde-50 mM EGTA for 20 :::in. The phases were removed and replaced with flesh heptane: MeOH. Devitellinised embryos were then rinsed three or four times in MeOH. For immunohistochemistry, the embryos were incubated overnight at 4°C in a 1:1000 dilution of mouse or rabbit anti-]3-galactosidase antibody (Promega) or a 1:100 dilution of monoclonal anti-Gsb in PBT-NGS (PBS + 0.1% Triton X-100 + 5%

Copyright Q 2000 by Academic Press. All rights of reproduction in any for::: reserved.

Combinatorial Activi ty of Pair-Rule Proteins on gsb 137

I0 6 5 4 3 2 I 0 scale (kb)

I~cZ pCDS.3 ~ ~

pCD&4

frag.IV ~ .

FIG. 1. Identification of gsb regulatory sequences. In transgenic ffies, a 5.3okb fragment including the gsb transcription start site reproduces early and late gsb expression patterns. Deletion to 4.4 kb (pCD4.4) only abrogates early expression. LacZ expression is first detected at stage 10 in these embryos. Fragment IV located in the interval between 5.3 and 4.8 kh was sufficient for early expression of the LacZ reporter gene (up to stage 11} when inserted upstream of a minirnal hsp70 promoter. Scale starts at gsb transcription start site. Bg, BglII; RI, EcoRI; S, SalI; X, XhoL

NGS). The first antibodies were revealed by HRP staining using the ABC amplification system {ABC Vectastain kit; Vector Laborato- ries), with 0.03 mg/ml DAB and 0.015% CoC1. Doubledabelling was done with anti,rabbit Alexa488 (to rabbit antiq3-galactosidase) and with anti-mouse ABC amplification (to nrouse anti-Gsb) using Cy3-tyramide substrate for HRP (NEN). Incubations were preceded and intercalated by three washes of 20 rain at room temperature in PBT. Embryos were lnounted in 70% glycerol {in PBT) or in Permount tFishe~ Scientific) after progressive dehy&ation in a EtOH-PBT series and xylene rinses, h~ sit~l hybridizations were carried out as previously described (Edgar and O'Farrell, 1990).

DNase I Protection Assay

The bacterial expression w~'ctors used for crude extract prepara- tion of pair-rule proteins were pAReveOri lHoey and Levine, 1988), pARftz, and pAP, prdOri (Treisman et al., 1989), of which the C-terminal portion of Prd was removed using BamHI sites. The constructs transformed in the Escherichia coli strain BL21(DE3) were induced by addition of 1 mM IPTG for 2-4 h at 37°C. The only exception is pAReveOri for whicl~ the induction was left for 6 h and the culture medium was 2XYT instead of LB. Preparation of bacterial crude extracts for footprinting experiments was carried out as described in Hoey and Levine (1988), except that 2 M urea was used instead of 1 M guanidine hydrochloride in the initial dialysis buffer and that 300 mM KC1 was added to the final dialysis buffer. The standard DNase I protection reaction was performed by incubating 1 to 3 ng of ~)P-labeled DNA and bacterial crude extract (0.1 to 1 /zg) in 75 mM KC1, 25 mM Hepes (pH 7.8), 20% glycerol, 6 mM MgClz, 0.3 mM DTT, 0.03% Nonidet-P40, and 1 /xg of poly(dI-dC). Binding was allowed to proceed for 10 rain at room temperature followed by 20 to 30 rain incubation on ice. DNase I digestion (Worthington) was performed as previously described (Bemier et at., 1993} and samples were analysed by electrophoresis on 6 to 8% polyacrylamide gels.

Site-Directed Mutagenesis

The Prd-binding site mutagenesis was made according to instruc- tions supplied by the manufacturer (Bio-Rad). Single-strand DNA was produced using the F1 origin of the vector pGEM-7Zf(+) (Promega) in which fragment IV had been cloned. The oligmmeleotides used were

as follows (mutated nucleotides are underlined): IV.2M, 5'-GATAAC- TAAAGTACTGCAAACTC-3'; IV.3M, 5'-GCGTCATAGTTGTG- GTGTGTC-3'; IV.4M, 5'-CAAACCATGAACAACCGAACCG-3'; IV.5M, 5'-CGCATGATGAGGAGCCAQTACAAATTG-3'; W.6M, 5'-GGTGGTCACTGTGAGACGC-3'; and IV.7M, 5'~TGATCG- ATCTAACACGCC-3'.

Mutant combinations were generated by pooling oligonucleo~ tides IV.2, IV.3, and IV.4. Combinations involving the site IV.5, IV.6, or IV.7 were made by a swap of the second half of fragment IV using the Hi~dtI site at position 259 [from the B~g/II site} and the pGEM-7Zf{+) HindlII site in the 3' end of the fragment. All mutations were tested in DNase 1 protection assays and found to prevent protection by Prd.

RESULTS

The Early gsb Regulation Is Driven by a 0.5~kb Enhancer Located at -4 .8 kb

In order to ident i fy gsb regulatory elements , we generated t ransgenic lines conta in ing delet ions of the gsb control region ups t ream of the LacZ reporter gene (Fig. 1). A construct conta in ing 5.3 kb of upstream, sequences repro- duced the comple te pa t t e rn of gsb expression, whereas we observed a comple te loss of early LacZ expression in a const ruct conta in ing 4.4 kb of 5' control region (Fig. 1). These resul ts suggest that the early expression is control led by a srnall enhancer e l emen t located in the in terva l be- tween pos i t ions - 5 . 3 and - 4 . 4 kb. Further dele t ions re- vealed a complex late regula tory region extending f rom 4.4 kb to the promoter (data not shown). To ir lvestigate the early regula t ion of gsb, we used the BglII-SalI f ragment of 514 bp corresponding to the - 5 . 3 to - 4 . 8 kb in terval (called f ragment IV), inser ted ups t ream of the m i n i m a l hsp70 promoter in t ransformed flies (referred to as t ransgenic l ine IV I. The/3-galactosidase expression pat te rn produced by this const ruct is very s imi la r to the pa t te rn observed for endog- enous gsb unt i l the extended germ4~and stage (stage ll}. Staining first appears at cel lular b las toderm in seven one- cel l -wide str ipes at the poster ior border of the even-

Copyright ~) 2000 by Academic Press. All rights of reproduction in any form reserved.

138 Bouchard, St-Amand, and Cdt4

FIG. 2. ]3~Galactosidase expression pattern of line IV in transgenic embryos. (A) At stage 6, the expression is detected in one-celLwide stripes (od&numbered). (B) At stage 9, the odd-numbered stripes expand to a second cell, while the even-numbered stripes appear in a double segment periodicity. (C) At germ-band-extended stage (stage 11)/3-galactosidase expression is detected in 15 stripes along the anterior- posterior axis. Some expression is also present in the pharyngeal region. (D) Ventral view of a stage 11 embryo. (E) Gsb expression pattern in a stage 11 embryo revealed by antibody staining. (F) Double labelling against Gsb (red) and f3~galactosidase (green) showing the coexpression of both proteins in the ectoderm at stage 10. Dots indicate parasegmental boundaries 3, 4, and 5. Embryos in A, B, C, E, and F are lateral views with dorsal side up; embryo in D is a ventral view. Anterior is left in all photographs.

numbered parasegments (Fig. 2A). These stripes will even- tually expand to include one or two more cells in the anterior domain of the adjacent parasegment. During germ- band extension, seven interstripes are activated at the posterior border of the odd-numbered parasegments (Figs. 2B, 2C, and 2D). At germ-band-extended stage, the expres- sion pattern of ]3-galactosidase colocalises with the endog- enous Gsb protein in the ectoderm (Figs. 2E and 2F). In situ hybridisation was used to closely follow the dynamics of LacZ transcription. The LacZ transcript was present until stage 11 after which it rapidly disappeared (data not shown). The 514-bp fragment IV thus seems to contain the essential elements for the proper activation and repression of the early gsb expression.

Genetic Control through Fragment IV by the Pair-Rule Genes

gsb is activated at the cellular blastoderm stage, when the pair-rule genes are expressed in overlapping domains in the embryo (Ingham, 1988). Based on the documented role of

these genes in the regulation of the segment polarity genes (Fujioka et aI., 1995; Ingham and Hidalgo, 1993; Benedyk et aL, 1994; and references therein) and the genetic data known for early gsb regulation (S.C. and R. Ouellette, unpublished data; Li and Noll, 1993), we assessed the effect of the absence of prd, eve, ftz, and odd on the expression pattern of the fragment IV transgene.

Prd is expressed in the even-numbered parasegments extending across all parasegment borders, thus encompass- ing the expression of gsb (Gutjahr et al., 1993b). In prd embryos, no/3-galactosidase expression is observed in the ectoderm until late germ-band-extension stage (Fig. 3A). This suggests a requirement for prd at all parasegment boundaries for the initiation of gsb expression. This result also correlates with the data obtained for the endogenous gsb by in situ hybridisation in prd embryos, in which no transcription could be detected before stage 8 (S.C. and R. Ouellette, unpublished data). At the germ-band-extended stage, some expression appears in one or two cells per hemi-even°numbered stripe (Fig. 3B) and fades during germ- band retraction. It is important to note that at this stage, the

Copyright ©2000 by Academic Press. All rights of reproduction in any form reserved.

Combil?atorial Ac t i v i t y of Pair .Rub Proteirls <m g,sb 139

A

C

E

D

eve

odd

B

::::: 7

prd , , , i! : j ! / '

prd

Ttz

FIG. 3. Fragment IV activity in pair-rule ge:ne mutants. Line IV transgenic flies were crossed in prd (A, B), eve (C), ftz {D}, and odd (E) backgrounds and stained for/3-gMactosidase expression./A} in a stage 10 prd embryo, fragment IV activity is completely lost in ehe trunk. ¢~-Galactosidase expression is still present in the pharyngeal region. IB} At late stage ] 1, f~-gabca)sidase expression is detected in some cells nf the even-numbered stripes. (C) In a stage 9 eve embryo, the expression :is stronger and widened in the whole odd-numbered parasegm~ nts, creating a fusion d the oddmumbered and tl~e even-.nmT~bered stripes. (D] A/)z embryo {stage 10) shows a posterior widening of e/-~e even~nurnbered stripes of/3~galactosidase witbin the domain of normal Ftz expression. Stripes 2 and 3 are almost completely fused, while the other evenmumbered interstripes conserve some repression in the posterior region [~rrow). {E) In a stage t0 odd mtttant, an anterior wide:ning of the odd-numbered stripes is observed (compare with Fig. 2D). Dnts indicate parasegmental boundaries 3, 4, and 5. All embryos are shown anterio~ left and dorsal, up except for a ventral view in/E}.

pair-rule genes (including prd) are no longer expressed in the ectoderm (Gutjahr et al., 1993a; Benedyk et aL, 1994). Therefore they cannot be responsible for the fragment IV activity observed. This late prd-independent fragment IV activity remains to be elucidated

When the transgenic line IV is crossed into a~ eve background, the stripes of #-galactosidase expression in the t runk appear earlier and are dramatically wider compared to the endogenous expression (Fig. 3C]. The fact that the widening of the stripe, s is found in the domain oi norma] eve expression is consistent with Eve funct iomng as a repressor of gsb activity. However, this change closely parallels the widening in prd expression into the odd-numbered paraseg- c e n t s in eve embryos (Baumgartner and Noll, 1990). In a wild-type embryo, eve could therefore repress %sb directly and/or indirectly th rough repression of prd.

In a f t z background, f ragment IV expression is also derepressed in the ectoderm (Fig. 3D). The stripes appear earlier and wfder poster ior ly in the even-numbered paras- segments (the domain of no rma l ) z expression), Unl ike wha t is observed in an eve background, m o s t stripes

remain repressed in one or two cells per parasegment (Fig. 3D). The low f3-galactosidase expression in the even-- numbered parasegments cannot be caused by a loss of prd expression since prd is derepressed in these cells in a f t z m u t a n t background (Baumgartner and Noll, 1990). Though the repression of f ragment tV in the cycle- numbered parasegments requires ftz, an addit ional factor seems to be needed for comple te repression. A good candidate for this remaining repression act ivi ty is odd (Coulter et al., 1990). Indeed, in an odd background, the /3-galactosidase expression pat tern of t~ansgenic line IV expands anter ior ly wi th in the even-numbered paraseg- c e n t s (Fig. 3E, compare wi th Fig. 2D). This ectopic expression is, however , less dramat ic than the effect observed in f t z or eve rnutant backgrounds.

prd, eve, ftz, and odd Act Direct ly on Fragmeilt IV in Tissue Culture Cells

The results obtained in prd, eve, ftz, and odd mutan t backgrounds are suggestive of a regulatory role for these

Copyrig It ~ 20( 0 by Academic Press, All rights of reproductiol~ in my {orm reserved,

140 Bouchard, St-Amand, and Cdtd

A

©

>

> '4vo

15

10

0 1 2 Act-Prd (#g)

B

120 100

:~ 80

~a m 60 >

40

20

0 1 Z 3 4 5

Act-Eve (#g)

C 120 L . . . 100

.>~ a . 4

co >

e~

6O

40 "~'-.{__---~

20

0 1 2 3 4 5 Act-Ftz (#g)

D

100

8O

~>, 60

40

% 20

0 1 2 3 4 5

Act-Odd (#g)

FIG. 4. Pal>rule protein activity on fragment tV in transient transfection assay, (A) Prd effectively activates fragment tV-LacZ construct in a concentration-dependent manner. (B} Eve strongly represses Prd activity. At a ratio of 2: ! of Act--Eve to Act-Prd constructs, the activity of Prd on fragment IV was completely abrogated (white squares}. No repression of basal activity was observed with increasing amounts of Act Eve in absence of Act-Prd (black dots). (C) Ftz has a clear but limited capacity to repress the activity of Prd on fragment IV. Even at high quantities of Act-Ftz construct, 40% activity of Prd -was still present. {D) Odd is a strong repressor of the activity of Prd in this assay. A complete repression is obtained at a ratio of 3:1 of Act-Odd to Act-Prd constructs. The repression assays {B, C, and D) were made using a constant amount of Act-Prd vector {1 ~,g}, arbitrarily considered 100% actfvity.

genes on f ragment IV. However, the poss ib i l i ty remains that the a l terat ions we observed are the resul t of indirect interact ions, via in te rmedia te factor(s). To invest igate this possibi l i ty , we cotransfected pr d, eve, ftz, and odd under the control of a cons t i tu t ive ly active act in promoter , to-- gether wi th the f ragment IV--LacZ construct , into Drosoph- ila t i ssue cul ture cells.

Transfect ion of the reporter f ragment IV-LacZ const ruct w i th increasing amounts of pAct-Prd effector p lasmid re- sul ted in a 10- to 15-fold ac t iva t ion over the background level, cons is ten t wi th Prd being a t ranscr ip t ional act ivator of gsb (Fig. 4A). Eve, Ftz, and Odd fail to act ivate the reporter cons t ruc t in a s imi lar assay (data not shown). The ac t iv i ty of 1 /,g of pAc>Prd effector is considered 100% ac t iv i ty in the subsequent repression assays wi th Eve, Ftz, and Odd proteins.

Cotransfec t ion of Prd and Eve effectors show-s a strong repress ion ac t iv i ty by Eve, Indeed, Eve comple te ly abro~

gates Prd ac t iv i ty at a 2:1 rat io of the respective constructs (Fig. 4B). In this assay, Eve does not seem to repress by in teract ing di rec t ly wi th the basal promoter , but rather by compet ing wi th Prd for binding to fragment IV. Indeed, in the absence of Prd, the basal level of f ragment IV-LacZ act iv i ty is not repressed by Eve alone (Fig. 4B).

In a s imi lar assay using Ftz and Odd, a clear decrease in the capaci ty of Prd to act ivate f ragment IV is also observed {Fig. 4C). Unl ike the effect observed wi th Eve, repression by Ftz on f ragment IV never exceeds 60%. Prd thus main ta ins a capaci ty of ac t ivat ion on f ragment IV despi te a high amoun t of Ftz prote in in the cell. When tes ted in our pAct-Prd/ f ragment IV assay, Odd is able to comple te ly repress Prd ac t iv i ty at a 3:1 rat io of pAct -Odd to pAct-Prd constructs (Fig. 4D). Odd is, in this regard, a lmost as good a repressor as Eve in Drosophila t issue cul ture cells and l ike ly to complemen t the l imi t ed Ftz repression act iv i ty observed.

Copyright (o 2000 b} Academic Press, All rigl-~ts of *ep~oduction in any {orm reserved.

Combinatorial Activity of Pair-Rule Proteins on gsb 141

A

IV.5

IVA

IV~S

IV.2

IV.I

<+ Prd <+ Prd Eve

tV,3

IV,4

IV.5

B

Bg

C

W,I

IV.2 IV.3 IV.4 IV.5

IV.6 IV,7

,1 ,2 .3 .4 HII .5 .6

CAATTTCCGGCGAAAATCGCATGAAGTC >

agtTTGCGGT~ATTTAGT'2ATCttocag < oaag~gtcATAATT~.l~C~ff'a%cj-tgao > TTCGGGTGTTAATGGTTTGttagtatgc <

ac~a,TTT]~AATGCC AGTGGA <

ggtGG']?CGCTGCGACACGG't%t'tgteet > CAATGATCGATTTGACACGCCAACTcagt >

.7S

FIG. 5o DNA-binding analysis of Prd and Eve on fragment IV. [A) Pl:d protein generates seven DNase I protections ove~ fragment IV [named IV.I to IV.7). The Eve-binding sites overlap with Prd homeodomain-binding sites W.3, FV.4, and IV,5. G-iA serves as a reference to identify protected sequences. Solid bar at top indicates a hOt, transferred bacterial extract. Triangles represent increasing concentration of prote.in. (B) Schematic representation of the binding sites obtained in A. Grey and l.~]ack boxes :represent homeodomain~ and paired domaJn-bitlding sites, respectively. Striped b(~x (site IV. 1) contains no canonical consensus sequence~ B]aek solid bars underneath represet~t Eve/Ftz-bin&ng sites. Bg ]~gllI~ HII, Hind]7; S, SaIL {C! Comparison of sequences protected by Prd {capital letters) al~d by Eve at~d Ftz (underlined). Proeection by Eve on site IV.3 corresponds to the GC.-rich Eve binding colas<msus (Hoey mid ll, evine, 1988) Paired domain and homeodolnag~ consensus bi~ding si tcs are in bold. The > arid < symbols indicate orientation of the sequence pointing towards and from ~:he transcription start sitE, respectivdy.

DNAoBind ing A c t i v i t y o f the Fragmen t I V RegMators

The majority of the pai>rule class of segmentation genes encode transcription factors {reviewed by Kornberg and Tabata, 19931. Prd is a paired domain- and paired-type homeodomaimconta in ing protein (Bopp et al., t986), Eve and Ftz are homeodomain proteins {Frash st a]., 1987; Laughton and Scott, 1984), and Odd contains a zinc<finger domain {Coulter at aL, 1990]. To assess the capacity of these regulators of gsb to bind fragment IV DNA, we performed DNase I protection assays using recombinant proteins purified from E. coIi.

Using this assay, we identified seven binding sites for the Prd protein {Fig. 5A). A search for consensus recognition sequences identified the binding sites in the 5' part of the

fragment as honleodonoain-binding sites (IV.2, IV.3, IV.4, and IV.5; Fig. 5C) while those in the second pact of the fragment are paired domain~-bindit~g sites /IV.6 and IV.7). This assignment is consistent with the DNase I protection results obtained with HD and PD truncations of the closely related Gsb protein on fragment IV (A. M. Larose and S.C., unpublished). Site IV.1 is bound by both domains and contains no evident consensus sequence. It was thus not further analysed in the following experiments. The binding sites observed on fragment IV are most likely Prd-binding sites since fragment IV activity is lost in a prd background (Fig. 2A), whereas no changes in activity were observed in a gsb background {data not shown).

Most interestingly, the DNase I protections obtained for Eve (Fig. 5) and Ftz {data not shown) overlap with Prd

Copyright (c) 2000 by Academic Press. All rights of reproduction m any form reserved.

142 Bouchard, St-Amand, end C6td

A

IV (wt)

IV. 2M

IV. 3M

IV, 4M

IV. 5M

IV. 6M

IV. 7M

IV. 234M

IV. 2345M

Pv'. 2346M

cell culture

4-4-+

+4-+

+ +

4-¢

4-

4-

4-+

4"4-

in vivo

+++

++4-

+++

+++

+++

+4-+

+++

4-++

B

C

c~

FIG~ 6. Effect of Prd-binding site mutations on fragment IV activity in transfections and in v~vo. (A} In transient transfection assays, most mutated constructs lost soi~qe capacity of activation compared to wild-type fragroent Constructs IV.TM and tV.2345M, however, lost all capacity of activation, in transgev~ic lines, expression of/{--galactosidase is eompleteJy Iost in line IV.TM (B] and IV.9,Sg5M (C) embryos and slightly enlarged in lil~e IV.2346M (D} embryos. The other constructs tested shoveed an expression pattern similar to that of wild-type fragm.ent IV {see Fig. 2). ( } <5% activity; ({-) ,540% activity; {+ ~-) 30--70% activiW; {-~ ~-) 70-100% activity. Constructs are named according to their mutated Prd~binding site{s).

homeodomain-binding sitcs IV3, IV.4, and IV.5 (Fig, 5~ unpublished data). This overlap suggests a repression mechanisu~ based on mutual ly exclusive binding between the Prd homeodomain and the Eve or Ft~ bomeodomains for access to fragment W. The Odd protein was also tested for D N A binding on fragment IV but no clear DNase I protec- tion was identified,

IndfviduM Prd-Binding Sf~e Act iv i ty

Given the complex organisation of the Prd-binding sites on fragl~aent IV and the overlap of some of them with ~egative regulator-binding sites, we further wanted to elu-. cidate the contr ibution of each of these sites to the activity of fragment IV. We thus inactivated them individually or in combination and tested these mutat ions in a tissue culture assay as well as in transgenic [lies.

The activi W of each of the individually mutated sites in tissue cultured cells is decreased compared to the wild-type fragment. Mutants IV.5 and IV.6, removing a homeodomah> binding site and a paired domain-binding site, respectively, result in only 15 to 20% activity {Fig. 6A). Such a reduction of activity is not observed in transgenic flies, likely rd!ecting the higher dependency of fragment IV to optimal Prd~binding activity in the tissue culture assay. Indeed some other factor(s) not present in the tissue culture system could contribute to

stabilise @agment tV i~ rive. The most dramatic effect for a single mutant ir~ transfection assay is observed with mutant IV.7M in whid l on]y 4% activi W remains {Fig. 6A}. This clearly identifies site IV.7 as a key Prd-binding site for tire normal activity of fragment IV. Consistent with this, we found no activiw of riffs construct in transgenic flies {Fig. 6B). The five other single mutants did not result in any detectable modification of: fragment [V expression pattetn in transgenic flies (see Fig. 2).

Mutating all four homeodomain~binding sites (W.2345M) has a dramatic effect in both tissue culture cells and transgenic {lies. An activity of less than 1% is observed for this construct m tissue culture {Fig. 6A}, whereas the expression in transgenic flies is nearly abolished (Fig. 6C}. This result unveils the necessity for at least one functional homeodomain-binding site for the activation of fragment IV by Prd. This model is further supported by another con- struct (IV.2346M} i1~ which the only hem eodomain-binding site present is IV.5 and the paired domain-bindhrg site IV.6 is inactivated. In tissue culture assay, this construct shows an activity of 30% (Fig. 6A), while the activity is normal in trallsgenic flies (Figs. 6A and 6D). Together, these results suggest that Prd activates transcription by binding to mul- tiple sites on fragment IV w i t h its paired-type homeodo-. main as well as its paired domain.

Cop3rig}l{ © ZOO(} by Acade*llic Press. All ights vff feploductk)~ fla any fom~ reserved.

Combinatorial Activity of Pair-Rule Proteins o:a gsb 143

D I S C U S S I O N

Using genetic and molecular approaches, we have shown that the initial ectodermal expression of gooseberry is controlled by tbe corn.bmatorial action of the pair-rule proteins on a small enhancer located 5 kb upstream of the transcription initiation site. The actiw~tion is prdo dependent in all parasegments. Repression in the inter-. stripes is regulated by eve in the oddonumbered paraseg~ ments and the combined action of flz and odd in the even-numbered parasegments. All repressors tested seem to act by impairing the capacity of Prd to properly activate transcription through the fragment IV enhancer.

Prd Act iv i ty on Fragment I V

Prd, like Gsb, contains a paired domain and a paired-type homeodomain. These domains are able to bind DNA im vitro in an independent as well as in a cooperative manner (Treisman et aL, 1991; Jun al~d Desplan, 1996). This pecu- liar feature gives the members of this family of transcri D tion factors a great DNA binding versatility. The gsb early transcriptional enhancer studied here presents an interest- ing case in which Prd uses both DNA-binding domains to interact with bomeo~ and paired domain recognition se~ quences segregated on the enhancer {Fig. 5B}. An enhancer fragment lacldng either all homeodomain-binding sites (IV.2345M) or a specific paired dornainobinding site (IV.7M) loses all activity. These results suggest that the two DNA~ binding domains of Paired cooperate for its proper activity on fragment IV. Whether the different sites of fragment IV are bound by the same molecule or by two different nolo ecules is currently unclear. The model involving only one Prd molecule is supported by an experiment showing that a combination of two mutant prd transgenes (under the control of the prd promoter), mutated in the paired domain and in the homeodomain, respectively, cannot rescue the early expression pattern of gsb in a prd mutant background, whereas a wild-type prd transgene is ablc to do so (Bertuc- cioli et al., 1996).

RegMation of gsb in the Odd-Numbered Stripes

The onset of g.~b expression first occurs in seven stripes at the cellular blastoderm stage. These stripes appear in a first row of cells at the posterior border of the evenmumhered parasegments. The expression rapidly expands to a second row of cells at the anterior border of the odd-numbered parasegments (Gutjahr et M., 1993b). The gsb stripes coin- cide with the posterior border of Prd expression in the odd-numbered parasegrnents (Baumgartner and Noll, 1990). In an elegant study of the different modes of eve regulation, Fujioka et aL (1995) suggest that the early bell~shaped expression of Eve acts as a morphogenetic gradient regulat- ing the posterior border of prd expression. Although the posterior border of gsb expression in the oddmumbered parasegments could be specified by Prd expression ~done, it

is likely that Eve also acts directly on the gsb control region. Indeed, we have shown here that the Eve-binding sites overlap with some of the Prd-binding sites, suggesting a competition at the DNAobindi:ag level.

In principle, the consensus sequences identified by DNase I protectioJ~ with Eve could represent binding sites of other homeodomain p:roteins regulating gsb expression. However, the fact that Eve and Ftz are the only known homeodomain proteins expressed in a double segment pe- riodicity at the blastoderm stage strongly argues against this. Moreover, a direct action of Eve on gsb regulation is supported by short-pulse heatoshock experiments which faw)ur direct regulatory effects (Manoukian and Krause, 1992). Using this assay, the ectopic overexpression of prd could override the repression by Eve in the odd°numbered paraseglnents, while a heat-shock eve could abrogate Prd activation of g.~b in all parasegments (S.C. and R. Ouellette, unpublished data)~ Altogether these results suggest that gsb responds to the Eve morphogenetic gradient in th.e odd- numbered parasegments.

RegMa,ion of gsb it, the Even-Numbered Stripes

The endogenous even-numbered g,sb stripes appear at stage 6 with a slight delay compared to the oddmmnbered stripes (Gutjahr et aL, 1993b). it is now dear that Prd is essential for the activation of these stripes since neither the endogenous gsb transcription (S.C. and R. Ouellette, unpub- lished data) nor the fragment IV expressiot~ {Fig. 2A) was observed :in the trunk during germ~band extension in a prd embryo. Transcriptional activity was also lost in tissue culture assays and in vivo {transgenie lines} upon removal of Prdobinding sites (Fig. 6). A similar conclusion concern- ing the activity of Prd in all parasegments was reached using ectopic overexpression of Prd {Cai et M., 1994). The necessily of Prd for g,vb activation does not exclude the potential requirement of another factor such as Odd-paired as previously suggested (Li et aL, 1.993). Alternatively, it is possible that Opa is involved i,~ the maintenance of gsb by activating wg in the evenmumbered stripes. The activity of Opa on g,~b through the Wg signal could account for the remnants of evenmumbered stripes observed at late stage 11 in a prd transgenic line IV embryo (Fig. 2B~ Li et al., 1993). Indeed, wg is known to depend on prd in the odd-numhered stripes, whereas it depends on Opa in the even-numbered stripes (Ingham, 1988~ Benedyk et aL, 1994).

The establishment of the posterior border of gsb in the even-numbered parasegments requires an efficient mecha- nism of repression since Prd is present in the whole even- numbered parasegments at the t ime of gsb initiation {Gut-- iahr et aL, 1993). We have shown that the expression of transgenie line IV-LacZ is derepressed in ) z and odd mutant embryos {Fig. 3}. Moreover, Prd activity was di~ rectly competed by Ftz and Odd in tissue cultured cells (Fig~ 4}. These data identify Ftz and Odd proteins as responsible

Copyright © 2000 by Academic Press, All rights of reproduction ir~ any form reserved.

144 Bouchc~rd, S t -Amend, ~md Cdtd

for the establishment of gsb expression borders in the even-nulnbered parasegments.

In the genetic analysis of f ragment IV, we observed that ne i ther f tz nor odd m u t a n t embryos show a comple te derepression in the even-numbered parasegment. An odd embryo shows an anterior widening of the odd-numbered gsb stripes (Fig. 3E; S.C. and R. Ouellette, unpubl ished data), suggesting a m o r e impor tan t role of Odd in the region of low Ftz concentra t ion. This result also indicates tha t Ftz is a potent repressor in the embryo since it is still able to partially repress gsb, even though Prd remains high in the central part of the even-numbered paraseg- men t s in an odd embryo, as opposed to its gradual repression in this region in a wild-type background (Baumgartner and Noll, 1990). In a f t z embryo, we ob- serve a posterior widening of two to three cells in the even-nmn.bered stripes. This l imi ted expansion can be explained by the act ion of Odd in the pos te r ionnos t por t ion of the parasegment Colnbined wi th the fact that Prd is fading exclusively in this region in a f t z m u t a n t embryo (Baumgartner and Noll, 1990).

The true repressor effect of Odd on f ragment IV is possibly masked in our genetic experirnents by the fact that, in an odd m u t a n t embryo, Ftz is not properly repressed in the posterior por t ion of the parasegment (Mullen and DiNardo, 1995). In such an embryo, Ftz is thus compensa t ing for the absence of Odd. At the mo- lecular level, the mechan i sm of act ion of Odd is unclear. It is possible tha t Odd binds direct ly to f ragment IV via its zinc-finger domain, but this in terac t ion would have been missed due to insuff icient binding act ivi ty in vitro. Alternat ively, Odd could bind Prd via protein.-protein in terac t ion and thereby interfere wi th its t ransact iva t ion properties.

The characterisation of the fragnrent IV early gsb en- hancer thus presents a demonstrat ion of the regulation of the segment polarity genes by combinatorial activity of pair-rule proteins. This is also one of the first demonstra~ tions of a cross-regulation between two Pax genes. In Drosophila eye development, it has recently been shown that eyeless {ey) gene regulation is under the control of 7'win of eyeless, a second Pax6 horn ologue closely related to ey (Czerny et eL, 1999). Likewise, proper Pax5 expression depends on Pax2 function in the mouse midbrain (Pfeffer et ol., 2000). Such direct cascades of regulation might prove to be a widespread mode of action of Pax genes during devel- opment, as suggested by the coexpression and genetic dependency of m a n y other Pax proteins in different tissues and organisms (Ouellette et aI., 1992; Gutjahr et el., 1993b; Stoykova and Gruss, 1994~ Mansouri et el., t994; Pfeffcr et el., 1999).

ACKNOWLEDGMENTS

We are grateful to Anne~Marie Larose and Rodney Ouellette for insightful coraments during this work. Thanks also to

Meinrad Busslinger, Thomas Czerny, Lucie Jeanotte, Jfirgen Knoblich, and Peter Pfeffer for critically reading the manuscript. Thanks to Tim Newsome, Kirsten Senti, and Valerie Vivancos for their valuable help in the completion of the manuscript and to Henry Krause for the pARFtz vector. This work was supported by a grant from the MRC (Canada) to S.C. and a MRC (Canada) fellowship to M.B.

REFERENCES

Ananthan, J., Baler, R., Morrissey, D., Zuo, J., Lan, Y., Weir, M., and Voelhny, R. {1993). Synergistic activation of transcription is mediated by the N~terminal domain o~ lJrosophiia fushi tarazu homeoprotein and can occur without DNA binding by the protein. Mol. Cel/. Bdo]. 13, 1599-d609,

Baumgarmer, S., Bopp, D., Burri, M., and Nolt, M. (1987}. Structure of two genes at the gooseberry locus related to the segmentation gene ])aired and their spatial expression, during Drosophila elTl- bryogenesis. Genes Dev. 1, 1247~1267.

Baumgartner, S., and Noll, M. (1990). Network of interactions among pair-rule genes regulating paired expression during pri- mordial segmentation of Drosophila. Mech. Dev. 1, 1-18.

Benedik, M. J., Mullen, J. R., and DiNardo, S. (1994). odd-paired: A zinc-finger pal>rule protein required for tbe timely activation of engrailed and wingless in Drosophila embryos. Genes Dev. 8, 105-117.

Bernier, D., Thomassin, H., Allard, D., Guertin, M., Hamel, D., Blaquihre, M., Beaucbemin, M., LaRne, H., Estable-Puig, M., and B61anger, L. (1993). Functional analysis of developmentally regu- lated chromatin.-hypersensitive domains carrying the ~>fetoprotein gene promoter and the albumin/c>fetoprotein in- tergenic enhancer. Mol. Cell. Biol. 13, 1619-1633.

Bertuccioli, C., Fasa~o, L., Inn, S., Wang, S., Sbeng, G., and Desplan, C. (1996). In vivo requirement for tl~e paired domain and the homeodomain of the paired segmentation product. Developl~qent 122, 26732685.

Bopp, D, Burri, M, Bamngartner, S., Frigerio, G., and Nol], M. (1986). Conservation of a large protein domain in the segmenta- tion genes poired gene and in functionally related genes of Drosophila. Cel] 47, [033 ]040.

Cadigan, K. M., Grossniklaus, U., and Gehring, W. (1994). Local- ized expression of slOppy-p~dred protein maintai~s the polarity of Drosophiga parasegments. Genes Dev. 8, 899-913.

Cai, J., Lan, Y., Appel, L. F., and Weir, M. [1994). Dissection of the Drosophila Paired protein: Functional requirements for con- served motifs. Mech. Dev. 47, 13%~I50.

C6td, S., Preiss, A., Haller, l., Schuh, R.; Kienlin, A, Seifert, E., and Jackle, H. (1987). The gooseberry-zipper region of Drosophila: Five genes encode different spatially restricted transcripts in the embryo. EMBO ]. 6, 2793-2802.

Coulter, D. E., Swaykus, E. A., Beran-Koebn, M. A., Goldberg, D., Wieschaus, E_, and Schedl, P. (1990). Molecular analysis of odd-.sk:ipped, a zinc-finger encoding segmentatim~ gene with a novel pal>rule expression pattern. EMBO ]. 8, 3795-3804.

Czemy, T., Schaffner, G., and Busslinger, M~ (1993). DNA sequence recognition by Pax proteins: Bipartite structure of the paired domain and its binding site. Genes Dev. 7, 2048-2061.

Czerny, T., Halder, G., Kloter, U., Souabni, A., Gehring, W. !., and Busslinger, M. (1999). Twdr~ of eyeless, a second Pax6 gene of Drosophila, acts uptstream of eyeJesx in the control of eye development. Mal. Cell 3, 297-307.

Copyright ,D 2000 by Academic Press. All rights of reproduction in m~y form reserved.

Combinatorial Act iv i ty of Fair-Rule Proteins o n gsb 145

Di Nocera, P. P., and DawJd, I. (1983]. Transient expression of genes introduced into cultured cells of Drosophila Proc. Nail. AcacL Sci. USA 80, 7095-7098.

Duman-Scheel, M., Li, X., Orlov, I., Noll, M., and Patcl, N, H. (1997). Genetic separation of the neural and cuticular patterning functions of gooseberry. Developrm;nt 124, 2855-.4865

Edgar, B., and O'Farrell, P. {2990). The three postblastoderm cell cycles of Drosol:d~Lhz embryogenesis are regulated in G2 by string. Cell 62, 469 ~-480.

Frasch, M., Hoey, T., Rushlow, C., Doyle, H., and Levine, M. {1987}. Characterization and localization of the eve~2-sl<l))ped protein of Dro,~ophila. EMBO ]: 6, 749=759.

Fujioka, M., Jaynes, J. B., and Goto, T. (1995), Early evemskq~ped stripes act as morphogenetic gradient at the single cell level to establish enj::miled expression. Develo!m?e,~t 121, 4371-- 4382.

Gergen, J. P., Coulter, D., and Wieschaus, E. (2986). Segmental pattern and blastodenn cell identities, lr~ "Gametogenesis and the Early Embryo" (J. G. Gall, Ed.}, pp. 195-.--220. R. Liss, New York.

Gutjahr, T., Frei, E., aad Noll, M. {1993a). Complex regulation of early paired expression: Initial activation by gap gone and pattern modulation by pai~-rule genes. Development. 117, 609--623.

Gutjahr, T., Patel, N. H., Li, X., Goodman, C. S., and No]l, M. {1993b). Analysis of the gooseberry locus in Drosophila embryos: gooseberry determines the cuticular pattern and activates goose- berry neuro, i)evelop~7~ent 118, 21~31.

Hart, K., Levin G M. S., and Manley, J. L. (1989). Synergistic activation and repression of transcription by Drosophila h(> meobox proteins. Cell 56, 573-58&

Hironri, Y, and Gehring, W. J. (1987)Regulation and function of t]:te Drosophila segmentation gone fushi torozu. Cell 50, 963-- 974.

Hocy, T., and Levine, M. (1988). Divergent homeo box proteins recognize similar DNA sequences in Drosophila. Noture 332, 858 -861.

Hooper, J., and Scott, M. P. (1992}. The molecular genetic basis of positional information in insect segments, li? "Results and Problems in Cell Differentiation" (W. Hennig, Ed.), Voh 18, pp. 1-48. Springe>Verlag, Berlin Heidelberg.

lngham, P. W. {19881. The molecular genetics of embryonic pattern formation in Drosophih~. Nature 335, 25-34.

Ingham, P, W., and Hidalgo, A, (1993}, Regulation of wingless transcription in the Drosophila embryo. Development 117, 283- 291.

Johnson, A. D. (1995). The price of repression. Ceil 81,655-658. Jun, &, and Desplat~, C. (1996). Cooperative interactions between

paired domain and homeodomain. Developme~t 122, 2639- 2650.

Karess, R. E., and Rubin, G. M. (1984). Analysis of P transposah2e element functions in Drosophila. Cell 38, 135-146.

Klemenz, R., Weber, U., and Gchri.ng, W. J. (1987}. The white gone as a marker in a new P-element vector for gone transfer in DrosotJhiIa. Nucleic Acids Res, 15, 394.7-3959.

Komberg, T. B., and Tabata, T (1993). Segmentation of the Dro- sophil(~ enabryo. Ctm-. Opin. Genet. Dev. 3, 585.-593.

Laughton, A., and Scott, M. P. (1984). Sequence of a Drosophila segmcntatinn gene: Protein structure honrology with DNA- binding proteins. Nnture 310, 2540.

Levine, M., and Manley, J, L. (1989). Transcriptional repression of enkaryotic promoters, Cell 5% 405-408.

Li, X,, and Nol], M. (2993). Role of the goosebezry gene in Drosw~hila ernbryos: Maintenance of wiug/es's expression by a wingles.~-gooseb¢r±y autoregulatory loop. EMBO [ 12, 4499-- 4509.

Li, X, Gutjar, T., and Noll, M. {1993). Separable regulatory ele- ments mediate the establishment and maintenance of cell states by the Dro.,;ophila segment-polarity gone gooseberry. EMBO ]. 12, 1427-1436,

Lindsley, D. L., and Zimm, G. G. 11992). "The Genom e of Drosoph-. iZa mehmogaster." Academic Press, San Diego.

Manoukian, A. S., and Krause, H. (1992). Concentration-dependent activities of the evm>skipl)ed protein in Drosophila embryos. Genes Dev. 6, 1740- 2752.

Mansouri, A., Stoykova, A., and Gruss, P. (1994). Pax genes in development. ] C~fll Sci. Suppl. 18, 35-42.

Morrissey, D., Askew', D., Lakshmi, R., and Weir, M. (1991) Functional dissection of the pnired segmentation gene in Dro- sophila embryos. Gen~s Dev. 5, 1684-1696.

Mullen, J. R., and DiNardo, S. (1995). Establishing parasegments in Drosophila embryos: Roles of the odd~skipt)ed and naked genes. Dev. Biol. 169, 295-308.

Nol], M, (2993). Evolution and role of Pax genes. Cm:r, ()pin. Gm~et. Dev. 3, 595-605.

Niisslein-Volhard, C., and Wieschaus, E, (1980). Mutations affect- ing segment number mud polarity ix Drosophilae. Nature 287, 795-801.

Ouellette, R. J., Valet, J.-P., and C6t4, S. (2992). Expression of gooseberry-proximal in the Drosophila developing nervous sys- tem responds to cues provided by segment polarity genes. Wil- helm Roux's Arch. Dew BioL 201, 157-168.

Proffer, P. 1.., Gerster, T., Lun, K., Brand, M., and Busslinger, M. (1999). Characterization of three novel menrbers of the ze- brafish Pax2/5/8 family: Dependency of Pax5 and Pe~x8 expre> sion on the Pax2.1 (noi) function. Developmenl 125, 3063- 3074.

Proffer, P. L., Bouchard, M., and Busslinger, M. (2000). Pax2 and homeodomain proteins cooperatively reglllate a 435 bp enhancer of the ll~OUSe Pax5 germ at the midbrain-hindbrain boundary. Development 127~ 1017-1028.

Rubin, G. M., and Spradling, A. C. (1982}. Genetic transformation of Drosophila with transpnsahle element vectors. Science 218, 348---353.

Seed, B., and Sheen, ].°Y. (1988}. A simple phase-extracti~m assay for chloramphenicnl acetyl transferase activity. Gone 67, 271-277.

Skeath, J. B., Zhang, Y,, Holmgren, R,, Caroll, S. B., and Doe, C. (1995). Specification of neuroblast identity in the Drosophila embryonic nervous system by gooseberry-distaL Nature 376, 427-430.

Stoykova, A., and Gruss, P. (1994). Roles of Pax-genes in developing and adult brain as suggested by expression patterns. J. NeuroscL 14, 1395-4412.

Thummel, C. S., Boulet, A. M., and Lipshitz, H. D. (29881. Vectors for Drosophila P-element-nrediated transformation and tissue culture transformation. Gane 74, 445-456.

Treisman, J., G6nczy, P., Vashishtha, M., Harris, E., and Desplan, C~ (1989). A single amino acid can determine the DNA binding specificity of homeodomain proteins. Cell 59, 553462.

Treissman, J., Harris, E., and Desplan, C. (1991). The paired-box encodes a second DNA-binding domain in the paired honreo domain protein. Genes Dev, 5, 594-604.

Copy:right © 2000 by Academic Press. Atl rGhts of reproduction in any folm reserved,

146 Bouchard, St-Amand, and Cdtd

Turner, F. R., and Mahowald, A. P. (1977). Scanning electron microscopy of Drosophila embryogenesis. II. Gastrulation and segmentatJom Dev Biol. 81, 51-64.

Walther, C., Guenet, J.-L., Simon, D., Deutsch, U., Jostes, B., Goulding, M., Plachov, D., Bailing, R., and Gruss, P. (1991). Pax: A routine multigene family of paired box-containing genes. Gez~omics 11, 424-434.

Wilson, D., Sheng, S., Lecuit, T., Dostani, N., and Desplan, C. (1993). Cooperative dimerization of Paired class homeo domains on DNA. Genes Dev. 7~ 2120-2134.

Zhang, Y., Ungar, A., Fresqnez, C, and Holmgren, R. (1994). Ectopic expression of either the Drosophilt~ gooseberry-distal or proximal gene causes alterations of cell fate in the epider- mis and central nervous system. Development 120, 115.[- 1161.

Received for publication November 22, 1999 Revised February 28, 2000

Accepted February 28, 2000

Copyright {) 2000 by Academic Press. All rights of reproduction in any form reserved,