CHMI 4226E – W2005 1

Recombinant DNA TechnologyCHMI 4226 E

Week 3

19 January 2009

Toolbox part 3

PCR

CHMI 4226E – W2005 2

PCR

• Very powerful method

• Allows for the in-vitro synthesis of a specific DNA molecule from very limited amounts.

• 3 basic steps (1 PCR cycle):– DNA denaturation– Primer annealing– Extension with DNA

polymerase

CHMI 4226E – W2005 3

PCR• The increase in the amounts of the

DNA on interest is exponential: doubles after each cycle (in theory)

• Fold increase can be determined as follows:

– Increase = 2n

• n = number of cycles – So, 25 PCR cycles will give you a

theoretical amplification of 34 million fold!!!

• In reality, a two-fold increase per cycle is rarely, if ever, obtained, due to:

– Presence of inhibitors– GC-rich regions in the template.

CHMI 4226E – W2005 4

PCR

CHMI 4226E – W2005 5

PCR - Reagents

CHMI 4226E – W2005 6

PCR-Selecting primers

CHMI 4226E – W2005 7

PCR

CHMI 4226E – W2005 8

PCR

CHMI 4226E – W2005 9

PCR5’ primer: 5’atg gac ggg tcc ggg gag cag ccc 3’ – Coding strand

5’atggacgggtccggggagcagcccagaggcggggggccca3’3’tacctgcccaggcccctcgtcgggtctccgccccccgggt5’

5’atggacgggtccggggagcagcccagaggcggggggccca3’

5’atggacgggtccggggagcagccc 3’3’tacctgcccaggcccctcgtcgggtctccgccccccgggt5’

95oC, 1 min

CHMI 4226E – W2005 10

PCR

CHMI 4226E – W2005 11

5’ctcaccgcctcgctcaccatctggaagaagatgggctga3’ 3’gagtggcggagcgagtggtagaccttcttctacccgact5’

3’gagtggcggagcgagtggtagaccttcttctacccgact5’

3’tggtagaccttcttctacccgact5’5’ctcaccgcctcgctcaccatctggaagaagatgggctga3’

95oC, 1 min

3’ Primer:

5’acc atc tgg aag aag atg ggc tga3’ Coding strand3’tgg tag acc ttc ttc tac ccg act5’ Template strand

5’ tca gcc cat ctt ctt cca gat ggt 3’

CHMI 4226E – W2005 12

PCR

CHMI 4226E – W2005 13

PCR• Desired properties of PCR primers:

– Length: 20-24 nt;

– Melting point (Tm) = 50-70oCTm= 2(A+T) +4(G+C)

T anneal = Tm-4oC

– %GC: 35%-65%;

– 3’ end is rich in GC (acts as a clamp);

– No sequence complementary between or within the two primers;

– No significant pairing (even incomplete) to other DNA molecules unrelated to the DNA of interest (perform Blast on primers).

• More on primer design guidelines:

– http://www.premierbiosoft.com/tech_notes/PCR_Primer_Design.html

• Software and algorithms:– http://www.humgen.nl/

primer_design.html

– http://www.biocenter.helsinki.fi/bi/Programs/fastpcr.htm

– http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi

CHMI 4226E – W2005 14

PCR-Annealing temperature

55oC 50oC

1 2 3 1 2 3

Primer sets

M

603 bp

310 bp281 bp234 bp194 bp

118 bp

CHMI 4226E – W2005 15

PCR – Fidelity of target amplification

CHMI 4226E – W2005 16

PCR-primers

CHMI 4226E – W2005 17

PCR-number of cycles

• While the yield of amplified product increases with the number of cycles, so is the possibility of:– Amplification of

partially related sequences;

– Introduction of mutations in the amplified DNA.

CHMI 4226E – W2005 18

PCR-number of cycles

CHMI 4226E – W2005 19

PCR-Effect of Mg+2

• Mg2+ is a co-factor for all DNA polymerases

• However, don’t forget that:– Primers and dNTPs

bind Mg2+

– Too much Mg2+ will favor non-specific DNA hybridization

• So: an optimal DNA concentration must be found for each pair of primers.

CHMI 4226E – W2005 20

PCR-Effect of Mg+2

Stoffel fragment: less heat sensitive and no 5’-3’ exonuclease activity.

CHMI 4226E – W2005 21

PCR-Effect of Mg+2

http://www.promega.com/guides/pcr_guide/070_04/promega.html

CHMI 4226E – W2005 22

PCR-Effect of Mg+2

http://info.med.yale.edu/genetics/ward/tavi/p14.html

CHMI 4226E – W2005 23

PCR- DNA polymerases

CHMI 4226E – W2005 24

PCR- DNA polymerases

• Processivity: number of nucleotides polymerized before the DNA pol leaves the DNA molecule.

• Fidelity: accuracy of the enzyme.

CHMI 4226E – W2005 25

PCR- DNA polymerases

CHMI 4226E – W2005 26

PCR- DNA polymerases

CHMI 4226E – W2005 27

PCR- DNA polymerases

• IMPORTANT: Fidelity and yield are mutually exclusive!

CHMI 4226E – W2005 28

PCR-Plateau effect

http://www.biotechlab.northwestern.edu/pe/sld021.htm

CHMI 4226E – W2005 29

PCR-Plateau effect

http://www.biotechlab.northwestern.edu/pe/sld021.htm

CHMI 4226E – W2005 30

PCR-Plateau effect• Plateau Effect - The plateau effect is an attenuation of the normally

exponential rate of product accumulation in a PCR reaction. It can be caused by:– depletion of dNTPs

– depletion of primers

– stability of the reactants (e.g. enzyme activity; particularly at the denaturation temperature)

– end product inhibition by duplex DNA

– non-specific competition for resources (production of incorrect product)

– reannealing of specific products to one another instead of to the primers (this is particularly problematic when product concentration is high).

CHMI 4226E – W2005 31

Major PCR problem: specificity

CHMI 4226E – W2005 32

Increasing PCR specificity Hot start method

http://www.biotechlab.northwestern.edu/pe/sld021.htm

CHMI 4226E – W2005 33

PCR-Specificity

CHMI 4226E – W2005 34

Increasing PCR specificity Use of nested primers

• Using two sets of primers to amplify a DNA fragment:– A first set of primers is used to amplify a

longer piece of the DNA of interest;– A second set of primers is used to amplify a

smaller section from the amplified region.

CHMI 4226E – W2005 35

Increasing PCR specificityTouchdown PCR

• In touchdown PCR, the reaction is first set with an annealing temperature a few degrees (e.g. 5oC) above the optimal temperature for the primers;

• During the first few cycles, the annealing temperature is slowly decreased (1oC per cycle);

• The aim is to favor the amplification of the DNA of interest over possible competing DNA molecules during the first few cycles of PCR, limiting the amplification of non-specific products in subsequent cycles.

CHMI 4226E – W2005 36

PCR-GC-rich templates

Betaine+-

Betaine

CHMI 4226E – W2005 37

PCR vs DNA cloning

CHMI 4226E – W2005 38

CHMI 4226E – W2005 39

CHMI 4226E – W2005 40

CHMI 4226E – W2005 41

Assignment #4!