Proc. Nati. Acad. Sci. USAVol. 86, pp. 9451-9455, December 1989Genetics

Chromosome-breaking structure in maize involving a fracturedAc element

(transposable elements/Ac-Ds/corn/bronze locus)

EDWARD RALSTON, JAMES ENGLISH, AND HUGO K. DOONERDNA Plant Technology, 6701 San Pablo Avenue, Oakland, CA 94608

Communicated by Barbara McClintock, September 11, 1989 (received for review March 28, 1989)

ABSTRACT Chromosome breakage in maize can resultfrom an interaction between certain transposable elements.When an Ac (Activator) element and a state I Ds (Dissociation)element are present together in the genome, either linked orunlinked, breaks occur regularly at the locus of the Ds element.We show here that breaks occur with high frequency at or nearthe locus of a structure consisting of a 2.5-kilobase (kb)terminally deleted or fractured Ac element very tightly linkedto a second, intact 4.6-kb Ac element. This structure has thefeatures of a macrotransposon and may behave like one. Lossof the tight linkage abolishes chromosome breakage. A modelbased on transposition of the macrotransposon is proposed toexplain the chromosome-breaking properties of Ac and Ds.

Chromosome breakage was the first manifestation of trans-posable element activity detected by McClintock. She for-mulated the concept of transposition based on her observa-tions that the position of breaks in the short arm of chromo-some 9 (chromosome 9S) could change in some of her stocks.In 1946, she reported the existence of a locus proximal to wx(waxy endosperm) at which breaks tended to occur (1). Shecalled the locus Ds (Dissociation) and established that breakswould occur at the locus only when a second factor, whichshe termed Ac (Activator), was present in the genome (2).Subsequently, she demonstrated that Ds did not occupy afixed locus but could transpose to locations in chromosome9S distal to wx and other genes specifying endosperm traits[colorless kernel (c), shrunken endosperm (sh), and bronze(bz)]. The altered position of chromatid breaks was readilyrecognized by the changes in kernel phenotypes that wereproduced when breaks initiated at different positions inchromosome 9S and was confirmed by cytological and ge-netic tests (3).The ability to break chromosomes is not, however, a

general feature of Ds transposable elements. McClintockdistinguished between state I Ds elements that producedmany detectable breaks and few reversions when inserted ina known gene and state II Ds elements that produced higherrates of reversion and lower-to-undetectable rates of chro-mosome breaks (4). These states differ in relative stability:whereas state II is very stable, state I is unstable and changesfrequently to state II.Two insertions in different sh mutants borne on chromo-

somes harboring state I Ds elements in the vicinity of the shlocus (5) have been characterized molecularly. The unstablesh mutants sh-m:5933 and sh-m:6233 carry unusual insertionsthat, though of dissimilar sizes [>30 kilobases (kb) vs. 4 kb],share a structure that has been termed "double Ds" (6, 7).This structure consists of two identical copies of a 2-kbinternal deletion derivative of the 4.6-kb autonomous Acelement, arranged so that one copy is inserted, in reverse

orientation, into the second copy. Double Ds has beenpostulated to be involved in chromosome breakage based onthe correlation between its presence in the above mutants andthe occurrence of chromosome breaks around the sh locus(8). None of the state II Ds elements so far characterized areof the double Ds type (9-15).

In this paper we present evidence that a different type ofstructure, also derived from the transposable element Ac,causes chromosome breaks. This structure was uncoveredduring the analysis of stable bronze derivatives from themutable allele bz-m2(Ac). As a consequence of Ac excision,bz-m2(Ac) can mutate from a coarsely spotted to a stablebronze phenotype in a few percent of the progeny (16). Wehave mapped the location ofthe transposed Ac (trAc) elementin a number of such derivatives and have shown that in thederivative bz-s:2094, Ac has transposed to a location 0.05centimorgans (cM) proximal to bz (17). We report here thatchromosome breaks occur with a high frequency in stockscarrying the bz-s:2094 allele and the closely linked trAc,which we designated Ac2O94, and show that the breaks aredue to the cis arrangement ofAc2O94 and a 2.5-kb terminallydeleted or fractured Ac element (fAc) remaining at the bzlocus. We also propose a model that explains the chromo-some-breaking properties of this type of structure.

MATERIALS AND METHODSDescription of Alleles. All of the stocks used in the present

study were in the genetic background of the inbred W22. Thekernel color specified by the respective alleles is indicated inparentheses.Bz-McC (purple) is the normal progenitor allele of the

transposable element mutations utilized in this study.bz-m2(Ac) (purple spots on a bronze background) is an

allele that arose by insertion of the 4.6-kb Ac element in thesecond exon of Bz-McC (18, 19).bz-m2(DI) (bronze in the absence of Ac; spotted in its

presence) is a derivative from bz-m2(Ac) that carries a 3.3-kbDs element as a consequence of an internal deletion in Ac (13,20).

bz-R (bronze) is the stable, reference allele of the bz locusthat has a 340-base-pair (bp) deletion in the transcribed region(21, 22).Markers. The mutations c, sh, and wx were used as

markers flanking the bz locus. They map, respectively, 6 and3 cM distal and 25 cM proximal to bz in chromosome 9S.

Molecular Analysis. Restriction enzyme digestions, DNAisolation and genomic blotting were carried out as described(23). The bz-s:2094 allele was isolated from an EMBL3 phagelibrary constructed with DNA that had been digested withBamHI and size-fractionated to enrich for fragments in the15- to 20-kb range. The library, consisting of about 400,000

Abbreviations: cM, centimorgan; Ac, Activator element; Ds, Dis-sociation element; fAc, fractured Ac; trAc, transposed Ac; chromo-some 9S, short arm of chromosome 9.

9451

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Aug

ust 1

4, 2

021

Proc. Natl. Acad. Sci. USA 86 (1989)

plaques, was screened with a bz-specific probe, and a 19-kbclone was isolated. To sequence thejunctions ofthe fracturedAc element with the bronze locus, a 2.1-kb EcoRI-Sst IIfragment from the bz 3' side and a 0.8-kb EcoRI-Sma Ifragment from the bz 5' side were subcloned into M13 phage(24) and sequenced by the dideoxy method (25). An 18-kb BglII fragment spanning the bz-s:3130 deletion was similarlyisolated.

RESULTSMolecular Characterization of bz-s:2094. Many stable

bronze (bz-s) derivatives from bz-m2(Ac) have been isolated(17). Southern blot analysis of these derivatives has revealedthat in almost all, Ac had been excised from the bz locus,leaving an "empty" site, but in the bz-s:2094 derivative, partofAc had been left behind at the original site of insertion (26).Fig. 1 shows a restriction map of the bz-m2(Ac) progenitorallele and of the bz-s:2094 derivative. In bz-s:2094, a deletionof about 2 kb from the right end of Ac had occurred. Thus,in addition to the trAc2O94 element 0.05 cM proximal to bz(17), the bz-s:2094 mutation carries an apparently terminallydeleted Ac element at the bz locus, which we have designatedfractured Ac (fAc).A genomic clone that hybridized to both bz and Ac probes

was isolated from an EMBL3 library of bz-s:2094. Restrictionsite mapping of the phage DNA confirmed that the Ac-hybridizing sequence within bz was missing almost 2 kb fromone end of Ac. The left and right bz-fAc junctions were thensequenced and compared with the junction sequences inbz-m2(Ac) (Fig. 2). The leftjunctions are identical, suggestingthat Ac may not have moved. However, the right junction ismore complex. A comparison of the sequences in Fig. 2 fromright to left reveals a typical empty site, consisting of animperfect 7+8-bp direct repeat at the previous Ac insertionsite. Immediately to the left of the empty site, one finds 37 bpof bz sequence also duplicated at the left bz-Ac junction, andfurther to the left one finds thefAc sequence, which is missing1893 bp from the right (BamHI) end ofAc. Since an active Acwas known to be present only 0.05 cM proximal to the bzlocus, we examined the genomic clone for the presence ofanother Ac-hybridizing sequence but found none in the 9 kbproximal to bz.Chromosome Breakage in the bz-s:2094 Derivative. The

rearrangement flanked by transposable-element ends in thebz-s:2094 derivative is reminiscent of the complex insertionin the mutant sh-m:5933, which has been postulated to breakchromosomes. In this insertion, at least 30 kb of DNAseparate a 4-kb double Ds at one end from a 3-kb, partiallydeleted, double Ds at the other end.We tested the ability of thefAc Ac2094 structure to break

chromosomes by monitoring the loss of the dominant mark-ers C and Sh, located distal to this structure, in crosses ofbz-s:2094 Ac2094 to a c sh tester. We found that practically

Eo_

bcoz-2Abz-m2(Ac) Sh_ ii i3i

551 528

2 - 0

CL IL U)

all ofthe kernels from this cross had colorless sectors and thatsome ofthe larger colorless sectors were also deeply indented(26)-the result expected if breaks occurred at or around thebz locus during the development of the endosperm. Since achromosome with a broken end will give rise to a chromatidbreakage/fusion/bridge cycle in the endosperm, even mark-ers located proximal to the initial break will be lost insubsequent cell divisions as a consequence of nonmedianbreaks in the recurring anaphase bridges (27). If the initialbreak occurs in the vicinity of bz, the proximal marker Wxshould be lost in some cell lineages. To test this genetically,the Ds reporter stock bz-m2(DI) wx was pollinated withbz-s:2094 Ac2094 Wx. Most kernels from this cross arespotted. Among them, some have large unspotted sectors,which result from losses of Ac early in endosperm develop-ment. If the loss of Ac were a consequence of chromosomebreaks, one should see Wx-wx variegation in the endospermunderlying the large unspotted sector. In fact, such variega-tion was seen and is illustrated in Fig. 3. This result implicatesthe newly arisen fAc Ac2094 structure in inducing chromo-some breaks.To test whether fAc alone could break chromosomes,

germinal derivatives that retained fAc but had lost Ac2094were also isolated from the above cross as uniformly bronze,nonwaxy exceptions. These were progeny-tested for loss ofAc activity and analyzed by Southern blots. All 11 exceptionsanalyzed lacked both Ac activity and the 2.6-kb Pvu II bandcharacteristic of an active Ac (28, 29) but retained the fAcelement at bz (not shown), indicating that they must havearisen by excision ofAc2094. None of them produced break-age patterns when crossed into a c sh Bz tester line. Neitherdid the progenitor allele bz-m2(Ac), confirming that Ac byitself does not break chromosomes. These results suggestthat breaks are not due to eitherfAc or Ac alone, but to aninteraction betweenfAc and Ac2094.To examine whether the interaction could occur in trans as

well as in cis, an independently segregating Ac element wasintroduced into three of the above Ac-minus, bz-s:2094derivatives. When crossed to the c sh Bz tester stock, theselines were found to be as ineffective in causing chromosomebreaks as their counterparts without Ac. Therefore, the closecoupling arrangement offfAc and a functional Ac seems to berequired for breakage.A Possible Macrotransposon Extending fromfAc to Ac2094.

One Ac-minus exception isolated from bz-s:2094 Ac2094turned out to be unusual, bz-s:3130. Southern blot analysisindicates thatfAc and the entire bz region proximal tofAc aredeleted in bz-s:3130 (26). The origin of this deletion might beexplained as an Ac-induced excision of a macrotransposonextending from the left end offfAc to the right end ofAc2094.This would be similar to the excision of the complex, >30-kbinsertion in sh-m:5933 (6). The bz-s:3130 deletion showsreduced pollen transmission (26) but is homozygous viable,

649 657

_ _X= _ uj - _

IL I UJ x C

528 526IN If so

zm ---Y'm

3 ' -5'

c 0 CNC w

la..it Ia I I I i i11 I KDI I I | | |

rA20941iii

Wx

. 1 kb

FIG. 1. Restriction maps of the bz-m2(Ac) and bz-s:2094(fAc) alleles. The Ac andfAc elements are shaded, the direction and extent of thebz transcript are indicated by the arrow below the map, and the bz (551, 528, and 526) and Ac subclones (649 and 657) used routinely as probesin Southern analysis are indicated above the map.

bz-s:2094(fAc)

9452 Genetics: Ralston et al.

WV

Sh .. I 12 ...

Dow

nloa

ded

by g

uest

on

Aug

ust 1

4, 2

021

Proc. Natl. Acad. Sci. USA 86 (1989) 9453

A bz-m2(Ac)

GGGAAGT- CTGCCCATGGGATGAGGTCGTAA GAT CC CTTT =GTAGT

AC

TAGGGATGAAAACGGTCGGTAA ....GCAGTGACACGGGACTTTAT ....CCATCCTACTTTCATCCCTG

B bz-s2094(fAc)

GGGAACG

fAcTAGGGATGAAAACGGTCGGTAA .... GCAGTGACAC (A1893 bp)

TGCCCCATGCGGTGGACGAGGAGGT

FIG. 2. Sequence of the bz/Acjunctions in bz-m2(Ac) and bz-s:2094(fAc). The 8-bp Ac targetsite duplicated in bz-m2(Ac) andpartly triplicated in bz-s:2094(fAc)is underlined, and the 38-bp regiondistal to Ac in bz-m2(Ac) and du-plicated on either side of the fAcinsertion in bz-s:2094(fAc) isshaded. Ac sequences are shown

'TGATGACGTAGT only for the junctions.

indicating that no genes essential for plant viability arelocated in the deleted fragment.

If the bz-s:3130 deletion is the result of the excision of amacrotransposon, its new DNAjunction should consist ofthedistal side of the bz-m2(Ac) insertion site juxtaposed to theproximal side of the Ac2094 insertion site (hereafter desig-nated as the tac2094 site). To verify this, the bz-s:3130

A

\^.

C l"*,q 9q

4

deletion allele was cloned and characterized. Fig. 4a showsa restriction map of the clone in the region adjacent to bz. Todetermine whether the excision of the putative macrotrans-poson was precise on the bz side, the 300-bp Sst I-Sma Ifragment spanning the deletion was subcloned and sequenced(Fig. Sa). The sequence of this subclone corresponds exactlyto the bz sequence up to the site of insertion offAc (Fig. 2).Of the eight bases flanking fAc, only five are retained(underlined in Fig. 5a), while the final three bases arereplaced with their reverse complement (lower case letters inFig. Sa). Thus, the sequence of a typical empty site, indicat-ing an Ac-like excision, is found on the bronze or distal sideof the new DNA junction in the bz-s:3130 deletion. Thesequence on the other side of the junction is unrelated toeither Ac or bz.To determine whether the sequence adjacent to bz in the

bz-s:3130 deletion allele corresponds to the tac2094 site, anXho I-EcoRI subclone from this region (Fig. 4a) was used toscreen an EMBL3 genomic library of bz-s:2094 Ac2094. A Aphage clone isolated in this screen was found to contain theexpected Ac/tac2094 junction upon restriction analysis (Fig.4b). A comparison of its sequence with that of the deletionjunction (Fig. Sa) shows that the latter corresponds to thepredicted bz/tac2094 junction and that three bases on the tacside of the junction are missing in bz-s:3130. We concludethat the deletion in bz-s:3130 extends exactly from the distalbz/fAc junction to the proximal Ac/tac2094 junction in thebz-s:2094 Ac chromosome. From the restriction map in Fig.4b and the sequence of the Ac terminus in Fig. Sb, one candetermine that Ac2094 is in direct orientation relative tofAc.

a bz-s:3130m x MUcM. CM. cO

11sne x iLI2I; 83

bz I tac 2094

asFIG. 3. Kernels from the cross bz-m2(DI) wx x bz-s:2094 Ac2094

Wx illustrating chromosome breakage. Variegation for the proximalmarker waxy can be seen in sectors where Ac has been lost bybreakage early in endosperm development. (A) Kernel showing alarge sector without purple spots in the aleurone as a consequence ofloss of Ac activity. Within this sector, smaller waxy sectors arevisible. (B) Same kernel cut and stained with an iodine/potassiumiodide solution to demonstrate light-staining starch in waxy sectors.(C) Close-up of Wx-wx variegated area in the same kernel showingindividual Wx and wx cells in the sector.

a:8Lu

_cc28x w

b bz-s:2094(fAc) AcAc

I _o_m toE,.x a 8

Lll

tac2094

1 kb

FIG. 4. (a) Restriction map of the bz-s:3130 deletion alleleshowing the bz/tac2094 junction. (b) Restriction map of the progen-itor allele bz-s:2094(fAc) Ac2094 showing the Ac/tac2094 junction.

le --i

Genetics: Ralston et al.

I:..hiol, la V&

Dow

nloa

ded

by g

uest

on

Aug

ust 1

4, 2

021

Proc. Natl. Acad. Sci. USA 86 (1989)

bz tac2094

a GCGCGGGAGGCACTGCCtgg/... AACCCCGCCCAGAGCGACCCACGCACCACGCCA

Ac taC2094

b CCATCCTACTTTCATCCCTG/CCCAACCCCGCCCAGAGCGACCCACGCACCACGCCA

FIG. 5. Sequence of the bz/tac2094 junction from the bz-s:3130deletion allele (a) and the Ac/tac2094 junction from the bz-s:2094(fAc) Ac2094 progenitor allele (b).

Southern blot analysis was used to demonstrate that Ac2094corresponds to the active Ac in the bz-s:2094 stock. A 1.6-kbXho I-EcoRI tac2094-specific fragment (Fig. 4a) was used toprobe BstEII-digested DNA from the original bz-s:2094Ac2094 stock and from bz-s:2094 derivatives lacking Ac. Astrong 17.5-kb band and a weak 13-kb (somatic excision) bandwere found in the former, while only the 13-kb (germinalexcision) band was found in the latter (data not shown). Sincethese bands differ in size precisely by the size ofAc, and sincein every instance the Southern phenotype agrees with the Acgenotype, we conclude that there is only one trAc in thegenome and that it resides at the tac2094 locus.

DISCUSSIONWe have provided genetic and molecular evidence that astructure composed of a terminally deleted fAc elementclosely linked to a functional Ac element can cause chromo-some breaks. This structure is found in the stable bronzemutant bz-s:2094, which arose from the mutable allele bz-m2(Ac) as a consequence ofa complex Ac transposition event.A scan of the bz nucleotide sequence of this mutant startingfrom the 5' end reveals thatfAc is flanked by a 45-bp repeatof a sequence found immediately downstream of Ac in bz-m2(Ac). In addition to the rearrangement at bz, there is afunctional Ac element 0.05 cM proximal to bz, Ac2094. It ishard to envision how this complex structure originated, but thepresence of an empty site and of a trAc element suggests thatthe structure arose from an unusual Ac transposition event.We have shown that chromosome breaks result from the

cis arrangement ofafAc element at bz and a trAc located 0.05cM proximal to bz, but not from eitherfAc or Ac alone. Webelieve that there are two relevant features in this structure:the relative orientation of the elements and the distanceseparating them. We have established that fAc and Ac2094are in direct orientation relative to each other. The derivativebz-s:3130 is a deletion that spans the distance between fAcand Ac2094. It most likely arose by excision of a macrotrans-poson extending from the distal end offAc to the proximalend of Ac2094. We have isolated probes from the Ac2094insertion site in bz-s:3130 (the tac2094 site) and from theupstream end of the bz-s:2094 clone and have used them ingenomic Southern blots in an attempt to identify bands thathybridize to both probes, but we have not detected any bandsin common (unpublished observations). Our data, so far,indicate that the distance separatingfAc and Ac2094 is at least25 kb.The genetic and molecular analysis of the chromosome-

breaking phenomenon in the bz-s:2094 Ac derivative leads usto the conclusion that the direct duplication of two closelylinked but nonadjacent transposable elements is a destabilizingstructure that causes chromosome breaks. Our data withbz-s:2094 Ac and other observations to be discussed belowprompt us to hypothesize that a minimum distance, possiblymore than 25 kb, must separate the transposable elements ina chromosome-breaking duplication. A model that explainsthe chromosome-breaking properties of such a rearrangementis diagrammed in Fig. 6. A key feature of the model is thetransposition of a partially replicated macrotransposon con-taining the two nonadjacent elements and the region between

them. In the figure, the replicated ends ofthe macrotransposon(B/b and C/c) are shown in different replicons, but similaroutcomes are possible if only one end of the macrotransposonhas replicated when transposition occurs.

Fig. 6 considers the outcomes of the transposition of thepartially replicated macrotransposon B-c to the replicatedsite ef. If B-c inserts in its original (direct) orientation (Fig.6bJ), it generates the empty site Ad and two new transposonjunctions, eB and cf. The two products of such an intra-chromosomal transposition event are: a chromatid with thetransposed macrotransposon flanked by a duplication of thesegment between the donor and receptor sites (Ade:-BC::DEF) and a chromatid with a deletion of the samefragment adjacent to the transposon (a::bc: :f). If, on the

FIG. 6. A model for chromosome breakage due to transpositionof a partially replicated macrotransposon spanning adjacent repli-cons. The replicating chromosome is represented as sister chroma-tids being held together at the macrotransposon, which has not yetcompleted replication. The centromeres are the open circles on theleft. The macrotransposon B-c excises and reinserts at replicated siteef. The directly repeated transposable elements at the ends of themacrotransposon are indicated in dark shading, and their short,inversely repeated termini are marked as solid lines. Phosphategroups at the 5' end of each cut are marked as dots to denote strandpolarity. (a) Positions of the cuts at sites AB, cd, and ef in the twosister chromatids. (bi) Consequences of reinsertion of the macro-transposon in direct orientation relative to the progenitor chromo-some: an adjacent duplication of the d-e interval between the donorand recipient sites in one chromatid and an adjacent deletion of thesame interval in the other chromatid. These monocentric chromatidswill behave normally at cell division. (b2) Consequences of reinser-tion of the macrotransposon in inverted orientation relative toprogenitor chromosome: a dicentric and an acentric chromatid. Thedicentric chromatid will form an anaphase bridge that will break andinitiate a chromatid breakage/fusion/bridge cycle, and the acentricwill fail to migrate to either pole at cell division and, therefore, willbe lost.

Ua Partially replicated macrotransposonA B CD EF

transpoase cutat B and c ends of

A B macrotransposon CD EFA and at e f targetQIZZ~~~~ 'insertionsite

,d~~~~a eft.. ... ..

® 1 Macrotransposon inserts in direct orientation atefA d e B CD EF

of replication

Ad e B * forks CD EF

O_:: ~~~~~~~~~~~~~................

a b cf

2 Macrotransposon inserts in inverted orientation ate f

A d e c baD E

Resolution

of replicationAd forksAd e c ba

FE DC Bf

_ eouto

9454 Genetics: Ralston et al.

Dow

nloa

ded

by g

uest

on

Aug

ust 1

4, 2

021

Proc. Natl. Acad. Sci. USA 86 (1989) 9455

other hand, B-c inserts in reverse orientation (Fig. 6b2), itgenerates the same Ad empty site and the two new junctionsec and Bf. The two products of this inverted intrachromo-somal transposition event are: a dicentric (Ade: :cb: :a) and anacentric (FED: :CB: :f) chromatid. At the following anaphase,the dicentric will break, initiating a chromatid breakage/fusion/bridge cycle. Markers distal to the insertion site areduplicated in the acentric chromatid and will be lost fromboth daughter cells at the first cell division following trans-position. Markers proximal to the insertion site will be lost atsubsequent cell divisions as a consequence of nonmedianbreaks in the dicentric bridges formed at the respectiveanaphases. The idea that dicentric and acentric chromatidscould arise as a consequence of the chromosome duplicationprocess was suggested by McClintock in 1956 (30). Shehypothesized that "some component of [the chromosome-breaking] Ds may be so ordered that it will allow a reversebonding between linearly arranged components during thereduplication process; this, in turn, would lead to dicentric-acentric chromatid formations." Our model is a refinement ofthis idea. Other aberrations of the normal chromosomereplication process caused by the transposition of a partiallyreplicated transposon not shown in Fig. 6 lead to the estab-lishment of rolling circles and to partial trisomy.We postulate a minimum distance between the ends of the

macrotransposon in our model because of the following con-siderations. If a single Ac element transposed in a partiallyreplicated state, both adjacent deletions and breaks wouldoccur at the site ofinsertion ofAc, yet they rarely do (26). Thisis in agreement with the expectation that a single Ac will existin a state of partial replication only briefly during the chro-mosome replication cycle. Given a rate of replication ofDNAin plants of 0.4 kb/min, we can calculate that it will take about12 min for the 4.6-kb Ac element to complete replication, asmall fraction of the several hours that it takes an activelydividing plant cell to complete the replication process (31-33).We hypothesize that the distance separating the directlyrepeated elements of a chromosome-breaking macrotranspo-son must be short enough so that the ends of the nonadjacentelements serve frequently as cosubstrates for transposition,but long enough so that the time of replication of the entiremacrotransposon is a significant proportion of the replicon'sdoubling time. In the fAc Ac macrotransposon, the distancebetween the ends of the border elements is >25 kb, which isat least half of the size of the average monocot replicon (33).

In examining the evidence correlating chromosome breakswith the presence of the particular Ds elements associatedwith the sh locus in the mutants sh-m:6233 and sh-m:5933,one is struck by McClintock's observations that reversions ofthe mutants were never accompanied by the disappearance ofchromosome breaks (34). Since Ac transposes to unlinkedsites about half of the time (17, 35), one would expect that Dselements should also transpose to unlinked sites at least someof the time and, therefore, should be lost from the genome bymeiotic segregation. However, since chromosome breaksoccur in all of the reversions of the above mutants that havebeen isolated to date (5-7, 34), there is no compelling reasonto assign chromosome-breaking properties to the Ds ele-ments found at the sh locus in these mutants. AnotherDs-homologous sequence is, in fact, known to be present inthe same chromosome as the mutant sh-m:5933 (6). Interest-ingly, in derivatives of sh-m:5933, which display a differentpattern (but not loss) of breaks, it is this second sequence thatis altered (6, 8).Our model can also explain the instability of state I Ds

elements. A state I Ds would be a composite of two closelylinked Ds elements in direct orientation. A change from stateI to state II (high breaks/low reversion to low breaks/highreversion) would result from the excision of the Ds member ofthe composite that is not inserted at the locus being monitored

for reversion. The new structure would be more stable, as hasbeen observed with state IIDs elements. The higher frequencyofbreaks relative to reversions observed with state I would beexplained if the transposase often tries to mobilize the entirestate I Ds rather than the single elements of the composite. Acorollary of the proposed model is that two closely linked Dsor Ac elements that behave as separate state II elements intrans may become a state I composite in cis. We have, indeed,confirmed this genetic prediction ofour model (H.K.D. and A.Belachew, unpublished data).We thank Diane Burgess, Robin Hightower, Peter Lund, and

Barbara McClintock, in particular, for helpful discussions; PaulChomet for assistance with kernel preparation for photography; andJoyce Hayashi for the artwork. This is paper no. 5-12 from AdvancedGenetic Sciences-DNA Plant Technology.1. McClintock, B. (1946) Carnegie Inst. Washington Yearbk. 45,

176-186.2. McClintock, B. (1947) Carnegie Inst. Washington Yearbk. 46,

146-152.3. McClintock, B. (1948) Carnegie Inst. Washington Yearbk. 47,

155-169.4. McClintock, B. (1949) Carnegie Inst. Washington Yearbk. 48,

142-154.5. McClintock, B. (1953) Carnegie Inst. Washington Yearbk. 52,

227-237.6. Courage-Tebbe, U., Doering, H.-P., Fedoroff, N. & Starlinger, P.

(1983) Cell 34, 383-393.7. Weck, E., Courage, U., Doering, H.-P., Fedoroff, N. & Starlinger,

P. (1984) EMBO J. 3, 1713-1716.8. Doering, H.-P., Garber, R., Nelsen, B. & Tillmann, E. (1985) in

Plant Genetics, ed. Freeling, M. (Liss, New York), pp. 355-367.9. Fedoroff, N., Wessler, S. & Shure, M. (1983) Cell 35, 235-242.

10. Peacock, W. J., Dennis, E. W., Gerlach, W. L., Sachs, M. M. &Schwartz, D. (1984) Cold Spring Harbor Symp. Quant. Biol. 49,347-354.

11. Schiefelbein, J. W., Furtek, D. B., Raboy, V., Banks, J. A., Fe-doroff, N. & Nelson, 0. E. (1985) in Plant Genetics, ed. Freeling,M. (Liss, New York), pp. 445-460.

12. Wessler, S. R. & Varagona, R. (1985) Proc. Natl. Acad. Sci. USA82, 4177-4181.

13. Dooner, H. K., English, J., Ralston, E. J. & Weck, E. (1986)Science 234, 210-211.

14. Merckelbach, A., Doering, H.-P. & Starlinger, P. (1986) Maydica31, 109-122.

15. Schiefelbein, J. W., Furtek, D. B., Dooner, H. K. & Nelson, 0. E.(1988) Genetics 120, 767-777.

16. McClintock, B. (1956) Carnegie Inst. Washington Yearbk. 55,323-332.

17. Dooner, H. K. & Belachew, A. (1989) Genetics 122, 447-457.18. McClintock, B. (1955) Carnegie Inst. Washington Yearbk. 54,

245-255.19. Ralston, E. J., English, J. & Dooner, H. K. (1988) Genetics 119,

185-197.20. McClintock, B. (1962) Carnegie Inst. Washington Yearbk. 61,

448-461.21. Rhoades, M. M. (1952) Am. Nat. 86, 105-108.22. Ralston, E. J., English, J. & Dooner, H. K. (1987) Theor. Appl.

Genet. 74, 471-475.23. Dooner, H. K., Weck, E., Adams, S., Ralston, E., Favreau, M. &

English, J. (1985) Mol. Gen. Genet. 200, 240-246.24. Messing, J., Crea, R. & Seeburg, P. H. (1981) Nucleic Acids Res.

9, 309-321.25. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl. Acad.

Sci. USA 74, 5463-5467.26. Dooner, H. K., Ralston, E. J. & English, J. (1988) in International

Symposium on Plant Transposable Elements, ed. Nelson, 0. E. &Wilson, C. (Plenum, New York), pp. 213-226.

27. McClintock, B. (1941) Genetics 26, 234-282.28. Schwartz, D. & Dennis, E. (1986) Mol. Gen. Genet. 205, 476-482.29. Chomet, P. S., Wessler, S. & Dellaporta, S. L. (1987) EMBO J. 6,

295-302.30. McClintock, B. (1956) Cold Spring Harbor Symp. Quant. Biol. 21,

197-216.31. Van't Hof, J. (1976) Exp. Cell Res. 103, 395-403.32. Van't Hof, J. & Bjerknes, C. A. (1981) Exp. Cell Res. 136,461-465.33. Van't Hof, J. (1987) Stadler Genet. Symp. 18, 75-89.34. McClintock, B. (1956) Brookhaven Symp. Biol. 8, 58-74.35. Greenblatt, I. M. (1984) Genetics 108, 471-485.

Genetics: Ralston et al.

Dow

nloa

ded

by g

uest

on

Aug

ust 1

4, 2

021