Characterization of Vibrio fischeri rpoQ::tn physiology and the effect of the transposon insertion in rpoQ

Jennifer Dreisbach, Steven Liu, Jennifer Poon & Tiffany Rios

ABSTRACTVibrio fischeri is dependent on quorum sensing to regulate genes involved in infection and colonization of its host, Euprymna scolopes, the Hawaiian bobtail squid. Previous studies have shown that rpoQ is a regulatory component in quorum sensing and suppresses bioluminescence and motility but increases chitinase activity. In this study, we further propose with a rpoQ::Tn that RpoQ regulates biofilm formation and protease production. At high cell density, overexpression of RpoQ exerts a strong positive effect on the Rscs-SypG pathway leading to formation of more robust biofilms. RpoQ expression is also associated with protease activity, suggesting a role for RpoQ in the transcriptional activation of pepN, a gene encoding an aminopeptidase. Our results highlight additional functions for RpoQ in the quorum-signaling network that controls symbiotic initiation and maintenance in the host.

INTRODUCTIONThe functional role of rpoQ::tn, in Vibrio fischeri ES114, was evaluated. rpoQ is a sigma

factor regulated by quorum sensing. According to Cao et al, rpoQ is a gene that encodes for the sigma factor protein, RpoQ, that is likened to an RpoS sigma factor (1). It was hypothesized that a transposon insertion in rpoQ may lead to physiological changes in: quorum sensing dependent phenotypes, motility, carbon utilization, indole production, and stress response.

Quorum sensing is a relatively new phenomenon. It demonstrates that population density has the ability to trigger the expression of genes that promote certain cellular activities. In Vibrio fischeri, quorum sensing is very well understood in regards to bioluminescence in its symbiotic host, Euprymna scolopes. However, it is unclear how biofilm formation is specifically regulated via quorum sensing signaling. Cao et al showed that overexpression of rpoQ would lead to decreased luminescence and motility (1). Since a transposon insertion would lead to an underexpression of rpoQ, increased luminescence and motility was predicted. Based off of this knowledge of bioluminescence, it was predicted that biofilm formation will also be increased because of their similar population dependent activation in wild-type Vibrio fischeri ES114.

Exoenzyme production is crucial for various biological processes. The secreted enzymes are mainly responsible for breaking down macromolecules to allow for uptake into the cell and integration into various cellular functions. Exoenzymes have been found to be specifically important in Vibrio species for colonization of their marine symbionts. It is predicted that exoenzyme production will not be affected by the transposon insertion because the rpoQ sigma factor appears to be independent of exoenzyme production.

The ability to use different carbon sources for energy is advantageous to microbes. It is essential for successful competition with other microbes as well as survival in nutrient poor environments. After a BIOLOG phenotype array was performed, it was noted that there were differences in carbon utilization between the wild-type and mutant strains. Based off of this initial observation, it was predicted that the mutant strain would be able to utilize a nutrient poor media with acetic acid as a carbon source.

The bacterial stress response, SOS response, is critical for bacterial survival in adverse and unfavorable conditions. DNA damage or inhibition of DNA replication can generate a signal that promotes activation of the stress response system. The distress signal can induce over 20 unlinked genes (8). Multiple types of stress response systems can interpret environmental stimuli that trigger a survival response, usually all working together by a complex of global regulatory networks. It was predicted that if the sigma factor encoded by rpoQ is similar to that of rpoS, then the transposon insertion could adversely affect stress response systems, specifically decreasing catalase activity and biofilm formation while under stress. Xuan et al also demonstrated deletion of rpoS in Vibrio anguillarum leads to increased tryptophanase production, and therefore increased indole production (4). If rpoQ is rpoS-like, then a transposon inserted into rpoQ should have a similar effect.

In the present study, we intend to explore the effects of a transposon insertion in rpoQ on the physiology of V. fischeri.

MATERIALS AND METHODS

Bacterial Strains and Growth ConditionsAll bacterial strains used, found in Table 1, were provided by Cal Poly. Vibrio were grown in Luria-Bertani with 2% salt (LBS) at 25oC unless otherwise indicated. Staphylococcus aureus was grown on LB at 35oC. Certain procedures used Biofilm Media (BM). BM consists of Basal Medium with 500 mL 2x ASW, 460.25 mL dH2O, and 11.9 g HEPES. Solution is autoclaved and additional sterile stocks of reagents are added aseptically (1 mL phosphate stock, 5 mL ammonium stock, 30 mL 10% autoclaved casamino acids stock, 3.75 mL 80% autoclaved glycerol stock, 10 mL of a 0.001M Ferric SO4 stock). Table 1. Bacteria used in this study.

Properties

Vibrio fischeri ES114 Wildtype

Vibrio fischeri rpoQ::tn Mutant with transposon inserted in rpoQ

Vibrio fischeri C10 Non-motile

Vibrio fischeri KV4131 (binA-) binA mutant

Vibrio fischeri K4196 (binA+) binA mutant complemented

Vibrio fischeri pepN- pepN protease mutant

Vibrio fischeri pepN+ pepN protease mutant complemented

Vibrio cholerae Wildtype

Staphylococcus aureus Wildtype

Identifying Role of RpoQSequence for rpoQ (taccttagagcagctcgtgagttatctaaatcattaaaacgtgaaccttctattagagacatttcgacttactgtgaaga agaacaaattaaagtaagtaagattataagtttg) was entered into Kyoto Encyclopedia of Genes and Genomes (KEGG) website under the BLAST tab of KEGG GENES. BLASTN (nucl query vs nucl db) was selected and results were computed. The first entry (vfi: VF_A1015) was selected.

Identification of Transposon Insertion in rpoQSequence for rpoQ was entered into Basic Local Alignment Search Tool (BLAST) website as a nucleotide blast. Description of “Vibrio fischeri ES114 chromosome II, complete sequence” was noted from BLAST results. Partial sequence of Vibrio fischeri ES114 genome with transposon insertion (gcagattttgctagtcgtcaggcctatctcatttgggggcccattgcta) was entered into BLAST website

as a nucleotide blast with Vibrio fischeri ES114 inserted as “organism” before BLAST search was directed. “Vibrio fischeri ES114 chromosome II, complete sequence” was identified in the BLAST results and selected. Using results of given location of alignment in genome and known transposon sequence (gtcaggcctatctcatttggg), location of transposon was identified.

Motility AssayA 2L drop of V. fischeri ES114, rpoQ::tn, and C10 was added to the center of separate LBS plates containing 0.25% agar. Plates were incubated without inversion for 24 hours at 25oC.

Biofilm Assay Crystal Violet Approach5L of V. fischeri ES114, rpoQ::tn, KV4131, and KV4196 was added to separate brand new tubes containing 0.5 mL of BM broth. Tubes were incubated in a rack for 48 hours at 25oC with no shaking nor leaning. After 48 hours, a Biophotometer was blanked with 70L of BM in a UVette. The BM was removed from the UVette and 70L of one of the previously grown cultures in BM (V. fischeri ES114, rpoQ::tn, KV4131, or KV4196) was measured for cell density at an absorbance of OD600. The rest of the cultures were measured for cell density in the same manner. All culture tubes were rinsed with deionized water. 0.5 mL of 1% crystal violet was pipetted directly into the bottom of each tube, being sure to avoid getting any on the walls of the tube. Tubes were incubated with crystal violet for 5 minutes. The crystal violet was pipetted out and the tubes were rinsed with deionized water until wash was clear. Image of stained biofilm was taken. 0.5 mL of 95% ethanol was added to each tube and incubated for 1 minute. Sterile wooden sticks were used to scrape biofilm into the ethanol. The Biophotometer was blanked with 70L of 95% ethanol in a UVette. OD600 was read for each solution, using 70L in a UVette. Biofilm units were calculated by dividing biofilm OD600 by cell density OD600.

Calcofluor Approach V. fischeri ES114, rpoQ::tn, KV4131, and KV4196 were grown as directed above for the crystal violet approach. Tubes were rinsed with deionized water. 0.5 mL of 0.2% calcofluor in 1M Tris (pH 9) was added to each tube and incubated for 30 minutes. Dye was rinsed out with deionized water. Tubes were exposed to UV light.

Growth Curve and Luminescence 70L of LBS was added to a 1.5 mL microfuge tube and a “background” reading was taken in a TD 20/20n luminometer. The 70L of LBS was removed from the microfuge tube and placed into a UVette to blank the Biophotometer at OD600. 100L of V. fischeri ES114 and rpoQ::tn previously grown at 28oC shaking (250 rpm) was added to 10 mL of LBS in respective flasks for each strain. 0.5L of autoinducer (AI 3OC6) was added to each of two other flasks. The ethyl acetate solvent was allowed to evaporate fully. 10 mL of LBS and 100L of V. fischeri ES114 or rpoQ::tn previously grown at 28oC shaking (250 rpm) were added to each flask after. Initial readings of all four flasks (ES114, rpoQ::tn, ES114+AI, rpoQ::tn+AI) were taken for luminescence and OD600. All flasks were placed in a 28oC incubator shaking at 250 rpm. Time was recorded. Readings for luminescence and OD600 were taken every

40 minutes until log phase growth was reached. Readings for luminescence and OD600 were then taken every 30 minutes. Microsoft Excel was used to graph OD600 vs. Time (min.). Data points for lag phase were eliminated. Corrected luminescence was found by subtracting background LU from all sample LUs. The corrected LU was divided by corresponding OD600 to determine specific luminescence. A Specific Luminescence vs. OD600 graph was made using Microsoft Excel. Luminescence and OD600 continued to be recorded until growth was in stationary phase.

Exoenzyme ProductionDNase ActivityV. fischeri ES114 and rpoQ::tn and V. cholerae were used to make a single streak with an inoculating loop across a DNase plate. The plate was incubated at 25oC for 48 hours. A culture of S. aureus was used to make a single steak with an inoculating loop across another DNase agar plate. The plate was incubated at 35oC for 48 hours. Both plates were flooded with 1N HCl and allowed to stand on the bench for a few minutes to observe zones of clearing around colonies.

Mucinase ActivityV. fischeri ES114, rpoQ::tn, pepN-, and pepN+, and V. cholerae cultures were used to make a single streak with an inoculating loop across mucin (with 2% salt) plates. Plates were incubated at 25oC for 48 hours. Amido black was used to flood the plates, which were then allowed to sit for 30 minutes. Staining solution was poured off and plates were flooded with de-stain solution made from acetic acid, swirled, and poured off. De-staining was repeated until zone of clearing was evident.Protease ProductionA Biophotometer was blanked using 70L of BM in a UVette. V. fischeri ES114, rpoQ::tn, pepN-, and pepN+, and V. cholerae cultures grown in BM shaking (250 rpm) at 25oC for 24 hours were measured in the Biophotometer at OD600 using 70L for each sample. In a 96-well plate, reactions were made in triplicate with substrate used being L-Leucine-7-amido-4-methylcoumarin hydrochloride. Reactions included: 1) 150L of strain, 2) 150L of strain and 5L of substrate, 3) 150L of sterile BM and 5L of substrate. The plate was covered in foil and incubated at 25oC for 3-4 hours. Plate was evaluated in the BLx800 BioTek fluorimeter with the KC4 program. Filters were placed inside the machine. Excitation was set to 380/30, emission to 440/20, and sensitivity to 80. Data was exported to Microsoft Excel for analysis. Largest value from negative controls was subtracted from each sample weil. The average fluorescence of samples was then divided by the cell OD600.

BIOLOG Phenotype Array V. fischeri rpoQ::tn grown on TSA with 1.4% NaCl at 25oC was used to inoculate separate tubes of Inoculation Fluid (phosphate-buffered 1.4% NaCl). Inoculation was compared to a turbidity standard with an OD600 of approximately 0.074 . A Biophotometer was blanked with 70L of Inoculation Fluid in a UVette. 70L of sample was then measured at OD600 to ensure standardization. 100L of turbid Inoculation Fluid was added to each well of a BIOLOG PM1 plate. Test was performed in duplicate. Plates were incubated at 25oC for 48 hours, then

observed for results. V. fischeri ES114 kinetic data was obtained from Dr. Fidopiastis at Cal Poly for analysis.

Acetic Acid Assay3L, 5L, and 8L of 95% acetic acid was added to separate tubes containing 9 mL of BM each (final concentrations of acetic acid: 6mM, 8mM, and 14mM respectively). 100L of V. fischeri ES114 and rpoQ::tn was added to different tubes of media for each concentration. Tests were performed in duplicate. A Biophotometer was blanked using 70L of BM in a UVette. OD600 was measured for each sample, using 70L in a UVette as well. Tubes were incubated at 28oC shaking (250 rpm) for 48 hours. 70L of each sample was measured in a Biophotometer blanked with 70L of BM at OD600 in a UVette.

Indole Assay100L of V. fischeri ES114 and rpoQ::tn was added to separate tubes of tryptone broth with a total concentration of 1.67% NaCl. Tests were performed in duplicate. Tubes were incubated at 25oC for 48 hours. A Biophotometer was blanked with 70L of tryptone broth in a UVette. OD600

was measured for each sample using 70L in a UVette. 1mL of Kovac’s reagent was added.

Catalase AssayA 10-fold and 100-fold dilution of 6% bleach in LBS (final concentrations 0.6% and 0.06%) was made. 100L of V. fischeri ES114 and rpoQ::tn was added to separate tubes for each concentration. Tests were performed in duplicate. Tubes were incubated at 25oC for 48 hours. A Biophotometer was blanked with 70L of LBS in a UVette. OD600 was measured for each sample in the Biophotometer using 70L in a UVette. 100L of 30% H2O2 was added to each tube. The height of bubble production was measured in mm.

RESULTSIdentifying Role of RpoQKEGG identified RpoQ as a sigma-Q factor, playing a role as a quorum-sensing regulated RpoS-like sigma subunit. Looking at a genomic map, rpoQ is located between a promoter and an open reading frame as observed in Fig. 1.

Fig. 1. A genomic map of the rpoQ gene and the genes surrounding it. Open reading frames are indicated by the block arrows.

Identification of Transposon Insertion in rpoQBLAST determined the location of transposon at base number 427 through 540 in rpoQ as indicated in Fig. 2. Total length of gene with transposon is 885 bases.

Fig. 2. Location of transposon insertion in rpoQ.

Motility AssayMotility of the V. fischeri mutant strain rpoQ::tn of strain was observed and compared to wild-type ES114 and non-motile C10 strains. ES114 and rpoQ::tn both showed motility at 24 hours, while C10 only grew at the point of inoculation. rpoQ::tn however, had a slightly smaller diameter of growth than ES114 when observed at 24 hours.

Biofilm AssayCrystal Violet ApproachBiofilm formation was observed qualitatively by staining with crystal violet without any oxidative stress as seen in Fig. 3. Comparison of ES114, rpoQ::tn, binA- and binA+ strains showed that the mutant rpoQ::tn strains produced the most prominent biofilms, followed by binA-, ES114 and binA+ decreasing in amount of biofilm present.

When ES114 and rpoQ::tn were oxidatively stressed using H2O2 and stained with crystal violet to quantify biofilm formation, an opposite result was seen than that of the biofilm formation without oxidative stress shown in Fig. 4. The wild-type strain produced a more pronounced biofilm in the tube than the mutant strain.

The quantitative biofilm data obtained is presented in Fig. 5. to compare biofilm formation per cell before and after oxidative stress using H2O2. In both stressed and unstressed conditions a greater amount of biofilm was measured from ES114 than rpoQ::tn. Without oxidative stress, biofilm per cell decreased among groups tested. The highest being ES114, rpoQ::tn, binA- and binA+ which produced values of 4.63, 2.52, 1.94 and 0.48 respectively. It should be noted that

the qualitative result showed a more prominent biofilm formed by rpoQ::tn, which was an opposite trend of the measured biofilm per cell value found when the OD readings were measured. Upon the addition oxidative stress using of H2O2 an increase in biofilm was observed in both ES114 and rpoQ::tn compared to the pre-oxidative stress groups, with ES114 generating more biofilm than mutant which was consistent with the trend seen in the absence of oxidative stress. ES114 created a biofilm value of 5.811 per cell, while rpoQ::tn was measured at 4.30 per cell.

Fig. 5. Comparison of biofilm formation before and after oxidative stress using H2O2.

Calcofluor ApproachThe calcofluor method compared cellulose biofilm production by observing fluorescence under UV light. The binA- mutant showed a positive result with a strong blue fluorescence when exposed to UV light. The binA+ mutant complemented produced significantly less fluorescence than the binA- strain. ES114 and RpoQ::TN showed relatively the same amount of fluorescence than both binA- and binA+.

Growth Curve and LuminescenceA growth curve was used to compare specific luminescence/OD600 of ES114 and RpoQ::TN as shown in Fig. 6. RpoQ::TN with autoinducer (RpoQ::TN+AI) showed significantly higher luminescence values than all other test groups, reaching specific luminescence per cell values 5.72x106. The next highest specific luminescence was measured in ES114+AI (7.14x104),

followed by RpoQ::TN (4.89x103) and finally ES114 (1.54x102). Specific luminescence fluctuated slightly in all samples over time. The luminescence values measured in stationary showed large decreases in the specific luminescence of all strains in the presence and absence of autoinducer. The same trend was observed among the samples in stationary phase, with no strain showing persistently high luminescence values in stationary phase.

Exoenzyme ProductionDNase ActivityDNase activity in all strains was positive, showing a clearing upon the addition of 1N HCl. S. aureus showed the weakest positive result as the halo was the smallest in diameter and was more opaque than the halos formed around ES114 and rpoQ::tn.

Mucinase Activity

ES114, rpoQ::tn, pepN- and pepN+ showed weak positive results when tested for mucinase activity. These strains formed light blue halos around the streak, while V. cholerae produced a light blue halo and a small zone of clearing around the streak. V. cholerae showed a stronger positive for mucinase production than the other strains tested.

Protease ProductionProtease production per cell in the strains rpoQ::tn, ES114, pepN-, pepN+ and V. cholerae is shown in Fig. 7. ES114 had the greatest protease production of 4.07x104 specific fluorescence/OD600. V. cholerae showed the second greatest protease activity at 3.08x104 specific fluorescence/OD600. Comparison of ES114 and rpoQ::tn shows a 10-fold reduction in protease production. pepN- and pepN+ each showed little protease activity in comparison to ES114 and V. cholerae.

Fig. 7. Specific fluorescence of various V. fischeri strains as a result of proteolytic cleavage of an amino acid peptide-bonded to a reporter fluorescent coumarin compound.

BIOLOG Phenotype ArrayPM1 BIOLOG plates tested sources for carbon utilization for ES114 and rpoQ::tn strains. Comparison of wild-type to mutant indicated five differences between the strains as shown in Table 2. The rpoQ::tn showed a gain of function in utilization of beta-methyl-D-glucoside and a loss of function in utilization of bromo succinic acid and 2-aminoethanol as carbon sources. ES114 was not able to use acetic acid or glucose-1-phosphate as a carbon source. The mutant was tested in duplicate, which yielded one positive and one negative result for both acetic acid and glucose-6-phosphate. Both positive results were observed on the same BIOLOG plate.

Table 2. Differences in carbon utilization between V. fischeri wild-type (ES114) and mutant (rpoQ::tn) strains.

ES114 RpoQ::TN

beta-Methyl-D-Glucoside - +

Bromo succinic acid + -

2-Aminoethanol + -

Acetic acid - +/-

Glucose-1-phosphate - +/-

Acetic Acid Assay The BIOLOG plates indicated that rpoQ::tn had a possible gain of function mutation, allowing it to utilize acetic acid as a carbon source. The growth of V. fischeri wild-type and mutant strains is illustrated in Fig. 8. ES114 had a higher initial OD than rpoQ::tn in all three concentrations of acetic acid. ES114 supplemented with 6.0 mM acetic acid continued to increase in OD over the 48 hour time period. ES114 supplemented with 8.0 and 14.0 mM acetic acid showed a decrease in cell density after 48 hours. rpoQ::tn at all concentrations of acetic acid showed a slight increase in cell density over 48 hours. There was no significant difference between measured luminescence values in this part of the study.

Fig. 8. Vibrio fischeri ES114 and rpoQ::tn cells were grown in BM with varying concentrations of acetic acid with shaking for 48 hours. OD600 values were measured at 0 hours and 48 hours.

Indole AssayUpon addition of Kovac’s reagent to ES114 and rpoQ::tn strains grown in tryptone broth, no positive results or red color was produced. No OD600 readings were taken as all samples showed a negative result.

Catalase AssayES114 and rpoQ::tn were tested for catalase activity before and after oxidative stress. Prior to oxidative stress, both strains were positive for catalase using the slide method. After oxidative stress with 0.6% bleach both strains produced 11mm of bubbles upon the addition of H2O2. With oxidative stress using 0.06% bleach ES114 produced 15mm of bubbles while rpoQ::tn only produced 9mm of bubbles when H2O2 was added.

DISCUSSIONIn this study, we show that insertion of a transposon in rpoQ disrupts V. fischeri biofilm

formation and peptidase function, both activities associated with symbiosis (1). Disruption of rpoQ also resulted in significantly elevated luminescence levels.

Biofilm formation is essential for initial infection of the host by providing access to nutrients and protection from toxic compounds (2). In V. fischeri, biofilm formation is mediated by the two-component sensor kinase, RscS, which activates transcription of the response-regulator SypG. The SypG transcriptional activator activates transcription of the syp locus, resulting in production of exopolysaccharides required for colonization (3). The host, Euprymna scolopes, produces biochemical defenses, in the form of oxidative compounds, which V. fischeri must coexist with for successful colonization and persistence. Cells of the host duct and portions of the crypts produce nitric oxide and hypohalous acid to prevent nonspecific colonization by other bacteria (1). V. fischeri is continuously challenged with these toxic oxidative chemicals and thus the biofilm is important in shielding bacterial cells.

Our results revealed that insertion of a transposon in rpoQ, disrupts V. fischeri’s biofilm formation and subsequently, response to oxidative stress. Average biofilm units produced per

cell after exposure to hydrogen peroxide resulted in approximately a 25% reduction in V. fischeri cells with a transposon insertion in rpoQ compared to the wild-type (Fig. 3). Our finding suggests that rpoQ is involved in producing robust biofilms which is crucial for protection against the types of oxidative stressors it regularly encounters in the host. One possible mechanism for producing more robust biofilms may involve rpoQ inducing overexpression of the rscS1 allele. Previous studies have shown that overexpression of the rscS1 allele results in the production of more robust biofilms (4, 5, 6). Thus rpoQ may play an accessory role in the RscS-SypG pathway by elevating level of rscS1 expression.

In addition to biofilm formation, disruption of rpoQ also resulted in repressed peptidase activity. Our mutant strain of V. fischeri displayed approximately an 8-fold reduction in peptidase activity. In fact, peptidase activity of our mutant was comparable to the pepN- mutant, where the gene encoding an aminopeptidase is deleted. Note that peptidase activity may only be higher in our mutant due to disruption of rpoQ versus complete removal of gene encoding aminopeptidase function (Fig. 7). The host secretes mucus from the light organ upon bacterial exposure. Components of squid mucus includes sugars, amino acids and peptides which may serve as nutrient sources or chemoattractants (7). In other studies, a type IV prepilin peptidase in Vibrio vulnificus, has been shown to be required for colonization and persistence in oysters (8). It is abundantly clear that peptidases are critical for host colonization, whether they play a role in acquiring nutrients or initial infection of the host. Loss of peptidase function, may have a significantly negative impact on V. fischeri’s ability to infect and colonize E. scolopes. Our results suggest that rpoQ is involved in the direct expression of pepN and may be a transcriptional activator of pepN.

Luminescence levels were also significantly higher in the mutant, both in the presence and absence of an autoinducer (Fig. 6). A previous study has demonstrated that rpoQ is involved in repressing luminescence at high cell densities. RpoQ is a negative regulator in the circuit regulating lux expression (9). Our findings confirm that RpoQ is a transcriptional repressor in the lux system. Disruption of rpoQ exhibited significantly increased levels of luminescence (Fig. 6).

The mutant also displays an affinity for utilizing acetic acid as a carbon source at all concentrations while the wild-type was only able to utilize acetic acid at a concentration of 6mM (Fig. 8). However, the association between acetic acid utilization and rpoQ remains unclear. Carbon source utilization is not typically a behavior that requires a threshold concentration of bacteria to be met. Metabolism is not a group-dependent function and an intrinsic ability that all cells possess.

In regards to other phenotypes associated with quorum-sensing, disruption of rpoQ did not have any effect on the motility of the mutant (data not shown). However, it is known that overexpression of rpoQ represses motility when V. fischeri are in high concentrations (8). Likewise, no significant difference was observed in our mutant’s ability to produce DNase and mucinase, suggesting these functions are not regulated by rpoQ (data not shown).

Fig. 9. Model of RpoQ regulation of quorum-sensing dependent activities in V. fischeri. (A) At low cell density, in the absence of LitR, rpoQ has no effect on biofilm formation and protease production. (B) At moderate cell densities, rpoQ has minimal effect on rscS, but transcriptionally activates pepN. rscS activates sypG to begin biofilm formation and does not require the help of rpoQ. At this level, rpoQ remains insufficient to affect rscS. (C) At high cell densities, rpoQ strongly upregulates rscS, inducing overexpression of rscS which results in more robust biofilms formation. rpoQ maintains the same transcriptional effect on pepN.

How is rpoQ involved in the circuit regulating these quorum-sensing dependent phenotypes? At low cell densities, in the absence of quorum signaling, LitR, has no effect on rpoQ (Fig. 9). As quorum-signaling increases, leading to higher levels of LitR, bacterial cells begin to produce more luminescence and display lower motility. At this stage, rpoQ activates transcription of pepN, in order to acquire exogenous nutrients and complete infection of the host (Fig. 9). At very high levels of LitR, rpoQ is highly induced and exerts a dominant effect on downstream genes such as rscS, increasing formation of a more robust biofilm (Fig. 9).

In summary, rpoQ may be involved in regulation of other quorum-sensing dependent phenotypes not previously studied, namely biofilm formation and protease production. This suggests that rpoQ is not only a global regulator of symbiotic maintenance in the host, but also a global regulator of symbiotic initiation.

REFERENCES

1. Cao, X., Studer, S. V., Wassarman, K., Zhang, Y., Ruby, E. G., & Miyashiro, T. (2012). The novel sigma factor-like regulator RpoQ controls luminescence, chitinase activity, and motility in Vibrio fischeri. MBio, 3(1), e00285-11.

2. DeLoney-Marino, C. R., Wolfe, A. J., & Visick, K. L. (2003). Chemoattraction of Vibrio fischeri to serine, nucleosides, and N-acetylneuraminic acid, a component of squid light-organ mucus. Applied and environmental microbiology, 69(12), 7527-7530.

3. Geszvain, K., & Visick, K. L. (2008). Multiple factors contribute to keeping levels of the symbiosis regulator RscS low. FEMS microbiology letters, 285(1), 33-39.

4. Li X, Yang Q, Dierckens K, Milton DL, Defoirdt T (2014) RpoS and Indole Signaling Control the Virulence of Vibrio anguillarum towards Gnotobiotic Sea Bass (Dicentrarchus labrax) Larvae. PLoS ONE 9(10): e111801.

5. Mandel, M. J., Wollenberg, M. S., Stabb, E. V., Visick, K. L., & Ruby, E. G. (2009). A single regulatory gene is sufficient to alter bacterial host range.Nature, 458(7235), 215-218.

6. Nyholm, S. V., & McFall-Ngai, M. (2004). The winnowing: establishing the squid–Vibrio symbiosis. Nature Reviews Microbiology, 2(8), 632-642.

7. Paranjpye, R. N., Johnson, A. B., Baxter, A. E., & Strom, M. S. (2007). Role of type IV pilins in persistence of Vibrio vulnificus in Crassostrea virginica oysters. Applied and environmental microbiology, 73(15), 5041-5044.

8. White, D., Drummond, J., and Fuqua, C. In The Physiology and Biochemistry of Prokaryotes, in press. Oxford University Press., New York, NY.

9. Yildiz, F. H., & Visick, K. L. (2009). Vibrio biofilms: so much the same yet so different. Trends in microbiology, 17(3), 109-118.

10. Yip, E. S., Geszvain, K., DeLoney Marino, C. R., & Visick, K. L. ‐ (2006). The symbiosis regulator RscS controls the syp gene locus, biofilm formation and symbiotic aggregation by Vibrio fischeri. Molecular microbiology, 62(6), 1586-1600.

11. Yip, E. S., Grublesky, B. T., Hussa, E. A., & Visick, K. L. (2005). A novel, conserved cluster of genes promotes symbiotic colonization and σ54 dependent biofilm formation by ‐Vibrio fischeri. Molecular microbiology, 57(5), 1485-1498.