Cloning of lipoprotein lipase (LPL) and the effectsof dietary lipid levels on LPL expression in GIFTtilapia (Oreochromis niloticus)

Aimin Wang • Guangming Han • Zhitao Qi • Fu Lv •

Yebing Yu • Jintian Huang • Tian Wang • Pao Xu

Received: 18 January 2012 / Accepted: 9 January 2013 / Published online: 8 February 2013� Springer Science+Business Media Dordrecht 2013

Abstract Genetically improved farmed tilapia (GIFT) (Oreochromis niloticus) is an

important aquaculture species. Lipoprotein lipase (LPL) is considered as a key enzyme in

lipid metabolism and deposition. The present study was conducted to investigate the

nutritional regulation of LPL in GIFT. We cloned and characterized the LPL gene from

GIFT. Finally, we determined the effects of dietary lipid levels and refeeding on hepatic

LPL gene expression in GIFT. The LPL gene of GIFT (Oreochromis niloticus) (O.nLPL)

was 2,298 bp in length and encoded 515 amino acids. Sequence analysis showed that

O.nLPL shared 57.3–87.9 % identity with LPLs from other piscine species. To study LPL

expression patterns, juveniles GIFT were fed diets containing 3.7, 7.7 or 16.6 % crude lipid

for 90 days and the expression of hepatic O.nLPL was examined using real-time PCR. The

abundance of hepatic LPL mRNA increased with increasing dietary lipid. The expression

of O.nLPL mRNA in the 16.6 % dietary lipid group was significantly higher than that of

the 3.7 % lipid group (P \ 0.05). The expression of O.nLPL was increased in GIFT

following a 48-h fast and decreased 12 h after refeeding. Hepatic LPL mRNA returned to

fasting levels 48 h after refeeding. In summary, high dietary lipid induced expression of

liver O.nLPL, and expression of liver LPL is regulated by fasting and refeeding.

Keywords Lipoprotein lipase (LPL) � Gene cloning and characterization � Hepatic LPL

expression � Feed oil � Dietary lipid levels � GIFT (Oreochromis niloticus)

A. Wang � G. Han � T. Wang (&) � P. Xu (&)Key Open Laboratory for Genetic Breeding of Aquatic Animals and AquacultureBiology Certificated by the Ministry of Agriculture, Wuxi College of Fisheries of NanjingAgriculture University, Wuxi 214081, Jiangsu, Chinae-mail: twang18@163.com

P. Xue-mail: xup@ffrc.cn

A. Wange-mail: blueseawam@ycit.cn

A. Wang � G. Han � Z. Qi � F. Lv � Y. Yu � J. HuangKey Laboratory for Aquaculture and Ecology of Coastal Pool of Jiangsu Province, Department ofOcean Technology, Yancheng Institute of Technology, Yancheng 224051, Jiangsu, China

123

Aquacult Int (2013) 21:1219–1232DOI 10.1007/s10499-013-9625-x

Introduction

Dietary lipid plays an important role in commercial fish diet as a source of energy and

essential fatty acids. Dietary lipids cannot be replaced by other nutrients due to their unique

biological functions. Fish have several lipases including lipoprotein lipase (LPL), hepatic

lipase (HL), pancreatic lipase (PL) and endothelial lipase (EL) all of which play critical

roles in digesting dietary lipids. These lipases share structural similarities but play different

roles in lipid metabolism (Hide et al. 1992; Oku et al. 2006). LPL is a glycoprotein that is

synthesized and secreted from adipocytes, muscle cells, macrophages and other paren-

chymal cells (Raisonnier et al. 1995; Cheng et al. 2010). LPL regulates lipid content in

different tissues and indirectly determines the lipid intake of the metabolic pathway from

dietary sources (Zechner 1997). In blood vessels, LPL binds to the surface of endothelial

cells and plays a key role in hydrolyzing triglycerides (TGs) transported in the bloodstream

as very low density lipoproteins and chylomicrons. LPL activity in the bloodstream pro-

vides free fatty acids for cells and affects the maturation of circulating lipoproteins (Wion

et al. 1987; Saera-Vila et al. 2005).

Full-length LPL cDNA has been cloned and characterized in several fish species

including zebrafish (Danio rerio) (Arnault et al. 1996), rainbow trout (Oncorhynchus

mykiss) (Kwon et al. 2001; Lindberg and Olivecrona 2002), gilthead sea bream (Sparus

aurata) (Saera-Vila et al. 2005), red sea bream (Pagrus major) (Oku et al. 2006), European

sea bass (Dicentrarchus labrax) (Jose Ibanez et al. 2008) and common carp (Cyprinus

carpio) (Cheng et al. 2010). Additionally, a partial sequence from grass carp (Cteno-

pharyngodon idellus) (Ji et al. 2009) is available.

In recent years, many studies have focused on piscine LPL, the effects of dietary lipid

levels and refeeding on fish LPL expression. For example, Oku et al. (2006) studied the

distribution of LPL in adipose tissue and concluded that the expression of LPL was tissue

specific. Saera-Vila et al. (2005) and Albalat et al. (2006) reported that in red sea bream

and rainbow trout, LPL was mainly expressed in the liver. Zheng et al. (2010) studied the

effects of dietary lipid level on hepatic LPL expression in dark barbel catfish (Pelteobagrus

vachelli). Oku et al. (2006) and Ji et al. (2009) evaluated the effects of fasting and

refeeding on the expression of liver LPL in red sea bream and grass carp, respectively.

These studies demonstrated that the expression of liver LPL is induced by fasting and high

dietary lipid. Previous studies demonstrated that the piscine liver possesses LPL activity

(Black and Skinner 1987) and expresses LPL mRNA (Liang et al. 2002; Lindberg and

Olivecrona 2002). Additional study of LPL expression in the piscine liver will further our

understanding of the mechanisms controlling hepatic lipid regulation and the formation of

fatty liver.

GIFT, the genetically improved farmed tilapia (Oreochromis niloticus), has become an

important aquaculture species in China (Dey et al. 2000). Due to its high market value,

aquaculture production of this species has increased rapidly in recent years. Fatty liver and

excess lipid accumulation are increasingly important factors in selecting lipid content for

aquaculture diets. LPL is a key enzyme in lipid metabolism and deposition. LPL plays a

central role in the hydrolysis of circulating triglycerides, present in chylomicrons and very

low density lipoprotein. Therefore, understanding the function of LPL in lipid metabolism

is particularly important. However, only limited information about lipid metabolism and

LPL expression in GIFT is available (Hsieh et al. 2007; Wang et al. 2010a; Han et al.

2011a). The aim of this study was to clone and characterize the LPL gene in GIFT

(O.nLPL) and evaluate the effect of dietary lipid levels and refeeding on hepatic LPL gene

expression in GIFT. The results of this study will facilitate further studies on the function

1220 Aquacult Int (2013) 21:1219–1232

123

of LPL and its regulation of lipid metabolism in fish. This data may have important

applications in aqua-feed formulation and aquaculture production.

Materials and methods

Experimental animals

GIFT juveniles were provided by the fish farm of the Freshwater Fisheries Research

Center, Chinese Academy of Fishery Sciences (Jiangsu Province, China). Fish were reared

in a temperature-controlled, recirculating aquaculture laboratory, which contained 18 tanks

(diameter: 70 cm, water volume: 250 L). Fish were acclimated to laboratory conditions for

2 weeks before being randomly distributed into the tanks.

Experimental diet

Our previous study showed that the optimal dietary lipid level for GIFT tilapia juveniles is

7.7–9.3 % (Wang et al. 2011). Therefore, in this study, the control group had a dietary lipid

level of 7.7 % and the treatment groups were high lipid (16.6 %) and low lipid (3.7 %)

groups. Three isonitrogenous experimental diets (30.4 % crude protein) were formulated to

contain lipid levels of 3.7, 7.7 and 16.6 %, with fish oil as the lipid source (added at 0, 6

and 15 %, respectively). Table 1 shows the ingredients and proximate composition of the

experimental diets.

Dietary ingredients were ground into a fine powder through a 260 lm mesh. Micro-

components were mixed by the progressive enlargement method. Distilled water and fish oil

were added to the premixed dry ingredients and thoroughly mixed with a mixer (SJF-30,

Fishery Machinery and Instrument Research Institute, Chinese Academy of Fishery Sci-

ences, China). Pellet feed (1 mm pellet diameter) were made at 70–85 �C using a feed mill

(SLP-80, Fishery Machinery and Instrument Research Institute) and dried for 16 h in a

ventilated oven at 60 �C. Dry pellets were sealed in plastic bags and stored at –20 �C until use.

Experimental procedure

The experiment was conducted at the Laboratory of Aquatic Nutrition and Feed of

Yancheng Institute of Technology, Key Laboratory for Aquaculture and Ecology of

Coastal Pool of Jiangsu Province, China. After acclimation, 315 GIFT juveniles (average

weight 2.63 ± 0.16 g) were randomly divided into nine tanks (35 fish per tank). The

following three groups (three tanks per group) were used in the experiment. The control

group was fed with the basal diet with 6 % fish oil (lipid level = 7.7 %) (Wang et al.

2011), and two treatment groups were fed with the basal diet with 2 % fish oil (lipid level

of 3.7 % (low)) and 15 % fish oil (lipid level of 16.6 % (high)). The fish were fed these

diets for 90 days. During the experiment, the fish were fed three times per day at 6:30,

13:30 and 18:30 h. The amount fed per day was 8.0–10.0 % of body weight. The water in

the tanks was provided by an underground source. One-third of the water volume was

exchanged once a week, silt was siphoned daily and the water was oxygenated day and

night. Water temperature was measured every day, and water quality was measured every

week. The water temperature was 22–27 �C, pH 6.8–8.0, dissolved oxygen content

[5 mg L-1, NH3 \ 0.05 mg L–1 and H2S \ 0.1 mg L–1.

Aquacult Int (2013) 21:1219–1232 1221

123

Sampling and analytical methods

At the beginning of the feeding experiment, the livers from six fish were sampled, batch

weighed, immersed in liquid nitrogen and kept at –80 �C for cloning of the LPL gene. All

fish were individually weighed at the beginning and the end of the 90-day feeding trial, and

weight gain (WG) was calculated. After the completion of the 90-day test period, the fish

were starved for 48 h and then refed. Fish were anesthetized with 0.02 % MS-222 (tricaine

methanesulfonate, Shang Hai Buxi Chemical Co., Ltd, China). Three fish per tank (nine

fish per group) were randomly collected, weighed, killed and dissected at 24 h pasting of

the 90-day feeding trials; liver and dorsal muscles above the lateral lines on both sides of

the body were sampled and then immediately frozen at -20 �C for determination of lipid

content.

And then, three fish per tank (nine fish per group) were randomly collected, weighed,

killed and dissected at each of the following times: 24-h fasting, 0, 6, 12, 24 and 48 h after

refeeding. Livers were sampled, immediately flash frozen in liquid nitrogen and then

transferred to -80 �C for later isolation and quantification of hepatic LPL mRNA.

Liver and muscle samples were dried at 105 �C until constant weight for analysis.

Analysis of crude lipid and crude protein from sample liver and muscle tissue, and the

experimental diets were determined following the recommended methods of the Associ-

ation of Official Analytical Chemists (AOAC 1984). Crude protein (N 9 6.25) was

Table 1 Formulation and nutritional composition of experimental diets (air-dry basis)

Ingredients (%) Lipid level

3.7 % 7.7 % 16.6 %

Fish meal 8.0 8.0 8.0

Soybean meal 25.0 25.0 25.0

Peanut meal 10.0 10 10

Rapeseed meal 18.0 18.0 18.0

Wheat middlings 14.0 14.0 14.0

Corn starcha 18.0 14.0 5.0

Ca (H2PO4)2 1.5 1.5 1.5

Fish oil 2.0 6.0 15.0

Salt 0.2 0.2 0.2

Choline chloride 0.3 0.3 0.3

Feed premixb 3.0 3.0 3.0

Total quantity 100 100 100

Proximate composition (%)

Crude proteinc (dry matter, %) 30.4 30.4 30.4

Crude lipidc (dry matter, %) 3.7 7.7 16.6

a Corn starch ingredient refers GB-T 8885-2008 standard of first rank standardb The premix provides vitamin and mineral for a kilogram of diet: VE 60 mg; VK 5 mg; VA 15,000 IU;VD3 3,000 IU; VB1 15 mg; VB2 30 mg; VB6 15 mg; VB12 0.5 mg; nicotinic acid 175 mg; folic acid5 mg; inositol 1,000 mg; biotin 2.5 mg; pantothenic acid 50 mg; Fe 25 mg; Cu 3 mg; Mn 15 mg; I 0.6 mg;Mg 0.7 gc Crude protein and crude lipid were determined following methods of Association of Official AnalyticalChemists (AOAC 1984)

1222 Aquacult Int (2013) 21:1219–1232

123

determined using the Kjeldahl method after acid digestion using an Auto Kjeldahl System

(1030-Auto-analyzer, Tecator, Sweden). Crude lipid was determined by the ether extrac-

tion method using Soxtec System HT (Soxtec System HT6, Tecator, Sweden).

Cloning and sequencing

Total RNA from liver was extracted using Trizol Reagent (Invitrogen) following the

manufacturer’s instructions. Quantity and purity of isolated RNA were determined by

absorbance measurements at 260 and 280 nm, respectively. Reverse transcription was

performed on total RNA using oligo-DT as the primer in a 20 ll reaction volume. The

M-MLV first strand cDNA synthesis kit (TaKaRa) was used according to manufacturer’s

instructions.

For sequencing of GIFT LPL mRNA, degenerate primers were based on conserved

piscine LPL sequences (LPL-F/LPL-R) and were designed with Primer 5.0. PCR ampli-

fication was performed in a total volume of 25 ll containing 2 ll cDNA template, 2.5 ll of

0 9 buffer, 2 lm MgCl2, 200 lm dNTP, 0.125 U Taq and 0.1 lm primers. The PCR was

carried out with 1 cycle at 94 �C for 3 min, 30 cycles at 94 �C for 1 min, 58 �C for 1 min,

72 �C for 1 min, followed by 1 cycle at 72 �C for 10 min. The amplified fragments were

gel purified and extracted using a TaKaRa agarose gel purification kit, and then ligated into

pMD18-T (TaKaRa). The ligation solution was transformed into competent Escherichia

coli DH5a cells (TaKaRa). Positive clones were screened using the following PCR pro-

gram: 1 cycle at 94 �C for 3 min, 30 cycles at 94 �C for 30 s, 52 �C for 1 min, 72 �C for

30 s followed by 1 cycle at 72 �C for 10 min. The positive clones were sequenced using an

automatic DNA sequencer (ABI Applied Biosystems Model 377).

The specific primers used for 30 RACE and 50 RACE were designed based on the obtained

partial sequence of Nile tilapia LPL. The 30 RACE and 50 RACE were performed using the

gene-specific primers, adaptor primers (AP) and the SMARTTM M-MLV RT kit following

the manufacturer’s instructions (Clontech). The PCR cycling program for 30 RACE was 1

cycle at 94 �C for 5 min, 9 cycles at 94 �C for 30 and 68 �C for 30 s. For 50 RACE, the cycle

was 72 �C for 90 s, 29 cycles at 94 �C for 30 s, 66 �C for 30 s, 72 �C for 90 s, followed by 1

cycle at 72 �C for 10 min. The primers used for LPL cloning were listed in Table 2.

Sequence analysis

BLAST was used to identify homologous sequences in the GenBank database. The

deduced amino acids were predicted using software on the ExPASy molecular biology

server (http://www.expasy.org). The signal peptides were predicted using SignalP 3.0

software (Bendtsen et al. 2004). Multiple sequence alignments were generated by the

CLUSTALX 1.8 program (Thompson et al. 1997). Identities of the amino acids were

determined using MegAlign in DNAStar software. Putative domains and possible N-gly-

cosylation sites were identified by PROSITE (http://ca.expasy.org/prosite) (Sigrist et al.

2010). The phylogenetic tree was constructed based on the deduced amino acid sequences

using the neighbor-joining (NJ) algorithm within MEGA 3.1 (Kumar et al. 2008).

Real-time qPCR

Expression analysis of O.nLPL was performed using the real-time PCR with b-actin as

house-keeping gene (Oku et al. 2006). Total RNA was isolated from the samples using

Aquacult Int (2013) 21:1219–1232 1223

123

Trizol Reagent (Invitrogen). The genomic DNA contaminating the RNA samples was

digested by RNase-free DNase I (TaKaRa) incubation for 15 min at 37 �C. Next, 2 lg of

RNA was transcribed into cDNA using M-MLV reverse transcriptase. All cDNA samples

were stored at –20 �C until analysis.

Real-time PCR was conducted on a Mini Option Real-time PCR machine (Bio-Rad). The

20-ll reaction contained 1-ll cDNA sample, 10 ll 2 9 SYBR green I Master Mix (TaKaRa),

0.5 ll of each primer and 8 ll H2O. PCR amplification was performed in triplicate wells

using the following protocol: 3 min at 95 �C, 45 cycles consisting of 10 s at 95 �C, 15 s at

63 �C and 25 s at 72 �C. A melting curve analysis was performed to confirm that a single PCR

product had been amplified. At the end of the reaction, the fluorescent data were converted

into Ct values. Each transcript level was normalized to b-actin using the 2-DDCT method

(Livak and Schmittgen 2001). Table 2 lists the primers used for this analysis.

Statistical analysis

All data were expressed as mean values ± standard error (SE) and subjected to one-way

analysis of variance (ANOVA). Percentage data were arcsine transformed before analysis

of variance. When there were significant differences, Duncan’s multiple range tests were

conducted among group means. The significant level was set as P \ 0.05. All statistical

analyses were performed using the SAS 9.0.

Results

Cloning and sequence analysis of O.nLPL

Using the degenerate primers (LPL-F and LPL-R), a single PCR product of 920 bp was

obtained from the liver of GIFT. The cDNA sequence of O.nLPL then was completed

using 30 RACE and 50 RACE. The full-length O.nLPL cDNA (GenBank accession number:

GU433189) was 2,298 bp in length, contained a 126 bp 50 untranslated region (UTR), a

1,548 bp open reading frame (ORF) encoding a 515 amino acid (aa) peptide and a 624 bp

30 UTR (Fig. 1).

Table 2 Primers used in this study

Primers Sequence (50–30) Usage

Oligo(dT)16AP CTG ATC TAG AGG TAC CGG ATC C(T)16 RT

LPL-F T(C)AAG(A)TTTG(T)C(T)TC(A)AGGAC RT-PCR

LPL-R TGTATCTTTACTTGGTAATGG RT-PCR

AP CTG ATCTAGAGGTACCGGATCC RACE

LPL3-F1 GCTCCATCCACCTGTTCATCG 30RACE

LPL3-F2 CAACAAGGGAATGTGCCTCAGC 30RACE

LPL5-R1 ATGAACTCTGTCCCAGGGCAACT 50RACE

LPL5-R2 TCAGCCAGTCCACCACAATCAC 50RACE

LPL-F1 AGAGCACACTGTCCCGAGGCGAT Real-time qPCR

LPL-R1 AAGGTGCCTCCGTTGGGGTAAAT Real-time qPCR

Actin-F CCTGAGCGTAAATACTCCGTCTG Real-time qPCR

Actin-R AAGCACTTGCGGTGGACGAT Real-time qPCR

1224 Aquacult Int (2013) 21:1219–1232

123

A 23-aa signal peptide (MGKQNICFLTAWIILGKIFATFS) was identified in the

O.nLPL peptide sequence using the SignalP program. The mature protein of O.nLPL (492

aa in length) had a high identity (46.7–70.8 %) with that of other piscine species. The

highest similarity was with O. mykiss LPL, and the lowest was with D. rerio. Blastp

analysis showed that O.nLPL contained two structural regions: an N terminus (24–361

residues) and a C terminus (362–515 residues). Conserved motifs including the lipid-

binding domain, which participates in substrate specificity, were found in the N terminus of

O.nLPL. Additionally, conserved functional sites were also found, including one N-linked

glycosylation site (Asn45), one catalytic triad (Ser178, Asp202 and His290), one conserved

heparin-binding site (Arg328 to Arg331, RKNR) and eight cysteine residues (Cys73 and

Cys86, Cys262 and Cys288, Cys313 and Cys324, Cys327 and Cys332) which form four

disulfide bridges. Two conserved lipid-binding sites (Trp442 and Trp443) and two

N-linked glycosylation sites (Asn408 and Asn492) were found at the C terminus (Fig. 2).

Phylogenetic analysis

Using the NJ method, an unrooted phylogenetic tree was constructed based on the deduced

amino acids of GIFT hepatic LPL. The zebrafish HL (GenBank accession number:

Fig. 1 The full-length cDNA sequence of GIFT LPL (GenBank accession No. GU433189) and the deducedamino acid sequence. The start codon and stop codons are underlined

Aquacult Int (2013) 21:1219–1232 1225

123

1226 Aquacult Int (2013) 21:1219–1232

123

NM_201022) was used as the out-group. The O.nLPL was grouped into one clade with the

LPL from S. aurata, P. major, P. flavescens, T. orientalis and D. labrax. The bootstrap

value for this clade was 98 % (Fig. 3).

Effects of dietary lipid on O.nLPL gene expression

After the fish were reared for 90 days followed by a 24-h fast, the effects of dietary lipid

levels on hepatic LPL expression were examined using real-time PCR (Fig. 4). As dietary

lipid increased, hepatic LPL expression also increased. The expression of LPL was highest

Fig. 2 Alignment of the deduced amino acid sequences of LPL from different species. The alignment wasanalyzed using MEGA 3.1 software and decorated with GeneDoc software. The identities between thesequences were indicated with asterisks, colon and dot. The residues required that needed for LPL function(Ser178-Asp202-His290, Trp442-Trp443) were marked red. The LID motif was boxed. The conservedcysteines residues were marked as triangles above the sequence comparisons. (Color figure online)

b

Fig. 3 Phylogenetic tree based on lipoprotein lipase amino acid sequences made with MEGA 3.1 softwareusing neighbor-joining (NJ) method. The distance matrix was calculated using the Kimura’s 2-parametermodel. The numbers represent bootstrap percentages. The topology was tested using bootstrap analyses(10,000 replicates). GenBank accession numbers: Sparus aurata AAS75120; Pagrus major BAE95413;Perca flavescens ACQ99326; Thunnus orientalis BAF95184; Dicentrarchus labrax CAL69901; Oncorhyn-chus niloticus GU433189; Oncorhynchus mykiss NP_001118076; Ctenopharyngodon idellus ACN66300;Danio rerio NP_571202; Cyprinus carpio ACN66301

b

ab

a

0

0.5

1

1.5

2

2.5

3

3.7%group 7.7%group 16.6%group

LPL

mR

NA

/β-a

ctin

mR

NAFig. 4 Effects of different

dietary lipid on the expression ofhepatic O.nLPL. Note: Values aremean ± SE, n = 3. ANOVAanalysis was used to test multiplemeans. Different lowercaseletters were significant differencebetween different groups(P \ 0.05)

Aquacult Int (2013) 21:1219–1232 1227

123

in the 16.6 % lipid group, and it was significantly higher than that of the 3.7 % lipid group

(P \ 0.05). The expression of the LPL gene in the 7.7 % lipid group was also higher than

that of the 3.7 % lipid group but the difference was not significant (P [ 0.05).

Results of final body weight, weight gain (WG), lipid content of muscle, lipid content of

liver and hepatic LPL mRNA were present in Table 3. Final body weight and WG of 7.7 %

lipid level group were significantly higher than those of 3.7 % lipid and 16.6 % lipid level

groups. Muscle and liver lipid content of GIFT were enhanced with increased dietary lipid

levels. GIFT fed 16.6 % lipid level reached muscle and liver lipid levels of 4.3 and 12.7 %,

respectively, which were significantly higher than those at 3.7 % lipid and 7.7 % lipid level

groups (P \ 0.05). Liver lipid content ranged from 7.9 to 12.7 % and was higher than

muscle lipid content (from 2.3 to 4.3 %).

ab

bb

aba

a

ab

b

abab

ab

a

b

b

ab

0

0.5

1

1.5

2

2.5

0 h 6 h 12 h 24 h 48 h

Time after refeeding

LP

L m

RN

A/β

-act

in m

RN

A

3.7% group

7.7% group

16.6% group

Fig. 5 Expression levels of hepatic LPL mRNA from GIFT at time points after refeeding. Transcripts forall samples were assessed by real-time quantitative PCR. Relative levels of LPL in the three groups wereexpressed as the ratio of LPL mRNA/b-actin mRNA and normalized to the level of LPL in the controlgroup. Lowercase letters above the bars indicate significant differences (P \ 0.05) at time points from thesame group. Asterisks above the bars show significant differences (P \ 0.05) between different groups atsame time point. All data were analyzed by ANOVA multiple range test (Values are mean ± SE, n = 9)

Table 3 Effects of dietary lipid levels on the expression of hepatic LPL, final average body weight, weightgain and tissue lipid content of GIFT (mean ± SE, n = 3)

Dietarygroup (%)

LPL mRNA/b-actin mRNA

Final bodyweight(g)

Weight gain (%) Lipid content inmuscle (%)

Lipid content inliver (%)

3.7 0.5 ± 0.0b 48.4 ± 0.7ab 1,588.6 ± 103.7b 2.3 ± 0.2c 7.9 ± 0.9c

7.7 1.1 ± 0.4ab 52.0 ± 0.5a 1,860.2 ± 44.8a 3.3 ± 0.3b 9.9 ± 0.1b

16.6 2.0 ± 0.5a 46.8 ± 1.5bc 1,348.3 ± 93.7c 4.3 ± 0.3a 12.7 ± 1.3a

All 35 fish from each tank were used for calculating weight gain (WG) and final body weight (FBW). Threefish from each tank (nine fish per group) were sampled for analysis of liver and muscle content, and anotherthree fish from each tank (nine fish per diet) were sampled for analysis of hepatic LPL gene expression at24 h after last feeding for the 90-day feeding trial

Values are mean ± SE of three replicates, and values in the same column with different letters are sig-nificantly different (P \ 0.05)

1228 Aquacult Int (2013) 21:1219–1232

123

Effects of refeeding on O.nLPL gene expression

At the end of 90-day feeding trials, the fish were fasted for 48 h and then refed. Expression

of hepatic LPL was examined at 0, 6, 12, 24 and 48 h after refeeding using real-time PCR

(Fig. 5). During the 48 h post-refeeding, LPL expression in GIFT decreased and then

recovered following refeeding. The lowest levels of LPL were seen 12 h post-refeeding

and returned to normal levels at 24 h post-refeeding and maintained normal levels through

48 h. There was a similar pattern of changes in LPL expression in the 3.7, 7.7 and 16.6 %

lipid groups.

Discussion

Sequence analysis of O.nLPL

In this study, we cloned and characterized the full-length cDNA of LPL from the liver of

juvenile GIFT. The O.nLPL was 2,298 bp in length and encoded 515 amino acids (aa).

Similar to LPL from other piscine species, GIFT LPL contained a 23-aa signal peptide and

produced a mature protein 492 aa in length. These findings suggest that O.nLPL is a

secreted protein. Alignment analysis showed that O.nLPL shares high homology with

LPLs of other species, especially with other teleosts. O.nLPL shares several motifs and

functional characteristics typical of the lipase family. The polypeptide ‘‘lid’’ is located at

bps 172–181 and is highly conserved across several species (Griffon et al. 2006). Trp420

and Trp421 (human numbering) play important roles in binding lipid substrates in O.nLPL

(Keiper et al. 2001). Unlike human LPL, three potential N-glycosylation sites were found

in O.nLPL: one in the N-terminal region (Asn45) and two in the C-terminal region

(Asn408 and Asn492). This finding suggests that Asn492 may be found outside of car-

nivorous fish (Cheng et al. 2010). The O.nLPL contained eight cysteine residues which

were all located in the N-terminal region. This pattern has been described in other fish

including red sea bream and rainbow trout. This pattern may have been lost during evo-

lution or may be a necessary adaptation for functioning at higher body temperatures (Liang

et al. 2002, Lindberg and Olivecrona 2002).

Effects of dietary lipid levels on hepatic O.nLPL expression

LPL is a key enzyme in lipoprotein metabolism and may hydrolyze TGs circulating in the

form of lipoprotein particles (Zechner 1997). Dietary lipid levels promote hepatic LPL

mRNA expression in dark barbel catfish (Zheng et al. 2010) and in red sea bream (Liang

et al. 2002). However, Liang et al. (2003) found that dietary lipid levels did not signifi-

cantly affect the expression level of LPL mRNA in red sea bream. Our study further

demonstrated that high dietary lipid induces and regulates the expression of hepatic LPL.

One possible explanation for these differing results is that Liang et al. (2003) used a shorter

sampling time after feeding.

In the present study, we also examined the effect of dietary lipid levels on WG, lipid

content of muscle and lipid content of liver. Additionally, we explored the preliminary

relationship between WG, lipid content and hepatic LPL mRNA (Table 3). Our results

showed that the group fed a high lipid (16.6 % lipid) diet had reduced WG, consistent with

previous reports for juvenile GIFT (Oreochromis niloticus) (Wang et al. 2011), crucian

carp (Carassius auratus gibelio) (Wang et al. 2010b), cobia (Rachycentron canadum)

Aquacult Int (2013) 21:1219–1232 1229

123

(Wang et al. 2005) and Atlantic cod (Gadus morhua) (Hansen et al. 2008). Reduced feed

intake could account for the decrease in WG (Tocher 2003; Xu et al. 2011). We also found

increased muscle and liver lipid content in GIFT fed the 16.7 % lipid diet relative to the

groups fed lower lipid diets. This finding is consistent with several other reports which

indicated that excessive dietary lipid increased body fat content (Catacutan and Coloso

1995; Luo et al. 2005; Han et al. 2011b). Increased expression of hepatic LPL in GIFT fed

a high lipid diet could provide more available fatty acids via metabolism of dietary lipids

leading to increased lipid deposition in the liver and muscle. Conversely, there was no

direct correlation between hepatic O.nLPL mRNA and WG of GIFT. The relationship

between hepatic O.nLPL mRNA and WG, muscle and liver lipid content under controlled

dietary lipid levels will be examined in-depth in future studies.

Effects of refeeding on hepatic O.nLPL expression

In this study, the effects of refeeding on hepatic O.nLPL mRNA levels were analyzed at 0,

6, 12, 24 and 48 h after refeeding using real-time PCR (Fig. 5). Our results demonstrated

that the expression of hepatic LPL decreased 12 h after refeeding and expression returned

to the 0-h value at 24 and 48 h after refeeding. These results indicate that the expression of

hepatic LPL is regulated by fasting or refeeding. Our results were consistent with those of

Ji et al. (2009) and partially consistent with those of Liang et al. (2002) and Oku et al.

(2006). A possible reason for the variation was a difference between fasting time and

refeeding; different fish species were used. Also, these studies were performed in different

seasons. Understanding the exact molecular regulatory mechanisms involved will require

further study.

Conclusions

In summary, this work is the first cloning and characterization of LPL from GIFT (Gen-

Bank accession NO, GU433189). The LPL cloned from GIFT contained conserved lipase

motifs, functional sites and was highly conserved with other piscine LPLs. High levels of

dietary lipid induced expression of hepatic LPL. Additionally, the expression of hepatic

LPL was regulated by fasting or refeeding. These results will be useful for furthering our

understanding the regulation of lipid metabolism in fish.

Acknowledgments This work was funded by an open project from the Key Laboratory of GeneticBreeding and Aquaculture Biology of Freshwater Fisher, Ministry of Agriculture, the People’s Republic ofChina (No. BZ2007-06), the Natural Science Foundation of the Jiangsu Higher Education Institutions ofChina (No. 08KJD240003), and ‘‘Three Projects’’ on aquaculture of Jiangsu Province (No. PJ2010-59).

References

Albalat A, Sanchez-Gurmaches GJ, Gutierrez J, Navarro I (2006) Regulation of lipoprotein lipase activity inrainbow trout (Oncorhynchus mykiss) tissues. Gen Comp Endocrinol 146:226–235

AOAC (Association of Official Analytical Chemists) (1984) In: Williams S (ed) Official methods ofanalysis, 14th edn. AOAC, Washington, DC, pp 152–169

Arnault F, Etienne J, Noe L, Raisonnier A, Brault D, Harney JW, Berry MJ, Tse C, Fromental-Ramain C,Hamelin J, Galibert F (1996) Human lipoprotein lipase last exon is not translated, in contrast to lowervertebrates. J Mol Evol 43:109–115

1230 Aquacult Int (2013) 21:1219–1232

123

Bendtsen JD, Nielsen H, Heijine GV, Brunak S (2004) Improved prediction of signal peptides: SignalP 3.0.J Mol Biol 340:783–795

Black D, Skinner ER (1987) Changes in plasma lipoproteins and tissue lipoprotein lipase and salt-resistantlipase activities during spawning in the rainbow trout (salmo gairdneri R.). Comp Biochem Physiol B88:261–267

Catacutan MR, Coloso RM (1995) Effect of dietary protein to energy ratios on growth, survival, and bodycomposition of juvenile Asian seabass, Lates calcarifer. Aquaculture 131:125–133

Cheng HL, Sun SP, Peng YX, Shi XY, Shen X, Meng XP, Dong ZG (2010) cDNA sequence and tissuesexpression analysis of lipoprotein lipase from common carp (Cyprinus carpio Var. Jian). Mol Biol Rep37:2665–2673

Dey MM, Paraguas FJ, Bimbao GB, Regaspi PB (2000) Socioeconomics of tilapia culture in Asia: anintroduction. Aquac Econ Manag 4:1–2

Griffon N, Budreck EC, Long CJ, Broedl UJ, Marchadier DHL, Glick JM, Rader DJ (2006) Substratespecificity of lipoprotein lipase and endothelial lipase: studies of lid chimeras. J Lipid Res47:1803–1811

Han CY, Wen XB, Zheng QM, Li HB (2011a) Effect of starvation on activities and mRNA expression oflipoprotein lipase and hormone-sensitive lipase in tilapia (Oreochromis niloticus 9 O.aureus). FishPhysiol Biochem 37:113–122

Han GM, Wang Am, Xu P, Lv F, Feng GN, Yu YB, Yang WP (2011b) Effects of dietary lipid levels on fatdeposition and fatty acid profiles of GIFT, Oreochromis niloticus. J Fish Sci China 18:338–349 (InChinese with English abstract)

Hansen JØ, Berge GM, Hiliestad M, Krogdahl A, Galloway TF, Holm H, Holm J, Ruyter B (2008) Apparentdigestion and apparent retention of lipid and fatty acids in Atlantic cod (Gadus morhua) fed increasingdietary lipid levels. Aquaculture 284:159–166

Hide WA, Chan L, Li WH (1992) Structure and evolution of the lipase superfamily. J Lipid Res 33:167–178Hsieh SL, Hu CY, Hsu YT, Hsieh TJ (2007) Influence of dietary lipids on the fatty acid composition and

stearoyl-CoA desaturase expression in hybrid tilapia (Oreochromis niloticus 9 O.aureus) under coldshock. Comp Biochem Physiol B: Biochem Mol Biol 147:438–444

Ji H, Su SS, Liu Q, Cao YZ, Yang GS, Lin YQ, Oku H (2009) Study on the LPL gene expression and theinfluence of fasting and refeeding on it in grass carp, Ctenopharyngodon idellus. J Fish China33:980–986 (In Chinese with English abstract)

Jose Ibanez A, Peinado-Onsurbe J, Sanchez E, Cerda-Reverter JM, Prat F (2008) Lipoprotein lipase (LPL) ishighly expressed and active in the ovary of European sea bass (Dicentrarchus labrax L.), duringgonadal development. Comp Biochem Physiol A: Mol Integr Physiol 150:347–354

Keiper T, Schneider JG, Dugi KA (2001) Novel site in lipoprotein lipase (LPL 415–438) essential forsubstrate interaction and dimer stability. J Lipid Res 42:1180–1186

Kumar S, Nei M, Dudley J, Tamura K (2008) MEGA: a biologist-centric software for evolutionary analysisof DNA and protein sequences. Brief Bioinform 9:299–306

Kwon JY, Prat F, Randall C, Tyler CR (2001) Molecular characterization of putative yolk processingenzymes and their expression during oogenesis and embryogenesis in rainbow trout (Oncorhynchusmykiss). Biol Reprod 65:1701–1709

Liang XF, Oku H, Ogata HY (2002) The effects of feeding condition and dietary lipid level on lipoproteinlipase gene expression in liver and visceral adipose tissue of red sea bream Pagrus major. CompBiochem Physiol A: Mol Integr Physiol 131:335–342

Liang XF, Bai JJ, Lao HH, Li GS, Zhou TH, Ogata HY (2003) Nutritional regulation of lipoprotein lipasegene expression and visceral fat deposition in red sea bream (Pagrus major). Oceanologia et Limn-ologia Sinica 34:625–631 (In Chinese with English abstract)

Lindberg A, Olivecrona G (2002) Lipoprotein lipase from rainbow trout differs in several respects from theenzyme in mammals. Gene 292:213–223

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCRand the 2-DDC T method. Methods 25:402–408

Luo Z, Liu YJ, Mai KS, Tian LX, Liu DH, Tan XY, Lin HZ (2005) Effect of dietary lipid level on growthperformance, feed utilization and body composition of grouper Epinephelus coioides juveniles fedisonitrogenous diets in floating netcages. Aquacult Int 13:257–269

Oku H, Koizumi N, Okumura T, Kobayashi T, Umino T (2006) Molecular characterization of lipoproteinlipase, hepatic lipase and pancreatic lipase genes: effects of fasting and refeeding on their geneexpression in red sea bream Pagrus major. Comp Biochem Physiol B: Biochem Mol Biol 145:168–178

Raisonnier A, Etienne J, Arnault F, Brault D, Noe L, Chuat JC, Galibert F (1995) Comparison of the cDNAand amino acid sequences of lipoprotein lipase in eight species. Comp Biochem Physiol B: BiochemMol Biol 111:385–398

Aquacult Int (2013) 21:1219–1232 1231

123

Saera-Vila A, Calduch-Giner JA, Gomez-Requeni P, Medale F, Kaushik S, Perez-Sanchez J (2005)Molecular characterization of Gilthead Sea bream (Sparus aurata) lipoprotein lipase. Transcriptionalregulation by season and nutritional condition in skeletal muscle and fat storage tissues. Comp Bio-chem Physiol B: Biochem Mol Biol 142:224–232

Sigrist CJA, Cerutti L, Castro ED, Langendijk-Genevaux PS, Bulliard V, Bairoch A, Hulo N (2010)PROSITE, a protein domain database for functional characterization and annotation. Nucleic AcidsRes 38:161–166

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The CLUSTAL_X windowsinterface: flexible strategies for multiple sequence alignment aided by quality analysis tools. NucleicAcids Res 25:4876–4882

Tocher DR (2003) Metabolism and functions of lipids and fatty acids in teleost fish. Rev Fish Sci11:107–184

Wang JT, Liu YJ, Ren ZL, Gao P, Yu Y, Pear G (2005) Effect of dietary lipid level on growth performance,lipid deposition, hepatic lipogenesis in juvenile cobia (Rachycentron canadum). Aquaculture249:439–447

Wang AM, Han GM, Wei XJ, Liu B, Lv F, Feng GN, Qi ZT, Wang T, Xu P, Yang ZG (2010a) Molecularcloning of fatty acid synthase from GIFT tilapia (Oreochromis niloticus): response of its expression torefeeding and different lipid level in diet. J Fish China 34:1113–1120 (In Chinese with Englishabstract)

Wang AM, Lv F, Yang WP, Yu YB, Han GM (2010b) Effects of dietary lipid levels on growth performance,body fat deposition, muscle composition and activities of digestive enzymes of gibel carp (Carassiusauratus gibelio). Chin J Anim Nutr 22:625–633 (In Chinese with English abstract)

Wang AM, Han GM, Feng GN, Yang WP, Guo JH, Wang T, Xu P (2011) Effects of dietary lipid levels ongrowth performance, nutrient digestibility and blood biochemical indices of GIFT tilapia (Oreochromisniloticus). Acta Hydrobiol Sin 35:80–87 (In Chinese with English abstract)

Wion KL, Kirchgessner TG, Lusis AJ, Schotz MC, Lawn RM (1987) Human lipoprotein lipase comple-mentary DNA sequence. Science 235:1638–1641

Xu JH, Qin J, Yan BL, Zhu M, Luo G (2011) Effects of dietary lipid levels on growth performance, feedutilization and fatty acid composition of juvenile Japanese seabass (Lateolabrax japonicus) reared insea water. Aquacult Int 19:79–89

Zechner R (1997) The tissue-specific expression of lipoprotein lipase: implications for energy and lipo-protein metabolism. Curr Opin Lipidol 8:77–88

Zheng KK, Zhu XM, Han D, Yang YX, Lei W, Xie SQ (2010) Effects of dietary lipid levels on growth,survival and lipid metabolism during early ontogeny of Pelteobagrus vachelli larvae. Aquaculture299:121–127

1232 Aquacult Int (2013) 21:1219–1232

123