Planta (2007) 226:429–442

DOI 10.1007/s00425-007-0493-3

ORIGINAL ARTICLE

Characterization of vascular-speciWc RSs1 and rolC promoters for their utilization in engineering plants to develop resistance against hemipteran insect pests

Prasenjit Saha · Dipankar Chakraborti · Anindya Sarkar · Indrajit Dutta · Debabrata Basu · Sampa Das

Received: 13 October 2006 / Accepted: 5 February 2007 / Published online: 24 February 2007© Springer-Verlag 2007

Abstract Rice sucrose synthase1, RSs1 (isolated fromrice) and rolC (isolated from Agrobacterium rhizoge-nes) promoters were evaluated by binding analyses oftheir respective cis-elements with host nuclear tran-scription factors. The expression proWle of an insecti-cidal protein driven by these promoters in transgenicplants was monitored. Motif-search analysis with avail-able phloem-speciWc promoter sequences revealed thepresence of two BoxII elements in RSs1. An octopinesynthase element, a stem-speciWc, a root-speciWc and alight-responsive element were found in the rolC pro-moter, whereas the ASL box, GATA and 13 bp motifswere detected in both promoters. Binding analysis ofthese cis-elements (both in native and mutant forms)with the trans-factors present in the nuclear extractsfrom rice, tobacco and chickpea, followed by electro-phoretic mobility shift assay, documented a highly spe-ciWc cis–trans interaction. Both promoters were utilizedto express Allium sativum leaf agglutinin (ASAL) genein the three aforementioned plant systems. By immu-nohistochemistry and immunohistoXuorescence, spe-ciWc patterns of ASAL accumulation were detected invascular tissues of single copy transgenic plants. Trans-

genic plants expressing ASAL in a phloem-speciWcmanner demonstrated about 60–65% more insecticidalactivity than control plants. The two promoters, whichevolved independently from two distinctly unrelatedorigins, were found to maintain their functionality in aconserved manner. They were able to express theinsecticidal protein coding ASAL as transgene both inmonocot and dicot hosts. Thus, the two promoters arevaluable as prospective phloem-speciWc promoters foruse in plant biotechnological programmes.

Keywords Allium · Leaf agglutinin · Electrophoretic mobility shift assay · ImmunohistoXuorescence localization · Phloem-speciWc cis-elements · Phloem-speciWc expression · Transgenic rice · Tobacco · Chickpea

AbbreviationsASAL Allium sativum leaf agglutininBBMV Brush border membrane vesiclecv. CultivarELISA Enzyme-linked immunosorbent assayEMSA Electrophoretic mobility shift assayFITC Fluorescein isothiocyanateRSs1 Rice sucrose synthase1SE Standard errorTrans Transcription factors

Introduction

Oryza sativa L. (rice) and Cicer arietinum L. (chickpea)suVer from massive yield loss due to the attack ofhemipteran insect pests, namely, Nilaparvata lugens(brown planthopper; BPH), Nephotettix virescens

Prasenjit Saha and Dipankar Chakraborti equally contributed to this work.

P. Saha · D. Chakraborti · A. Sarkar · I. Dutta · S. Das (&)Plant Molecular and Cellular Genetics, Bose Institute, P1/12 C.I.T. Scheme VIIM, Kolkata 700054, West Bengal, Indiae-mail: sampa@bic.boseinst.ernet.in

D. BasuDepartment of Botany, Bose Institute, 93/1 A.P.C. Road, Kolkata 700009, West Bengal, India

123

430 Planta (2007) 226:429–442

(green leafhopper; GLH) and Aphis craccivora (blackbean aphid), respectively (Sharma et al. 2004). Likewise,Myzus persicae (peach potato aphid) is an importantpolyphagous insect, which infests Nicotiana tabacum L.(tobacco) and causes signiWcant damage. Specialattention has been focused to control crop loss causedby hemipteran insects. Regular insecticide spraysduring cropping stages not only adversely aVect thebeneWcial organisms and human population, but alsocause outbreaks of hemipteran pests (Foissac et al.2000). All these insects damage crops by removingplant phloem sap, causing blockage of phloem vesselsand also serve as vehicle for more than 100 plantviruses including rice tungro viruses (Sogawa 1994) andchickpea stunt disease-associated luteoviruses (Reddyand Kumar 2004). Therefore, developing insect resis-tance in plants through phloem-speciWc expression ofan insecticidal protein has the merits of directly aVect-ing the phloem feeding insects. This may avoid unex-pected expression of the target gene in non-targetorgans and tissues, which reduces the metabolic loadon the transgenic plants. This necessitated identifyingand characterizing eYcient phloem-speciWc promoters.

Complex applications in biotechnology will increas-ingly require the use of banks of promoters withdeWned or spatial speciWcity. In the past few years,several phloem-speciWc promoters have been utilized todevelop genetically superior plants (Bajaj and Mohanty2005). Two such promoters are rice sucrose synthase1,RSs1, isolated from rice, and rolC, isolated from Agro-bacterium rhizogenes A4 strain. The RSs1 was found toregulate the expression of �-glucuronidase (GUS) gene(Shi et al. 1994), Galanthus nivalis agglutinin (GNA)gene (Rao et al. 1998; Sudhakar et al. 1998) and Alliumsativum leaf agglutinin (ASAL) gene (Dutta et al.2005a) in a phloem-speciWc manner. The rolC has beendemonstrated to be the phloem-speciWc expression ofGUS gene in transgenic tobacco by Sugaya et al. (1989)and Schmuelling et al. (1989), and in transgenic rice byMatsuki et al. (1989). However, the molecular interac-tion determining the phloem speciWcity of these twopromoters was not investigated in greater detail. Thepresent investigation has been directed to identify andcharacterize the potential cis-elements of the two pro-moters, to monitor their interaction with host trans-fac-tors as well as to analyse the tissue-speciWc functionalability of these two promoters through the expressionof insecticidal protein in target plants.

However, sap-sucking pests belonging to the orderhemiptera generally have very low levels of proteolyticactivity in their guts (Chang et al. 2003). Therefore, Bttoxins or protease inhibitors based on the inhibition ofinsect gut proteolysis are unlikely to be eVective

against hemipteran insect pests (Rao et al. 1998).Adaptations of the pests to protease inhibitors by pro-ducing inhibitor-insensitive proteases have beenobserved (Chang et al. 2003). Plant lectins have showndeleterious eVect on insects belonging to the orderhemiptera when tested in artiWcial diets and in plantabioassays on transgenic plants (Hilder et al. 1995; Raoet al. 1998). The insecticidal activity of a carbohydrate-binding plant lectin ASAL has been analysed againstvarious hemipteran pests (Bandyopadhyay et al. 2001;Majumder et al. 2004). It has also been shown thatconstitutive (from CaMV35S promoter) expression ofASAL in tobacco and in rice exhibited signiWcant levelof resistance against M. persicae (Dutta et al. 2005b) N.lugens and N. virescens (Saha et al. 2006), respectively.

In the current work, a homology search tool hasbeen adopted to identify the possible cis-elements ofRSs1 and rolC promoters, responsible for determiningthe tissue speciWcity. Subsequently, binding of thesecis-elements to host transcription factors isolated fromall three plants was investigated in the mode of DNA–protein interaction. DiVerential cis–trans interactionsin the form of native and competitive binding assayswere analysed using electrophoretic mobility shiftassay (EMSA). In situ localization of ASAL in the tar-get tissue of transgenic plants regulated by RSs1 androlC promoters was analysed. Promoter-regulatedexpression and the functional activity of ASAL weredetermined by enzyme-linked immunosorbent assay(ELISA) and in planta insect bioassay. This providesinformation about the mode of interaction of cis-ele-ments with trans-factors of three host plants and itsfunctional relevance in terms of tissue-speciWc expres-sion of ASAL, which occurs in a more or less similarmanner in both dicot and monocot plant species.

Since our future goal is to attain sustainable cropyield by engineering or pyramiding multiple resistancegenes with diVerential modes of action on diVerentinsect groups, the characterization of the RSs1 androlC promoters in the present study may be eVectivelyutilized in future for engineering a broad range of agro-nomically important plants for developing resistanceagainst phloem-feeding hemipteran insect pests.

Materials and methods

Plant material

Rice (Oryza sativa L. cv. Pusa Basmati 1), tobacco(Nicotiana tabacum L. cv. Petit Havana SR1) andchickpea (Cicer arietinum L. cv. ICCV 89314) plantswere used for the preparation of nuclear extract and

123

Planta (2007) 226:429–442 431

transformation. Rice and chickpea seeds wereobtained from the Regional Rice Research Station(Chinsurah) and Oil Seed Research Station (Berham-pur), West Bengal, India, respectively. Tobacco seedswere purchased from Sutton and Sons (India) Pvt. Ltd.(Kolkata), West Bengal, India.

Promoter-ASAL cloning

The cloning of CaMV35S-ASAL into the binary vectorpCAMBIA1301 was described previously by Duttaet al. (2005b). The promoter region of rice sucrose syn-thase1 (RSs1) spans between ¡693 bp 5� upstream tothe transcription start site (+1) and 1,224 bp down-stream including intron1 sequence (Accession No.AJ401233). The promoter fragment was cloned intothe binary vector pCAMBIA1301CaMV35S-ASAL,replacing the CaMV35S promoter (Dutta et al. 2005a).The TATA and CAAT boxes in RSs1 promoter werelocated at ¡28 to ¡21 bp and ¡79 to ¡72 bp upstreamregions. The ¡930 bp 5� upstream rolC promoter frag-ment of the ORF12 gene of Agrobacterium rhizogenesA4 strain Ri plasmid TL-DNA was obtained by PCRampliWcation using 5�AGGAAGCTTAG CGAAAGGATGTCA3� forward and 5�CCGGATCCATGGTAACAAAGTAGGA3� reverse primers, includingan additional HindIII and BamHI site (shown in italicand underlined), respectively. The ampliWed fragmentwas sequenced (Accession No. DQ160187) andinserted into HindIII/BamHI sites of pCAMBIA1301/2301-ASAL. The putative TATA and CAAT boxes inrolC were assigned at ¡62 to ¡55 bp and ¡83 to¡79 bp relative to +1. The vectors pCAMBIA1301/230135S-ASAL were used for constitutive expressionof the ASAL gene (Accession No. AY866499) andpCAMBIA1301/2301-ASAL (promoterless ASAL)was used as negative control in plant transformationexperiments. Individual plant transformation vectors(pCAMBIA-ASAL, 35S-ASAL, RSs1-ASAL androlC-ASAL) were mobilized into A. tumefaciens strainLBA4404.

Sequence analysis and motif search of the promoters

Computer-based sequence analysis and motif searchwere carried out using generunner (v.3.05) software(Hastings Software) for locating potential cis-elementsin RSs1 and rolC promoter sequences. Motif searchwas also carried out on the 5�upstream promoterregion of the genes having potentiality for strongexpression in vascular tissue e.g. glutamine synthase 3A(GS3A), Arabidopsis H+-ATPase isoform 3 (AHA3),Robinia pseudoacacia inner-bark lectin (Rplec2),

Arabidopsis sucrose synthase (Asus1), maize sucrosesynthase1 (Sh1), the rice sucrose synthase1 (RSs1),phenylalanine ammonia-lyase 2 (PAL2), phenylpropa-noid enzyme 4-coumarate:coenzyme A ligase (4CL),maize alohol dehydrogease1 (Adh1), potato invertase(invCD111 and invCD141), pea ribulose-1,5-bisphos-phate carboxylase oxygenase-3A (rbcs-3A), Chloro-phyll a/b binding (Cab), bean glycine-rich protein(grp1.8), bean nitrate reductase (PVNR1), tobaccohydroxyproline rich glycoprotein (HRGPPnt3), metal-lothionein of maize (MTL) and pea (pSmtA), theAgrobacterium rolA, rolB, rolC and rolD, plant viruspromoters [cauliXower mosaic virus (CaMV35S), car-nation etched ring virus (CERV), commelina yellowmottle virus (CoYMV), coconut foliar decay virus(CFDV), Wgwort mosaic virus (FMV) and rice tungrobacilliform virus (RTBV)] and promoters of T-DNAgenes [mannopine synthase (MAS), nopaline synthase(NOS) and octopine synthase (OCS)].

Preparation of nuclei and nuclear protein extracts

Nuclei were isolated according to the proceduredescribed by Maier et al. (1987) using »15-day-oldrice, tobacco and chickpea seedlings. Leaves (100 g)were powdered in liquid nitrogen and homogenized in100 ml of buVer A [2.5% (w/v) Wcoll, 5% (w/v) dextran,25 mM Tris-HCl pH 8.5, 10 mM MgCl2, 0.5% (v/v) Tri-ton X-100, 440 mM sucrose, 10 mM �-mercaptoetha-nol, 0.2 mM EDTA, 2 mM spermine–HCl and 10 �g/mlleupeptin hemisulfate]. Right from this, all subsequentprocedures were performed in ice; all centrifugationswere done at 4°C. The suspension was Wltered througha 70 �m nylon Wlter. The Wltrate containing crudenuclear suspension was precipitated by centrifuging for5 min at 3,000g and the pellet resuspended in 100 mlbuVer B (identical to buVer A, but without spermine–HCl) and recentrifuged. The nuclei-enriched pellet wasused directly for extraction of nuclear proteins. Thenuclear pellet was resuspended in 0.5 ml buVer C[20 mM Hepes, pH 7.5, 25% (v/v) glycerol, 0.42 mMNaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM PMSF,0.5 mM DTT, 10 �g/ml leupeptin hemisulfate] andincubated in ice for 20 min, followed by the disruptionof nuclei by ultrasonic treatment The suspension wascentrifuged at 22,000g for 30 min and the clear super-natant was dialyzed overnight against 100 ml buVer D[20 mM Hepes pH 7.5, 20% (v/v) glycerol, 0.1 mMKCl, 0.2 mM EDTA, 0.5 mM PMSF, 0.5 mM DTT,10 �g/ml leupeptin hemisulfate]. The crude nuclearextract was stored in aliquots at ¡80°C and the proteinconcentration was determined according to the methodof Bradford (1976).

123

432 Planta (2007) 226:429–442

Preparation of the wild-type and mutated cis-elements

DNA probe of about »70 to »130 bp were preparedby PCR ampliWcation using speciWc primer pairsdesigned for each motif from RSs1 and rolC promotersequences. PCR was performed in 50 �l of reactionmixture using Pfu DNA polymerase (MBI Fermentas,Hanover, MD, USA) as follows: one cycle at 94°C for5 min, 30 cycles comprising 1 min at 94°C, 1 min atannealing temperature, 1 min at 72°C and a Wnal exten-sion at 72°C for 7 min. The ampliWed product was puri-Wed using the PCR puriWcation kit (Qiagen, Valencia,CA, USA). The oligonucleotide primes used to amplifydiVerent motifs are listed below.

RSs1 BoxII f1 5� TGCTTTATTTCCCTCTTG 3�RSs1 BoxII r1 5�ACTGCAGGTGGTAGACT 3�RSs1 BoxII f2 5� TGATTAGTGACACCATCAG 3�RSs1 BoxII r2 5� TAGTGGTAGGGCCTTTCA 3�RSs1 ASL f 5� TGAAATCCACCAAATCAAAC 3�RSs1 ASL r 5� ATGAAAAGAAAGCAAGAGA 3�RSs1 GATA f 5� TCTCCAAAGCTGACAATGGTG 3�RSs1 GATA r 5� TCAAAATTGTAGTGGGTTGG 3�RSs1 13 bp f 5� TTGTAGAAGTCTACCACC 3�RSs1 13 bp r 5� ATCCTATTAGCATATGCC 3�rolC ASL f 5� GAACCTATTCCCTCACGT 3�rolC ASL r 5� TCGATGCTCCACGTCGCCT 3�rolC 13 bp f 5� GCAGTTAGCCTAAGAA 3�rolC 13 bp r 5� CACAGCTGGCAATTTA 3�rolC GATA f 5� TATCTATGCCAAAATGAT 3�rolC GATA r 5� AGCAGGTTCTCCAAAACC 3�rolC ocs f 5� TGGGTGCAAAACTATTAT 3�rolC ocs r 5� GTACATGGCCACCATTCCT 3�rolC SE2 f 5� GTTGAATAAATTATTCCA 3�rolC SE2 r 5� AAACTCAGAAACAGAGA 3�rolC RSE f 5� AGCTTAGCGAAAGGATGT 3�rolC RSE r 5� GTATCTTGAATGCAGCAATCT 3�rolC LRE f 5� CGTGAAGATTGCTGCATTCA 3�rolC LRE r 5� GGCATAGATAATTTCCGCA 3�

For competition assay, wild type and mutated oligo-nucleotides of about 30–60 bp were synthesized foreach motif (Sigma Genosys, Sigma, St. Louis, MO,USA). PCR ampliWed DNA fragments were 5� endlabelled with �-32P ATP (111 GBq, PerkinElmer, Wal-tham, MA, USA) using T4 polynucleotide kinase (Pro-mega, Madison, WI, USA).

Electrophoretic mobility shift assay

EMSAs were performed as described by Allen et al.(1989) using gel shift assay system kit (Promega) in avolume of 20 �l containing 1£ gel shift binding buVer[10 mM Tris–HCl pH 7.5, 50 mM NaCl, 0.5 mMEDTA, 1 mM MgCl2, 5 mM DTT, 4% (v/v) glycerol,50 �g/ml poly (dl-dC) poly (dl-dC)] plus 20 �g oftotal nuclear protein from rice, tobacco and chick-pea following the manufacturer’s instructions. For

competition analyses, 5 ng (10£) and 25 ng (50£) ofunlabelled wild-type and mutated double-strandedcompetitor DNA was added before adding thelabelled probe. After incubation, 2 �l of 10X gelloading buVer [250 mM Tris–HCl, pH 7.5, 40% (v/v)glycerol, 0.2% (w/v) bromophenol blue] was addedand loaded on 4% (v/v) non-denaturing polyacryl-amide gels and subjected to electrophoresis at 100 Vfor 1 h in 0.5£ TBE (1£ TBE = 89 mM Tris–borate,pH 8.0, 2 mM EDTA). The gels were Wxed in 10% (v/v)acetic acid and 10% (v/v) methanol for 15 min, driedand exposed to X-ray Wlm for 12–24 h and Wnallydeveloped.

Plant transformation

Transformation of rice and tobacco were performed asdescribed by Saha et al. (2006) and Dutta et al.(2005b), respectively. Mature seed-derived scutellarcallus of rice and leaf discs of tobacco were infectedwith A. tumefaciens strain LBA4404 harbouringpCAMBIA-ASAL, 35S-ASAL, RSs1-ASAL and rolC-ASAL. The regenerated shoots were developed in amedium containing 50 mg/l hygromycin and 250 mg/lcefotaxime, as described by Saha et al. (2006) andDutta et al. (2005b), respectively. The primary trans-formants were maintained in a hormone-free mediumin sterile culture and subsequently grown to maturity insoil. Chickpea transformation was carried out using A.tumefaciens strain LBA4404 carrying chimeric ASALgene cassette in pCAMBIA2301-ASAL and single cot-yledon with half embryo explant prepared from sur-face-sterilized, overnight-soaked germinated seeds.Transgenic plants were regenerated according to theprotocol optimized by Chakraborti et al. (2006a).Regenerated shoots were selected with 100 mg/l kana-mycin. The primary transformants veriWed throughPCR and Southern-blot analyses following the proto-col of Saha et al. (2006) and Chakraborti et al. (2006b)were designated as T0 plants. These plants wereallowed to self-fertilize and plants derived from theseseeds were designated as T1 plants.

Western-blot analysis and enzyme-linked immunosorbent assay

Western-blot analysis of transgenic total leaf proteins(»10 �g) was carried out following the method of Duttaet al. (2005b) and Saha et al. (2006). The electroblottedmembrane was probed with anti-ASAL polyclonal pri-mary antibody and anti-rabbit IgG-horse radish peroxi-dase (HRP) conjugate as secondary antibody (Sigma).Bound secondary antibodies were detected by

123

Planta (2007) 226:429–442 433

enhanced chemiluminescence (ECL) reagents (Amer-sham Biosciences, Pittburgh, PA, USA).

Quantitative level of ASAL expression was deter-mined by ELISA as described by Dutta et al. (2005b)and Saha et al. (2006). Approximately, 10 �g trans-genic protein coated wells were blocked with 5% (w/v)non-fat milk (Merck, Whitehouse Station, NJ, USA) inPBS for 2 h at 37°C. The wells were subsequently incu-bated with anti-ASAL primary antibody in PBS for 1 hat 37°C and HRP conjugated anti-rabbit antibody inPBS for 1 h at 37°C. Washing was performed followingthe standardized protocol (Dutta et al. 2005b; Sahaet al. 2006). The reading of the colour solution afterreaction with O-phenylenediamine hydrochloride(OPD; BRL, Houston, TX, USA) substrate in the mic-rotitre plate was recorded at 415 nm in a plate reader(BioRad, Hercules, CA, USA).

Immunohistochemical and immunohistoXuorescence analysis

Localization of ASAL in transgenic plants was carriedout according to the method of Dutta et al. (2005a).Hand sections (stem and leaves) of plants transformedwith promoterless and promoter-ASAL constructs wereincubated in 10% (v/v) trichloroacetic acid (TCA) at4°C for 1 h and then treated with ethanol:acetic acid(3:1, v/v) with three to four changes until all thechlorophyll was removed. They were then incubatedsuccessively from absolute alcohol to water through90, 70, 50 and 30% (v/v) steps, respectively, each of15 min duration and kept in blocking solution [3%(w/v) bovine serum albumin (BSA) in 1£ phosphatebuVered saline (PBS)] at room temperature for 2 h.Anti-ASAL primary antibody at 1:10,000 dilutionswas added to 1 ml blocking solution and incubatedovernight.

For immunohistochemical analysis, the sections werewashed in 1£ PBS four times, followed by incubation insecondary antibody (HRP conjugated anti-rabbit anti-body) at 1:20,000 dilutions for 2 h and subsequentlywashed. Finally, these were incubated in a solution of4 mg of 3, 3�-diaminobenzidine tetrahydrochloride(DAB, Sigma) in 5 ml of 1£ PBS supplemented with5 �l hydrogen peroxide till colour appeared andobserved under stereomicroscope (Leitz Biomed).

ImmunohistoXuorescence localization of ASAL intransformed leaf tissue sections was performed follow-ing the method of Yin et al. (1997b). The sections wereincubated with anti-rabbit IgG-biotin conjugated sec-ondary antibody (Sigma) at 1:1,000 dilutions in 1 mlPBS for 2 h followed by incubation in avidin–Xuores-cein isothiocyanate (FITC) conjugate (Sigma) at 1:200

dilutions in 1 ml PBS. The sections were washedaccording to the manufactures’s protocol and observedwith an Axioskope 2 Xuorescence microscope (Zeiss)using excitation Wlter (set 1) of 450–490 nm for FITCand the photographs were recorded.

Insect bioassay of transgenic plants

To examine the insecticidal activity of ASAL on T0transgenic plants, in planta bioassay of tobacco againstM. persicae was carried out following Dutta et al.(2005b). For chickpea bioassay against A. craccivora,for each set of experiment, 20 nymphs (second instar)were collected from cultured stock (reared on controlchickpea plants) and kept on the ventral surface of theleaXets of twigs of 30-day-old plants. The insects-con-taining twig was inserted inside transparent cylindricalplastic cages (diameter 6.5 cm; length 7 cm) and the lidwas closed by cotton plugging. Three such cages wereused per individual plant with three replica experi-ments for the individual line. The mortality and thefecundity of insects within the cage were monitored atintervals of 24 h up to 72 h. Statistical unpaired t testswere conducted to compare the signiWcance of diVer-ences between control and treatments for both theinsect bioassay experiments.

Results

IdentiWcation of potential cis-elements involved in phloem-speciWc ASAL gene expression from RSs1 and rolC promoters

Computer-assisted motif search of the RSs1 promoterrevealed Wve potential cis-elements, BoxI, BoxII,ASL box, GATA and the 13 bp conserved motifs thatare important for phloem-speciWc expression(Fig. 1a). A close examination of the RSs1 promotersequence disclosed the presence of one BoxI motif at+12 to +23 bp downstream and three BoxII motifs at¡49 to ¡33, ¡143 to ¡128 and ¡611 to ¡599 bpupstream to the transcription start site (+1). TheBoxII motif contains CCA and/or TGG repeatsequence with CCCC core sequence similar to that ofother phloem-speciWc promoters (Table 1). The ASLbox contains GCAGA, GCATC repeat sequence at¡662 to ¡638 bp (Fig. 2a). The third element respon-sible for phloem-speciWc gene expression identiWed inRSs1 is the GATA motif at ¡484 to ¡476 bp resem-bling conserved A (N3) GATA sequence of otherphloem-speciWc promoters (Table 1). Another 13 bpconsensus sequence motif at ¡552 to ¡540 bp in relation

123

434 Planta (2007) 226:429–442

to transcription start site has been identiWed in RSs1promoter, which remains a highly consensus sequenceamong several other reported phloem-speciWc promoters(Table 1).

The sequence comparison and the motif search ofthe rolC with other phloem-speciWc promoters identi-Wed the presence of ASL box, GATA, 13 bp conservedmotif, ocs element, SE2 (stem element), RSE (root-speciWc element) and LRE (light-responsive element)or GT potential phloem-speciWc cis-acting motifs in

rolC promoter also (Fig. 1a). The ASL box containsGCAGG, GCACA and TTCTATATTC conservedsequences at ¡198 to ¡173 bp upstream (Fig. 2b). AGATA motif at ¡635 to ¡627 bp has also beendetected on rolC promoter (Table 1). At least two13 bp conserved motifs are located at ¡447 to ¡435 bpand ¡644 to ¡632 bp and three 16 bp palindromic ocselements are present at ¡160 to ¡141, ¡428 to ¡409and ¡502 to ¡483 bp regions (Table 1). Additionally,we found a signiWcantly similar SE2 (negative regula-tory element) and an RSE (positive regulatory ele-ment) elements located at ¡571 to ¡546 bp and ¡881to ¡858 bp upstream region of the rolC promoter,respectively (Table 1). A light responsive element(LRE) or GT cis-acting DNA element has also beenidentiWed at ¡790 to ¡777 bp on the rolC promoter(Table 1).

Nuclear factors binding activity with cis-elements of RSs1 and rolC promoters

Multiple cis-elements were derived through PCRampliWcation using sequence-speciWc primers. ThePCR ampliWed wild-type and the synthetic annealedoligonucleotides containing wild-type and mutatedelements (Fig. 2a, b) were used in EMSAs and incompetition assays to deWne speciWc binding of hosttrans-factors from rice, tobacco and chickpea. Increasingamounts of nuclear protein extracts were added to therespective cis-element probes to determine the exact

Fig. 1 Schematic diagram and the location of cis-elements on thepromoter fragment of chimeric ASAL gene cassette within the T-DNA region. a RSs1 and rolC promoter fragments with their po-tential phloem-speciWc cis-elements represented by boxes; b mapof the pCAMBIA1301/ 2301 35S/RSs1/rolC-ASAL chimeric genecassettes used for plant transformation. CaMV35S/RSs1/rolCpromoters respectively; marker, hygromycin (hpt)/kanamycin(npt) resistance gene; reporter, �-glucuronidase (GUS) gene;nosT, nos terminator; RB, T-DNA right borders; LB, T-DNA leftborders. The respective restriction endonuclease sites for cloningare indicated

Table 1 Indication of sequence and position of potential cis-elements in phloem-speciWc RSs1 and rolC promoters

Nucleotides conserved within the motif are shaded with a bold and underlined. The position of sequence relative to TATA box and theirfunction are indicated. The characterized and non-characterized potential cis-elements and nuclear factors binding to each of the ele-ments with their function are indicated by name and question mark (?), respectively. See text for detailed cis-elements and function.ABF, ASL box binding factor (Yin et al. 1997a); R-GATA, rice GATA (Yin et al. 1997a); ASF-1, activation sequence factor-1 (Frommet al. 1989); GT-1, GT binding factor (Gilmartin et al.1990); RNFG2, rice nuclear factor group2 (Yin et al.1997b)

Promoters cis-element Sequences Distance from TATA box

Function Binding factor

RSs1 BoxII TCATCCCCAACCA ¡590 to 578 Phloem RNFG2TTAAACCCCAATAGGT ¡122 to 107CTCGTGACCCCAAAACG ¡28 to 12

RSs1 ASL box GCAGA(N)15GCATC ¡641 to 617 Phloem ABFrolC ASL box GCAGG(N)16GCACA ¡143 to 118 Phloem ABFRSs1 GATA AATAGGATA ¡463 to 455 Phloem R-GATArolC GATA AACACGATA ¡580 to 572 Phloem R-GATARSs1 13 bp ATAATAAGATGTC ¡531 to 519 Phloem ?rolC 13 bp TTAAGAGACCCTA ¡392 to 380 Phloem ?

TTAAGCGATTATG ¡589 to 577 Phloem ?rolC ocs CTACGCCGACAGCTACGAGG ¡105 to 86 Phloem ASF-1

TAACGGTCGACACAACGAAA ¡373 to 354 Phloem ASF-1TGACGATAAGCGGGACGAAT ¡447 to 428 Phloem ASF-1

rolC SE2 CCCACTAAACTAGTGTAAATTTGGCA ¡516 to 491 Phloem ?rolC RSE GCGGGCCAACTTTAAGCTTTACCC ¡826 to 803 Phloem ?rolC LRE/GT TTCTGGTTAAGATG ¡735 to 722 Phloem GT-1

123

Planta (2007) 226:429–442 435

titre of the host factors required for eVective binding(Fig. 2c). Competitive inhibition of binding was alsodetermined using wild-type and mutated cis-elements(Fig. 2d).

To analyse the binding activity of BoxII, ASL boxand GATA motifs to the host trans-factors in the con-text of phloem-speciWc gene expression by RSs1 pro-moter, mutations were introduced into each of theelements and allowed to interact with the nuclearextract (Fig. 2a). Figure 3a shows the binding of tran-scription factors from rice, tobacco and chickpea in anEMSA, using PCR ampliWed ¡636 to ¡535 �-32Plabelled BoxII probe. Competition assays using boththe wild-type BoxI and BoxII unlabelled DNA frag-ment clearly revealed that only wild-type BoxII motifcompetes for binding of nuclear factors in all the threeplant nuclear extracts, while mutated BoxII motif(BoxIIm) failed to compete with the binding of corre-sponding nuclear factors (Fig. a). When a DNA frag-ment containing nucleotides ¡693 to ¡607 bp was usedas a probe, two complexes were observed that com-peted with the wild-type ASL box, but not with themutated ASL (ASLm) box (Fig. 3b). Similarly, com-plexes were detected when ¡516 to ¡421 bp GATA

motif was used as a probe. The binding of nuclear fac-tor was eVectively reduced when the wild-type coldGATA motif was used as a competitor at 10£ concen-tration and completely lost at 50£ concentration in thereaction mixture (Fig. 3c).

All the wild-type and mutated (13 bpm, ocsm,SE2m, RSEm and LREm) motif sequences of rolCpromoter are shown in Fig. 2b. To identify protein fac-tors interacting with the 13 bp conserved motif of rolCpromoter, gel-retardation assays were carried out.PCR ampliWed DNA fragment from ¡488 to ¡417 bpcontaining 13 bp motif was labelled with �-32P ATPand incubated with nuclear extracts from rice, tobaccoand chickpea. A single retarded band was observedfollowing electrophoresis indicating the formation ofa DNA–protein complex. Sequence speciWcity wasassessed by adding unlabelled speciWc competitorDNA motif in the binding reactions. Binding is mark-edly reduced with 10£ (5 �g) or abolished with 50£(25 �g) of unlabelled motif (Fig. 4a). Two retardedbands (upper and lower) were observed in EMSA ofthe complex using 95 bp (¡550 to ¡455 bp) fragmentcontaining rolC ocs-element and nuclear extracts fromrice, tobacco and chickpea plants. The speciWcity of this

Fig. 2 Wild-type and mutated RSs1 and rolC promoter cis-ele-ments used in in vitro DNA-protein binding and competitionexperiments with rice and tobacco nuclear extracts. a The se-quences of wild-type and mutated RSs1 promoter elements withtheir changed nucleotides in the mutated sequence are under-lined. b The sequences of wild-type and mutated rolC promoterelements with their changed nucleotides in the mutated sequence

are underlined. c RSs1 BoxII probe binding activity with increas-ing amounts of nuclear protein (0.5–20 �g) from rice. d Competi-tion experiments of labelled rolC ocs element probe (0.5 �g) afterbinding of nuclear protein extracts (20 �g) from tobacco withincreasing amounts of unlabelled ocs element (0.5–50 �g) in anEMSA. The free probe and retarded bound probe (DNA–proteincomplex) are indicated as FP and BP, respectively

123

436 Planta (2007) 226:429–442

interaction was further demonstrated using wild-typecompetitor cold ocs-element, which competed with thewild-type probe and prevented the formation of bothretarded complexes (Fig. 4b). Moreover, EMSAs usingSE2 and RSE motifs revealed single retarded band inall three plant nuclear extracts with wild-type SE2 andRSE probes, respectively (Fig. 5a, b). SpeciWcity of theprobe was also assessed by using unlabelled wild-typeand mutated synthesized RSE and SE2 motif competi-tor DNA in the binding experiment. No retarded bandwas observed in the competition assay using wild-typecompetitor DNA at 10£ concentration, whereas bind-ing was evident using mutated competitor SE2m andRSEm probes, respectively (Fig. 5a, b). Similar resultswere obtained in the gel-retardation assays using ¡708to ¡827 bp rolC probe containing the GT/LRE con-served motif (Fig. 5c).

Production of transgenic plants

To investigate the phloem speciWcity of the RSs1 androlC promoters in transgenic plants, approximately10–12 primary transgenic plants were producedwith pCAMBIA-ASAL (promoterless construct) 35S-ASAL, RSs1-ASAL and rolC-ASAL gene constructs(Fig. 1b). Each of the DNA construct was introducedinto rice, tobacco and chickpea by an Agrobacterium-mediated transformation technique. The GUS-express-ing (not shown) and ASAL-positive independent singlecopy transgenic lines detected through PCR andSouthern-blot analyses (not shown) from the threeplant types were selected for analyses. All the trans-genic plants were morphologically similar to untrans-formed controls with respect to Xowering and seedsetting.

Expression of ASAL in transgenic plants

Western-blot analysis using transgenic leaf proteinextracts showed the presence of a 12 kDa polypep-tide in the protein extracts, which corresponds to thepuriWed native ASAL (Fig. 6a, lane PC). Con-versely, no such band was observed in the untrans-formed control plant (Fig. 6a, lane NC). Quantitativeestimation of expressed ASAL driven by all the pro-moters used in this study is summarized in Fig. 6b.The CaMV35S promoter-derived plants showedmuch higher level of expression (9.3 ng/�g of totalsoluble protein §0.5) than rolC promoter (3.6 ng/�gof total soluble protein §0.3), while the expressiongoverned by RSs1 promoter showed relatively lessamount of ASAL (1.0 ng/�g of total soluble protein§0.1) in the total leaf soluble protein of transgenicplants.

Fig. 3 Binding proWles of nuclear extracts from rice, tobacco andchickpea with wild-type and mutated cis-elements of RSs1 pro-moter in EMSAs. a An EMSA proWle using �-32P labelled oligo-nucleotides probe containing the RSs1 BoxII promoter fragmentand wild-type BoxI, BoxII and mutated BoxIIm as competitors(£10 and £50 excess relative to the labelled probe) with 20 �g of

nuclear extracts; b an EMSA proWle using �-32P labelled RSs1promoter fragment containing ASL box; c binding of wild-type ormutated �-32P labelled RSs1 promoter GATA motif with nuclearextracts from rice, tobacco and chickpea in an EMSA. The FP andBP are indicated. R, N, C denote rice, tobacco and chickpea,respectively

Fig. 4 Binding proWles of nuclear extracts from rice, tobacco andchickpea with wild-type and mutated rolC promoter elements. aOligonucleotides containing the wild-type and mutated 13 bp mo-tifs were used as probe or competitors in binding with nuclearprotein in an EMSA; b binding patterns of �-32P labelled wild-type and mutated rolC ocs as probe and competitors (£10 and£50 excess relative to the labelled probe) with rice, tobacco andchickpea nuclear extracts in an EMSA. The positions of the freeprobe (FP), lower retarded band (LB) and upper retarded band(UB) are shown. The FP and BP are indicated. R, N, C denoterice, tobacco and chickpea, respectively

123

Planta (2007) 226:429–442 437

In situ detection of expression patterns of ASAL in transgenic plant

The spatial expression patterns of RSs1 and rolCpromoters were determined by in situ localization ofASAL in various TCA-Wxed tissue sections of trans-genic plants derived from RSs1-ASAL and rolC-ASALconstructs using anti-ASAL antibodies (Figs. 7, 8).Immunohistochemical localization of ASAL in the stem

sections of transgenic tobacco developed with RSs1-ASAL, detected ASAL accumulation in phloem cellsand other non-ligniWed vascular tissues (Fig. 7d).Expression of ASAL was also detectable in lesseramount in the epidermal cells (Fig. 7h). However, rolCpromoter drives the expression of ASAL actively in thephloem tissue, epidermis and trichomes of stem oftransgenic tobacco and chickpea (Fig. 7c, g, k). The tis-sue sections of diVerent leaf blades gave identicalresults. ImmunohistoXuorescence examination of leaftissue sections of RSs1-ASAL transgenic rice plantsshowed the unique ASAL expression in phloem com-panion cells with higher intensity (Fig. 8f) compared toimmunohistochemical analysis (Fig. 8e). In contrast tothe tissue-speciWc expression observed by immunohis-tochemical analysis in rice and tobacco containing theRSs1-ASAL, the immunohistoXuorescence analysis ofrolC-ASAL transgenic rice leaf sections revealed thepresence of ASAL in the phloem parenchyma, compan-ion cells, sieve elements, cortical cells, epidermal cellsand trichome cells (Fig. 8h). Leaf and stem sections of35S-ASAL plants showed a non-speciWc pattern ofASAL accumulation with uniform staining distributedin all the tissue types in both the in situ detection tech-niques used (Figs. 7b, f, j, 8c, d). No ASAL accumula-tion was detected in any cell type of the uninfectedcontrol plants and/ or plants transformed with promo-terless ASAL construct (Figs. 7a, e, i, 8a, b).

EVect of ASAL expression on insect survival and fecundity

Bioassay for monitoring resistance in transgenicsagainst M. persicae and A. craccivora were carried outin planta using 20 nymphs of second instar (as initialinoculum). The insect mortality was recorded at 24 hintervals up to 72 h (Fig. 9). T0 tobacco and chickpeatransformants, 30-days-old, expressing ASAL showed

Fig. 6 Determination of ASAL expression in transgenic plants. aWestern blot analysis of the leaf extracts from transgenic and un-transformed control plants. Lane PC, 1.5 �g of puriWed ASALfrom garlic leaves; lane NC, crude protein from untransformedrice plant; b quantitative estimation of ASAL in transgenic rice,tobacco and chickpea derived from CaMV35S, RSs1 and rolCpromoters by ELISA. The bars represent the mean level ofASAL per �g of total soluble protein + SE (n = 10). ELISA read-ing represented after subtracting the background readings fromuntransformed and transformed plants with promoter-less ASALgene construct

Fig. 5 Binding proWles of nuclear extracts from rice, tobacco andchickpea with wild-type and mutated rolC promoter elements. aAn EMSA proWle using rolC SE2 promoter fragment and nuclearprotein showing single DNA-protein complexes (retarded boundprobe); b gel retardation assays with rolC RSE probe and wild-

type and mutated competitor DNA; c an EMSA proWle usingrolC LRE/GT motif and mutated LREm as competitors. Bound(BP) and free (FP) probe are indicated. R, N, C denote rice, to-bacco and chickpea, respectively

123

438 Planta (2007) 226:429–442

signiWcant resistance to their respective aphids withminimal plant damage. The survivability of M. persicaeand A. craccivora were observed as 42 and 25% on35S-ASAL tobacco and chickpea plants, respectively,whereas the same on untransformed tobacco andchickpea plants were found to be 82 and 85% after 72 hof bioassay period. The RSs1-ASAL tobacco, rolC-ASAL chickpea plants exhibited a higher level of ento-motoxic eVect on the respective aphids compared to35S-ASAL plants (tobacco and chickpea). At the endof the bioassay period, the survivability of M. persicaeand A. craccivora on RSs1-ASAL, rolC-ASAL tobaccoand rolC-ASAL chickpea plants were noted to be 26,22 and 18.5%, respectively (Fig. 9c). The larvicidal andlarvistatic eVect of transgenic plants expressed ASALon M. persicae and A. craccivora nymphs were moni-tored by counting the total nymphs produced by theadult insects at the end of the bioassay period on trans-formed and untransformed control plants. After 72 hthe populations of M. persicae and A. craccivora on

tobacco RSs1-ASAL, rolC-ASAL and chickpea rolC-ASAL plants were reduced by 67.9, 70.5 and 79.5%,respectively (Fig. 9f) with respect to untransformedcontrol plants (tobacco and chickpea). The fecundityof the same aphid was reduced by 46.6 and 57.2% onthe 35S-ASAL tobacco and chickpea plants, respec-tively. Both the insects fed less on the respective trans-genic plants, and most of the time they moved on theinner cage wall compared to controls, where theyremained attached to the lower leaf surface. The sur-vivability and fecundity of both the aphids were signiW-cantly (P < 0.05) lower on transgenic plants throughoutthe bioassay period compared to respective controllines (t test).

Discussion

Phloem tissue-speciWc promoters represent useful con-trollers of the target protein expression in the phloem

Fig. 7 Immunohistochemical localization of ASAL in the trans-verse stem sections of transgenic tobacco and chickpea plantscontaining RSs1-ASAL and rolC-ASAL constructs. Sectionswere treated with anti-ASAL primary antibody and HRP-conju-gated secondary antibody. The presence of ASAL is indicated bythe insoluble red colour product with orange/brown colour stain-ing in the ligniWed tissue. a, e, i Untransformed control and plant

transformed with p-ASAL (promoterless ASAL) showed no redstaining due to absence of ASAL; b, f, j 35S-ASAL plants show-ing uniform colouration due to constitutive ASAL expression inall the cell types; c, g, k rolC-ASAL plants showing localization ofASAL in the phloem cells, epidermis and trichomes; d, h RSs1-ASAL plants showing the presence of ASAL in phloem cells andnon-ligniWed vascular cells

123

Planta (2007) 226:429–442 439

tissue for its loading in the phloem sap. Understandingof such promoter function is an important issue in plantbiotechnology. Therefore, in silico identiWcation ofphloem-speciWc promoter cis-elements followed byin vitro interactions between cis-elements and hosttrans-factors have been considered to be useful studiesfor elucidating the in vivo mechanisms of tissue-speciWcpromoter activity. In the present study, RSs1 and rolC

promoters were selected, which have shown earlier thephloem-speciWc expression of GUS in transgenictobacco (Sugaya et al. 1989; Shi et al. 1994). Severalpositive and negative cis-acting promoter elements ofRSs1 and rolC were identiWed through sequence com-parison with earlier described vascular-speciWc pro-moters, which actually determined the underlying roleof phloem speciWcity (Fig. 1). Phloem-speciWc cis-ele-ments, namely, BoxII, ASL box, GATA motif and13 bp conserved motifs were detected in RSs1 pro-moter and ASL box, GATA, 13 bp conserved motif,ocs element, SE2, RSE and LRE or GT cis-actingmotifs were found in rolC promoter (Table 1). Thecombinatorial interactions of multiple elements deter-mining tissue speciWcity have earlier been documentedwell in plants (Keller and Baumgartner 1991; HauVeet al. 1993; Hatton et al. 1995). Previous studies indi-cated that phloem-speciWc gene expression might bedue to interactions between positive cis-elements only,whereas synergistic and/or additive interactions of mul-tiple positive and negative cis-elements conferred vas-cular speciWcity (Yin et al. 1997a, b). The delineation ofseveral distinct cis-acting elements with clearly deWnedproperties in the RSs1 and rolC promoters allowed thecharacterization of individual regulatory elements indiVerent sequence contexts, as well as the search fortrans-acting factors that bind to these sequences.

Several transgenic rice, tobacco and chickpea plantsexpressing ASAL regulated by the above-mentionedpromoters were developed using Agrobacterium-medi-ated transformation technology. To eliminate theproblem of variation in transgene expression level dueto the so-called “copy number eVect”, we have selectedthe single copy transgene bearing lines. Stable, consis-tent and spatial ASAL expression pattern in transgenicplants were monitored by Western blot, ELISA andin situ localization studies (Figs. 6, 7, 8). The overalllevel of expression of ASAL regulated by the rolC pro-moter was higher than the one regulated by the RSs1promoter (Fig. 6b). A similar result was reported byGraham et al. (1997) using Sh1 and rolC promoters intransgenic potato. However, in the present investiga-tion we have observed variations in ASAL expressionlevel in diVerent transgenic lines, which can be attrib-uted to the so-called “position eVect” (Matzke andMatzke 1998).

The immunohistochemical study elucidated the pat-tern of ASAL expression by RSs1 promoter in non-lig-niWed vascular tissue of all three plant systems tested,which is similar to the previous record with RSs1-ASAL (Dutta et al. 2005a) and RSs1-GNA (Shi et al.1994; Rao et al. 1998; Sudhakar et al. 1998). Further-more, using immunohistoXuorescence analysis, ASAL

Fig. 8 In situ localization of ASAL in the leaf transverse sectionsof transgenic rice plants using immunohistochemical and immu-nohistoXuorescence analyses. Sections were incubated withanti-ASAL as primary antibody and HRP conjugated and/oranti-rabbit IgG-biotin conjugated secondary antibody. The pres-ence of ASAL is indicated by the insoluble red colour productand/or green Xuorescence. a, b Absence of ASAL in leaf sectionsof untransformed control and plant transformed with p-ASAL(promoterless ASAL); c, d constitutive ASAL expression from35S-ASAL plants; e, f ASAL accumulation pattern in RSs1-ASALplants; g, h ASAL accumulation pattern in rolC-ASAL plants

123

440 Planta (2007) 226:429–442

expression in the epidermal cells of the leaf blade ofrice was also observed, which corroborated with theimmunohistochemical data of Sudhakar et al. (1998).RSs1 promoter has been reported previously to strictlydirect gene expression in sieve elements and compan-ion cells of the phloem tissue (Shi et al. 1994). In thepresent observation, apart from phloem cells, the rolCpromoter also drives ASAL expression in trichomecells, which is in accordance with GUS expression pat-tern under the control of rolC promoter documentedby Graham et al. (1997). The detectable ASAL expres-sion in trichomes of rolC-ASAL plants in all the threeplant types suggested the active role of rolC ocs ele-ment. Our in situ ASAL localization data is quite simi-lar to the observations of Matsuki et al. (1989) andSugaya et al. (1989), who reported that rolC promoterdirected the gene expression in phloem parenchymaand bundle sheath cells in addition to sieve elementsand companion cells. Thus, the rolC-driven expressiontakes place in a more vascular (phloem > xylem) tis-sue-speciWc manner than the RSs-regulated expression,which is strictly conWned to the phloem tissue. Uniformaccumulation of ASAL observed in the present 35S-

ASAL plants reiterates the constitutive nature ofCaMV35S promoter.

In our earlier studies, we have shown that the trans-genic rice (cv. IR64), tobacco and mustard plants,constitutively expressing ASAL, exhibited substantialresistance against the phloem feeding by N. lugens,N. virescens (Saha et al. 2006), Lipaphis erysimi(Dutta et al. 2005a) and M. persicae (Dutta et al.2005b), respectively. In the current investigation,phloem-speciWc ASAL plants exhibited a relativelyhigher level of resistance against M. persicae and A.craccivora than 35S-ASAL plants. The transgenicRSs1-ASAL, rolC-ASAL tobacco plants exhibited»16%, »20% higher mortality and »21.3%, »23.9%less fecundity of M. persicae than the 35S-ASAL lines.The present study also demonstrates less amount ofASAL expression regulated by two phloem-speciWcpromoters compared to our earlier observation on35S-ASAL plants (Dutta et al. 2005b), albeit theycontributed to more mortality of M. persicae than35S-ASAL plants. Similarly, the survivability andfecundity of A. craccivora on rolC-ASAL chickpea plantswere reduced by »6.5 and 22.3% than on 35S-ASAL

Fig. 9 Insect bioassay setup and eVect of expressed ASAL on A.craccivora and M. persicae nymphs when fed on the untrans-formed control plant and the transgenic tobacco and chickpeaplants. a A. craccivora bioassay set up on transgenic chickpeaplant; b A. craccivora nympha feeding on the lower leaf surface ofchickpea plant; c mean survival of A. craccivora and M. persicaeon transformed and untransformed tobacco and chickpea plants;

d M. persicae bioassay set up on transgenic tobacco plant indi-cated by arrows in the Wgure; e M. persicae nymphs moving on theinner bioassay cage wall on tobacco plant; f mean number of A.craccivora and M. persicae nymphs on untransformed and trans-formed chickpea and tobacco plants. in three sets of replication,20 nymphs (second instar) were inoculated per plant. Points andbar show the mean § SE (n = 10)

123

Planta (2007) 226:429–442 441

plants. In the present work, we report for the Wrst timethe insecticidal and larvicidal eVect of ASAL on A.craccivora when fed on ASAL expressing transgenicchickpea plant. Such eVect of ASAL on M. persicae iscomparable with that of other lectins, such as Galan-thus nivalis agglutinin (GNA) and Helianthus tubero-sus agglutinin (HTA). Reduced fecundity andretarded development of aphids on transgenictobacco (Hilder et al. 1995) and potato (Gatehouseet al. 1996) plants expressing GNA had been reportedin the past. However, Chang et al. (2003) reportedthat the survival of aphid on transgenic tobacco wasnot signiWcantly aVected by HTA gene expression.Additionally, molecular mechanisms behind the ento-motoxic eVects of ASAL against hemipteran insectshave been well documented by our group (Bandyo-padhyay et al. 2001; Majumder et al. 2004). Bandyo-padhyay et al. (2001) and Majumder et al. (2004), byimmunohistochemical localization of ASAL in intoxi-cated aphids, demonstrated that ASAL binds to theinsect gut epithelial cells . Binding of ASAL to thebrush border membrane vesicle (BBMV) receptors ofL. erysimi (Banerjee et al. 2004; Dutta et al. 2005a),M. persicae (Dutta et al. 2005b) and N. virescens(Majumder et al. 2004; Saha et al. 2006) has also beenwell established.

In addition to developing enhanced resistance inprime food crops against hemipteran pests, the presentobservation provides evidence for the use of RSs1 androlC promoters in biotechnological programmes. Forexample, a number of plant viruses, such as luteovi-ruses, reoviruses and most geminiviruses, replicatedexclusively in phloem-associated tissue and were trans-mitted by hemipteran vectors. Phloem-speciWc expres-sion of an insecticidal gene, ASAL, toxic to hemipteranvectors is desirable because it directly controls thetransmission of plant viruses. Furthermore, phloem-speciWc gene expression may impose a decreased meta-bolic load on the plant. Thus, the introduction of thisnovel gene in a controlled manner into the germplasmof crops makes the trait available for conventionalbreeding programmes aimed at resistance against thehemipteran insects.

Acknowledgments This study has been partly implementedwith Wnancial contributions from the Swiss Agency for Develop-ment and Cooperation, Government of Switzerland and theDepartment of Biotechnology, Government of India under theIndo-Swiss Collaboration in Biotechnology. PS and ID are grate-ful to the Council of ScientiWc and Industrial Research, Govern-ment of India for providing fellowships. The help of Prof. BarbaraHohn and Dr. David Schuermann, FMI, Basel, Switzerland in theisolation of RSs1 promoter is sincerely acknowledged. The sup-port of Bose Institute is greatly acknowledged.

References

Allen RD, Bernier F, Lessard PA, Beachy RN (1989) Nuclearfactors interact with a soybean �-conglycinin enhancer. PlantCell 1:623–631

Bajaj S, Mohanty A (2005) Recent advances in rice biotechnol-ogy-towards genetically superior transgenic rice. Plant Bio-technol J 3:275–307

Bandyopadhyay S, Roy A, Das S (2001) Binding of garlic (Alliumsativum) leaf lectin to the gut receptors of homopteran pests iscorrelated to its insecticidal activity. Plant Sci 161:1025–1033

Banerjee S, Hess D, Majumder P, Roy D, Das S (2004) The iin-teractions of Allium sativum leaf agglutinin with a chapero-nin group of unique receptor protein isolated from abacterial endosymbiont of the mustard aphid. J Biol Chem279:23782–23789

Bradford M (1976) A rapid and sensitive method for the quanti-tation of microgram quantities of protein utilizing the princi-ple of protein-dye binding. Anal Biochem 72:248–254

Chang T, Chen L, Chen S, Cai H, Liu X, Xiao G, Zhu Z (2003)Transformation of tobacco with genes encoding Helianthustuberosus agglutinin (HTA) confers resistance to peach-po-tato aphid (Myzus persicae). Transgenic Res 12:607–614

Chakraborti D, Sarkar A, Das S (2006a) EYcient and rapidin vitro plant regeneration system for Indian cultivars ofchickpea (Cicer arietinum L.). Plant Cell Tiss Org Cult86:117–123

Chakraborti D, Sarkar A, Gupta S, Das S (2006b) Small and largescale genomic DNA isolation protocol for chickpea (Cicerarietinum L.), suitable for molecular marker and transgenicanalyses. Afr J Biotechnol 5:585–589

Dutta I, Majumder I, Saha P, Ray K, Das S (2005a) Constitutiveand phloem speciWc expression of Allium sativum leaf agglu-tinin (ASAL) to engineer aphid (Lipaphis erysimi) resis-tance in transgenic Indian mustard (Brassica juncea). PlantSci 169:996–1007

Dutta I, Saha P, Majumder P, Sarkar A, Chakraborti D, BanerjeeS, Das S (2005b) The eYcacy of a novel insecticidal protein,Allium sativum leaf lectin (ASAL), against homopteran in-sects monitored in transgenic tobacco. Plant Biotechnol J3:601–611

Foissac X, Loc NT, Christou P, Gatehouse AMR, Gatehouse JA(2000) Resistance to green leafhopper (Nephotettix vires-cens) and brown planthopper (Nilaparvata lugens) in trans-genic rice expressing snowdrop lectin (Galanthus nivalisagglutinin; GNA). J Insect Physiol 46:573–583

Fromm H, Katagiri F, Chua NH (1989) An octopine snthase en-hancer element directs tissue-speciWc expression and bindsASF-1, a factor from tobacco nuclear extracts. Plant Cell1:977–984

Gatehouse AMR, Down RE, Powell KS, Sauvion N, Rahbe Y,Newell CA, Merryweather A, Hamilton WDO, GatehouseJA (1996) Transgenic potato plants with enhanced resistanceto the peach-potato aphid Myzus persicae. Entomol ExpAppl 79:295–307

Graham MW, Craig S, Waterhouse PM (1997) Expression pat-terns of vascular-speciWc promoter RolC and Sh in trans-genic potatoes and their use in engineering PLRV-resistantplants. Plant Mol Biol 33:729–735

Gilmartin PM, Sarokin L, Memelink J, Chua N-H (1990) Molec-ular light switches for plant genes. Plant Cell 2:369–378

Hatton D, Sablowski R, Yung M-H, Smith C, Schuch W, BevenM (1995) Two classes of cis sequences contribute to tissue-speciWc expression of a PAL2 promoter in transgenic tobac-co. Plant J 7:859–876

123

442 Planta (2007) 226:429–442

HauVe KD, Lee SP, Subramaniam R, Douglas CJ (1993) Combi-natorial interactions between positive and negative cis-act-ing elements control spatial pattern of 4CL-1 expression intransgenic tobacco. Plant J 4:235–253

Hilder VA, Powell KS, Gatehouse AMR, Gatehouse J, Gate-house LN, Shi Y, Hamilton W, Merryweather A, Newell CA,Timans JC (1995) Expression of snowdrop lectin in trans-genic tobacco plants results in added protection againstaphids. Transgenic Res 4:18–25

Keller B, Baumgartner C (1991) Vascular-speciWc expression ofthe bean GPR 1.8 gene is negatively regulated. Plant Cell3:1051–1061

Maier UG, Brown JWS, Toloczyki C, Feix G (1987) Binding of anuclear factor to a consensus sequence in the 5� Xanking re-gion of zein genes from maize. EMBO J 6:17–22

Majumder P, Banerjee S, Das S (2004) IdentiWcation of receptorsresponsible for binding of the mannose speciWc lectin to thegut epithelial membrane of the target insects. Glycoconju-gate J 20:525–530

Matsuki R, Onodera H, Yamauchi T, Uchimiya H (1989) Tissue-speciWc expression of the rolC promoter of the Ri plasmid intransgenic rice plants. Mol Gen Genet 220:12–16

Matzke AJM, Matzke AM (1998) Position eVect and epigeneticsilencing of plant transgenes. Curr Opin Plant Biol 1:142–148

Rao KV, Rathore KS, Hodges TK, Fu X, Stoger E, Sudhakar S,Williams P, Christou P, Bharathi M, Bown DP, Powell KS,Spence J, Gatehouse A, Gatehouse JA (1998) Expression ofsnowdrop lectin (GNA) in transgenic plants confers resis-tance to rice brown planthopper. Plant J 15:469–477

Reddy SV, Kumar PL (2004) Transmission and properties of anew leutovirus associated with chickpea stunt disease in In-dia. Curr Sci 86:1157–1161

Saha P, Majumder P, Dutta I, Ray T, Roy SC, Das S (2006)Transgenic rice expressing Allium sativum leaf lectin with

enhanced resistance against sap-sucking insect pests. Planta223:1329–1343

Schmuelling T, Schell J, Spena A (1989) Promoters of the rolA,B, and C genes of Agrobacterium rhizogenes are diVeren-tially regulated in transgenic plants. Plant Cell 1:665–670

Sharma HC, Sharma KK, Crouch JH (2004) Genetic transforma-tion of crops for insect resistance: potential and limitations.Crit Rev Plant Sci 23:47–72

Shi Y, Wang MB, Powell KS, Damme EV, Hilder VA, GatehouseAMR, Boulter D, Gatehouse JA (1994) Use of the rice su-crose synthase-1 promoter to direct phloem-speciWc expres-sion of �-glucuronidase and snowdrop lectin genes intransgenic tobacco plants. J Exp Bot 45:623–631

Sogawa K (1994) Feeding behaviour and damage mechanism ofthe rice planthopper. In: Elings A, Rubai EG (eds) Analysisof damage mechanism by pests and diseases and their eVectson rice yield. Proceedings, SARP Res, Wageningen, pp143–154

Sudhakar D, Fu X, Stoger E, Williams S, Spence J, Brown DP,Bharathi M, Gatehouse JA, Christou P (1998) Expressionand immunolocalization of the snowdrop lectin, GNA intransgenic rice plants. Transgenic Res 7:371–378

Sugaya S, Hayakawa K, Handa K, Uchimiya H (1989) Cell-speciWc expression of the rolC gene of the TL-DNA of Riplasmid in transgenic tobacco plants. Plant Cell Physiol30:649–653

Yin Y, Chen L, Beachy R (1997a) Promoter elements requiredfor phloem-speciWc gene expression from the RTBV pro-moter in rice. Plant J 12:1179–1188

Yin Y, Zhu Q, Dai S, Lamb C, Beachy RN (1997b) RF2a, a bZIPtranscriptional activator of the phloem-speciWc rice tungrobacilliform virus promoter, functions in vascular develop-ment. EMBO J 16:5247–5259

123