CHARACTERIZATION OF THE INTESTINAL MICROBIOTA OF ...
Transcript of CHARACTERIZATION OF THE INTESTINAL MICROBIOTA OF ...
CHARACTERIZATION OF THE INTESTINAL
MICROBIOTA OF NATURAL POPULATIONS
OF Lutzomyia evansi: VECTOR OF VISCERAL
LEISHMANIASIS
Rafael José Vivero Gómez, Biologist; Ms.C
Universidad Nacional de Colombia
Sede Medellín
Sciences Faculty
2016
Gut of larvae L4 Gut of male Gut of female
Isolate 154 Isolate 151 Isolate 139
CHARACTERIZATION OF THE INTESTINAL
MICROBIOTA OF NATURAL POPULATIONS
OF Lutzomyia evansi: VECTOR OF VISCERAL
LEISHMANIASIS
Rafael José Vivero Gómez, Biologist; Ms.C
Thesis or presented (or) research as partial requirement to obtain the title of:
PhD in Biotechnology Science
Advisors Agronomist (Ph.D) Sandra I. Uribe Soto
Bacteriologist (Ph.D.) Claudia X. Moreno Herrera Bacteriologist (Ph.D.) Gloria E. Cadavid Restrepo
Investigation Groups Grupo de investigación en Sistemática Molecular
Microbiodiversidad y Bioprospección Programa de Estudio y Control de Enfermedades Tropicales (PECET-UdeA)
Universidad Nacional de Colombia
Sede Medellín Sciences Faculty
Colombia 2016
“A Dios, mi padres (Ana Cris y Jaime V), Mis sobrinos (Andrés, Cesar y Maria) y
hermanas (Viviana y Sandra), A mi Madrina, Mi esposa Susana Ochoa y Familia (Don
Valerio, Sra. Dora, Cuñis Juliana y Gladys)”
“To Maria Auxiliadora for her blessings.
To God, my parents (Ana Cris and Jaime V) my nephews and sisters (Viviana y Sandra),
my godmother (Norma Otero), my wife Susana Ochoa and her family ((Don Valerio, Sra.
Dora, Cuñis Juliana y Gladys)”
“Nada en el mundo sustituye a la Constancia.
El talento no la sustituye, pues nada es tan corriente como los inteligentes frustrados.
El genio tampoco, ya que resulta ser tópico el caso de los genios ignorados. Ni
siquiera la educación sustituye a la Constancia, pues el mundo está lleno de
fracasados bien educados. Solamente la Constancia y la Decisión lo consiguen
todo” Baltasar Gracián
ACKNOWLEDGEMENTS
I am very grateful to my advisors Dr. Sandra I. Uribe, Dr. Claudia Ximena Moreno Herrera
and Dr. Gloria Ester Cadavid Restrepo for their guidance, support, patience, advices and
knowledge imparted that helped me in every single step of this process.
I acknowledge the support for the entomological field sampling to members of Programa de
Estudio y Control de Enfermedades Tropicales (PECET) Universidad de Antioquia,
particularly Horacio Cadena and Andres Vélez Mira. Also to people from the Biomédicas
Research Group, Universidad de Sucre, Sincelejo, Colombia specially the professor Eduar
Bejarano, and students Luis Gregorio Estrada y Edgar D. Ortega that helped me with the
fieldwork in the two locations in the Sucre department.
I appreciate the support form different communities visited during the fieldwork in the
municipality of Ovejas and Colosó (department of Sucre) as they gave me access to their
facilities, providing hospitality and collaborating with fieldwork.
I am also grateful with Drs Iván Darío Vélez y Sara Robledo, from PECET, Universidad de
of Antioquia. Institutional support and research formation was always constant.
I acknowledge the support Financial Support: Administrative Department of Science,
Technology and Innovation (COLCIENCIAS code # 357-2011 U.T EICOLEISH -
“Comprehensive Strategy for the Control of Leishmaniasis”); Administrative Department of
Science, Technology and Innovation (National Call 528 for doctoral studies in Colombia,
2011). Also to Grupo de Microbiodiversidad y Bioprospección and Grupo de Investigación
en Sistemàtica Molecular, Universidad Nacional de Colombia, Sede Medellín. Both research
groups with infrastructure, laboratories and experience were crucial for this investigation.
A group of friends from the Sistemática Molecular group, especially to Alejandra Clavijo,
Manuela Gutierrez and Sebastian for their collaboration in logistic and entomological
aspects.
Also a group of friends from molecular biology PECET, especially to Didier and Gustavo
(Manitos) for their help and support.
l thank to my friends from Laboratorio de biología celular y molecular, Universidad Nacional,
as this laboratory and people working there, were of special significance in finishing this
work. People as Lina Silva, Andres Londoño, Luisa Montoya, Natalia Gil, Monica Higuita,
José Rangel, Maria Andrea García, Duvan, Viviana among others were key people during
my work in that laboratory.
The unconditional support of Wilson Guerrero Castro in this laboratory is appreciated. The
doctoral program biotechnology and administrative people were so helpful.
ABSTRACT
Lutzomyia evansi (Diptera: Psychodidae) is a phlebotomine “sandfly” insect endemic to the
Caribbean coast of Colombia with epidemiological significance for being the main vector of
leishmaniasis disease, which is caused by Leishmania spp parasites. Sand flies (164
species in Colombia) in general are able to transmit other parasites as Bartonella spp, and
virus mostly from vesiculovirus group, affecting human and animal health.
This group of insects has been studied in Colombia in relation to vectorial role, geographical
distribution and epidemiological importance, but vaccine absence for the most important
disease they transmit (leishmaniasis) encourage the implementation of vector control
measures as key factor for the disease control. In this sense entomological surveillance and
prevention measures have been implemented but most of the time in transmission episodes
is frequently invested in taxonomical work.
In spite of the importance of phlebotomine sand flies and the necessity of their control, very
few studies exist in Colombia and in general in America, related to their biology, ecology or
many other basic aspects, which are relevant for their diminishing or control.
Biological control of insect vectors or the parasites or pathogens they transmit is a topic of
research actually addressed by academic and scientific points of view and encouraged by
health authorities given difficulties as insecticide resistance and costs for traditional
methods. For Lutzomyia spp., sand flies, this is one basic study providing, basic information
about microbial communities (bacteria) associated to their biological stages (larvae, pupa
and adult) and evaluating as basic line of evidence, potential effects of some of them on
Lesihmania.
Although Lu evansi and in general sandflies can harbor pathogenic and non-pathogenic
microorganisms in their guts, there is little knowledge related to the intestine ecology and to
the bacterial diversity present in the gut of wild populations. Presence of some bacteria
including Wolbachia spp is of significance and may encourage further investigation on the
possible effects of those bacteria in Leishmania transmission given the proven effect on
some viruses and other parasites in their vectors.
In this study, conventional microbiological methods and molecular ones, were used to
explore the composition of bacterial communities associated with the gut of immature and
adult stages of wild populations of Lu. evansi from the department of Sucre (Caribbean coast
of Colombia). Different lines of evidence were addressed for identification of the bacteria
including ribosomal intergenic spacer analysis (RISA) and 16S rRNA and gyrB gene
sequences variation. The genetic profile of bacterial populations was generated and
compared by temperature gradient gel electrophoresis (TTGE) from total DNA of Lutzomyia
gut. Concomitant Wolbachia and Leishmania infection in Lu. evansi and other species was
also evaluated by PCR. Leishmanicidal and antimicrobial activity of Pantoea ananatis,
Ochrobactrum anthropi and Enterobacter cloacae, isolated from the gut of Lu. evansi, were
evaluated as well as the sensitivity of these bacteria to commonly used antibiotics.
The culture-dependent techniques indicated intestinal bacteria belonging to Acinetobacter,
Enterobacter, Pseudomonas, Ochrobactrum, Shinella and Paenibacillus being the dominant
bacteria larvae. Lysobacter, Microbacterium, Streptomyces, Bacillus and Rummeliibacillus
were found in pupae; Staphylococcus, Streptomyces, Brevibacterium, Acinetobacter,
Enterobacter and Pantoea were isolated from adults. Fingerprint pattern of PCR - TTGE had
statistical significant variations in bacterial communities in Lu. evansi when immature and
adult stages were compared, as also when engorged condition and origin of insects were
considered.
Results indicated 20% of infection by Wolbachia in all samples of Lutzomyia evaluated. This
endosymbiotic bacteria was found in three species: Lutzomyia cayennensis and Lutzomyia
dubitans with 3 positive pools= 8.5% for both species, and Lutzomyia evansi, with a positive
pool= 2.8%. Two Wolbachia genotypes (strains) were clearly found, wLev in Lu dubitans, Lu
cayennensis, and Lu evansi; while wLcay was found only in Lu cayennensis. Evidence of
Wolbachia infections in natural Lutzomyia populations encourage further investigation on
the possible effects of this bacteria in Leishmania transmission given the proven efficacy in
biological control of some parasites transmitted by vectors.
The highest percentage of inhibition against Leishmania procyclic promastigotes was
observed with bacterial concentrations of 108 CFU/ml of E. cloacae (77.29 ± 0.6%) and P.
ananatis (70.17% ± 1.1). The inhibitory growth activity of procyclic L. infantum promastigotes
shown by extracts of E. cloacae and P. ananantis suggests that the presence of these
bacteria in the vector intestine could be affecting the parasite development to metacyclic
stages infective to human hosts, which will be desirable to corroborate. O. anthropi was the
isolate with the highest number of antibiotic resistance patterns while P. ananatis and E.
cloacae showed greater sensitivity to the antibiotics evaluated.
CONTENT
Abstract
List of abbreviations
List of Figures
List of Tables
Introduction
Hypothesis
Objectives
1. CHAPTER 1. DIFFERENCES IN THE STRUCTURE OF THE GUT BACTERIA
COMMUNITIES IN DEVELOPMENT STAGES OF NATURAL POPULATIONS OF
Lutzomyia evansi FROM THE CARIBBEAN COAST OF COLOMBIA
1.1 Highlights
1.2 Graphical abstract
1.3 Abstract
1.4 Introduction
1.5 Materials and methods
1.5.1. Ethics Statement
1.5.2 Collection, processing and identification of sand flies
1.5.3 Lutzomyia evansi guts
1.5.4 Culture-Dependent assays
1.5.4.1. Isolation of bacteria and Colony Forming Units
1.5.4.2. PCR amplification of the spacer region between the 23S and 16S ribosomal gene
(ITS), 16S rRNA gene and gyrB.
1.5.4.3. Identity of bacteria and their phylogenetic relationships.
1.5.5. Culture-Independent assays
1.5.5.1. Temporal temperature gradient gel electrophoresis (PCR –TGGE)
1.5.6. Detection of Wolbachia and Leishmania
1.5.7. Data Analysis
1.6. Results
1.6.1. Lutzomyia evansi guts
1.6.2. Cultured bacterial community of Lu. evansi
1.6.3. Identification of bacterial isolates by using 16S DNA sequences
1.6.4. Neighbor-Joining Cluster analysis of 16S rRNA and gyrB gene sequences from
bacterial isolates.
1.6.5. PCR-TGGE and phylogenetic analysis of the intestinal bacteria of L. evansi
1.6.6. Bacterial diversity in guts of L. evansi associated with the blood intake and
developmental stage.
1.6.7 Detection of Wolbachia and Leihsmania in the gut of female Lu. evansi
1.7. Discussion
1.8. Conclusions
1.9. Acknowledgements
1.10. References
2. CHAPTER 2. MOLECULAR DETECTION AND IDENTIFICATION OF
Wolbachia IN THREE SPECIES OF Lutzomyia GENUS IN THE COLOMBIAN
CARIBBEAN COAST
2.1 Highlights
2.2. Graphical abstract
2.3 Abstract
2.4 Introduction
2.5 Materials and methods
2.5.1. Ethics Statement
2.5.2 Phlebotomine survey, processing, and identification.
2.5.3 Pool formation and DNA extraction.
2.5.4 PCR, Cloning and DNA fragment sequencing for Wolbachia wsp gene.
2.5.5. Identity of Wolbachia strains and their positions in phylogroups.
2.5.6. PCR amplification of the HSP-70N Leishmania gene in female groups.
2.6. Results
2.6.1. Taxonomic identification of sand flies
2.6.2. Wolbachia (wsp gene) infection.
2.6.3. Wolbachia identity based on comparisons with previous sequences and assignation
of phylogroups using wsp gene sequences.
2.6.4. Leishmania infection.
2.7. Discussion
2.8. Acknowledgements
2.9. References
3. CHAPTER 3. ANTAGONISTIC EFFECT OF BACTERIA ISOLATED FROM THE
DIGESTIVE TRACT OF Lutzomyia evansi AGAINST PROCYCLIC AND
METACYCLIC PROMASTIGOTES OF Leishmania infantum
3.1 Highlights
3.2. Graphical abstract
3.3 Abstract
3.4 Introduction
3.5 Materials and methods
3.5.1. Identification of bacterial isolates and estimate of cell concentration.
3.5.2 Reactivation of Leishmania infantum fluorescent promastigotes, fluorescence
emission estimation and calculation of cell concentration.
3.5.3 In vitro antileishmanial activity assay of bacterial extracts in procyclic and metacyclic
promastigotes of Leishmania infantum.
3.5.4 Quantification of the bacterial isolates activity on Leishmania infantum promastigotes
3.5.5. Evaluation of antibacterial activity from crude methanol extracts produced by P.
ananatis, O. anthropi and E. cloacae
3.5.6. Antibiotic sensitivity test
3.5.7. Data analysis
3.6. Results
3.6.1. In vitro bacterial test with procyclic and metacyclic promastigotes
3.6.2. Antimicrobial activity test of crude methanolic extracts
3.6.3. Antibiotic sensitivity test
3.7. Discussion
3.8. Conclusions
3.9. Acknowledgements
3.10. Financial Support
3.11. References
4. ADDITIONAL RESULTS: EUBACTERIAL COMPOSITION ASSOCIATED WITH
THE INTESTINE OF Lutzomyia evansi FROM COLOMBIA: THE CORE GUT
MICROBIOME, SIGNIFICANT CONTRIBUTION OF Wolbachia,
Methylobacterium AND A DIVERSE GUILD OF BACTEROIDETES AND
LACTOBACILLUS
5. ADDITIONAL RESULTS: PRESENCIA DE Wolbachia y Leishmania EN UNA
POBLACION DE Lutzomyia evansi PRESENTE EN LA COSTA CARIBE DE
COLOMBIA
6. GENERAL CONCLUSIONS
7. PERSPECTIVES AND DESIRABLE FUTURE STUDIES
APPENDIXES
Appendix A: Geographical areas for sanflies collection and sampling methods for immature
and adults.
Appendix B: Areas and collection methods of immature and adult sand flies.
Appendix C: Lu evansi processing for guts obtention througth imature and adult dissection.
Appendix D: Neighbor-Joining dendrogram (consensus) based on DNA barcode
sequences - COI to validate taxonomic identity of immature Lutzomyia.
Appendix E: Bacteria Counts (CFU) in Lu. evansi guts .
Appendix F: Morphology and phylogenetic affiliation of bacterial isolates
Appendix G: Morphology and phylogenetic affiliation of bacterial isolates
Appendix H: Analysis of (ITS) spacer region between the 23S and 16S ribosomal gene
(ITS) for bacterial isolates from Lutzomyia evansi guts (adults).
Appendix I: Analysis of the (ITS) spacer region between the 23S and 16S ribosomal gene
(ITS) for bacterial isolates from Lutzomyia evansi guts (immature).
Appendix J: Analysis of the (ITS) spacer region between the 23S and 16S ribosomal gene
(ITS) of cultivable fraction from Lutzomyia evansi guts (immature). L4: Larvae; PP: Pupae;
UF: unfed females; FF: fed females; M: males.
Appendix K: Principal components analysis for the RISA quantitative matrix of cultivable
fractions from the different samples
Appendix L: Analysis of the (ITS) spacer region between the 23S and 16S ribosomal gene
(ITS) of total fraction from Lutzomyia evansi guts.
Appendix M: Principal components analysis for the TTGE quantitative matrix of the total
DNA from the different samples
Apendix N: PCR amplification of the Spacer Region (ITS) between the 23S and 16S
ribosomal gene (ITS), 16S rRNA gene, gyrB gene, WSP gene of Wolbachia and HSP-70N
gene of Leishmania sp
Appendix O: Nucleotide and amino acid sequences of Wleva and Wlcay strains detected
Appendix P: Nomenclature of Wolbachia supergroups, groups, and strains used and host
insects related.
Appendix Q: Verification of recombination events and the presence of chimeras using
RDP4.
Appendix R: Experimental Scheme for activity evaluation of found bacteria on Leishmania
infantum (procyclical and metacyclic) by co-culture techniques.
Appendix S: Ressults socialization in conferences (national and international)
REFERENCES
List of abbreviations
Lu: Lutzomyia
CFU: Number of Colony-Forming Units
TTGE: Temporal Temperature Gradient Gel Electrophoresis
RISA: Ribosomal Intergenic Spacer Analysis
gyrB: The B-subunit of DNA gyrase, a type II DNA topoisomerase
Wsp: Main surface protein of Wolbachia
HSPN70: gene that encode for cytoplasmic Heat Shock Protein 70
COI: Cytochrome Oxidase I gene
RDP4: Recombination Detection Program
NGS: next-generation sequencing
List of Figures
Fig. 1. Neighbor-Joining dendrogram of partial 16S rDNA sequences of bacteria obtained
from adult stages of Lutzomyia evansi collected in the municipalities of Ovejas and Colosó
(Sucre Department, Colombia).
Fig. 2. Neighbor-Joining dendrogram of partial 16S rDNA sequences of bacteria obtained
from immature stages of Lutzomyia evansi collected in the Ovejas municipality (Sucre
Department, Colombia).
Fig. 3. Neighbor-Joining dendrogram of gyrB gene sequences of bacteria obtained from
adult and immature stages of Lutzomyia evansi collected in the municipalities of Ovejas and
Colosó (Sucre Department, Colombia).
Fig. 4. PCR-TGGE Profiles of 16S rDNA amplification products.
Fig. 5. Neighbor-Joining dendrogram of 16S rDNA fragment sequences obtained from the
PCR-TGGE profiles
Fig. 6. Simple correspondence analysis of the intestinal bacterial flora associated with adult
and immature stages
Fig. 7. PCR from Lutzomyia genomic DNA pools
Fig. 8. Phylogenetic relationships of Wolbachia strains inferred using wsp gene including
the ones detected in Lutzomyia species (Blue) collected in Ovejas (Sucre, Colombia).
Fig. 9. Macroscopic and microscopic morphology (Gram stain) of the strains P. ananatis, E.
cloacae and O. anthropi isolated from the gut of Lu. evansi and NJ dendrogram of partial
16S gene sequences illustrating the taxonomic confirmation of the bacterial isolates.
Fig. 10. Agar diffusion assay of the antibacterial activity of the extracts produced by P.
ananatis, E. cloacae, O. anthropi.
List of Tables
Table 1. Sample description of adult and immature stages of Lutzomyia evansi
Table 2. Closest phylogenetic identification of bacteria isolated from the digestive tract of
adult Lutzomyia evansi
Table 3. Closest phylogenetic identification of the 16S rDNA sequences of bacteria isolated
from the digestive tract of immature Lutzomyia evansi
Table 4. Bacteria found in the digestive tract of adult and immature Lutzomyia evansi by
TTGE analysis.
Table 5. Formation of pools of Lutzomyia spp., for detection of infection by Wolbachia or
Leishmania in peri-urban environments in the municipality of Ovejas.
Table 6. Values of genetic distances K2P and percent of sequence identity based on
alignment of the wsp gene among strains of Wolbachia
Table 7. In vitro activity of three bacterial isolates from the gut of Lu. evansi against procyclic
and metacyclic promastigotes of Leishmania infantum
Table 8. Antibacterial activity of extracts produced by strains O. anthropi, E. cloacae and P.
ananatis isolated from the gut of Lu. evansi
Table 9. Antibiotic sensitivity patterns of the strains O. anthropi, E. cloacae and P. ananatis
isolated from the gut of Lu. evansi
Introduction
At present, the study of bacterial communities associated with the intestine of insect vectors
of tropical diseases (eg. Malaria, Chagas, Leishmaniasis, Dengue, Zika, Chikungunya or
Filariasis) is considered a "biotechnology platform" of high interest for the development of
new alternatives to control and prevent the transmission of pathogens with great impact on
public health worldwide (Finney et al., 2015). "The microbiota" (microflora and fauna present
in an ecosystem) associated with insects has also an important role in the physiology of the
vector (digestion, nutrition) and in the maturation of the innate immune system (Dillon and
Dillon, 2004; Azambuja et al., 2005).
The use of “symbiotic microorganisms” is among the main approaches used to reduce vector
competence of insects that includes a stable vertical transmission in progeny when
transfected and with effects on the development of target pathogens in the gut (Hoffmann
et al., 2015). Some of these symbionts include bacteria of the genera Wolbachia and Asaia
which have been evaluated mainly in mosquitoes of the genera Anopheles and Aedes (=
Stegomyia) (Favia et al., 2007; Werren et al., 2008; Hoffmann et al., 2015). Another
approach is "Paratransgenesis", also related to the above information but in a higher level
of the biotechnology platform, that not only takes advantage of the biology of the
microorganism, but also modifies it in a more efficient way to attack the target pathogen
within the insect (Cirimotich et al., 2012). That is, through a genetic modification of bacterial
symbionts to produce anti-pathogenic molecules targeting specific tissues or compartments
(portions of the intestine, reproductive structures, salivary glands) to reduce the vector
competence (Hurwitz et al., 2001).
In this context, the current situation of leishmaniasis (group of infectious diseases caused
by protozoa of the genus Leishmania) (Amora et al., 2009), requires the exploration of the
microbial diversity associated with the intestine of Lutzomyia species (insect vectors) and to
study the potential of secondary metabolites produced by bacteria, considered as an
important source of natural products with different biological properties over the parasites
and viruses transmitted by these insects (Azambuja amount et al., 2005; Molloy et al., 2012).
For Colombia and other regions of America, this approach is justified because leishmaniasis
displays: The difficulties associated with diagnostics and treatment; the ambiguity on the
vectors surveillance mechanisms in endemic areas of transmission of Leishmania species
(Gonzalez et al., 2006); the absence of alternative vector control methods, related only to
non-specific use of insecticides, mosquito nets and repellents; the emergence of resistant
strains of Leishmania, and the ubiquity and adaptability of insect vectors and the existence
of different eco-epidemiological settings where the transmission of the disease can occur
(Rangel and Vilela et al., 2008).
In short, and from a holistic point of view, it is suggested to integrate the isolation and
identification of bacterial communities associated with the intestine and evaluate if their
activity can influence, directly or indirectly, the development of Leishmania parasites
(antitrypanosomal activity) (Sant'Anna et al., 2014; Shanchez and Vlisidou., 2008).
Traditionally, microbiological studies of arthropod vectors rely on "culture dependent
techniques" to identify pathogens and commensal or mutualistic species, however, only a
small proportion of bacterial species (3% - 5%) can grow under culture conditions, and can
severely limit our understanding of microbial communities present in a particular ecological
niche (“gut”) (Azambuja et al., 2005; Hoffmann et al., 2015.).
To address the lack of information, the recent use of "culture independent methods" based
on DNA sequencing technology advances (next-generation sequencing-NGS) or amplicon
"fingerprinting" methods (eg. temperature gradient gel Electrophoresis -TGGE) using genes
with good phylogenetic signals (16S rDNA, gyrB, rpoB), have established distinctive solid
profiles (95%) of microbial communities from different samples (Guernaoui et al, 2011;
Vargas et al., 2012). Few studies have combined culture dependent and PCR based
approaches to characterize the sand fly or insect vectors microbiota in America (Oliveira et
al., 2000; Lindh et al., 2005; Zahner et al., 2008, McCarthy et al, 2011; Sant'anna et al,
2012), despite both methods produce different, but complementary, results (Hoffmann et al,
2015), and are useful for understanding the transmission dynamics or to select bacteria with
promising biological activities that may hinder the development of the Leishmania parasite.
In Colombia, there are approximately 14 species of Lutzomyia reported as vectors of
different species of Leishmania (Bejarano et al., 2015), and to date only the intestinal
microbiota of a wild population of Lu. longipalpis from a non-endemic leishmaniasis area
has been described (Gonzalez et al., 2006; Sant'anna et al., 2012.). The species Lutzomyia
evansi, is a vector insect recognized for the transmission of parasites that generate visceral
and cutaneous leishmaniasis in rural and urban environments of the Caribbean coast of
Colombia (González et al., 2006). Its abundance and epidemiological importance makes it
an attractive biological model to develop the first study analysing the intestinal microbiota
associated with natural populations of adults (males, females) and immature stages (larvae,
pupae) through a polyphasic approach (culture dependent and independent methods);
specific detection of natural infection of the Wolbachia endosymbiont; and finally to evaluate
the in vitro activity of three bacterial isolates on the development of Leishmania
promastigotes and their action against pathogenic bacteria.
The objectives of this study are described by chapters as follows: The first chapter contains
the study of the intestinal microbiota called "Structural differences in gut bacteria
communities in developmental stages of natural populations of Lutzomyia evansi
from Colombia’s Caribbean coast" which was submitted to the journal Microbial Ecology
(Manuscript Number MECO-D-16-00098); the second chapter relates to the detection of
Wolbachia "Molecular detection and identification of Wolbachia in three species of the
genus Lutzomyia in the Colombian Caribbean Coast" which was submitted to the journal
Acta Tropica (Manuscript Number ACTROP-D-16-00162); and the third chapter is
associated with the in vitro activity of the isolates against Leishmania, which bears the title
"Antagonistic effect of bacteria isolated from the digestive tract of Lutzomyia evansi
against procyclic and metacyclic promastigotes of Leishmania infantum" submitted to
International Journal of Parasitology (Manuscript Number IJPARA-S-16-00144). Additional
results using a NGS (Next Generation Sequence) approach correspond to the manuscript
“Eubacterial composition associated with the intestine of Lutzomyia evansi from
Colombia: the core gut microbiome, significant contribution of wolbachia,
methylobacterium and a diverse guild of bacteroidetes and lactobacillus” in
preparation for submission and the manuscript "Presence of Wolbachia and Leishmania
in a population of Lutzomyia evansi present in the Caribbean Coast of Colombia” was
included as a supplement of the information included into the second article cited above,
and was submitted to Revista de la Facultad de Ciencas.
Hypothesis
The wild populations of Lutzomyia evansi present in areas with transmission of
leishmaniasis in the Caribbean coast of Colombia, have an intestinal microbiota
associated, which may differ according to their biological life stage, engorged
condition or locality of collection.
Lutzomyia evansi and other species are infected with Wolbachia in the Caribbean
coast of Colombia, with at least one strain.
The crude extracts and native isolates obtained from digestive tract of Lutzomyia
evansi, have decisive effects on the in vitro development of Leishmania infantum and
have potential use in biological control of leishmaniasis.
General objective
Characterize the bacterial communities associated with the intestine of two natural
populations of Lutzomyia evansi from the Caribbean coast of Colombia and evaluate
the effect of whole bacteria against Leishmania infatum.
Specific objectives
1. Examine the diversity of bacterial communities associated with the guts of two
natural populations (wild and urban) of Lu. evansi from Colombian Caribbean coast
in different developmental stages, by culture-dependent and culture-independent
methods.
2. Detect and identify the endosymbiont Wolbachia by molecular methods in natural
populations of Lutzomyia species found in the municipality of Ovejas on the
Colombian Caribbean Coast.
3. Evaluate the leishmanicidal and antibacterial activity of extracts and whole bacteria
(P. ananatis, O. anthropi and E. cloacae) isolated from the digestive tract of Lu.
evansi and their sensitivity to antibiotics.
1. CHAPTER 1. STRUCTURAL DIFFERENCES IN GUT BACTERIA
COMMUNITIES IN DEVELOPMENTAL STAGES OF NATURAL
POPULATIONS OF Lutzomyia evansi FROM THE COLOMBIA’S
CARIBBEAN COAST
1.1 HIGHLIGHTS
The culture-dependent technique indicated that the dominant intestinal bacteria from
Lutzomyia belong to Firmicutes, Actinobacteria and Proteobacteria.
The analyses culture-dependent showed significant variations in the bacterial
species, depending on the developmental stage, engorged condition and origin of
the insects.
TTGE band profiles and analysis of partial 16S rDNA sequences were indicative of
different genera (Enterobacter, Bacillus, Burkholderia and Pseudomonas)
associated to adult and immature stages of Lu. evansi.
For graphic information related to methodology and findings see Appendixes A-N
1.2 GRAPHICAL ABSTRACT
“Natural circulations of bacteria among the developmental stage of Lutzomyia evansi”
Proteobacteria
Firmicutes
The core gut
microbiome
Enterobacter, Pseudomona, Staphylococcus, Pantoea, Brevibacterium, Acinetobacter, Streptomyces, Lysobacter, Ochrobactrum, Shinella, Paenibacillus, Bacillus, Microbacterium, Rummellibacillus, Burkholderia
Proteobacteria
Firmicutes
Actinobacteria
Proteobacteria
Firmicutes
Proteobacteria
Firmicutes
Firmicutes
Actinobacteria
Haematophagy
Blood source of
human and reservoir
of each locality
Phytophagy Plant food
Sources (Uvito) and others
Phytophagy
Plant food Sources (Uvito)
and others
Coprophagia Natural breeding site associate with
plant (Uvito)
Acquiring
bacterial
microbiota
1.3 ABSTRACT
Lutzomyia (Lu.) evansi is a phlebotomine insect endemic to Colombia’s Caribbean coast. It
is epidemiologically significant because is considered the main vector of visceral and
cutaneous leishmaniasis in the region. Although insects of this species can harbor
pathogenic and non-pathogenic microorganisms in their intestinal microbiota, there is little
information available about the diversity of gut bacteria present in Lu. evansi and its
influence on the development and transmission of parasites. In this study, conventional
microbiological methods and molecular tools were used to assess the composition of
bacterial communities associated with Lu. evansi guts in immature and adult stages of
natural populations from the department of Sucre (Caribbean coast of Colombia). Different
methods were used for bacterial identification, including ribosomal intergenic spacer
analysis (RISA) and analysis of the 16S rRNA and gyrB gene sequences. The genetic
profiles of the bacterial populations were generated and Temporal temperature gradient gel
electrophoresis (TTGE) was used to compare them with total gut DNA. We also used PCR
and DNA sequence analysis to determine the presence of Wolbachia endosymbiont bacteria
and the Leishmania parasite. The culture-dependent technique showed that the dominant
intestinal bacteria isolated belonged to Acinetobacter, Enterobacter, Pseudomonas,
Ochrobactrum, Shinella and Paenibacillus in the larvae stage; Lysobacter, Microbacterium,
Streptomyces, Bacillus and Rummeliibacillus in the pupae stage; and Staphylococcus,
Streptomyces, Brevibacterium, Acinetobacter, Enterobacter and Pantoea in adult stages.
The statistical analysis revealed significant differences between the fingerprint patterns of
the PCR - TTGE bands in bacterial communities from immature and adult stages.
Additionally, differences were found among the bacterial community structures of the fed
females, unfed females, males and larvae. The intestinal bacteria detected by PCR- were
classified as Enterobacter cloacae and Bacillus thuringiensis, which were present in different
stages, and Burkholderia cenocepacia and Bacillus gibsonii, which were detected only in
the larvae stage. The analyses conducted using microbiological and molecular approaches
indicated significant variations in the bacterial communities associated with the gut of Lu.
evansi, depending on the developmental stage and the food source. We propose that these
elements affect microbial diversity in Lu. evansi guts and may in turn influence pathogen
transmission to humans who have been bitten by this insect.
Key Words: Lutzomyia evansi – Immature – Adults – Intestinal microbiota – Colombia.
1.4 INTRODUCTION
Insects from the genus Lutzomyia (Lu.) França 1924 (Phlebotominae subfamily) are of great
interest in biological studies because of their ability to transmit parasites from the genus
Leishmania Ross 1903 (Amora et al., 2009) to vertebrates, as well as other pathogens,
including the bacteria Bartonella baciliformis and viruses from the Bunyaviridae, Reoviridae
and Rhabdoviridae families (Gomes et al., 2010; Brazil 2013; Acevedo and Arrivillaga 2008).
The potential of Lutzomyia species to transmit parasites can be attributed primarily to the
hematophagic habit of females (anthropophilic or zoophilic), which are the only ones that
ingest blood as a necessary source of protein for the maturation of their eggs (Haouas et
al., 2007). Various studies about feeding preferences suggest that phlebotomine insects
have eclectic feeding habits and can take blood from different vertebrates (Haouas et al.,
2007; Cochero et al., 2007). There are also autogenous species that use protein stocks
acquired during the larvae stage to complete their first gonadotropic cycle (Ferro and
Morales et al., 1998). For survival and movement, sap, nectar or aphid secretions are the
most-described carbohydrate sources (Tang and Ward 1998).
As described above, phlebotomine insects need a varied diet and have the ability to digest
complex molecules throughout the different stages of their development (Minard et al., 2013;
Janson et al., 2007). The different bacterial communities these insects acquire from the
environment and from their eating habits are involved in the plant material digestion process
and promotethe availability of Fe ++ from erythrocytes and essential amino acids and
vitamins from the B complex (Raffa et al., 2008; De Gaio et al., 2011).
The metabolic importance of bacterial communities associated with the guts of phlebotomine
insects has led to the emergence of several new questions related to the parasite-vector
interaction. The most basic and essential of these include what bacterial communities are
present in the gut and how they interact with the parasites (Sanchez-Contreras and Vlisidou
2008). Other questions relate to the location of the bacteria in the intestine and other organs
of physiological relevance (Sanchez-Contreras and Vlisidou 2008), the identity of the
bacteria that remain during metamorphosis (Volf et al., 2002), the ability of the bacteria to
express recombinant molecules that display antitrypanosomal or antiviral activity
(Eleftherianos et al., 2013), and the existence of intestinal bacteria with insecticidal
properties or the ability to alter insect life cycles (Azambuja et al., 2005).
In America, bacterial diversity analysis has only been recorded for Lu. longipalpis and Lu.
cruzi adults (from colonies and natural populations in Brazil and Colombia) (Sant’anna et
al., 2012; Oliveira et al., 2000; Mccarthy et al., 2011; Gouveia et al., 2008). The gut bacteria
isolates registered for these species mainly belong to the genera Serratia, Enterobacter,
Acinetobacter and Pseudomonas (Mccarthy et al., 2011). Microbiota associated with
immature stages in natural breeding sites have not yet been evaluated, due to several
difficulties related to their recovery and identification (Vivero et al., 2015). The large number
of Lutzomyia species in Colombia serves as a motivation for exploring gut bacteria in other
important vectors.
Around 163 species from the subfamily Phlebotominae are registered in Colombia. Fourteen
of these have been reported as vectors for different Leishmania species (Vivero et al., 2013),
however Lu. longipalpis is the only species whose midgut microbiota have been described
(Mccarthy et al., 2011; Gouveia et al., 2008). Lu. evansi, is the most specie abundant on
Colombia’s Caribbean coast, transmits Leishmania infantum chagasi and Leishmania
braziliensis (Travi et al., 2002).
Studies have been conducted in order to understand the role of Lu. evansi as a vector of
Leishmania infantum (vector competence, life cycle, insecticide resistance, genetic
structure, blood intake and bionomics) (Gónzalez et al., 2006), however, the composition of
bacterial communities present in the gut of this species, and the changes in the microbiota
associated with food source, developmental stage, and the presence of parasitic infection,
have not been studied. Among the gut microbiota, the molecular detection and identification
of endosymbionts such as Wolbachia is important due to their potential use for decreasing
the population density of Lutzomyia species and interfering with parasite multiplication and,
thus, Leishmania transmission (Shanchez-Contreras and Vlisidou 2008; Sant’anna et al.,
2012).
Given the environmental plasticity of Lu. evansi, it is to be expected that this species
possesses complex and diverse intestinal microbiota. In recent years, a polyphasic
approach incorporating classical microbiological techniques and culture-independent
methods based on direct analysis of DNA (or RNA) cultures has gained popularity. This
approach has had reliable and effective results with regard to detecting and identifying
microorganisms, leading to major advances in the understanding of this complex microbial
ecosystem (Shanchez-Contreras and Vlisidou 2008; Azambuja et al., 2005; Mccarthy et al.,
2011). For the culture-independent approach, fingerprinting methods represent a complete
alternative for the study of intestinal microbiota. These methods include temperature
gradient gel electrophoresis (TTGE), which is a powerful genetic tool for establishing
distinctive profiles of microbial communities among different samples (Vargas et al., 2012;
Guernaoui et al., 2011).
In the present study, we used the culture-dependent and culture-independent methods of
TTGE, PCR, and sequence analysis to examine the diversity of bacterial communities
associated with the guts of two natural populations (wild and urban) of Lu. evansi from
Colombia’s Caribbean coast in different developmental stages.
1.5 MATERIALS AND METHODS
1.5.1 Ethics statement
Sand fly collection was performed in accordance with the parameters of Colombian decree
number 1376, which regulates specimen collection of biologically diverse wild species for
non-commercial research. No specific permits were required for this study. The sand flies
were collected on private property and permission was received from landowners prior to
sampling.
1.5.2 Collection, processing and identification of sand flies
Sand flies were collected from two locations in the department of Sucre (Caribbean coast of
Colombia). The first location was associated with a peri-urban biotype near the Ovejas
municipality (75° 13'W, 9° 31'N; 277msnm), classified as a tropical dry forest ecosystem
(Hernández et al., 1992) (Appendix A, B). The second location corresponded to a jungle
biotype at the “Primates” Wildlife Experimental Station (09° 31' 48.0"N - 75° 21' 4.3" W,
220m) in the municipality of Colosó, located within the Protected Forest Reserve “Serranía
de Coraza” (Appendix A). This nature reserve is classified as a transitional ecosystem of
premontane dry forest to tropical dry forest (Hernández et al., 1992) (Appendix B). Adult
stage samples were collected from Ovejas and Colosó during July and October 2013 and
January 2014, while immature stages were searched for in Ovejas during October and
November 2013.
The adult specimens were collected from the two locations using Shannon-type extra-
domiciliary white light traps that remained active between 18:00h and 22:00h (Appendix B).
The adult sand flies that were collected were transported live to the laboratory in
entomological cages to obtain the gut and morphological structures (male genitalia and
female spermathecae) for taxonomic identification of Lu. evansi using a taxonomic key
(Young and Duncan 1994).
Immature stages of Lu. evansi (larvae and pupae) were isolated from substrates extracted
from potential breeding sites, usually at the base of Cordia dentata shrubs (common name:
Uvito) associated with the urban environment of Ovejas (results not shown) (Appendix B).
The search was performed with a stereomicroscope, using the direct view technique (Vivero
et al., 2015). Immature specimens were immediately processed to obtain the gut; the rest of
each specimen (integument and head) was stored at -20°C for DNA extraction (Golczer and
Arrivillaga et al., 2008). The barcode region of the Cytochrome Oxidase I gene (Herbert et
al., 2003) was amplified and high quality sequences were obtained in order to estimate the
taxonomic identity of the immature specimens by comparing them with adult specimen
sequences from the same locality and others reported in the NCBI GenBank (results not
shown).
1.5.3 Lutzomyia evansi guts
Processed adult sand flies confirmed as Lu. evansi were categorized into three groups and
represented by source as follows: fed females (Colosó=FFC; Ovejas=FFO), unfed females
(Colosó=UFC; Ovejas=UFO) and males (Colosó=MC; Ovejas=MV) (Appendix C). Prior to
gut dissection, adult and immature specimens were washed with 50μL of 1X PBS and
Tween 20, centrifuged at 3000g for 5 minutes, and submerged in a 70% ethanol wash for
one minute to remove excess microvilli, dust and exogenous bacteria.
The guts of adult Lu. evansi specimens were removed aseptically with sterile stilettos under
a stereoscope in 1X PBS buffer. Gut pools were formed according to locality and
physiological stage; these were re-suspended in 100μL of sterile PBS. Gut groups were
macerated and then vortexed for 30 seconds to break the intestinal wall and obtain intestinal
homogenate. The guts of larvae (Ovejas=L4) and pupae (Ovejas=PP), were processed
individually prior to taxonomic identification (Appendix D). Each intestinal homogenate was
preserved and processed cold. Half was used for conventional microbiological methods of
cultivable fraction (CF) and the remainder was used for the culture-independent molecular
approach of the total intestinal bacteria fraction (TF).
1.5.4 Culture-dependent assays
1.5.4.1 Isolation of bacteria and colony-forming units
Gut homogenates were cultured using serial dilutions for surface plating on LB Agar (Merck)
and MacConkey Agar (Merck) (Akhoundi et al., 2012). The plates were incubated aerobically
at 33°C for 24 to 48 hours. The total number of colony-forming units (CFU) was determined
for each homogenate (Appendix E). The isolates selected for molecular identification were
purified; they were then characterized macroscopically based on colony characteristics and
microscopically by Gram staining (Appendix F, G). All isolates were cryopreserved in 20%
glycerol at -80°C.
1.5.4.2 PCR amplification of the spacer region between the 23S and 16S ribosomal gene
(ITS), 16S rRNA gene and gyrB.
For total DNA extraction, each colony was incubated for 10 minutes at 95°C in 100μL of
sterile Tris-EDTA 1X to generate cell lysis. This was followed by centrifugation at 10,000
rpm for five minutes, in order to obtain the DNA in the supernatant for use as a template in
the PCR assays (colony PCR Protocol) (Jansen et al., 2006).
The template DNA of all isolates was initially assessed by amplifying the ITS region using
the L1 (5'CAAGGCATCCACCGT3') and G1 (5'GAAGTCGTAACAAGG3') primers (Jansen
et al., 2006) (Appendix N), as previously described (Espejo et al., 1998). GelCompar II
software (Applied Maths Biosystems, Belgium) was used to build a dendrogram with the
banding patterns of the ITS regions. A distance matrix was calculated using the Dice
coefficient (Neil 1979) and cluster analysis was performed using the unweighted arithmetic
average (UPGMA) (Mohammadi and Prasanna 2003).
In order to properly represent the bacterial diversity associated with adult and immature Lu.
evansi guts, ≥70 % similarity between ITS standards was established as a criterion for
selecting bacterial isolates to be considered for the subsequent molecular identification
assays. The DNA isolated from the selected colonies was used to amplify the 16S rRNA
gene (1.5 kbp), using the Eubac 27F- 5'AGAGTTTGATCCTGGCTCAG3' and 1492R-
5'GGTTACCTTGTTACGACTT3' (Jansen 2006) primers, as previously described (Moreno
et al 2006).
The gyrB gene (encodes the B-subunit of DNA gyrase, a type II DNA topoisomerase) was
amplified from the same template DNA of some isolates (Want et al., 2007). The primers
UP1 5'GAAGTCATCATGACCGTTCTGCAYGCNGGNGGNAARTTYGA3' and UP- 2r-
5'AGCAGGGTACGGATGTGCGAGCCRTCNACRTCNGCRTCNGTCAT3' were used with a
reaction mixture and a thermal profile designed to amplify two conserved regions of
approximately 1.26 kbp of the gyrB gene (Yamamoto and Harayama 1995). Positive and
negative controls (DNA from pure cultures of Escherichia coli or Bacillus cereus and
ultrapure water) were routinely included in all PCR reactions for both genes.
Partial 16S rDNA and the gyrB gene PCR products were verified by visualization in 1%
agarose gels (Appendix N). The amplified products were purified using Wizard PCR Preps
(Promega) and the double-stranded DNA was sequenced in both directions using the ABI
PRISM 3700 DNA analyzer service (Applied Biosystems) of Macrogen Company Inc. in
Korea. The nucleotide sequences of the 16S rRNA and gyrB genes reported in this study
were recorded in the NCBI database (Tables 2-4).
1.5.4.3 Bacterial identity and phylogenetic relationships
The sequences from the 16S rDNA and gyrB genes were edited using Bioedit v7.2.5 (Hall
1999), in order to obtain consensus sequences for each isolate. Subsequently, they were
compared with GenBank and RDP reference sequences, using BLASTN (National Center
for Biotechnology Information; http://www.ncbi.nlm.nih.gov/BLAST/) to confirm the identity
and the taxonomic identity of the nucleotide fragment obtained, with ≥97% similarity values.
The ClustalW algorithm built in MEGA 5 (Tamura et al 2011) was used to align sequences
of the 16S rRNA and gyrB genes with reference sequences of bacterial species found in
GenBank as a result of the similarity search. The sequence matrix of delimited fragments of
the 16S rRNA and gyrB genes was used to generate neighbor-joining dendrograms (Saitou
and Nei 1987), using the DNA correction distances of the Kimura 2-parameter model
(Kimura 1980) to provide a graphical representation of clustering patterns between species.
Verification and/or validation of recombination events and the presence of chimeras was
carried out with RDP4 software (Martin et al., 2005) to ensure the accuracy of the nucleotide
variability with respect to the sequences previously reported in the NCBI database.
1.5.5 Culture-independent assays
1.5.5.1 Temporal temperature gradient gel electrophoresis (PCR –TTGE)
TTGE protocol was used to monitor the dynamic changes in the intestinal microbe
population in adult and immature specimens. Total gut DNA was extracted using the Ultra
CleanTM Soil DNA Isolation Kit (MO BIO Laboratories, Inc., USA), according to the
manufacturer’s instructions. Final DNA aliquots were quantified using an ND-100 Nanodrop
Thermo Scientific spectrophotometer (Thermo Fisher Scientific Inc, MA). The quality of
genomic DNA was analyzed on 1% agarose gel, followed by EZ-visionTM DNA 6X STAIN
(AMRESCO). DNA samples were subjected to 16S rRNA gene amplification between the
V3 and V6 variable regions to obtain a 566 bp fragment with primers specific to the
conserved domains. These were 341F (5'-CCT GCA GGA GGC AGC AG-3 '), with an extra
GC termination at the 5' end, and 907R (5'- CCC TGA CGT GTT ATT CAA TTC Y 3') (Muyzer
et al., 1993). The PCR reaction conditions were implemented as described previously
(Gomez et al., 2011).
All PCR products were checked for amplification by electrophoresis on 1% (w/v) agarose
gels. PCR products were concentrated with Concentrator (Eppendorf 5301) and dissolved
in 20 μl of double-distilled H2O. Approximately 600 ng of amplified DNA were loaded into
each well. TGGE was performed using the DCode TM Universal mutation detection system
(Bio-Rad Laboratories, Hercules, CA) with a 6% (w/v) polyacrylamide-7 M urea gel and a
1.25× TAE running buffer (40 mM Tris base, 20 mM sodium acetate, 1 mM EDTA) at a
constant voltage of 55 V for 15 h. The initial temperature was 66°C, the final temperature
was 69°C, and a ramp of 0.2°C h−1 was applied. Additionally, each gel contained at least
two marker lanes consisting of a 100 bp ladder (Fermentas, U.S.A) and another consisting
of 16S fragments of two reference bacterial strains (Enterobacter cloacae KU134778,
Acinetobacter colcaeceticus KU134748).
Polyacrylamide gels were stained with SafeView™ DNA stain (Applied Biological Materials)
and imaged with a digital scanner. Banding patterns were analyzed through Pearson
correlation and Complete Linkage clustering (Koeppel et al., 2008) using GelCompar II
software (Applied Biosystems Maths, Belgium) (Rademaker and De Bruijin 1997), in order
to detect differences in diversity and abundance profiles among the gut samples (Appendix
M). Bands of interest were excised and the DNA was eluted in 60 µl of ultrapure water. Five
microliters of the DNA elution were re-amplified using the same 341F (without the GC tail)
and 907R primers. Bands that were successfully re-amplified were sent for sequencing
(Macrogen, Korea). Further analyses were carried out using the methods and procedures
described above for the isolate sequences. A cluster analysis was constructed with the Dice
coefficient, using an unweighted pair-group average with Euclidean distance estimations
(GelCompar II software - Applied Maths Biosystems, Belgium).
1.5.6 Detection of Wolbachia bacteria and Leishmania parasite
The intestinal DNA of female pools collected in Ovejas and Colosó was also searched for
Wolbachia endosymbiont bacteria and the Leishmania parasite. The specific primers
wsp81F-5'TGGTCCAATAAGTGATGAAGAAAC-3' and wsp691R-5'AAAAATTAAACGCTA
CTCCA-3' were used to detect Wolbachia (Appendix N). These primers amplify a partial
fragment (590 bp - 632 bp) of the gene that encodes the Wolbachia main surface protein
(WSP) (Braig et al., 2008). The reaction mixture and working conditions used for detecting
Wolbachia included a 2μl DNA (30 ng) sample in a final reaction volume of 20μ (Zhou et al.,
1998). A PCR positive control was included, which consisted of DNA obtained from 10
Aedes (Stegomyia) aegypti larvae (L4) infected with a Wolbachia reference strain (Group A,
wMel strain) under insectary laboratory conditions.
To detect Leishmania infection, the specific primers HSP70-F25-
5'GGACGCCGGCACGATTKCT-3 'and 5'-HSP70-R617 CGAAGAAGTCCGATA
CGAGGGA-3' were used, as described by Fraga et al. 2012 (Fraga et al., 2012). These
primers amplify a partial fragment (593pb) of the HSP-70N gene (cytoplasmic Heat Shock
Protein 70) (Appendix N).
1.5.7 Data Analysis
A descriptive analysis was performed to determine possible differences in the gut bacterial
load (colony forming units) in adult (fed females, unfed females, males) and immature stages
(larvae, pupae) of Lu. evansi. The XLSTAT 3.04 (http://www.xlstat.com/) program was used
to generate a simple correspondence analysis between bacterial isolates and the TTGE
profiles, Lu. evansi stages and sample origins, in order to distinguish possible trends or
associations. Finally, a presence and absence matrix was used to generate an analysis of
similarity (ANOSIM) based on the Bray-Curtis index, using PAST software, version 2.17
(Hammer et al., 2001). The analysis of similarity was used to examine the statistical
significance of differences between the TTGE profiles.
1.6 RESULTS
1.6.1 Lutzomyia evansi guts
A total of 752 Lu. evansi intestines were dissected and processed to form 31 pools, each
containing 13–50 adult intestines. Analysis of individual form was performed for immature
stages (Table 1). We obtained the taxonomic identifications of adults of both localities by
using dichotomous keys, and confirmed these with the COI mitochondrial marker. Immature
stages were also identified with the COI mitochondrial marker (results not shown) (Appendix
D).
1.6.2 Cultured bacterial community of Lu. evansi
In this study, 125 bacterial strains were isolated from different culture media (LB Agar,
MacConkey Agar) (Table 1). The results showed significant differences between stages in
terms of the CFU count, which was highest for larvae in LB agar (CFU/intestine= 348.4 x10-
3), and lowest for pupae in both culture media (CFU /intestine= 1.25 x10-3). In adults, the
bacterial load was lower in male populations from Colosó (CFU/intestine= 8.8 x10-3) than in
the pools of fed females (CFU/intestine= 80.3 x10-3 – 72.5 x10-3) and unfed females
(CFU/intestine= 56.8 x10-3 -115 x10-3) (Appendix E).
After morphological (Gram stain) and molecular characterization of the isolates based on
RISA pattern analysis revealed differences of more than 30%, we found that 72.5 % were
Gram-negative and 27.4% were Gram-positive (mainly on pupae stage) (Appendix H, I).
Fifty-one presumably different isolates were selected for 16S rDNA sequencing; 26 isolates
from this group were selected for additional gyrB gene sequence analysis.
1.6.3 Identification of bacterial isolates using 16S DNA sequences
Three different predominant phyla (Proteobacteria, Actinobacteria and Firmicutes) with high
similarity percentages (97-100%) were isolated based on the similarity analysis of the
related sequences from RDP and BLAST (NCBI database) (Tables 2-3 and Fig. 1-2).
A higher frequency of the genera Enterobacter, Pseudomonas and Acinetobacter (Table 2)
was found in adults. The highest number of bacterial genera was found at the larval stage
(n=8), with the Ochrobactrum species most prominent. The genera Lysobacter,
Microbacterium, Bacillus, Streptomyces and Rummeliibacillus (Table 3) were identified in
the pupae stage. The diversity of aerobic bacterial flora in Lu. evansi from the two localities,
urban and wild environments, was represented by 27 phylotypes at the species level (Table
2-3).
Table 2. Closest phylogenetic identification of bacteria isolated from the digestive tracts of adult Lutzomyia evansi, according to their
homology with 16S rRNA gene sequences in the GenBank and RDP II databases.
COLS. Colosó; OVEJ. Ovejas. %. Percentage. Pb. Base pairs.
Table 3. Closest phylogenetic identification of the 16S rDNA sequences of bacteria isolated from the digestive tracts of immature
Lutzomyia evansi from the Ovejas locality, according to their homology with with sequences registered in the Genbank and RDP II
databases.
%. Percentage. Pb. Base pairs. L4. Fourth instar larvae. PP. Pupae
The bacterial communities in unfed females from both locations had the species A.
calcoaceticus, P. putida and E. cloacae in common (Table 2). For fed females, the species
E. aerogenes was prominent, and the presence of A. calcoaceticus was also observed
(Table 2). In males, a slight similarity with the fed female bacterial community was seen,
with P. putida and E. aerogenes present (Table 2). The species Bacillus anthracis and
Lysobacter soli were only found in the guts of Lu. evansi larvae and pupae (Table 3). O.
anthropi appeared more frequently in larvae. The analyses indicated significant variations in
the bacterial species, depending on the developmental stage and origin of the insects (Table
2-3).
1.6.4 Neighbor-joining cluster analysis of 16S rRNA and gyrB gene sequences from
bacterial isolates.
Molecular identification using 16S rDNA sequences from Lu. evansi isolates showed a high
level of correspondence with sequences deposited in BlastN at species level and among
different taxonomic divisions (Fig. 1-2). The analysis showed that most clusters had
bootstrap values ranging from 96% to 100% for bacterial isolates from Lu. evansi guts from
different stages, geographic locations and types of natural environment (wild and urban).
This was seen in the P. putida and A. calcoaceticus clusters in adults (Fig. 1) and the L. soli
and B. anthracis clusters in immature specimens (Fig. 2).
For some isolates, the identity was confirmed with the gyrB gene sequence due to difficulties
that have been reported with some genera, including Enterebocter and Pseudomonas,
particularly for environmental samples. In our study, the gyrB molecular marker worked
correctly with Pseudomonas species and other genera (Fig. 3). This result is consistent with
the results of the neighbor-joining analysis of the gyrB gene sequence, showing clusters and
similar bootstrap values (99% -100%) for most of the bacterial isolates (A. calcoaceticus,
Pantoea ananatis, O. anthropi, P. putida, P. aeruginosa, and P. otitidis) that were also
identified with the 16S rRNA gene sequence (Fig. 3).
Fig. 1. Neighbor-joining dendrogram of partial 16S rDNA sequences of bacteria obtained from adult stages of
Lutzomyia evansi collected in the municipalities of Ovejas and Colosó (Sucre Department, Colombia). Numbers in nodes represent bootstrap values. Fed females; Unfed Females; Male.
Fig. 2. Neighbor-joining dendrogram of partial 16S rDNA sequences of bacteria obtained from immature stages of Lutzomyia evansi collected in the Ovejas municipality (Sucre Department,
Colombia). Numbers in nodes represent bootstrap values. Larvae; Pupae.
However, the results were not as good for other species. Low bootstrap values (89%) were
found for the cluster related to E. hormaechei and E. cloace, and no taxonomic definition
was found for the isolates L4_Isolate 199 and L4_Isolate 188, which were identified by
analysis of the16S rDNA gene as Shinella zoogloeoides and L. soli (Fig. 3). This result may
be attributed to the absence of gyrB sequences in GenBank for these species; however,
there is some relationship with Xanthomonas campestris, a phylogenetically related species
(Fig. 3). The cultured bacterial sequences obtained in our study are available in the GenBank
database (Table 2-3).
Fig. 3. Neighbor-joining dendrogram of gyrB gene sequences of bacteria obtained from adult and
immature stages of Lutzomyia evansi collected in the municipalities of Ovejas and Colosó (Sucre
Department, Colombia). Numbers in nodes represent bootstrap values. Fed females; Unfed
Females; Male; Larvae.
1.6.5 PCR-TTGE and phylogenetic analysis of L. evansi intestinal bacteria
TTGE band profiles and analysis of partial 16S rDNA sequences indicative of different
genera associated to adult and immature stages of Lu. evansi were compared with 16S
rDNA sequence information for known bacteria listed in the GenBank databases. The
banding patterns were similar among fed females in both geographical locations (Fig. 4a),
but indicated significant variations between the bacterial communities in unfed females and
males (Fig. 4a) (Appendix M). The predominant TTGE bands for L. evansi intestinal bacteria
indicated similarity values between 99% and 100%, corresponding to E. cloacae (Fig. 4a,
band code FFC8-1A, FFO13-2A) and B. thuringiensis (Fig. 4a, band code UFC83 -3B, MC9-
6A, 8B), in adult and immature specimens (larvae and pupae) (Table 4). An uncultured
bacterium sequence was detected only in samples from the Colosó region (Fig. 4a, UFC83-
3C). All the TTGE sequences obtained in this study have been registered in GenBank.
Table 4. Closest phylogenetic classification of bacteria found in the digestive tracts of adult and
immature Lutzomyia evansi by TTGE analysis, according to their homology with 16S rRNA gene
sequences recorded in the Genbank and RDP II databases.
In the case of the larvae, we found a different banding pattern than that expressed in adults
and pupae (Fig. 4a). This pattern was related to the Burkholderia cenocepacia (Fig. 4a, band
code LO88-10A) and Bacillus gibsonii bands (Fig. 4a, band code LO88-10b). Partial 16S
rDNA sequences of the bands were identified through comparison with the sequences
available in the Genbank database and RDP II, with high similarity percentages found (97-
100%) (Table 4). The NJ topology generated showed clusters with suitable bootstrap
supports (98% - 100 %), indicating that the phylogenetic affiliations were consistent (Fig. 5).
Fig. 5. Neighbor-joining dendrogram of 16S rDNA fragment sequences obtained from the
PCR-TGGE profiles. Numbers in nodes represent bootstrap values. Male; Unfed
Females; Larvae; Fed females.
1.6.6 Bacterial diversity of Lu. evansi guts associated with blood intake and
developmental stage
In order to statistically analyze the TTGE bacterial profiles relative to the developmental and
nutritional status of the insects, banding patterns were analyzed with Gel Compare II
software. These were found to be consistent and revealed the formation of different groups
of bacterial communities with solid similarity values (100%) for the groups of fed females,
unfed females and immature insects from the Ovejas locality (larvae and pupae) (Fig. 4b).
Through Pearson correlation analysis, statistically significant differences were found
between the banding patterns associated with the bacterial communities present in the guts
of unfed females from different locations (p<0.0001); fed females from Colosó and unfed
females from Ovejas (p<0.0001); and males from both locations (p<0.0001). In immature
specimens, there were no statistically significant variations among larvae, but there were
variations between the larvae and adult stages (p<0.0001).
A simple correspondence analysis, performed with a 67.32% significance level, found
various bacterial consortia specifically associated with the guts of larvae, pupae and unfed
females (Colosó population) (Fig. 6). In contrast, the groups of males, fed females and unfed
females (Ovejas population) that were analyzed shared a bacterial species consortium,
indicating greater proximity between the microbiota of males and fed females (Fig. 6).
1.6.7 Detection of Wolbachia and Leishmania in female Lu. evansi guts
Given that Wolbachia is very important in the identification of potential strains with the ability
to interrupt the Lu. evansi lifecycle or to block the development of parasites or viruses, and
Leishmania is the most relevant parasite to control in Lu evansi, their presence in our insect
samples was examined by PCR. Wolbachia and Leishmania were not detected or found to
be amplified in the intestinal groups formed by female Lu. evansi in our conditions.
Fig. 6. Simple correspondence analysis of the intestinal bacterial flora associated with adult and immature stages and localities where Lu. evansi populations were
collected. UFO: Unfed Females from Ovejas; UFC: Unfed Females from Coloso; FFO: Fed Females from Ovejas; FFC: Fed Females from Coloso; MC: Males
from Coloso; MO: Males from Ovejas; PP: Pupae; L4: Larvae. The XLSTAT 3.04 (http://www.xlstat.com/) program was used to generate a simple
correspondence analysis.
1.7 DISCUSSION
This study represents the first report on bacteria associated with the guts of natural
populations of adult and immature Lu. evansi present in both types of environments (urban
and jungle biotypes) on Colombia’s Caribbean coast, based on a polyphasic approach
including culture-dependent and culture-independent methods. The analysis permitted the
identification of bacterial species, with a percentage of microorganisms or cultivable
phylotypes (3% - 5%) obtained by the culture-dependent method under aerobic conditions
(Sant’anna et al., 2012; Oliveira et al., 2000; Mccarthy et al., 2011; Gouveia et al., 2008).
For this reason, and to increase the range of bacteria, we examined the microbial diversity
associated with Lu. evansi guts in various development stages, using the PCR-TTGE
technique and DNA sequence analysis (Guernaoui et al., 2011; Hillesland et al., 2008;
Maleki et al., 2014). We found significant variations in the bacterial communities associated
with Lu. evansi guts, depending on the developmental stage (adult and immature stages),
the food source (female blood intake), and location.
Many studies on intestinal microbiota do not include immature stages of sand flies because
of the difficulty of finding them in natural breeding sites, the complexity of transporting them
live to the laboratory to obtain the guts, and a lack of taxonomic keys to identify them to
species level (Vivero et al., 2015; Maleki et al., 2014). In this sense, it is necessary to
highlight the usefulness of COI gene barcode sequences, which enabled the taxonomical
association of immature and adult specimens of Lu. evansi (data not shown) in a manner
that was consistent with other studies in terms of intraspecific divergence percentages
(0.002 to 0.031) and neighbor-joining cluster supports (98 % -100 %) (Contreras-Gutiérrez
et al., 2014; Contreras-Gutiérrez et al., 2013).
This approach provided information on unregistered bacterial communities belonging
exclusively to these stages (Dillon and Dillon 2004). The majority of bacterial species in
immature specimens were Gram-positive and were associated to the soil, which is directly
related to their habitat. However, most of these were transient bacteria and none were
detected in the adult stages, presumably as a result of intestinal resorption (Mukhopadhyay
et al., 2012; Peterkova et al., 2012).
A higher representation of Gram-negative bacteria was detected in females, males and
larvae belonging to the genera Pseudomonas, Acinetobacter, Enterobacter and
Ochrobactrum, while in the pupal stages all bacteria were Gram-positive and included the
genera Microbacterium, Streptomyces, Bacillus, Lysobacter and Rummeliibacillus. Studies
of gut bacteria from wild and laboratory populations of Lu. longipalpis, Phlebotomus and
different vector insects show a larger proportion of Gram-negative bacteria (Hurwitz et al.,
2011; Rani et al., 2009; Mccarthy et al., 2011). The dominance of Gram-negative bacteria
may be associated with partial or complete inhibitory activity on the development of parasites
(Plasmodium falciparum, Leishmania infantum chagasi) and the multiplication of viruses
(Dengue) in the guts of some mosquito species (Akhoundi et al., 2012).
The proportion of Gram-positive bacteria in Lu. evansi intestines was lower. The
mechanisms of action of the toxins produced by Gram-positive bacteria associated with
insect guts are related to alkaline pH, and the responses from the insects’ immune systems
are varied (Eleftherianos et al., 2013; Hurwitz et al., 2011; Rani et al., 2009; Broderick et al.,
2006). These bacteria are characterized by their ability to adapt to different environmental
niches and insect intestinal systems (Sant’anna et al., 2012), which could explain their
association with immature stages (Table 3).
We suggest that changes in the microbiota associated with the biology of Lu. evansi may be
the result of the animal, plant and soil composition in the two collection sites (Sant’anna et
al., 2012; Gouveia et al., 2008). In unfed Lu. evansi females from both locations, the main
species identified were A. calcoaceticus, P. putida and E. cloacae. A. calcoaceticus is
considered a human pathogen (Dillion et al., 1996; Doughari et al., 2011), and although the
presence of this specific species has not been previously reported in sand flies, studies on
mosquitoes (Anopheles, Aedes and Culex) and sand flies (P. argentipes, Lu. Longipalpis)
have detected the presence of the genus Acinetobacter (Hillesland et al., 2008; Manguin et
al., 2013; Malhotra et al., 2012; Pidiyar et al., 2004). This suggests that the genus
Acinetobacter is dominant in vector insects and is considered a "core genus" in the guts of
natural Anopheles populations (Manguin et al., 2013).
P. putida isolates were discovered both in the guts of unfed Lu. evansi females and in males.
Similar results were found in the guts of a natural population of Lu. longipalpis collected from
a visceral leishmaniasis-endemic area in Brazil (Jacobina, State of Bahia) (Gouveia et al.,
2008). P. putida is associated with fermented foods and plants, has good potential for
genetic transformation, and is contained within the group of non-pathogenic bacteria that
easily adapt to the physiological and immunological conditions present in the mosquito
midgut (Oliveira et al., 2000). The fact that P. putida was present in both locations and in
different stages (unfed females and males) could be associated with the food source
(Oliveira et al., 2000).
Regarding the presence of the genus Pseudomonas in Lu. evansi guts , it is necessary to
highlight the presence of P. aeruginosa and P. otitidis isolates in the guts of male and larval
populations collected in Colosó and Ovejas, respectively. These two species are
opportunistic human pathogens that appear in immunocompromised patients, and their
presence has been recorded in other insects (Table 2) (Manguin et al., 2013; Malhotra et
al., 2012; Pidiyar et al., 2004; Oliveira et al., 2001; Demaio et al., 1996). P. aeruginosa have
the capacity to synthesize antiparasitic molecules (prodiogiosine, cytotoxic
metalloproteinase, haemolysins, antibiotics and hemagglutinin) in insect guts (Dong et al.,
2009).
The discovery of E. cloacae isolates in the guts of unfed Lu. evansi females is consistent
with previously recorded findings in sand flies and mosquitoes (Ph. argentipes, Lu.
longipalpis, Ph. papatasi, Ph. sergenti, An. albimanus, An. stephensi) (Hillesland et al.,
2008; Akhoundi et al., 2012; Husseneder and Kenneth 2005). Gouveia et al., 2008 suggest
that E. cloacae does not influence parasite establishment in sand fly guts in leishmaniasis
areas. However, other studies show that Enterobacter species (Enterobacter sp. strain Eng
Z) can make insects more resistant to infections from other bacteria and can partially or fully
inhibit ooquinete, sporozoite and oocyst formation in Anopheles (Dong et al., 2009;
Husseneder et al., 2005). Other species of Enterobacter associated with Lu. evansi guts and
considered pathogenic, including E. cancerogenus, E. ludwiggii, E. aerogenes and E.
hormaechei, were detected in other insect vectors [Table 2] (Manguin et al., 2013).
There is a strong correlation between Lu. evansi gut bacteria and the potential source of
bacterial infection, which is associated with the behavior and/or eating habits of this species
(Fig. 6). The presence of B. linens, S. epidermidis, S. sciuri and S. agnetis is associated with
the guts of fed and unfed females. These bacteria are important because of their close
relationship with the skin and mucosa in both humans and animals (Chakraborty et al., 2006;
Braks et al., 1999; Meijerink and Loon et al., 1999), which constitute the main source of
blood intake for Lu. evansi females, due to their anthropophilic and/or zoophilic
characteristics (Haouas et al., 2007).
A wide variety of bacteria with entomopathogenic or genetic potential were isolated mainly
in the guts of Lu. evansi larvae and pupae (O. anthropi, L. soli, P. illinoisensi, B. anthracis,
S. zoogloeoides, among others) collected from natural breeding sites in the Ovejas
municipality (Fig. 6, Table 3). Previous literature has noted that these bacteria are
associated with plant roots, decaying plant material, straw and forage, which are
components of natural micro-habitats where immature sand flies develop (Vivero et al.,
2015). Recent studies suggest that Ochrobactrum species reduce Leishmania
establishment in the gut and negatively impact Lu. longipalpis survival (Sant’Anna et al.,
2014).
Vertical transmission of gut bacteria is an important criterion in the selection of biological
control strategies for vector insects (Volf et al., 2002). L. soli was only isolated from Lu.
evansi larvae and pupae. This suggests that it could meet this criterion even though it was
not found in adults., which could be attributed to the low probability of collecting wild larvae,
pupae and adults from the same oviposition.
In this context, the study of microbiota for paratransgenic insect generation involves the
detection and isolation of symbionts like Wolbachia and Elizabethkingia, and the
determination of their influence on the vector insect’s life cycle and on parasite or virus
obstruction (Ngwa et al., 2013). The culture-dependent and culture-independent
approaches we used failed to identify these symbionts, possibly because these intracellular
species have little representation in the gut and are difficult to isolate in conventional culture
media (Floate et al., 2006). However, it is important to emphasize the detection of the
symbiont Pa. ananatis, which is related to plants and soils and is classified as
entomopathogenic (Akhoundi et al., 2012).
Studies of gut microbiota in sand flies mainly use the 16S molecular marker via direct
sequencing of amplicons from isolates differentiated by morphology, cloned amplicons from
total DNA, TTGE/DGGE techniques, and next-generation sequencing strategies (Guernaoui
et al., 2011). However, the occurrence of multiple copies of the 16S gene in some bacteria
and the sequence heterogeneity between these copies may complicate ecological
interpretation by causing confusion about the taxonomic identity of closely related species,
as in the genera Enterobacter and Pseudomonas (Peixoto et al., 2002). Furthermore, it has
been shown that 16S gene heterogeneity is typical in bacteria isolated from natural
environments (Dahllo et al., 2000). The gyrB gene, on the other hand, exists as a single
copy in bacterial genomes, so it allows for more accurate differentiation between species
and/or populations, with some taxonomic conflicts reported in genera including
Pseudomonas, Bacillus, Enterobacteriaceae, lactic acid bacteria and Mycobacteria (Boua
et al., 2011).
The culture-independent approach permitted differentiation of the structures of gut bacteria
communities in developmental stages of natural populations of Lu. evansi. The most
important results included the discovery of variations depending on the nutritional status of
females and the wide variety of bacteria associated with immature stages. This technique
has only been previously evaluated for the analysis of bacterial communities in P. dubosqui
and P. papatasi sand flies (Guernaoui et al., 2011); the findings indicated low bacterial
community diversity dominated by Microbacterium in wild adult stages and Chloroflexi in
laboratory-reared immature stages (Guernaoui et al., 2011).
The presence and abundance of E. cloacae was noteworthy mainly in males and females
from both populations and in pupae from Colosó. These results suggest that E. cloacae is a
resident population associated to Lu. evansi, with possible transstadial transmission. Other
bacteria identified through the TTGE technique include Burkholderia cenocepacia, Bacillus
thuringiensis, Bacillus gibsonii and uncultured bacteria, which were not detected by the
culture-dependent approach.
Bu. cenocepacia was found only in Lu. evansi larvae from the Ovejas locality; this bacterial
species belongs to the symbiont group with high genetic diversity (strains) associated with
insects. Depending on the strain, it may have adverse physiological functions (growth
retardation, mortality of nymphs or immature stages, and/or sterility), positive physiological
functions (fitness or protection of the insect against entomopathogenic fungi), or metabolic
functions (N2 fixation ability) (Kikuchi et al., 2005; Estrada et al., 2001). Burkholderia
members are strictly associated with soil and are commonly found in plant roots, adjacent
areas, and other moist environments. This explains the presence of Bu. cenocepacia in Lu.
evansi larvae, which develop in this type of substrate (Kikuchi et al., 2005).
The soil bacteria B. thuringiensis and B. gibsonii are of great importance in the biocontrol of
agricultural pests and biotechnological applications (Sezen et al., 2013), and can greatly
affect the intestinal bacterial community of the host insect (Sezen et al., 2013; Tchioffo et
al., 2012). These two species have not been reported among bacterial flora associated with
sand fly guts.
Further studies would be needed to determine whether the observed changes in bacterial
communities associated with the different developmental stages and blood sources of the
insects could influence the development and transmission of the Leishmania parasite. This
could be achieved by utilizing next-generation sequencing methods for an in-depth
comparative analysis of the different feeding stages and/or parasitic infection in Lu. evansi.
1.8 CONCLUSIONS
This study is a starting point for understanding particular aspects of the interaction and
dynamic changes in gut bacteria communities in the developmental stages of Lu. evansi
from Colombia’s Caribbean coast. TTGE profiles and culture-dependent methods are
efficient and complementary. These methods work together to record and increase the
range of bacterial communities detected in Lu. evansi guts. The dominant bacterial
communities associated with Lu. evansi belong to the genera Enterobacter, Pseudomonas,
Acinetobacter and Ochrobactrum. Additionally, the large number of bacterial species
reported may have biological and genetic potential for anti-tripanosomal or biological control
assays in leishmaniasis vectors.
1.9 ACKNOWLEDGEMENTS
The authors acknowledge the support that members of the Programa de Estudio y Control
de Enfermedades Tropicales (PECET) of the University of Antioquia and the Biomédicas
Research Group of the University of Sucre in Sincelejo, Colombia provided for the
entomological survey. We would like to thank the different communities we visited during
our surveys in the municipalities of Ovejas and Colosó (department of Sucre) for giving us
access to their facilities, providing hospitality and collaborating with fieldwork. We also
acknowledge the support that Dr. Eduar E. Bejarano, Luis Gregorio Estrada and Edgar D.
Ortega (Biomedicas Research Group, University of Sucre) provided for the survey of insects
in the two locations in the department of Sucre. The funders had no role in the study design,
data collection and analysis, decision to publish or preparation of the manuscript.
1.10 REFERENCES
Amora S, Bevilaqua C, Feijo F, Alves N, Maciel M (2009) Control de Phlebotomine (Diptera: Psychodidae) Leishmaniasis Vectors. Neotrop. Entomol 38(3): 303-10. Acevedo M, Arrivillaga J (2008) Ecoepidemiology of phlebovirus (Bunyaviridae, Phlebovirus) transmitted by phlebotomine (Psychodidae, Phlebotominae). Bol Dir Malariol Sanea Amb 48: 2–16. Akhoundi M, Bakhtiari R, Guillard T, Baghaei A, Tolouei R, Sereno D, et al (2012) Diversity of the Bacterial and Fungal Microflora from the Midgut and Cuticle of Phlebotomine Sand Flies Collected in North-Western Iran. PLoS One 7(11): e50259.
Azambuja P, Garcia E, Ratcliffe N. (2005). Gut microbiota and parasite transmission by insect vectors. Trends in Parasitology 21(12): 568-572. Brazil R (2013) The dispersion of Lutzomyia longipalpis in urban areas. Revista da Sociedade Brasileira de Medicina Tropical 46(3): 263-264. Braig H, Zhou W, Dobson S, O'Neill S (1998) Cloning and characterization of a gene encoding the major Surface protein of the bacterial endosymbiont Wolbachia (Submitted.)
Broderick N, Raffa K, Handelsman J (2006) Midgut bacteria required for Bacillus thuringiensis insecticidal activity. PNAS 103(41) www.pnas.orgcgidoi10.1073pnas.0604865103.
Boua B, Fernández A, García C, Sáez-Nieto S, Valdezated S (2011) Métodos de identificación bacteriana en el laboratorio de microbiología. Enferm Infecc Microbiol Clin 29(8):601–608. Braks MA, Anderson RA, Knols BG (1999) Infochemicals in mosquito host selection: human skin microflora and Plasmodium parasites. Parasitol Today 15: 409–413. Chavshin A, Oshaghi M, Vatandoost H, Pourmand M, Raeisi A, Terenius O (2014) Isolation and identification of culturable bacteria from wild Anopheles culicifacies, a first step in a paratransgenesis approach. Parasites & Vectors 7:419 doi:10.1186/1756-3305-7-419. Chakraborty U, Chakraborty B, Basnet M (2006) Plant growth promotion and induction of resistance in Camellia sinensis by Bacillus megaterium. J Basic Microbiol 46: 186–195.
Chaniotis BN (1974) Sugar-feeding behavior of Lutzomyia trapidoi (Diptera: Psychodidae) under experimental conditions. J Med Entomol 11: 73–79.
Contreras-Gutiérrez MA, Vivero RJ, Vélez ID, Porter CH, Uribe S (2014) DNA Barcoding for the Identification of Sand Fly Species (Diptera, Psychodidae, Phlebotominae) in Colombia. Plos One 9(1): e85496. doi:10.1371/journal.pone.0085496 Cochero S, Anaya Y, Díaz-Olmos Y, Paternina-Gómez M, Luna A, Paternina L, Bejarano EE. (2007) Infección natural de Lutzomyia cayennensis cayennensis con parásitos
tripanosomatídeos (Kinetoplastida: Trypanosomatidae) en Los Montes de María, Colombia. Rev Cubana Med Trop 59 (1). Contreras-Gutiérrez MA, Vivero RJ, Uribe S (2013) DNA barcode: A tool for identification of Lutzomyia spp. From larvae. Boletín del museo entomológico Francisco Luis Gallego 5(4): 7-16. Dillon R, Dillon V (2004) The gut bacteria of insects: nonpathogenic interactions. Annu Rev Entomol 49: 71–92. De Gaio A, Gusmão D, Santos A, Berbert M, Pimenta P, Lemos F (2011) Contribution of midgut bacteria to blood digestion and egg production in Aedes aegypti (diptera: culicidae) (L.). Parasites Vectors 4:105.
Dillion J, Kordy E, Lane R (1996) The prevalence of a microbiota in the digestive tract of Phlebotomus papatasi. Ann Trop Med Parasitol 90: 669–673. Doughari H, Ndakidemi P, Human I, Benade S (2011) The ecology, biology and pathogenesis of Acinetobacter spp.: An overview. Microbes Environ 26: 101–112. Demaio J, Pumpuni C, Kent M, Beier J (1996) The migut bacterial fl ora of wild Aedes triseriatus, Culex pipens e Psorophora columbiae mosquitoes. Am. J. Trop. Med. Hyg 54: 219.
Dong Y, Manfredini F, Dimopoulos G (2009) Implication of the mosquito midgut microbiota in the defense against malaria parasites. PLoS Pathogens 5:e1000423. Dahllo F, Baillie, H. and Kjelleberg, S (2000) rpoB-Based microbial community analysis avoids limitations inherent in 16S rRNA gene intraspecies heterogeneity. Applied and Environmental Microbiology 66: 3376–3380. Estrada De Los Santos P, Bustillos-Cristales R, and Caballero-Mellado J (2001). Burkholderia, a genus rich in plant-associated nitrogen fixers with wide environmental and geographic distribution. Appl. Environ. Microbiol. 67: 2790–2798.
Eleftherianos I, Atri J, Accetta J, Castillo J (2013) Endosymbiotic bacteria in insects: guardians of the immune system?. Front Physiol.15: 4-46. doi: 10.3389/fphys.2013.00046.
Espejo R, Feijo C, Romero J, Vásquez M (1998). PAGE analysis of the heteroduplexes formed between PCR-amplified 16S rRNA genes: estimation of sequence similarity and rADN complexity. Microbiology 144: 1611–1617.
Ferro C, Morales A (1998) Flebotomos de Colombia: estudios realizados por el Laboratorio de Entomologia 1965-1997. Pp.217-233. In: G. Toro, C. A. Hernandez, J. Raad. (Eds.). Instituto Nacional de Salud 1917-1997. Una historia, un compromiso. Division de Biblioteca y Publicaciones INS, Santafe de Bogota. Fraga J, Montalvo M, De Doncker S, Dujardin J, Van der Auwera G (2012) Phylogeny of Leishmania species based on the heatshock protein 70 gene. Infect Genet Evol 10(2): 238-45.
Floate K, Kyei-Poku G, Coghlin P (2006) Overview and relevance of Wolbachia bacteria in biocontrol research. Biocontrol Science and Technology 16(8): 767-788. Gomes T, Collin N, Reynoso D, Jochim R, Oliveira F, et al (2010) Discovery of Markers of Exposure Specific to Bites of Lutzomyia longipalpis, the Vector of Leishmania infantum chagasi in Latin America. PLoS Negl Trop Dis 4(3): e638. doi:10.1371/journal.pntd.0000638. Gouveia C, AsensI M, Zahner V, Rangel E, Oliveira S (2008) Study on the bacterial midgut microbiota associated to different Brazilian populations of Lutzomyia longipalpis (Lutz & Neiva) (Diptera: Psychodidae). Neotrop Entomol 37: 597–601.
Gomez A, Yannarell A, Sims G, Cadavid-Restrepo G, Moreno C (2011) Characterization of bacterial diversity at different depths in the Moravia Hill landfill site at Medellín, Colombia. Soil Biology and Biochemistry, 43 (6): 1275–1284 doi:10.1016/j.soilbio.2011.02.018.
Golczer G, Arrivillaga J (2008) Modificación de un protocolo estándar de extracción de ADN para flebotominos pequeños (Phlebotominae: Lutzomyia). Rev. Colomb. Entomol 34: 199-202.
González C, Cabrera O, Munstermann L, Ferro C (2006). Distribución de los vectores de Leishmania infantum (Kinetoplastida: Trypanosomatidae) en Colombia. Biomédica 26(1): 64-72.
Guernaoui S, Garcia D, Gazanion E, Boumezzough A, Pesson B, Fontenille D, Sereno D (2011) Bacterial flora as indicated by PCR-temperature gradient gel electrophoresis (TGGE) of 16S rDNA gene fragments from isolated guts of phlebotomine sand flies (Diptera: Psychodidae). Journal of Vector Ecology 36 (1): S144-S147. Haouas N, Pesson B, Boudabous R, Dedet JP, Babba H, Ravel C. 2007. Development of a molecular tool for the identification of Leishmania reservoir hosts by blood meal analysis in the insect vectors. Am J Trop Med Hyg 77: 1054-9. Hillesland H, Read A, Subhadra B, Hurwitz I, McKelvey R, et al (2008) Identification of Aerobic Gut Bacteria from the Kala Azar Vector, Phlebotomus argentipes: A Platform for Potential Paratransgenic Manipulation of Sand flies. Am J Trop Med Hyg 79: 881–886. Hammer O, Harper D, Ryan P. (2001) PAST: Paleontological statistics software package for education and data analysis. Palaeontologia Electronica 4(1): 9pp. http://palaeo-electronica.org/2001_1/past/issue1_01.htm. Hurwitz I, Hillesland H, Fieck A, Das P, Durvasula R (2011) The paratransgenic sand fly: A platform for control of Leishmania transmission. Parasites & Vectors 4:82, http://www.parasitesandvectors.com/content/4/1/82
Hernández J, Hurtado A, Ortiz R, Walschburger T (1992) Unidades biogeográficas de Colombia. Págs. 105-152 en: Halffter, G. (ed.). La Diversidad Biológica de Iberoamérica I. CYTED-B Programa iberoamericano de ciencia y tecnología para el desarrollo. Instituto de Ecología, A.C., Xalapa, México.
Hebert P, Cywinska A, Ball S, Dewaard J (2003) Biological identifications through DNA barcodes. Proceedings the Royal Society of London 270: 313-321.
Hall T (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41: 95–98. Husseneder C, Kenneth J (2005) Genetically engineered termite gut bacteria (Enterobacter cloacae) deliver and spread foreign genes in termite colonies. Appl Microbiol Biotechnol 68: 360–367. Janson E, Stireman J, Singer M, Abbot P (2007) Phytophagous Insect–Microbe Mutualisms And Adaptive Evolutionary Diversification. The Society for the Study of Evolution. Evolution 62(5): 997–1012. Jansen P (2006) Identifying the main soil bacterial taxa in libraries of 16S rRNA and 16 rRNA genes. Applied and Environmental Microbiology 72 (3): 1719-23.
Kikuchi Y, Meng X, Fukatsu T (2005) Gut Symbiotic Bacteria of the Genus Burkholderia in the Broad-Headed Bugs Riptortus clavatus and Leptocorisa chinensis (Heteroptera: Alydidae). Applied And Environmental Microbiology. doi:10.1128/AEM.71.7.40354043. Kimura M (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 15: 111–120. Koeppel A, Perry E, Sikorski J, Krizanc D, Warner A, Ward D, et al (2008) Identifying the fundamental units of bacterial diversity: a paradigm shift to incorporate ecology into bacterial systematics. Proceedings of the National Academy of Sciences of the United States of America., 105, 2504e2509.
Minard G, Mavingui P, Valiente C, Minard et al (2013) Diversity and function of bacterial microbiota in the mosquito holobiont. Parasites & Vectors 6:146. Mccarthy C, Diambra L, Rivera R (2011) Metagenomic analysis of taxa associated with Lutzomyia longipalpis, vector of visceral Leishmaniasis, using an unbiased high-throughput Approach. PLoS Neglected Tropical Diseases 5(9): e1304.
Mukhopadhyay J, Braig H, Rowton E, Ghosh K (2012) Naturally occurring culturable aerobic gut flora of adult Phlebotomus papatasi, Vector of Leishmania major in the old world. PLoS ONE. 7(5): e35748. Meijerink J, Loon V (1999) Sensitivities of antennal olfactory neurons of the malaria mosquito, Anopheles gambiae, to carboxylic acids. J Insect Physiol 45: 365–373. Manguin S, Ngo C, Tainchum K, Juntarajumnong W, Chareonviriyaphap T, Michon A, Jumas-Bilak E (2013) Bacterial Biodiversity in Midguts of Anopheles Mosquitoes, Malaria Vectors in Southeast Asia. ISBN 978-953-51-1188-7, http://dx.doi.org/10.5772/55610. 2013. Malhotra J, Dua A, Saxena A, Sangwan N, Mukherjee U, Pandey N, Rajagopal R, Khurana P, Khurana J, Lal R (2012) Genome sequence of Acinetobacter sp. strain HA, isolated from the gut of the polyphagous insect pest Helicoverpa armigera. J Bacteriol 194(18):5156. doi: 10.1128/JB.01194-12.
Maleki N, Ali M, Hajikhani S, Saeidi Z, Ahmad A, Gerami M, Hasan M, et al (2014) Aerobic Microbial Community of Insectary Population of Phlebotomus papatasi. Journal of Arthropod-Borne Diseases 8(1):69.
Mohammadi A, Prasanna B (2003) Analysis of genetic diversity in crop plants. Salient statistical tools and considerations. Crop Sci. 43:1235–1248.
Moreno C, Moy F, Daniel T, Godfrey H, Cabello F (2006) Molecular analysis of microbial communities identified in different developmental stages of Ixodes scapularis ticks fromWestchester and Dutchess Counties, New York. Enviro. Microbiol 8(5): 761-772. Martin D, Williamson C, Posada D. (2005) 2RDP2: recombination detection and analysis from sequence alignments. Bioinformatics 21 (2): 260–262, doi:10.1093/bioinformatics/bth490.
Muyzer G, Waal E, Uitterlinden G (1993) Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl Environ Microbiol 59: 695–700.
Neil L (1979) Mathemathical model for studing genetic variation in terms of restriction endonuclease. Proc Natl Acad Sci Usa 76: 5269- 5273.
Ngwa C, Ckner V, Abdelmohsen R, Scheuermayer M, Fischer R, Hentschel U, Pradel G (2013)16S rRNA Gene-Based Identification of Elizabethkingia meningoseptica (Flavobacteriales: Flavobacteriaceae) as a Dominant Midgut Bacterium of the Asian Malaria Vector Anopheles stephensi (Dipteria: Culicidae) With Antimicrobial Activities. J. Med. Entomol. 50(2): 404-414 DOI: http://dx.doi.org/10.1603/ME12180. Oliveira S, Moraes B, Goncalves C, Giordano C, D’Almeida J, et al (2000) Prevalence of microbiota in the digestive tract of wild females of Lutzomyia longipalpis (Diptera: Psychodidae). Rev Soc Bras Med Trop 33: 319–322. Oliveira S, Morais B, Gonçalves C, Giordano-Dias C, Vilela M, Brazil R Et al (2001) Microbiota do trato digestivo de fêmeas de Lutzomyia longipalpis (Lutz & Neiva, 1912) (Diptera: Psychodidae) provenientes de colônia alimentadas com sangue e com sangue e sacarose. Cad. Saúde Pública, Rio de Janeiro, 17(1):229-232.1 Pidiyar V, Jangid K, Patole M, Shouche Y (2004) Studies on cultured and uncultured microbiota of wild Culex quinquefasciatus mosquito midgut based on 16s ribosomal RNA gene analysis. Am. J. Trop. Med. Hyg 70(6): 597–603. Peterkova K, Robles M, Ramalho M, Zurek L (2012) Significance of bacteria in oviposition and larval development of the sand fly Lutzomyia longipalpis. Parasites & Vectors 5:145 doi:10.1186/1756-3305-5-145.
Peixoto H, Coutinho D, Rumjanek N, Macrae A, Rosado A (2002) Use of rpoB and 16S rRNA genes to analyse bacterial diversity of a tropical soil using PCR and DGGE R.S. Letters in Applied Microbiology 35: 316–320.
Raffa K, Adams A, Broderick N, Boone C, Cardoza Y, Delalibera I, Vasanthakumar A (2008) Symbionts of invasive insects: characterization, ecological roles, and relation to invasive
potential and management strategies. Department of Entomology, University of Wisconsin-Madison, Madison, WI 53706. USDA. Research Forum on Invasive Species p. 61-62.
Rani A, Sharma A, Rajagopal R, Adak T, Bhatnagar R (2009) Bacterial diversity analysis of larvae and adult midgut microflora using culture-dependent and culture-independent methods in lab-reared and field-collected Anopheles stephensi: an Asian malarial vector. BMC Microbiol 9: 96. Rademaker J, De Bruijin F. Characterization and classification of microbes by rep-PCR genomic fingerprinting and computer assisted pattern analysis (1997) In: Caetano-Anollés G, Gresshoff PM (eds) DNA Markers: protocols, Aplications and Overviews, pp. 151-171. J. Wiley & Sons, New York. Sant’Anna M, Diaz H, Aguiar H, Waleed S, Salem A, Cavalcante R, et al (2014) Colonisation resistance in the sand fly gut: Leishmania protects Lutzomyia longipalpis from bacterial infection Parasites & Vectors 7:329.
Shanchez-Contreras M,Vlisidou I (2008) The Diversity of Insect-bacteria Interactions and its Applications for Disease Control. Biotechnology and Genetic Engineering 25: 203-244.
Sant’anna M, Darby A, Brazil R, Montoya J, Dillon V, et al (2012) Investigation of the Bacterial Communities Associated with Females of Lutzomyia Sand Fly Species from South America. PLoS ONE 7(8): e42531. doi:10.1371/journal.pone.0042531.
Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4: 406–425. doi:10.1016/ j.ympev.2008.01.019. Sezen K, Isci S, Muratoglu H, Inan K, Demirbag Z (2013) Identification and pathogenicity of bacteria from Gryllotalpa gryllotalpa L. (Orthoptera: Gryllotalpidae). Türk. biyo. müc. Derg 4 (2): 89-108. Tchioffo M, Bachar D, Abate L, Marie A, Nsango S, Shahbazkia H, et al, (2012) Midgut Microbiota of the Malaria Mosquito Vector Anopheles gambiae and Interactions with Plasmodium falciparum Infection. DOI: 10.1371/journal.ppat.1002742. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, et al. (2011) MEGA 5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Mol Biol Evol 28: 2731–2739. doi:10.1093/molbev/msr121.
Tang Y, Ward R (1998) Sugar feeding and fluid destination control in the phlebotomine sandfly Lutzomyia longipalpis (Diptera: Psychodidae). Med Vet Entomol 12(1):13-9.
Travi B, Adler G, Lozano M, Cadena H, Montoya-Lerma J (2002) Impact of habitat degradation on Phlebotominae (Diptera: Psychodidae) of tropical dry forests in Northern Colombia. J. Med. Entomol 39: 451-456.
Volf P, Kiewegová A, Nemec A (2002) Bacterial colonisation in the gut of Phlebotomus dubosqi (Diptera: Psychodidae): transtadial passage and the role of female diet. Folia Parasitol 49(1):73-7.
Vivero R, Torres-Gutierrez C, Bejarano E, Cadena H, Estrada L, Florez F, et al. (2015) Study on natural breeding sites of sand flies (Diptera: Phlebotominae) in areas
of Leishmania transmission in Colombia. Parasit Vectors 8 (116).doi:10.1186/s13071-015-0711-y.
Vivero R, Ortega E, Aparicio Y, Torres C, Muskus C, Bejarano E (2013) Flebotominos adultos e inmaduros (Diptera: Psychodidae): registros para el Caribe colombiano. Boletín De Malariología Y Salud Ambiental 3(2): 1-10.
Vargas A, Vivero R, Uribe S, Moreno C, Cadavid G (2012) Interacción de microbiotas bacterianas e insectos hospederos. Boletín entomológico Francisco Luís Gallego. ISSN 2027-4378, 4(3): 13-22.
Wang L, Lee F, Tai1 C, Kasai H (2007) Comparison of gyrB gene sequences, 16S rRNA gene sequences and DNA–DNA hybridization in the Bacillus subtilis group. International Journal of Systematic and Evolutionary Microbiology 57: 1846–1850.
Young G, Duncan M (1994) Guide to identification and geographic distribution of Lutzomyia sand flies in Mexico, the West Indies, Central and South America (Diptera: Psychodidae). Mem. Am. Entomol. Inst 54: 1-881.
Yamamoto S, Harayama S (1995) PCR amplification and direct sequencing of gyrB genes with universal primers and their application to the detection and taxonomic analysis of Pseudomonas putida strains. Appl Environ Microbiol 61:1104–1109.
Zhou W, Rousset F, O'Neill (1998) Phylogeny and PCR-based classication of Wolbachia strains using WSP gene sequences. Proc. R. Soc. Lond. B 265: 509-515.
.
PROOF OF SUBMISSION
2. CHAPTER 2. MOLECULAR DETECTION AND IDENTIFICATION
OF Wolbachia IN THREE SPECIES OF THE Lutzomyia GENUS IN
THE COLOMBIAN CARIBBEAN COAST
2.1 HIGHLIGHTS
Infection of Lutzomyia spp with Wolbachia in the Caribbean coast of Colombia.
Report of two genotypes of Wolbachia (wLcay- wLev) located in Supergroup B,
previously unknown for dipteran insects.
Detection of more than one strain of Wolbachia in Lutozmyia cayennensis
cayennensis.
Evidence suggesting the possibility of horizontal transmission of Wolbachia among
three species (Lutzomyia dubitans, Lutzomyia cayennensis, and Lutzomyia evansi).
Diversity of haplotypes in the wsp gene among the infected Lutzomyia
For graphic information related to methodology and findings see Appendixes N-Q
2.2 GRAPHICAL ABSTRACT
“Molecular detection and identification of Wolbachia in three species the Lutzomyia
genus”
2.3 ABSTRACT
The hematophagous habits of insects belonging to the Lutzomyia genus (Diptera:
Psychodidae), as well as their role as biological vectors of Leishmania species, make their
presence an indication of infection risk. In the present study, seven species of the Lutzomyia
genus were identified and screened for natural infections of Wolbachia. Collection of
sandflies was made in an endemic focus of leishmaniasis on the Colombian Caribbean
Coast (Department of Sucre, Ovejas municipality). DNA collected from Lutzomyia species
was evaluated with PCR for wsp gene amplification to screen for bacterial infection. Results
indicated 20% of infection by Wolbachia in samples of Lutzomyia tested. Endosymbiotic
Wolbachia was found in three species: Lutzomyia cayennensis and Lutzomyia dubitans,
with positive pools= 3; 8.5% for both species, and Lutzomyia evansi, with a positive pool=
1; 2.8%. Two Wolbachia strains (genotypes) found in the Lutzomyia genus and previously
unknown in dipteran insects. wLev in Lutzomyia dubitans, Lutzomyia cayennensis, and
Lutzomyia evansi; while wLcay it was found only in Lutzomyia cayennensis. Phylogenetic
analysis indicate that the Wolbachia strains (wLcay- wLev) are located in Supergroup B.
This study shown evidence for infections of more than one strain of Wolbachia in L.
cayennensis; also suggesting the possibility of horizontal transmission of Wolbachia among
three species (representing three subgenera of Lutzomyia) and diversity of haplotypes in
the wsp gene among the groups of infected Lutzomyia.
Key Words: Wolbachia, Phylogroup wLeva, wsp, Lutzomyia, Colombia.
2. 4 INTRODUCTION
Los Montes De María is a region located on the Caribbean coast of Colombia which has
been historically considered focus of several clinical forms of leishmaniasis (Travi et al.,
2002; Perez-Doria et al., 2008). In this region, the municipality of Ovejas (department of
Sucre) shows particular epidemiological interest due to the endemic character of
leishmaniasis that is occurring in urban, peri-urban, and rural areas there (Le Pape, 1992;
Camacho et al., 1997). Additionally, the diversity of Lutzomyia species (vector insects)
present in Ovejas is high, and most of species are implicated in leishmaniasis transmission
(Cochero et al., 2007, Paternina et al., 2011; Paternina, 2012).
In Latin America, vector control campaigns developed for leishmaniasis have mainly focused
on chemical control using synthetic pesticides such as pyrethroids and chlorofluazuron
(Mikery et al., 2012). The use of biological alternatives or their derivatives (bacteria, sex
pheromones, entomopathogenic fungi, and toxic plants) have also been considered; but few
are used by vector control agencies in Colombia (Maroli and Khoury, 2006; Sanchez and
Romero, 2007; Warburg and Faiman, 2011). The medical importance of phlebotomine sand
flies, particularly those of the Lutzomyia species, points to the need to consider new and
more effective control measures; including some that have already been used for the control
of other insects transmitting vector-borne diseases. Among such methods is transfection
with bacteria of the Wolbachia genus (Wallace, 2013; Aguilera et al., 2011).
Bacteria in the genus Wolbachia are intracellular microorganisms belonging to α-
proteobacteria (Rickettsia); have maternal inheritance; and are commonly found in
intestines, salivary glands, ovaries, and thorax of insects (Werren et al., 2008; Das et al.,
2014). These bacteria may affect the reproductive capabilities of their hosts through diverse
mechanisms, generating effects such as the death of male offspring as well as feminization
and cytoplasmic incompatibility (CI) (Werren and Windsor, 2000). The pathogenic effect of
some phenotypes of Wolbachia is now being evaluated on viruses such as Dengue and
Chikungunya, as well as on filarial worms and Plasmodium (Moreira et al., 2009; Brelsfoard
and Dobson, 2009; Walker et al., 2011; Hughes et al., 2011).
The use of certain strains of Wolbachia is considered to be a promising alternative for
decreasing population density of Lutzomyia species and interfering with the multiplication of
parasites, and, as a result, Leishmania transmission (Ono et al., 2001; Azpurua et al., 2010).
Thus, initial research efforts have been directed toward screening the presence and
circulation of Wolbachia strains in these and other vectors (Mirkery et al., 2012). In the
Americas, only five Lutzomyia species have been found to have low levels of Wolbachia
infection, with strains belonging to the A and B supergroups: Lu. cruciata in México; Lu.
trapidoi and Lu. vespertilionis in Panamá; and Lu. whitmani in Brazil (Ono et al., 2001;
Azpurua et al., 2010; Mirkery et al., 2012). In Colombia, the only species found to be positive
for Wolbachia was Lu. shannoni (Ono et al., 2001). Supergroup A, also includes the
Wolbachia species detected in Sergentomyia and Phlebotomus (Ono et al., 2001).
Currently, genes (16S rRNA, ftsZ, Wsp gene) and techniques (Multilocus Sequence Typing
technique MLST) are being used to validate the identification and phylogeny of strains of
Wolbachia (Baldo and Werren, 2007; Sanches et al., 2011), as well as their levels of
infection in insects through the use of real-time PCR (Werren and Windsor, 2000; Joanne
et al., 2015). However, in the case of sand flies, most studies report sequences of wsp
genes, indicating only the detection and location of the strains in supergroups (Ono et al.,
2001; Azpurua et al. 2010; Parvizi et al., 2013). This suggests a greater availability of
sequences in GenBank that may be used to contrast the identity of other strains found. The
aim of the present study was the molecular detection and identification of the endosymbiont
Wolbachia in natural populations of Lutzomyia species found in the municipality of Ovejas
on the Colombian Caribbean Coast.
2.5 MATERIALS AND METHODS
2. 5.1 Ethics Statement.
Collection of sand flies was done according to the parameters of Colombian decree number
1376, which regulates the collection of specimens of wild species of biological diversity for
non-commercial research. No specific permits were required for this study. The sand flies
were collected on private property and permission was received from landowners prior to
sampling.
2.5.2 Phlebotomine survey, processing, and identification.
Sand flies were collected in peri-urban environments in the municipality of Ovejas (75°13’
O; 9°31’N; 277 m.a.s.l) during an entomological survey performed between February 21 and
27, 2013 (Appendix A). This location is classified as a tropical dry forest ecosystem
(Hernandez et al., 1992). Collection was done using CDC white light traps, located indoors
and near homes, overnight, between 17:00 and 06:00 hours. Shannon traps were also used
for collection near homes (Appendix B). Additionally, diurnal collection using a mouth
aspirator was done in the vicinity of nocturnal trapping sites. Collected specimens were kept
dry in 1.5 ml vials, and were transported to the laboratory with dry ice. Once at the laboratory,
they were kept at -20°C. The head and last three abdominal segments were removed from
the specimens in order to perform taxonomic identification following the Young and Duncan
classification system (Young and Duncan, 1994). The thorax and remaining abdominal
segments were stored at -20°C until DNA extraction.
2.5.3 Pool formation and DNA extraction.
Following identification, males and females were separated by species in groups with a
variable number of individuals (6 to 10) in 1.5 ml Eppendorf tubes. The formation of groups
in this way is justified by differences in the abundance of species in the study area, which
complicates statistical interpretation regarding Wolbachia infection rates, but increases the
success of molecular detection of bacteria found in natural populations of Lutzomyia in the
conditions encountered. In addition, the samples were all collected at the same time.
DNA extraction was done according to the high salt concentration protocol (Collin et al.,
1987, Uribe et al., 2001). Finally, 1% agarose gel electrophoresis was performed in order to
visually analyze the quality of the DNA obtained, and concentrations were estimated by
Spectrophotometry (Thermo Scientific™ NanoDrop). Additionally, a partial segment of COI
gen (Fig. 7) and the spacer region (ITS) between the 23S and 16S ribosomal gene (Fig. 7),
was amplified in order to evaluate the quality of DNA present, as well as the absence of
PCR inhibitors (Braig et al., 1998).
2.5.4 PCR, Cloning and DNA fragment sequencing for Wolbachia wsp gene.
Primers wsp81F (5’-TGGTCCAATAAGTGATGAAGAAAC-3’) and wsp691R (5’-
AAAAATTAAACGCTACTCCA-3’) were used to amplify a partial fragment (590 bp – 632 bp)
of the gene coding for the main surface protein of endosymbiotic Wolbachia (wsp) (Fig. 1)
(Braig et al., 1998) (Appendix N). The reaction mix used to detect Wolbachia included 80 ng
of sample DNA according to the conditions previously described (Werren et al., 1995; Zhou
et al., 1998), High fidelity Taq DNA Polymerase (Thermo Scientific) was employed, as well
as a conventional thermocycler (BIOMETRA). As a PCR positive control, DNA from ten
Aedes (Stegomyia) aegypti larvae (kindly donated by the insectary of PECET group)
infected under laboratory conditions with a reference strain of Wolbachia (Supergroup A,
strain wMel) were included (Fig. 1). As a PCR negative control, ultrapure water and DNA of
Stegomyia aegypti without Wolbachia was included (Fig. 1).
Wsp gene amplicons were ligated into JET1.2 vectors (Thermo Scientific) and then
transformed into DH5α Escherichia coli. At least five independent clones were sequenced
for each positive sample involved in detecting Wolbachia strains in order to identify
polymerase errors and to generate consensus for further analysis, as well as to mitigate the
potential of a mixed infection in the pools (Zhou et al., 1998). Partial products of wsp were
verified by PCR from the clones and sequenced in both directions using primers from
Macrogen Inc., Korea. The PCR product of the JET1.2 vector commercial kit from Thermo
Scientific was used to monitor the cloning and PCR assays. As cloning control, plasmid were
used without the inserts, competent cells were used without DNA, and a plasmid was used
with a previously studied PCR product.
2.5.5 Identity of Wolbachia strains and their positions in phylogroups.
The wsp gene sequences obtained from Wolbachia were verified and edited with Bioedit
v.7.2.5 (Hall, 1999) in order to obtain detected consensus sequence for every Lutzomyia
species. The sequences in this study were initially compared with gene sequences of
Wolbachia, which were available in the National Center for Biotechnology Information
(NCBI) database. Searches were done using BLASTN (http://www.ncbi.nlm.nih.gov)
(Altschul et al., 1997). The nucleotide alignment reading framework reported by O'Neill
(ftp://ftp.ebi.ac.uk/pub/databases/embl/align/; Access Number DS42468) was considered,
which suggests starting the analysis by translating the sequences to amino acids as a guide
to align the DNA sequences of the wsp gene (Ono et al., 2001; Zhou et al., 1998).
The Clustal W (Higgins et al., 1992) and Muscle (Robert, 2004) algorithms incorporated in
MEGA 6 (Tamura et al., 2007) were used to obtain the final alignment of sequences of wsp
genes obtained in Lutzomyia and reported in GenBank (Appendix A). Verification of
recombination events and the presence of chimeras was performed with RDP4
(Recombination Detection Program version 4) software (Martin et al. 2005) (Appendix Q),
using all sequences of wsp obtained in this study in order to ensure the accuracy of
nucleotide variability with respect to previously reported sequences in GenBank (Appendix
A). Patterns of genetic divergence (nucleotide composition, number of haplotypes, variable
sites) and K2P genetic distances were evaluated using Bioedit v.7.2.5 (Hall, 1999) and
DNAsp 5.0 software (Librado and Rojas, 2009).
All aligned sequences (= haplotypes) of wsp genes obtained in this study and reported in
GenBank were exported using MEGA software (Tamura et al., 2007). Subsequently, the
identities and relationships of the Wolbachia strains obtained in our study was determined
by performing a phylogenetic inference using the Bayesian method (number of generations
= 1,000,000) with the MrBayes 3.0 software (Ronquist and Huelsenbeck 2003) under the
substitution model GTR + G (number of estimated parameters k = 139; AIC Akaike
information criterion = 7807.8819); with jModeltest 2.1.4 software (Darriba et al., 2012); and
Phyml 3.0 software. All of the sequences obtained in the present study (KR907869,
KR907870, KR907871, KR907872, KR907873, and KR907874) were submitted to GenBank
(Appendix A).
2.5.6 PCR amplification of the HSP-70N Leishmania gene in female groups.
A PCR test was done to screen for Leishmania infection in females of Lutzomyia. The
primers used were HSP70-F25 (5’-GGACGCCGGCACGATTKCT-3’) and HSP70-R617 (5’-
CGAAGAAGTCCGATACGAGGGA-3’), which amplify a 593 bp partial segment of the HSP-
70N gene (coding for Heat shock protein 70) (Fraga et al., 2012). PCR testing was done
following the conditions and thermal profile described by Fraga et al., (2012) and Auwera et
al., (2013). As a positive control, DNA from Leishmania panamensis (reference strain
UA140) and Leishmania braziliensis (reference strain UA 2903), which was kindly provided
by the PECET group of the Universidad de Antioquia, was included.
2.6 RESULTS
2.6.1 Taxonomic identification of sand flies.
A total of 325 individuals were collected from peri-urban environments. Morphological study
following taxonomic guides allowed for the identification of seven species: Lu. evansi, Lu.
trinidadensis, Lu. cayennensis, Lu. dubitans, Lu. gomezi, Lu. rangeliana, and Lu. atroclavata
(Table 5). Lu. dubitans (number of individual specimens = 110; 33.8%) and Lu. cayennensis
(number of individual specimens = 107; 32.2%) were the species found in the highest
proportions (Table 5). Sexing and taxonomic assignation to species level allowed the
formation of 35 pools containing from 6 to 10 individuals that were processed for molecular
detection of Wolbachia (Table 5).
Table 5. Formation of pools of Lutzomyia spp., for detection of infection by Wolbachia or
Leishmania in peri-urban environments in the municipality of Ovejas (Department of Sucre,
Colombia).
2.6.2 Wolbachia (wsp gene) infection.
As expected, all PCR fragments of the wsp gene were approximately 600 bp in size, and
were obtained from three species: Lu. dubitans, Lu. cayennensis and Lu. evansi. Out of a
total of seven groups, 20% were positive for Wolbachia (Fig. 7; Table 5). Low relative
infection rates were found in Lu. dubitans and Lu. cayennensis (Positive pools= 3; 8.5% for
both species) (Table 5). In Lu. evansi (Positive pools= 1; 2.8%), only one group was positive
(Fig 7, Table 5). Noteworthy is the presence of Wolbachia in both sexes of Lutzomyia,
particularly in Lu. dubitans (♂= 5.7%; ♀= 2.8%) and Lu. cayennensis (♂= 5.7%; ♀= 2.8%)
(Table 5), while in Lu. evansi it was detected only in males. Lu. rangeliana, Lu. trinidadensis,
Lu. gomezi, and Lu. atroclavata were all negative for Wolbachia. The positive control strain
wMel successfully amplified in all PCR assays of the wsp gene for Wolbachia and the
negative controls showed no PCR products (Fig. 7).
04/05/2015 HORA FINAL
pendiente Volumen Reaccion 50 10
#Tubo #Pozo Código muestra Taxon DNA (uL) Resultado reactivo Concentración1x(uL)
1 MP 100pb Fermentas 2 dH2O - 32,2 322,0
1 2 75 Lu. evansi (H) 4 Positivo Buffer NH4(SO4)2 (10X) 1X 5,0 50,0
2 3 42 Lu. evansi (H) 4 Positivo MgCl2 (50mM) 2,5 mM 2,5 25,0
3 4 64 Lu. evansi (H) 4 Positivo DNTPs (5mM c/u) 200 uM c/u 2,0 20,0
4 5 57 Lu. evansi (H) 4 Positivo Primer LCO (10uM) 0,3 uM 1,5 15,0
5 6 51 Lu. evansi (H) 4 Positivo Primer HCO (10uM) 0,3 uM 1,5 15,0
6 7 gr2 Lu. evansi (H) 4 Positivo Taq polimerasa (5u/ul) 0,03uM 0,3 3,0
7 8 gr1 Lu. panamensi (H) 5 Positivo BSA 1,0 10,0
8 9 56 Lu. panamensi (Ma) 5 Positivo 0,0 0,0
9 10 gr10 Lu. evansi (Ma) 5 Positivo - 0,0 0,0
10 11 gr16 Lu. gomesi (H) 5 Positivo Total MIX 46,0
12 CN Control Negativo 4 Negativo DNA (*) 4,0
1 MP 100pb Fermentas 2
-
Foto Gel de Agarosa
NOTAS
PROCEDIMIENTO: PCR-Barcoding COI Lutzomyia, Electroforesis con Z-Vision, Primer LCO1490 ((5’ GGTCAACAAATCATAAAGATATTGG-3’)
Folmer et al. 1994), Primer HCO 2198 ((5’ TAAACTTCAGGGTGACCAAAAATCA-3`) Folmer et al. 1994).
CODIGO DE EXPERIMENTO DE PCR Ficha N° 1
Marcador molecular NUMERO DE REACCIONES
PERFIL TERMICO
Perfil térmico: Ciclo 1: 94oC/5’ Ciclo 2: (94/1’,45/1’50’’,72/1’50’’)35X,
Ciclo 3: 72 oC /5’, Ciclo 4: 4 oC /
infinito Folmer et al. 1994
RESPONSABLES Rafael Vivero Gómez
TIPO Y PRESERVACION DE MUESTRA (seleccione valor de la lista) Agua libre de nucleasas(-20ºC)
METODO DE EXTRACCION (seleccione valor de la lista) Buffer de macerador (Grind Buffer)
LABORATORIO DE SISTEMATICA MOLECULAR .- FICHA INFORMATIVA PARA PCR
NOMBRE DEL PROYECTO Verificación por PCR COI de ADN amplificable en los pooles de los grupos de Lutzomyia evaluados para Wolbachia y Leishmania Doc
FECHA (dd/mm/aaaa) HORA INICIO 3:00 P. M 7:00 p. m.
Fig. 7. PCR from Lutzomyia genomic DNA pools. a) PCR amplification of COI gene fragment to
evaluate the quality of DNA and absence of inhibitors from genomic DNA pools; b) PCR for ITS to
estimate the quality of available bacterial DNA; c) PCR amplification from a partial fragment of wsp
gene with primers wsp in different species of Lutzomyia. PCR product were evaluated in
electrophoresis gel 1%.
2.6.3 Wolbachia identity based on comparisons with previous sequences and assignation
of phylogroups using wsp gene sequences.
Based on DNA sequences, the presence and identity of Wolbachia in Lu. dubitans, Lu.
evansi, and Lu. cayennensis was determined. Nucleotide composition analysis showed a
high content of adenine and thymidine (64.3%), while the content of guanine and cytosine
was only 35.7%. Nucleotide variability analysis showed only 14 variable sites among
sequences (Appendix O). Comparative analysis of Wolbachia wsp sequences obtained from
Lutzomyia species, as well as those reported in GenBank (Appendix P), revealed high
nucleotide variability in the final alignment, which fluctuated between 218 and 221 nucleotide
variable sites, out of the 449 bp included in the final alignment. In contrast, low nucleotide
variability (1-2 nt) was detected among the clones analyzed for wsp gene in the same group
of species.
In the Bayesian inference, 59 partial sequences of the Wolbachia wsp gene were included
from strains related to arthropods, which are located in supergroups A and B, representing
24 groups with 57 previously detected strains from a wide number of insects (Appendix A).
Five haplotypes of the wsp gene from HP1 to HP5 were found in Colombian Lutzomyia,
which were described with short codes that allow the location of Wolbachia genotypes to be
determined in relation to the species in which they were detected and that facilitate locating
them in the tree created with all the sequences by Bayesian inference.
Description codes include the species initials Lev: Lutzomyia evansi, Lcy: Lutzomyia
cayenensis, and Luduv: Lutzomyia dubitans followed by the letters ov, which refer to the
place where they were collected in Colombia (ov: municipality of Ovejas) and numbers
corresponding to specimens with the same sequence. The five haplotypes
HP1=WbLevov75; HP2= WbLcyov56/WbLdubov45; HP3= WbLcyov59; HP4=
WbLdubov43; and HP5=WbLdubov51 differ due to between 2 and 11 insertion-deletion and
point mutation events. The values of Kimura pairwise genetic distances among the
haplotypes WbLevov75, WbLcyov56, WbLdubov45, WbLdubov43 were between 0.004 and
0.007. WbLcyov59 and WbLevov75 exhibited identity percentages of 99.6%, indicating
natural infection with the same Wolbachia strain for females of Lu. cayennensis, Lu.
dubitans, and Lu. evansi (Table6). Conversely, higher values for genetic distances (0.017-
0.021) and lower values for sequence identity (97.9%) were obtained when comparing the
WbLcyov59 haplotype with the remaining haplotypes of the wsp gene, suggesting the
existence of a different Wolbachia strain present only in Lutzomyia cayennensis (♂) (Table
6).
The haplotypes WbLevov75, WbLcyov56, WbLdubov45, and WbLdubov43; representing
the wLev strain, (Table 6) showed low levels of genetic distances as compared to the strains
from supergroup B, as well as showing affinity for strains from the groups Unif (wUnif= 0.017-
0.026; wInd= 0.014-0.019), Con (wSit= 0.020-0.026; wCon=0.022-0.027; wGel=0.014-
0.019; wStri= 0.019-0.024), and Per (wPer= 0.014-0.020) (Table 6). In contrast, high values
of genetic distances (0.234-0.255) were found by comparing the strains clustered into the
supergroup A when wNiv from Aedes (Stegomyia) niveus was included (Table 6) (Appendix
P).
The haplotype wLcy showed low genetic distance values in comparison to strains located in
subgroup B, such as Prn (wPrn= 0.017) (Table 6); identified in the phlebotomine
Phlebotomus perniciosus; strains wInd, wUnif (Group Unif= 0.019) out of group Unif; strains
wSit (0.024), wCon (0.027) wGel (0.019), wStri (0.019) out of group Con, detected in
mosquito species Mansonia indiana, Mansonia uniformis and Culex gelidus; and in
homopterous Laodelphax striatellus, respectively (Table 6, Appendix A). Both wLev and
wLcy showed higher values in genetic distances in relation to Wolbachia strains in
supergroup A, among which wNiv (0.240), wPa (0.230) and wSub (0.231) are highlighted.
Percentage identity based on alignment, which includes a large number of available
sequences, suggests that wsp gene sequences from Wolbachia present considerable intra-
and inter-genic variation. This can be summarized as follows: between sequences of the
same strain there is 0.4% variation; between strains of the same group there is 1- 2.1%
variation; between strains of different groups located in the same supergroup there is 1.9 -
2.7% variation; and between strains of different supergroups there is 13.4 - 25.5% variation
(Table 6). These percentages are consistent with the established ranges for the separation
of strains and current assignment of Wolbachia groups (Zhou et al., 1998).
Table 6. Values of genetic distances K2P and percent of sequence identity based
on alignment of the wsp gene among strains of Wolbachia in the Leva, Con, Unif,
Pern groups (Supergroup B) and some strains (WNiv, wWhi) of supergroup A.
The superscripts indicate the percent identity between the sequences and were determined only
among some strains representing different levels of variation: within the same strain, between strains
of the same groups, between strains of different groups, among strains from different supergroups.
Phylogenetic relationships estimated by Bayesian inference grouped the strains wLev and
wLcy in a new group called "wLeva" (branch support of 0.97), located on the supergroup B,
based on the robustness of clade posterior probability (0.71) with respect to supergroup A
(Fig. 8). The Leva group has a close phylogenetic relationship (0.98) with the Dei, Crag,
Unif, and Prn groups (Fig. 8).
2.6.4 Leishmania infection.
A total of 18 female groups composed of 171 individual specimens of Lu. evansi, Lu.
dubitans, Lu. cayennensis, Lu. gomezi, Lu. trinidadensis, Lu. rangeliana, and Lu.
atroclavata, were negative for Leishmania infection, as confirmed through PCR diagnosis of
the HSP-70N gene (Table 5).
Fig. 8. Phylogenetic relationships of Wolbachia strains inferred using wsp gene including
the ones detected in Lutzomyia species (Blue) collected in Ovejas (Sucre, Colombia).
Numbers in nodes represent Bayesian posterior probabilities. Reconstruction performed
MrBayes (version 3.0). The wMel positive control is indicated in red.
2.7 DISCUSSION
This study reports a natural infection of endosymbiotic Wolbachia in natural populations of
Lu. dubitans, Lu. cayennensis, and Lu. evansi for the first time from the peri-urban
environment of a leishmaniasis focus transmission on the Caribbean coast of Colombia. The
estimated Wolbachia infection rate in the species studied was 20.0%, which is consistent
with the average reported for Neotropical insects (Jiggins et al., 2001; Werren et al., 2008;
De Oliveira et al., 2015). Different studies with similar sample sizes (between 141 to 547
individuals) and grouping of individuals by species (10 to 100), show that correct estimates
may influence an increase in infection rates up to 90% (Cui et al.; 1999; Sanches et al.,
2011).
Lu. evansi and Lu. dubitans were found to be infected with Wolbachia by a strain we called
wLev, while Lu. cayennensis was infected with both strains of Wolbachia (wLcay, wLev). In
the first place, the fact that different species of Lutzomyia were found in three different
groups or subgenera (Verrucarum Migonei, Micropygomyia) which tested positive for the
same strain of Wolbachia, suggests the possibility of horizontal transmission (Hurts and
Jiggins, 2000; Jiggins et al., 2001; Ono et al., 2001; Werren et al., 2008; Saridaki and
Bourtzis, 2012). This is consistent with the presence of these species in a uniform ecological
region (similar collection localities) (Veneti et al., 2004; Martinez et al. 2014). With regard to
the species Lu. cayennensis, the possibility exists that Wolbachia infected it more than once,
which would explain the presence of two different strains. In some studies, some Wolbachia
strains belonging to different subgroups or groups have been observed to infect the same
host species (Martinez et al. 2014, Veneti et al. 2004).
The groupings based on Wolbachia wsp gene sequences included in this study are well
supported and are consistent with those previously reported for supergroups A and B (Ono
et al., 2001; Ruang-Areerate et al., 2003). The Wolbachia strains wLev and wLcay reported
in this study appear to be included as a group in supergroup B, which is common in
arthropods. Wolbachia strains wLev and wLcay show close relationships to the Prn, Con,
and Unif groups of supergroup B (Ono et al., 2001). Proximity to the group Prn is highlighted,
because the wPrn strain was found in the host Ph. pernisiosus (Ono et al., 2001). In contrast,
strains wLcay and wLev located in this group do not appear to show a close relationship to
Wolbachia strains in group Whi (Lu. whitmanni, Lu. shannoni), which are detected in species
of the subfamily Phlebotominae, even though they have a closely related host and a similar
continental distribution (Young and Duncan, 1994).
Interestingly, some strains of supergroup B (wPip, WBoL, wVul) have phenotypes
associated with feminization of males, as well as mortality and cytoplasmic incompatibility
(Jiggins et al., 2001; Werren et al., 2008; Bouchon et al., 1998). Each of these reproductive
alterations are advantageous to Wolbachia as they are correlated to an increase in infected
females. This group of strategies is called reproductive parasitism (Werren et al., 2008).
Partial wsp gene sequences exhibited informative characters useful in the identification of
Wolbachia strains detected in the Lutzomyia genus. The wsp gene has evolved at a much
faster rate than any previously reported gene in Wolbachia (Braig et al., 1998), and, for this
reason, its nucleotide variability facilitates the division into Subgroups and Groups in a
consistent manner (Endo et al., 1996; Zhou et al., 1998, Joanne et al., 2015). The nucleotide
variability of the wsp gene and the combination of different primers in PCR reactions is an
approach that enables a fast assigning of unknown strains to a particular group, due to its
specificity and lack of cross reactions (Zhou et al., 1998).
The species Lu. evansi, Lu. dubitans, and Lu. cayennensis were found positive for
Wolbachia infection both by PCR and by sequencing of the wsp gene, and have a history of
natural infection by species of Leishmania (Cochero et al., 2007; Paternina et al., 2012).
However, in this study, Leishmania was not detected in them. Other researchers have
reported differences in the sensitivity of different molecular markers and conventional tests
(PCR, RFLP, isozyme patterns, Hybridization with DNA probes) for the detection, diagnosis,
and identification of Leishmania species; and they propose that exploring the possibility of
viewing promastigotes by the dissection of digestive tracts and the implementation of more
variants of PCR with genus specific primers (Azpurua et al., 2010) would be beneficial.
It is desirable to advance understanding of the biology and spread of Wolbachia bacteria in
relation to Leishmania infection, given the fact that different studies show the impact of this
bacterium in host-parasite interaction with a potential use in reducing the risk of infectious
diseases caused by parasites and transmitted to humans by insects (Brelsfoard and
Dobson, 2011). Additionally, it has been found that the presence of some strains of
Wolbachia in mosquitoes can regulate the expression of genes involved in the immune
responses, resulting in inhibition of the replication, multiplication, or resistance to the
proliferation of viruses, parasites, and microfilariae (Munikrishnappa et al., 2014).
Our study represents a significant advance in the understanding of natural infections of
Wolbachia in Lutzomyia. Further studies are needed to investigate the dynamics of natural
infection of Wolbachia and Leishmania in natural populations of Lutzomyia present in other
areas of leishmaniasis transmission.
2.8 ACKNOWLEDGEMENTS
We are grateful for the support given by members of the Program of Study and Control of
Tropical Diseases (PECET) of the University of Antioquia and the Biomédicas Research
Group of the University of Sucre, Sincelejo, Colombia during this entomological survey. We
thank the different communities in the municipality of Ovejas (department of Sucre) visited
during our surveys for giving us access to their facilities, providing hospitality, and
collaborating with fieldwork. We are also grateful for the help in field sampling of Horacio
Cadena, researcher of the Program for Study and Control of Tropical Diseases of the
University of Antioquia, and Luis Estrada and Edgar Ortega researcher of the Biomédicas
Research Group of the University of Sucre, Sincelejo. This project is part of the activities
associated with a consortium financed by Departamento Administrativo de Ciencia,
Tecnología e Innovación (code # 357-2011 U.T EICOLEISH - “Comprehensive Strategy for
the Control of Leishmaniasis”). Acknowledge the financial support provided by the
Departamento Administrativo de Ciencia, Tecnología e Innovación (National Call 528 for
doctoral studies in Colombia, 2011).
2.9 REFERENCES
Aguilera, G,, Padilla, B., Flórez, R., Rubio, J., Acuña, J., 2011. ARN interferente: Potenciales usos en genómica funcional y control genético de Hypothenemus hampei (Coleoptera: Scolytinae). Revista Colombiana de Entomología 37(2), 167-172.
Azpurua, J., De La Cruz, D., Valderama, A., Windsor, D., 2010. Lutzomyia Sand Fly Diversity and Rates of Infection by Wolbachia and an Exotic Leishmania Species on Barro Colorado Island, Panama. PLoS Negl Trop Dis 4(3), e627. doi:10.1371/journal.pntd.0000627.
Auwera, G., Maes, I., De Doncker, S., Ravel, C., Cnops, L., et al., 2013 Heat-shock protein 70 gene sequencing for Leishmania species typing in European tropical infectious disease clinics. Euro Surveill 18(30).
Altschul, S., Madden, T., Schaffer, A., Zhang, J., Zhang, Z., et al., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25, 3389–3402.
Brelsfoard, C., Dobson, S., 2009. Wolbachia-based strategies to control insect pests and disease vectors. AsPac J. Mol. Biol. Biotechnol 17(3), 55-63.
Baldo, L., Werren, J., 2007. Revisiting Wolbachia Supergroup Typing Based on wsp: Spurious Lineages and Discordance with MLST. Current Microbiology 55, 81-87.
Bouchon, D., Rigaud, T., Juchault, P., 1998. Evidence for widespread Wolbachia infection in isopod crustaceans: molecular identification and host feminization. Proc. R. Soc. Lond. B 265, 1081-1090.
Braig, H., Zhou, W., Dobson, S., O'Neill, S., 1998. Cloning and characterization of a gene encoding the major Surface protein of the bacterial endosymbiont Wolbachia. J Bacteriol. 180(9), 2373-8.
Brelsfoard, C., Dobson, S., 2011. An update on the utility of Wolbachia for controlling insect vectors and disease transmission. AsPac J. Mol. Biol. Biotechnol 19(3), 85 - 92.
Camacho, M., Caraballo, L., Barrios, H., Correa, I., Figueroa, N., 1977. Kala-azar: un foco en el departamento de sucre. Tribuna Médica 56, 33-4.
Cochero, S., Anaya, Y., Días, Y., Paternina, M., Luna, A., Paternina, L., Bejarano, E., 2007. Infección natural de Lutzomyia cayennensis cayennensis con parásitos tripanosomastídeos (Kinetoplastida: Trypanosomatide) en los Montes de María, Colombia. Revista Cubana de Medicina Tropical 61(3), 59-66.
Cui, L., Chang, S., Strickman, D., Rowton, E., 1999. Frequency of Wolbachia infection in laboratory and held sand by (Diptera: Psychodidae) populations. J. Am. Mosq. Control Assoc 15, 571-572.
Darriba, D., et al., 2012. jModelTest 2: more models, new heuristics and parallel computing.Nat. Methods. 9:772.
De Oliveira, C., Gonçalves, D., Baton, L., Shimabukuro, P., Carvalho, F., Moreira, L., 2015. Broader prevalence of Wolbachia in insects including potential human disease vectors. Bull Entomol Res 105(3), 305-15. doi: 10.1017/S0007485315000085.
Das, B., Satapathy, T., Kar, S.K., Hazra, R.K., 2014. Genetic structure and Wolbachiagenotyping in naturally occurring populations of Aedes albopictus across con-tiguous landscapes of Orissa, India. PLoS ONE 9, e94094.
Endo, T., Ikeo, K., Gojobori, T., 1996. Large-scale search for genes on which positive selection may operate. Molec. Biol. Evol 13, 685-690.
Fraga, J., Montalvo, M., De Doncker, S., Dujardin, J., Van der Auwera, G., 2012. Phylogeny of Leishmania species based on the heatshock protein 70 gene. Infect Genet Evol 10(2), 238-45.
Hughes, L., Koga, R., Xue, P., Fukatsu, T., Rasgon, JL., 2011. Wolbachia Infections Are Virulent and Inhibit the Human Malaria Parasite Plasmodium Falciparum in Anopheles Gambiae. PLoS Pathog 7(5): e1002043. doi:10.1371/journal.ppat.1002043.
Higgins, D., et al., 1992. CLUSTAL W: improved software for multiple sequence alignment. Comput. Appl. Biosci 8, 189-191.
Hernández, J., Hurtado, A., Ortiz, R., Walschburger, T., 1992. Unidades biogeográficas de Colombia. Págs. 105-152 en: Halffter, G. (ed.). La Diversidad Biológica de Iberoamérica I. CYTED-B Programa iberoamericano de ciencia y tecnología para el desarrollo. Instituto de Ecología, A.C., Xalapa, México.
Hall, TA., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleics Acids Symposium Series 41, 95-98.
Jiggins, F., Bentley, J., Majerus, M., Hurst, G., 2001. How many species are infected with Wolbachia? Cryptic sex ratio distorters revealed to be common by intensive sampling. Proc. R. Soc. Lond. B 268, 1123-1126.
Joannea, S., Vythilingama, I., Yugavathya, N., Leonga, C., Wonga, M., AbuBakar S., 2015. Distribution and dynamics of Wolbachia infection in Malaysian Aedes albopictus. Acta Tropica 148, 38–45.
Le, Pape., 1992. Écoépidémiologie de la leishmaniose a Leishmania infantum = L. chagasi dans la plaine des caraïbes (Colombie): corrélation vecteur et réservoir canin. Montpellier, Francia: Université de Montpellier I.
Librado, P., Rozas, J., 2009. DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25, 1451-1452 doi: 10.1093/bioinformatics/btp187.
Mikery, O., Marina, C., Ibáñez-Bernal, S., Sánchez, D., Castillo, A., 2012. Infección natural de Lutzomyia cruciata (Diptera: Psychodidae, Phlebotominae) con Wolbachia en cafetales de Chiapas, México. Acta Zoológica Mexicana 28(2), 401-413. Moreira, L., Iturbe-Ormaetxe I., Jeffery, J., et al,. 2009. A Wolbachia symbiont in Aedes aegypti limits infection with dengue, Chikungunya, and Plasmodium. Cell 139(7):1268-78. doi: 10.1016/j.cell.2009.11.042.
Maroli, M., Khoury, C., 2006. Current Approaches to the Prevention and Control of Leishmaniasis Vectors. Veterinary Research Communications 30(1), 49–52. Martinez, J., Longdon, B., Bauer, S., Chan, Y., Miller, W., Bourtzis, K., Teixeira, L., Jiggins, L., 2014. Symbionts Commonly Provide Broad Spectrum Resistance to Viruses in Insects: A Comparative Analysis of Wolbachia Strains. PLoS Genet 9(4): e1003381. doi:10.1371/journal.pgen.1003381.
Munikrishnappa, N., Kumar, S., Puttegowda, H., 2014. Wolbachia a foe for mosquitoes. Asian Pac J Trop Dis 4(1), 78-81.
Martin, D., Williamson, C., Posada, D., 2005. 2RDP2: recombination detection and analysis from sequence alignments. Bioinformatics 21 (2), 260–262, doi:10.1093/bioinformatics/bth490.
Ono, M., Braig, H., Munstermann, L., Ferro, C., O’NeilL, S., 2001. Wolbachia Infections of Phlebotomine Sand Flies (Diptera: Psychodidae). Journal of Medical Entomology 38(2), 237-241. Paternina, L., 2012. Determinación molecular de las fuentes alimenticias de Lutzomyia spp. (Diptera: Psychodidae) asociadas a casos de Leishmaniasis Cutánea en el departamento
de Sucre, Caribe Colombiano. Universidad Nacional de Colombia Sede Medellín, Facultad de Ciencias, Tesis de Maestría. pp70.
Paternina-Gómez, M., Pérez-Doria, A., Paternina, L., Velbel, D., Martínez, L., Bejarano, E., 2011. Infección natural de Lutzomyia micropyga con tripanosomatídeos en el Caribe colombiano. Biomédica 31(3), 209-421.
Parvizi, P., Bordbar, A., Najafzadeh, N., 2013. Detection of Wolbachia pipientis, including a new strain containing the wsp gene, in two sister species of Paraphlebotomus sandflies, potential vectors of zoonotic cutaneous leishmaniasis. Mem Inst Oswaldo Cruz, Rio de Janeiro, 108(3).
Robert, E., 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput, Nucleic Acids Research 32(5), 1792-97.
Ruang-Areerate, T., Kittyapong, P., Baimai, V., O’Neill, S., 2003. Molecular Phylogeny of Wolbachia Endosymbionts in Southeast Asian Mosquitoes (Diptera: Culicidae) Based on wsp Gene Sequences. Journal of Medical Entomology 40(1), 1-5.
Ronquist, F., Huelsenbeck, J., 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics.19(12), 1572-4.
Sanchez, J., Romero, M., 2007. "Una mirada a la epidemiología y al control de la leishmaniasis zoonótica en Colombia”. Revista De Ciencias Básicas 9, 99 – 111.
Sanches, H., Coscrato, V., Selivon, D., Paranhos, A., Marino, C., 2011. Variations in the sensitivity of different primers for detecting Wolbachia in Anastrepha (diptera: tephritidae). Brazilian Journal of Microbiology 42, 778-785.
Travi, B., Adler, G., Lozano, M., Cadena, H., Montoya-Lerma, J., 2002. Impact of habitat degradation on Phlebotominae (Diptera: Psychodidae) of tropical dry forests in Northern Colombia. J. Med. Entomol 39, 451-456.
Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA 4.1: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol 24, 1596-1599.
Uribe, S., Porter, C., Lemanhh, T., Velez, I., 2001. "The morphospecies Lutzomyia longipalpis as derived from mitochondrial DNA". Molecular Phylogenetics And Evolution 23, 44- 470.
Veneti, Z., Clark, M., Karr, T., Savakis, C., Bourtzis, K., 2004. Heads or Tails: Host-Parasite Interactions in the Drosophila-Wolbachia System. Applied and Environmental Microbiology 7(9), 5366-5372.
Warburg, A., Faiman, R., 2011. Research priorities for the control of phlebotomine sand flies. Journal of Vector Ecology 36(1), 10-16. Wallace, H., 2013. Mosquitos Genéticamente Modificados: Preocupaciones Actuales. Third World Network ISBN: 978-967-5412-79-0.
Werren, J., 1997. Biology of Wolbachia. Annu. Rev. Entomol 1997. 42, 587–609.
Werren, J., Baldo, L., Clark, M., 2008. Wolbachia: master manipulators of invertebrate biology. Nature Reviews, Microbiology 6, 741-751.
Werren, J., Windsor, D., 2000. Wolbachia infection frequencies in insects: evidence of a global equilibrium?. Proc. R. Soc. Lond. B 267, 1277-1285.
Werren, J., Zhang, W., Guo, L., 1995. Evolution and phylogeny of Wolbachia: reproductive parasites of arthropods. Proc. R. Soc. Lond. B 261, 55-63.
Young, G., Duncan, M., 1994. Guide to identification and geographic distribution of Lutzomyia sand flies in Mexico, the West Indies, Central and South America (Diptera: Psychodidae). Mem. Am. Entomol. Inst 54, 1-881.
Zhou, W., Rousset, F., O'Neill., 1998 Phylogeny and PCR-based classication of Wolbachia strains using wsp gene sequences. Proc. R. Soc. Lond. B 265, 509-515.
PROOF OF SUBMISSION
3. CHAPTER 3. ANTAGONISTIC EFFECT OF BACTERIA ISOLATED
FROM THE DIGESTIVE TRACT OF Lutzomyia evansi AGAINST
PROCYCLIC AND METACYCLIC PROMASTIGOTES OF Leishmania
infantum
3.1 HIGHLIGHTS
The highest percentage of Leishmania growth inhibition was observed by E. cloacae
and P. ananatis and it was registered against procyclic L. infantum promastigotes.
Biological activity from crude methanol extracts obtained from P. ananatis, O.
anthropi and E. cloacae against pathogenic bacteria.
O. anthropi presented the highest number of antibiotic resistance patterns, while P.
ananatis and E. cloacae showed greater sensitivity to the antibiotics evaluated.
For graphic information related to methodology and findings see Appendix R
3.2 GRAPHICAL ABSTRACT
“Biological activity from bacterial cultures and crude methanol extracts produced by
P. ananatis, O. anthropi and E. cloacae against pathogenic bacteria and L.
infantum promastigotes”
Photograph: Female of Lutzomyia evansi; AMP: Antimicrobial Peptides
3.3 ABSTRACT
Lutzomyia evansi, the sandfly vector of Leishmania infantum, the causative parasite of
visceral leishmaniasis, can acquire different bacterial communities which are distributed
through the digestive tract due to eating habits of immatures and adults or habitat factors
that are part of its niche. However, it is not clear whether these bacterial communities can
play roles associated with the development and transmission of L. infantum. Therefore,
specific studies of the direct effects generated by bacteria in the digestive tract of the insect
vector of L. infantum using in vitro models, represents a novel alternative as a control
strategy for the transmission of leishmaniasis and also provides the opportunity to detect
natural products or antimicrobial peptides with different biological activities. In this study we
evaluate the leishmanicidal and antimicrobial activities of Pantoea ananatis, Ochrobactrum
anthropi and Enterobacter cloacae, isolated from the digestive tract of Lu. evansi and the
sensitivity of these bacteria to commonly used antibiotics. The antagonistic effect of P.
ananatis, O. anthropi and E. cloacae was evaluated against six species of human
pathogenic bacteria and against procyclic and metacyclic promastigotes of L. infantum
(BCN-GFP strain) by co-culture assays for 24 hours. The activity of the bacterial isolates on
L. infantum promastigotes was quantified by flow cytometry. The sensitivity of the bacterial
strains to clinically used antibiotics was analyzed by antibiogram. The highest percentage
of inhibition was observed against procyclic promastigotes with bacterial concentrations of
108 CFU/ml of E. cloacae (77.29 ± 0.6%) and P. ananatis (70.17% ± 1.1). The extracts
produced by the three bacterial isolates showed similar biological activity (13mm-22mm
inhibition halos) against all tested bacteria; however, significant differences were observed
with respect to gram-positive bacteria (F=85,31; df=2,713;P <0.003557). The most active
antibacterial activity was displayed against the pathogenic bacteria Bacillus cereus. O.
anthropi was the isolate with the highest number of antibiotic resistance patterns while P.
ananatis and E. cloacae showed greater sensitivity to the evaluated antibiotics. The growth
inhibitory activity of procyclic L. infantum promastigotes shown by extracts of E. cloacae and
P. ananantis suggests that the presence of these bacteria in the vector intestine may affect
the parasite development to metacyclic stages, infective to human hosts. This in turn confers
said bacteria, a potential in controlling the transmission of Leishmania spp. that deserves to
be studied in depth.
Keywords: microbiota, Lutzomyia evansi, Leishmania infantum, Enterobacter cloacae, in
vitro activity.
3.4 INTRODUCTION
Leishmaniasis remains as a public health problem worldwide due to its morbidity and
geographical distribution (Alvar et al., 2012). Transmission of the disease is complex and
involves not only the participation of different species of Leishmania parasites but also
sandflies vector insects (Amora et al., 2009; Vivero et al., 2015) and mammalian species
that serve as reservoirs for the parasite. The infection in humans generates various clinical
manifestations, being visceral leishmaniais (VL) one of the clinical form with greater impact
in the Americas specifically in countries like Colombia, Brazil and Venezuela for the
possibility of causing the death of patients if not diagnosed and treated early (Freitas-Junior
et al., 2012).
Currently, the VL presents difficulties associated with treatment, diagnostic tests and
surveillance and control strategies of insect vectors (Lemos et al., 2013). This problem is
attributed mainly to the emergence of drug-resistant strains of the L. infantum parasite, as
well as the ubiquity and adaptability of vector insects, Lu. longipalpis, and Lu. evansi, and
the existence of different eco-epidemiological settings where transmission can occur
(Montoya-Lerma et al., 2003; Rangel and Vilela et al., 2008). Therefore, it is necessary to
explore alternatives aimed at interrupting the transmission of the infection and thereby
reduce the impact of leishmaniasis in public health (Desjeux, 2004). An alternative option to
the chemical control of vectors or to the synthetic generation of vaccines and treatments, is
to understand the "intestinal microbiota" of sandflies vectors (Raffa et al., 2008; Shanchez
and Vlisidou., 2008).
From a holistic point of view, it is suggested to integrate the isolation of bacterial
communities and the study of the action or activity of bacteria by generating secondary
metabolites and bacterial peptides that can impact directly (antileishmanial activity) or
indirectly (immune system) the development of Leishmania parasites, being decisive in the
modulation of the transmission or vector competence of Lutzomyia spp (Azambuja et al.,
2005; Moraes et al., 2008; Sant'anna et al., 2012).
There are several studies on intestinal microbiota in sandflies aimed at finding molecules
with antileishmanial activity. Among these, the study of lytic effects generated in L. chagasi
(syn L. infantum) by its interaction with Serratia marcescens (Moraes et al., 2008), the
variability of molecules like defensins in Phlebotomus duboscqi induced by changes in the
microbiota (Boulanger et al., 2004), the generation of reactive oxygen species mediated by
S. marcescens against L. mexicana in the digestive tract of Lu. longipalpis (Diaz-Albiter et
al., 2012) and most recently, the in vitro activity of Pseudozyma sp., Asaia sp., and
Ochrobactrum intermedium against the development of promastigotes of L. mexicana (Sant
'Anna et al., 2014). In Colombia, there are not known studies that explored the usefulness
of the intestinal microbiota of insects that transmit Leishmania spp.
Lu. evansi, is a vector recognized species for transmitting parasites that generate cutaneous
and VL in rural and urban environments of the Caribbean coast of Colombia (Gonzalez et
al., 2006; Vivero et al., 2009). Its abundance and epidemiological importance made it an
attractive biological model for the preliminary study of the microbiota using a culture
dependent approach under aerobic conditions. This strategy allowed the isolation of
bacterial strains P. ananatis, O. anthropi and E. cloacae, arousing interest either by being
dominant in the digestive tract of Lu. evansi (E. cloacae), by being symbionts (P. ananatis)
or by their reports on antitrypanosomal activity (Ochrobactrum sp.) (Sant'Anna et al., 2014;
Vivero et al., in press). Therefore, this study aimed to evaluate the leishmanicidal and
antibacterial activity of extracts and whole bacteria (P. ananatis, O. anthropi and E. cloacae)
isolated from the digestive tract of Lu. evansi and their sensitivity to antibiotics.
3.5 MATERIALS AND METHODS
3.5.1 Identification of bacterial isolates and estimate cell concentration.
P. ananatis, O. anthropi and E. cloacae all Gram negative strains were isolated from the
digestive tract of adults and immatures from natural populations of Lu. evansi from the
municipality of Ovejas (Sucre department, Caribbean coast of Colombia). Isolates were
cultured under aerobic conditions (33°C for 24 and 48 hours) by surface plating intestinal
homogenates on Luria-Bertani (LB) agar (Merck). The selected isolates were purified,
characterized by macro and microscopic appareance of the colony, Gram stained (Fig.9a-
c) and molecularly by analyzing the spacer region (ITS) between the 23S and 16S ribosomal
gene, the 16S rRNA and (Fig. 9d) gyrB genes partial nucleotide sequences (Vivero et al., in
press). The isolates identified as P. ananatis, O. anthropi and E. cloacae were
cryopreserved in 20% glycerol at -80°C until use.
The reactivation of this bacteria was performed by incubating 100 µl of the cell suspension
of each isolate in sterile liquid LB medium at room temperature (28°C). This allowed
assessing cell viability and purity of the three bacterial strains, monitoring their growth for
the in vitro tests in the exponential phase. Estimated concentrations of 107UFC and 108UFC
were calculated to challenge the isolates in the in vitro activity test against promastigotes of
L. infantum. The cell concentration of bacteria was estimated with commercial MacFarland
turbidity standard pattern (BBL McFarland Turbidity Standard No. 0.5).
3.5.2 Reactivation of Leishmania infantum fluorescent promastigotes, fluorescence
emission estimation and calculation of cell concentration.
The BCN-GFP strain of L. infantum transfected with green fluorescent protein was thawed
and planted in biphasic modified Novy, Nicolle and McNeal (NNN) medium for growth of
promastigotes, verifying their vitality by observation with a fluorescence inverted microscope
(Nikon eclipse TS100). L. infantum promastigotes were incubated at 26°C, performing
successive sub-cultures to obtain parasites with 98% of fluorescence, which allow
estimating the action of bacterial isolates in vitro by flow cytometry. Massive growth of
parasites in biphasic modified NNN modified culture medium was carried out with direct
counting in Neubauer chamber to ensure the number of parasites necessary for activity
assays.
GU937430.1|_Pantoea_ananatis_strain_LN-1
GU338400.1|_Pantoea_ananatis_strain_E-1-4
GU937431.1|_Pantoea_ananatis_strain_LN-4
UFC_Isolate_140
UFC_Isolate_139
JX885522.1|_Enterobacter_cloacae_strain_DT-1
EF551364.1|_Enterobacter_cloacae_strain_Rs-35
L4_Isolate__102
KF956631.1|_Ochrobactrum_anthropi_strain_S21808
AB841137.1|_Ochrobactrum_anthropi_strain:_SP91B
AB841131.1|_Ochrobactrum_anthropi_strain:_OchP
Fig. 9. Macroscopic and microscopic morphology (Gram stain 100X) of the strains P. ananatis (a.), E. cloacae (b.), O.
anthropi (c.) isolated from the gut of Lu. evansi and NJ dendrogram (d.) of partial 16S gene sequences illustrating the
taxonomic confirmation of the bacterial isolates.
d.
a.
b.
c.
3.5.3 In vitro antileishmanial activity assay of crude methanol extracts of bacterial against
procyclic and metacyclic promastigotes of L. infantum.
Metacyclic-like (6 days of culture) and procyclic-like (3 days of culture) promastigotes of L.
infantum were centrifuged at 1500g for 10 minutes, washed twice with sterile PBS buffer for
carbohydrate removal and then re suspended in single phase RPMI liquid culture medium
without antibiotic at a final concentration of 3 x 106 parasites/ml for each co-culture and
activity assay (Appendix R).
Cultures of P. ananatis, O. anthropi and E. cloacae grown in liquid LB medium ( Merk) to
108UFC and 107UFC were concentrated by centrifugation at 6,500 g for 5 minutes. The cell
pellet was washed twice with sterile PBS buffer. Bacteria were re-suspended in PBS to a
final concentration of 107 CFU/ml and incubated for 24 hours at 27°C with 1ml of metacyclic
or procyclic L. infantum promastigotes in RPMI. The trials were independent for each strain
and in triplicate for each stage of development of the parasite. Cell viability controls
consisted of PBS with promastigotes and the three bacterial strains re-suspended in PBS
independently.
3.5.4 Quantification of the bacterial isolates activity on L. infantum promastigotes
The action of bacterial isolates on the viability of L. infantum promastigotes were determined
by flow cytometry on a Cytomics FC 500MPL using an argon laser at 488nm of excitation
and 525nm of emission, counting at least 10,000 events to calculate the number of
fluorescent promastigotes. The acquired data was analyzed using the CXP (Beckman
Coulter, Fullerton, CA, USA) software.
3.5.5. Evaluation of antibacterial activity from crude methanol extracts produced by P.
ananatis, O. anthropi and E. cloacae
Production and evaluation of secondary metabolites was performed following the method
previously described by Romero et al., 2006. An Erlenmeyer containing 50 ml of 2% LB
broth (w/v), 2% Amberlite resin XAD-16 (W/V) (Spyere, 2003), was inoculated with 0.5 ml
of each strain culture and grown overnight (Romero-Tabarez et al., 2006;. Krug et al., 2008).
After seven days of incubation at 30°C and 180 rpm, the resin was decanted from the culture
medium and washed with distilled water and the absorbed products were eluted with 40 ml
of 100% methanol for 30 minutes (Sangnoi et al., 2009). Each extract was then concentrated
to 1.5 ml in a rotating evaporator at 40°C (Heidolph Efficient Rotary Evaporator Laborota
4001).
The bacteria used were reference strains: Escherichia coli, Enterococcus faecalis, Bacillus
cereus, Pseudomonas aeruginosa, S. marcescens and Staphylococcus aureus subsp.
aureus. Psychrobacter sp. CP25 isolates were used as controls. (Positive control from
Microbiop reference strain collection, National University of Colombia), Methanol (negative
control) and the antibiotic chloramphenicol (10 ug/ml, positive control).
Diffusion test in agar was used (El-Masry et al., 2000). Sterile Whatman No.1 filter paper
discs, 6 mm diameter, were impregnated with 10, 20 and 50 ul of each extract and placed
on the surface of Petri dishes containing Mueller-Hinton agar (Becton Dickinson), previously
inoculated with a liquid culture of the target strains at a concentration of 1.2 x 108 CFU/ml
(absorbance 600 nm= 0,1). The plates were incubated at 37°C for 18 hours and the diameter
of the growth inhibition halo around each disk was measured. Determination of the
antibacterial activity was performed following the procedure described by Bauer et al.,
(1966) and amended by the Clinical and Laboratory Standards Institute (Cona, 2002; CLSI,
2009,). The antibacterial activity assays were performed in duplicate in two independent
experiments.
3.5.6. Antibiotic sensitivity test
The antibiotic sensitivity tests for the bacterial isolates (P. ananatis, O. anthropi and E.
cloacae), were developed with Mueller Hilton agar plates (Bckton Dickinson). An inoculum
of 108 CFU/ml of each bacterial isolate was used (0.5 units on the MacFarland scale,
McFarland Turbidity Standard BBL). All isolates were tested against 14 different antibiotics
of known concentration classified as follows: Rifampicin (RD 5; Oxoid, 5 ug), Tetracycline
(Te 30, Valtek, 30 mcg), Gentamicin (CN120; Oxoid; 120 ug - 10 ug ); Penicillin (P 30;
Comprolab; 30 FMU), Chloramphenicol (C 30; Oxoid, 30 ug), Sulbactam Cefopeazone (SFC
105; Oxoid, 105 ug), Cefepime (CEP; Oxoid, 30 ug); Cefoperazone (PIC; Oxoid, 75 ug),
Cefuroxime (CXM, Oxoid; 30 ug), Cephazolin (KZ; Oxoid, 30 ug), Ceftriaxone (CRO; Oxoid,
30 ug), Cefoxitin (FOX; Oxoid, 30 ug) Ceftazidime (CAZ; Oxoid, 30 ug). The plates were
incubated at 30°C for 24 hours and the bacterial growth inhibition halos were measured by
the diameter in mm.
3.5.7. Data analysis
Statistical analysis of the antibacterial activity was estimated by a two-way ANOVA with the
GraphPad Prism version 4.0 program using the extracts and targeted pathogenic bacteria
as factors. Based on the diameter of the antibiotics inhibition halos, bacteria were
categorized as sensitive, moderately sensitive, highly sensitive and resistant according to
the M100-S25 protocol (Performance Standards for Antimicrobial Susceptibility Testing).
3.6 RESULTS
3.6.1. In vitro bacterial test with procyclic and metacyclic promastigotes.
The co-culture of the three midgut bacterial isolates with promastigotes of L. infantum
caused inhibition of procyclic-like but not metacyclic-like promastigotes. A greater impact on
the inhibition percentage of the promastigotes using the bacterial cell concentration of 1-2 x
108 CFU/ml (Table 7) was observed. The standard deviation calculated for triplicate assays
of co-culturing bacteria and promastigotes was low SD=0,5 and 5,3, respectively. A greater
impact of cell concentration of 1-2 x 108 CFU/ml of E. cloacae and P. ananatis on the percent
inhibition of procyclic-like parasites is further noted, with values of 70,17 ± 1,1 and 77,29 ±
0,6 respectively (Table 7), whereas E. cloacae also significantly altered the development of
procyclic-like promastigotes with bacterial concentrations of 1-2 x 107 CFU/ml (Table 7). O.
anthropi had the lowest inhibitory activity on procyclic-like (62,33 ± 2,0; 38,13 ± 1,4) and
metacyclic-like promastigotes (32,95 ± 5.3; 36,81 ± 3.2), with respect to the other two
isolates analyzed. P. ananatis was the only bacterial isolate that presented inhibitory activity
of 50.01% of metacyclic-like promastigotes.
3.6.2. Antimicrobial activity test of crude methanolic extracts
The three extracts produced by O. anthropi, P. ananatis and E. cloacae exhibited similar
antimicrobial activity patterns against all bacteria tested, with inhibition zones between
13mm and 22mm (Table 8, Fig. 10). No significant differences were found between the
inhibition zones produced by the extracts evaluated against Gram negative bacteria
(F=6,692; df=3,949; P<0,05918). However highly significant differences between the
inhibition zones associated with gram-positive bacteria used as blank were found (F=85, 31;
df= 2,713; P<0 003557) (Table 8).
The species most sensitive to the extracts produced by the isolates from the digestive tract
of Lu. evansi was B. cereus, with inhibition halos of 22mm with others less sensitive to the
extracts activity like E. coli and E. faecalis, with inhibition halos between 13mm and 15mm.
Figure 10a shows the antibacterial activity of the E. cloacae extract (more active) with the
clinical isolate B. cereus.
Table 7. In vitro activity of three bacterial isolates from the gut of Lu. evansi against procyclic and metacyclic
promastigotes of Leishmania infantum.
The data represents the average value (X) ± standard deviation (SD) of two experiments each in triplicate. Symbols: CFU/ml colony forming units per milliliter; % Percentage; ± standard deviation; MP metacyclic promastigotes of Leishmania infantum; PP procyclic promastigotes of Leishmania infantum. Note: Number of parasites in each trial = 3 × 106 parasites/ml
Table 8. Antibacterial activity of extracts produced by strains O. anthropi, E. cloacae and P. ananatis isolated from the gut
of Lu. evansi.
C+: positive control; C-: negative control; mm: diameter of the inhibition zones, average of the replicates per sample.
Cell
Concentration
O. anthropi P. ananatis E. cloacae
inhibition % M P
inhibition % PP
inhibition % MP
inhibition % PP
inhibition % MP
inhibition % PP
1-2 x 107 CFU/ml 36,81 ± 3.2 38,13 ± 1.4 44,46 ± 3.2 66,41 ± 0.5 38,12 ± 0.5 71,04 ± 1.2 1-2 x 108 CFU/ml 32,95 ± 5.3 62,33 ± 2.0 50,01 ± 1.3 70,17 ± 1.1 48,73 ± 1.5 77,29 ± 0.6
Bacterial Group
Target microorganism/ Inhibition halo (mm)*
Gram negative Gram positive
Strain tested (Extract source)
E. coli (ATCC® 8739™)
P. aeruginosa (ATCC® 9027™)
S. marcescens (Clinical isolate)
B.cereus (Clinical isolate)
E. faecalis (ATCC® 51299™)
S. aureus subsp. aureus
(ATCC® 29213™)
O. anthropi 14 15,5 18 22 13 19
E. cloacae 13 17,5 18 22 15 19
P. ananatis 15 15 16 22 14 17
Psychrobacter sp. C+ 18,5 13,5 15 21 14 13,5
Methanol C- 0 0 0 8,5 0 0 Chloramphenicol C+ 28 20 29 34,5 9 33,5
3.6.3. Antibiotic sensitivity test
The E. cloacae and P. ananatis isolates showed resistance to penicillin and rifampicin, while
O. anthropi presented antibiotic resistance to Cephazolin and Cefoxitin (Table 9).
Additionally, O. anthropi presented a greater number of resistance patterns to antibiotics,
being resistant to penicillin, sulbactam, cefopeazone, cefuroxime, cephazolin, ceftriaxone,
cefoxitin and ceftazidime (Table 9). E. cloacae and P. ananatis had higher sensitivity, mainly
with Beta-lactams, cephalosporins, chloramphenicol and whereas O. anthropi only
presented high sensitivity with tetracyclines and aminoglycosides (Table 9).
3.7 DISCUSSION
The bacterial isolates P. ananatis, O. anthropi and E. cloacae, obtained from the intestinal
microbiota of Lu. evansi assessed in this study exhibited differential activity against L.
infantum as well as a differential sensitivity to antibiotics and against clinical isolates. The
high inhibition percentage (72.29%) generated by E. cloacae against procyclic-like
promastigotes of L. infantum, when co-cultured under in vitro conditions is emphasized. This
is the first study demonstrating the in vitro activity of E. cloacae against promastigotes of
Leishmania, from studies that recognize its importance in the vector competence of some
insects (Azambuja et al., 2005; Maleki-Ravasan et al., 2015). It is suggested that the action
of E. cloacae can be derived from the expression of peptides or molecules with lytic activity
on the surface of prokaryotes, by the action of enterococcal cytolysins (hemolysin) (Cox et
al., 2005). However, this hypothesis needs further studies.
In this sense, it is possible that the protective response of L. infantum procyclic
promastigotes associated with the generation of glycoconjugates (proteophosphoglycans,
acid phosphatase, lipophosphoglycans, metalloproteins) (Sack et al., 2000), is not sufficient
for protection against enzymes or highly pathogenic bacterial peptides expressed by E.
cloacae. In this state lifecycle (24-48hrs), procyclical promastigotes of L. infantum present a
lower degree of specialization and adaptation with respect to the metacyclic promastigotes
(infective stage ), which produce stronger enzymes such as chitinases that may even
degrade the insects stomodeal valve and have a defense system resistant to mammalian
complement factors and greater mobility (Kamhawi, 2006).
Some studies on the interaction of bacteria and insect vectors suggest that E. cloacae can
perform functions that are crucial for the development of the parasites. For example, the
distribution and function of metallo-proteases in the fat bodies of the intestinal membrane of
Rhodnius prolixus useful in the defense reaction mechanisms of the insect, are dependent
on the presence or absence of E. cloacae and can modulate the hemolymph release as the
development of parasites evolves in the midgut (Feder et al., 1998).
The in vitro activity of E. cloacae on procyclic-like promastigotes of Leishmania is consistent
and can justify their use in paratrasgenesis to express antitrypanosomal peptides, because
other reports state that the bacteria also blocks the development of other parasites as
Plasmodium falciparum in Anopheles gambiae and the sporogonic development of P. vivax
in An. albimanus (Yadav et al., 2015; Maleki-Ravasan et al., 2015).
Similar to E. cloacae, the symbiont P. ananatis showed a significant activity over the survival
(70.17%) of the procyclic promastigotes of L. infantum, a species that, to date only has
reported entomopathogenic and phytopathogenic activity (Akhoundi et al., 2012; Bonaterra
et al., 2014). These aspects are interesting because these bacteria could be used to disrupt
the life cycle of sandflies and the transmission of Leishmania spp, by the rapid spread and
adaptation of these arthropods (Akhoundi et al., 2012; Maayer et al., 2104). As previously
described in a study in which P. agglomerans (family Enterobacteriaceae) was genetically
modified, to express and secrete two anti-plasmodium effector proteins (pelB, hly) in infected
mosquitoes (Bisi et al., 2001).
The dissemination of P. ananatis symbiont to organs or complex structures of insects
suggests that it is a specialized bacteria (Bonaterra et al., 2014), which is supported by its
pan-genome that incorporates a large number of protein encoding genes that enable P.
ananatis to colonize, persist and secrete a wide range of peptides (Maayer et al., 2104).
This can also be related to the better activity over the survival of metacyclic promastigotes
(50.01%) compared to E. cloacae and O. anthropi.
O. anthropi had lower activity against metacyclic (32.95%) and procyclic promastigotes
(62.33%). Unlike our results, the activity of other Ochrobactrum species (O. intermedium,
Ochrobactrum sp., AK strain) presented greater impact (~ 90%) on the survival of L.
mexicana promastigotes in co-infection trials with Lu. longipalpis and in vitro assays (Volf et
al., 2002; Sant'Anna et al., 2014).
The crude methanolic extracts exhibited similar antimicrobial activity patterns against target
bacteria, with a difference appreciated mainly against the growth of B. cereus (22mm),
suggesting that the isolates O. anthropi, E. cloacae and P. ananatis are important sources
of promising antimicrobial compounds with a wide biological activity spectrum. In this sense
these compounds or secreted peptides, can provide selective advantages to these bacteria
in different environmental niches (including the digestive tract of sandflies) and be important
for colonization, providing virulence factors and defense systems to keep its niche or prevent
invasion from other bacterial strains (Motta et al., 2004;. Azambuja et al., 2005; Vallet-Gely
et al., 2008).
Gram negative bacteria, such as those used in this study, currently have six types of protein
secretion systems reported (T1SS to T6SS) associated with bacterial competition (Shyntum
et al., 2015; Holland 2010). Among these systems, T6SS has a role in cytotoxicity, biofilm
formation, antimicrobial peptide transport and interaction with host cells. This system has
recently been described for P. ananatis, being responsible for their potential virulence and
antimicrobial activity (Shyntum et al., 2015).
Some members of the Enterobacteriaceae family are known to produce bacteriocins (3% to
26%) such as enterocins, colicins and antimicrobial lipopeptides produced by different
species of Enterobacter, with great biopharmaceutical potential (Riley et al., 2003; Mandal
et al., 2013) suggesting that bacteriocins are produced by these bacteria as part of their
defense mechanism to survive complex environments such as the digestive tract of different
kinds of insect vectors (Lutzomyia, Phlebotomus, Anopheles, Aedes) where E. cloacae is a
dominant taxonomic unit (Akhoundi et al., 2012;. Vivero et al in press.).
Additionally, O. anthropi, which also exhibits antimicrobial activity against Gram positive and
Gram negative bacteria, is of great interest for bioremediation and for their ability to degrade
organophosphates (Seleem et al., 2006). In this sense, knowledge on antimicrobial peptides
secreted by O. anthropi is interesting because this bacteria can transfer pesticide resistance
factors to sandflies or simply remove pesticides by degradation (Bergman, 2003; Seleem et
al., 2006). O. anthropi secretes detoxification enzymes, reactive oxygen species and
nucleosides of great interest for their anti-tumoral, antiviral, antibiotic and antiparasitic
activity (Ogawa et al., 2001; Tamburro et al., 2004).
Few reports inform about the sensitivity of antibacterial compounds from O. anthropi. In our
study, this isolate was resistant to most cephalosporins and penicillins, but susceptible to
rifampicin, chloramphenicol, some cephalosporins (cefepime, cefoperazone), tetracycline
and gentamicin. The latter two antibiotics were the most active on O. anthropi. Our results
are consistent with other studies reporting multi-resistance patterns present in O. anthropi
(Higgins et al., 2001; Vay et al., 2005). However some strains of O. anthropi exhibit
resistance patterns to cefepime (Nadjar et al., 2001) and only in few cases they are sensitive
to cefoperazone (Duran et al., 2009).
Unlike O. Anthropi, the E. cloacae and P. ananatis isolates exhibited fewer resistance
patterns to the antibiotics tested, and agreed in their response to penicillin and rifampicin,
while P. ananatis was also resistant to cephazolin and cefoxitin. Both bacteria are reported
as multiresistant for its environmental ubiquity and invasion of different hosts including soils,
plants, animals and insects (Fernandez-Fuentes et al., 2012). The greatest sensitivity
pattern of these two isolated correspond to cephalosporins, although some reports indicate
their resistance to cefuroxime (Fernandez-Fuentes et al., 2012).
The antibiotic sensitivity tests of the intestinal microbiota of insect vectors are important for
co-infection based assays with parasites or viruses, in order to evaluate drugs, vaccines or
to determine the autonomous vector competence of the insect. In this sense, to remove or
modulate the resident intestinal microbiota depends on the resistance state to certain
antibiotics, and allows to access the functional relationships between gut microbiota and
their hosts.
3.8. CONCLUSIONS
The ability of E. cloacae and P. ananatis to inhibit the growth of procyclic-like promastigotes
of L infantum in co-culture and the similar sensitivity patterns shown by O. anthropic, suggest
that these isolates are promising for future control strategies aimed at evaluating the parasite
load in Lutzomyia species when exposed to E. cloacae and P. ananatis, in order to provide
new ways to reduce the transmission of leishmaniasis.
3.9 ACKNOWLEDGEMENTS
Acknowledge the support by Luisa Montoya (Microbiodiversity and Bioprospection
Research Group, Cellular and Molecular Biology Laboratory, National University of
Colombia). The funders had no role in study design, data collection and analysis, decision
to publish or preparation of the manuscript.
3.10. FINANCIAL SUPPORT
Administrative Department of Science, Technology and Innovation - COLCIENCIAS (Grant
695-201 and Doctoral studies 528-2011); Grupo de Microbiodiversidad y Bioprospección
and Grupo de Investigación en Sistemática Molecular, Universidad Nacional de Colombia,
Sede Medellín.
3.11 REFERENCES
Amora, S., Bevilaqua, C., Feijo, F., Alves, N., Maciel, M., 2009. Control de Phlebotomine (Diptera: Psychodidae) Leishmaniasis Vectors. Neotrop. Entomol 38(3), 303-10.
Alvar, J., Velez, I., Bern, C., et al., 2012. Leishmaniasis worldwide and global estimates of its incidence. PLoS ONE 7(5), Article ID e35671. Azambuja, P., Garcia, E., Ratcliffe, N., 2005. Gut microbiota and parasite transmission by insect vectors. Trends in Parasitology 21(12), 568-572. Akhoundi, M., Bakhtiari, R., Guillard, T., Baghaei, A., Tolouei, R., Sereno, D., et al., 2012. Diversity of the bacterial and fungal microflora from the midgut and cuticle of Phlebotomine sand flies collected in North-Western Iran. PLoS One 7(11): e50259.
Boulanger, N., Lowenberger, C., Volf, P., et al., 2004. Characterization of a Defensin from the Sand Fly Phlebotomus duboscqi Induced by Challenge with Bacteria or the Protozoan Parasite Leishmania major. Infection and Immunity 72(12), 7140-7146 DOI: 10.1128/IAI.72.12.7140. Bergman, J., 2003. Does the acquisition of antibiotic and pesticide resistance provide evidence for evolution?. Journal of Creation 17(1), 26–32. Bauer, A., Kirby, W., Sherrus, J., Truck, M., 1966. Antibiotic susceptibility testing by a standardized single disc method. American Journal of Clinical Pathology 45, 493-496. Bisi, D., Lampe, D., 2011. Secretion of Anti-Plasmodium Effector Proteins from a Natural Pantoea agglomerans Isolate by Using PelB and HlyA Secretion Signals. Applied and Environmental Microbiology 77(13), 4669–4675 doi:10.1128/AEM.00514-11. Bonaterra, A., Badosa, E., Rezzonico, F., Duffy, B., Montesinos, E., 2014. Phenotypic comparison of clinical and plant-beneficial strains of Pantoea agglomerans. Int Microbiol 17(2), 81-90. doi: 10.2436/20.1501.01.210. Clinical and Laboratory Standards Institute- CLSI 2009. Methods for dilution antimicrobial susceptibility test for bacteria that grow aerobically. Approved Standard 29(2), 1-65. Cona, E., 2002. Condiciones para un buen estudio de susceptibilidad mediante test de difusión en agar. Revista Chilena de Infectología, 19, 77- 81. Cox, C., et al., 2005. Enterococcal cytolysin: a novel two component peptide system that serves as a bacterial defense against eukaryotic and prokaryotic cells. Curr. Protein Pept. Sci. 6:1. Duran, R., Vatansever, U., Acunas, B., Basaran, U., 2009. Ochrobactrum anthropi bacteremia in a preterm infant with meconium peritonitis. International Journal of Infectious Diseases 2: 61-63 doi:10.1016/j.ijid.2008.06.027. Moraes, A., Sergio, H., et al., 2008. Leishmania (Leishmania) chagasi interactions with Serratia marcescens: Ultrastructural studies, lysis and carbohydrate effects. Experimental Parasitology 118, 561–568. Días, H., Sant´Anna, M., Genta, F., 2012. Reactive Oxygen Species-mediated Immunity against Leishmania mexicana and Serratia marcescens in the Phlebotomine Sand Fly Lutzomyia longipalpis. J. Biol. Chem 287, 23995-24003. Desjeux, P., 2004. Leishmaniasis: current situation and new perspectives. Comp. Immunol. Microbiol. Infect. Dis 27(5): 305-318. El-Masry, H., Fahmy, H., Abdelwahed, A., 2000. Synthesis and antimicrobial activity of some new benzimidazole derivatives. Molecules 5, 1429-1438. Feder, V., Salles, J., Garcia, E., Azambuja, P., 1998. Haemolymph and fat body metallo-protease associated with Enterobacter cloacae infection in the bloodsucking insect, Rhodnius prolixus. Mem Inst Oswaldo Cruz, Rio de Janeiro 93(6), 823-826.
Fernández-Fuentes, M., Morente, E., Abriouel, H., Pulido, R., Gálvez, A., 2012. Isolation and identification of bacteria from organic foods: Sensitivity to biocides and antibiotics. Food Control 26(1), 72-78 doi:10.1016/j.foodcont.2012.01.017. Freitas-Junior, L., Chatelain, L., Andrade, H., Siqueira-Neto, J., 2012. Visceral leishmaniasis treatment: What do we have, what do we need and how to deliver it? International Journal for Parasitology: Drugs and Drug Resistance 2, 11–19. González, C., Cabrera, O., Munstermann, L., Ferro, C., 2006. Distribución de los vectores de Leishmania infantum (Kinetoplastida: Trypanosomatidae) en Colombia. Biomédica 26(1), 64-72. Holland, B., 2010. The extraordinary diversity of bacterial protein secretion mechanisms. Methods Mol. Biol. 619,1-20. Higgins, C., Murtough, S., Williamson, E., Hiom, S., Payne, D., 2001. Biocides among non- fermenting gram-negative bacteria. Clin. Microbiol. Ingect. 7, 308-315.
Krug, D., Zurek, G., Revermann, O., Vos, M., Velicer, G., Müller, R., 2008. Discovering the hidden secondary metabolome of Myxococcus xanthus: a study of intraspecific diversity. Applied and Environmental Microbiology 74, 3058-3068. Lemos. P., Dantas-Torresa, F., da Silva, F., Veloso, V., Gaudêncioa, K., Brandão-Filhoa, S., 2013. Ecology of Lutzomyia longipalpis in an area of visceral leishmaniasis transmission in north-eastern Brazil. Acta Tropica 126, 99– 102. Maleki-Ravasan, M., Oshaghi, M., Afshar, D., et al., 2015, Aerobic bacterial flora of biotic and abiotic compartments of a hyperendemic Zoonotic Cutaneous Leishmaniasis (ZCL) focus. Parasites & Vectors 8, 63 doi:10.1186/s13071-014-0517-3. Montoya-Lerma, J., Cadena, H., Oviedo, M., Ready, P., Barazarte, R., Travi, B., Lane, R., 2003. Comparative vectorial efficiency of Lutzomyia evansi and Lu. longipalpis for transmitting Leishmania chagasi. Acta Trop 85(1), 19-29. Mandal, S., Sharma, S., Pinnaka, K., Kumari, A., Korpole, S., 2013. Isolation and characterization of diverse antimicrobial lipopeptides produced by Citrobacter and Enterobacter. BMC Microbiol. 13, 152. doi: 10.1186/1471-2180-13-152.
Maayer, D., Chan, W., Rubagotti, E., Venter, E., Toth, I., Birch, P., Coutinho C., 2014. Analysis of the Pantoea ananatis pan-genome reveals factors underlying its ability to colonize and interact with plant, insect and vertebrate hosts. BMC Genomics 15, 404 http://www.biomedcentral.com/1471-2164/15/404. Nadjar, D., Labia, R., Cerceau, C., Bizet, C., Philippon, A., Arlet, G., 2001. Molecular Characterization of Chromosomal Class C β-Lactamase and Its Regulatory Gene in Ochrobactrum anthropi. Antimicrob. Agents Chemother 45(8), 2324-2330 doi: 10.1128/AAC.45.8.2324-2330.
Ogawa, J., Takeda, S., Xie, S., et al., 2001. Purification, Characterization, and Gene Cloning of Purine Nucleosidase from Ochrobactrum anthropi. Appl. Environ. Microbiol 67(4): 1783-1787 doi: 10.1128/AEM.67.4.1783-1787
Perfomance Standards for Antimicrobial Susceptibility Testing. 2012. Cilinical and laboratory standards institute 32(3), 188. M100- S22. ISSN 2162-2914. Rangel, E., Vilela, M., 2008. Lutzomyia longipalpis (Diptera, Psychodidae, Phlebotominae) and urbanization of visceral leishmaniasis in Brazil. Cad. Saúde Pública 24(12), 2948-2952. Raffa, K., Adams, A., Broderick, N., Boone, C., Cardoza, Y., Delalibera, I., Vasanthakumar, A., 2008. Symbionts of invasive insects: characterization, ecological roles, and relation to invasive potential and management strategies. Department of Entomology, University of Wisconsin-Madison, Madison, WI 53706. USDA. Research Forum on Invasive Species p. 61-62. Romero-Tabarez, M., Jansen, R., Sylla, M., Lünsdorf, H., Häussler, S., Santosa, D., et al., 2006. 7-O-malonyl macrolactin A, a new macrolactin antibiotic from Bacillus subtilis active against methicillin-resistant Staphylococcus aureus, vancomycin-resistant enterococci, and a small-colony variant of Burkholderia cepacia. Antimicrob Agents Chemother 50(5), 1701-1709. Riley, M., Goldtone, C., Wertz, J., Gordon, D., 2003. A phylogenetic approach to assessing the targets of microbial warfare. J. Evol. Biol 16(4), 690-697. Sacks, D., Govind, M., Rowton, E., Spa, G., Epstein, L., Turcoi, S., Beverley, S., 2000. The role of phosphoglycans in Leishmania–sand fly interactions. PNAS 97(1), 406–411. Sangnoi, Y., Srisukchayakul, P., Arunpairojana, V., Kanjana-Opas, A., 2009. Diversity of marine gliding bacteria in Thailand and their cytotoxicity. Electron J Biotechnol 12(3), 1-8. Shanchez-Contreras, M.,Vlisidou, I., 2008. The Diversity of Insect-bacteria Interactions and its Applications for Disease Control. Biotechnology and Genetic Engineering 25, 203-244. Sant’anna, M., Darby, A., Brazil, R., Montoya, J., Dillon, V., et al,. 2012. Investigation of the Bacterial Communities Associated with Females of Lutzomyia Sand Fly Species from South America. PLoS ONE 7(8): e42531. doi:10.1371/journal.pone.0042531. Sant’Anna, M., Diaz-Albiter, H., Aguiar, K., et al., 2014. Colonisation resistance in the sand fly gut: Leishmania protects Lutzomyia longipalpis from bacterial infection. Parasites & Vectors 7,329. Shyntum, D., Theron, J., Venter, S., Moleleki, L., Toth, I., Coutinho, T., 2015. Pantoea ananatis utilizes a Type VI Secretion System for Pathogenesis and Bacterial Competition. Mol Plant Microbe Interact 28(4), 420-31. doi: 10.1094/MPMI-07-14-0219-R.
Seleem, M., Ali, M., Boyle, S., et al., 2006. Establishment of a Gene Expression System in Ochrobactrum anthropi Appl Environ Microbiol. 72(10), 6833–6836. doi: 10.1128/AEM.01446-06.
Tamburro, A., Robuffo, I., Heipieper, H., et al., 2004. Expression of glutathione S-transferase and peptide methionine sulphoxide reductase in Ochrobactrum anthropi is correlated to the production of reactive oxygen species caused by aromatic substrates. FEMS Microbiology Letters DOI: http://dx.doi.org/10.1016/j.femsle.2004.10.013.
Vivero, R., Torres-Gutierrez, C., Bejarano, E., Cadena, H., Estrada, L., Florez, F., et al., 2015. Study on natural breeding sites of sand flies (Diptera: Phlebotominae) in areas
of Leishmania transmission in Colombia. Parasit Vectors 8(116) doi: 10.1186/s13071-015-0711-y. Vivero, R., Torres-Gutierrez, C., Bejarano, E., Estrada, L., Florez, F., et al., 2009. Nuevos registros de flebotomíneos (Diptera: Psychodidae), con el hallazgo de Lutzomyia longipalpis (Lutz & Neiva, 1912), en los alrededores de la Ciudad de Sincelejo, Colombia. Biota Neotrop 9(4), 277-280. Vay, C., Almuzara, M., Rodríguez, C., Pugliese, M., Barba, F., Mattera, J., Famiglietti, A., 2005. Actividad “in vitro” de diferentes antibacterianos sobre bacilos gram-negativos no fermentadores, excluidos Pseudomonas aeruginosa y Acinetobacter spp. Revista Argentina de Microbiología 37, 34-45. Volf, P., Kiewegová, A., Nemec, A., 2002. Bacterial colonisation in the gut of Phlebotomus dubosqi (Diptera: Psychodidae): transtadial passage and the role of female diet. Folia Parasitol 49(1), 73-7.
Vallet-Gely, I., Lemaitre, B., Boccard, F., 2008. Bacterial strategies to overcome insect defences. Nature 6: 302-313, doi:10.1038/nrmicro1870. Yadav, K., Bora, A., Datta, S., et al., 2015. Molecular characterization of midgut microbiota of Aedes albopictus and Aedes aegypti from Arunachal Pradesh, India Kamlesh. Parasites & Vectors 8, 63 doi:10.1186/s13071-014-0517-3.
PROOF OF SUBMISSION
4. ADDITIONAL RESULTS. Manuscript in preparation for submission
EUBACTERIAL COMPOSITION ASSOCIATED WITH THE
INTESTINE OF Lutzomyia evansi FROM COLOMBIA: THE CORE
GUT MICROBIOME, SIGNIFICANT CONTRIBUTION OF Wolbachia,
Methylobacterium AND A DIVERSE GUILD OF BACTEROIDETES
AND LACTOBACILLUS.
SUMMARY
In a previous study, it has been previously shown the detection by PCR, confirmed by
conventional Sanger sequencing, of Wolbachia spp. in natural populations of Lutzomyia
evansi from Colombia’s Caribbean Coast. We aimed at expanding this observation using
MiSeq Illumina sequencing technology in complete amplicons of 16S rRNA genes
hypervariable region V4 in order to determine the Eubacterial microbial community
composition and to see if at this level of resolution Wolbachia is above detection limits and
if so, relative abundance over the whole microbiome. This implied to have simultaneously a
very detailed description of the microbiome composition, which provided additional insights
about the bacterial types present at higher abundances and common. In this work we
describe the general bacterial composition detected in these intestinal samples of Lutzomyia
evansi (natural populations) that acting as Leishmania vector in Colombia. The bacterial
composition shared among the samples is similarly to other insect gut microbiome reported,
including the detection of several diverse OTUs of Bacteroidetes and Lactobacillales. It is
remarkable the fact that OTUs classified as coming from Wolbachia are indeed present at
relatively high abundance in half of the samples. While we could not ascribe this presence
to a negative or positive hosting of Leishmania in these specific samples, it is interesting to
note that Wolbachia spp. OTUs are naturally present, possibly exerting an influence on the
vector parasite carriage or relative load in Lutzomyia evansi. Other OTUs are shared among
all the samples and can be considered core microbiome members stably maintained in the
intestine of the Phlebotominae analysed in this report, particularly insightful about the
lifestyle is Methylobacterium spp. that confirms as expected the constant feeding from
plants, and the differential presence of Wolbachia, opening a future perspective for exploring
its correlation with Leishmania coinfection.
Key Words: NGS, Lutzomyia evansi midgut - Wolbachia – Methylobacterium -
Bacteroidetes -Lactobacillus.
INTRODUCTION
The current situation of leishmaniasis (group of infectious diseases caused by protozoa of
the genus Leishmania) (Amora et al., 2009), requires the exploration of the microbial
diversity associated with the intestine of Lutzomyia species (insect vectors) (Azambuja et
al., 2005; Molloy et al., 2012), due to absence of alternative vector control methods (Rangel
and Vilela et al., 2008). In Colombia, there are approximately 14 species of Lutzomyia
reported as vectors of different species of Leishmania (Bejarano et al., 2015), and to date
only the intestinal microbiota of a wild population of Lu. longipalpis from a non-endemic
leishmaniasis area has been described (Gonzalez et al., 2006; Sant'anna et al., 2012).
The species Lutzomyia evansi, is a vector insect recognized for the transmission of parasites
that generate visceral and cutaneous leishmaniasis in rural and urban environments of the
Caribbean coast of Colombia (González et al., 2006). Its abundance and epidemiological
importance makes it an attractive biological model to develop study about the intestinal
microbiota associated with natural populations.
Given the environmental plasticity of Lu. evansi, it is to be expected that this species
possesses complex and diverse intestinal microbiota. Traditionally, microbiological studies
of arthropod vectors rely on "culture dependent techniques" to identify pathogens and
commensal or mutualistic species, however, only a small proportion of bacterial species (3%
- 5%) can grow under culture conditions, and can severely limit our understanding of
microbial communities present in a particular ecological niche (“gut”) (Azambuja et al., 2005;
Hoffmann et al., 2015). Cultivation-based techniques have been unable to accurately
capture the true diversity within microbial communities (Degnan and Ochman 2012)
To address the lack of information of species that are recalcitrant to cultivation, the recent
use of "culture independent methods" based on DNA sequencing technology advances
(next-generation sequencing-NGS) have established distinctive solid profiles of microbial
communities from different samples (Guernaoui et al, 2011). Illumina-based 16S rRNA gene
sequencing has recently gained popularity over 454 pyrosequencing due to its lower costs
higher accuracy and greater throughput (Nelson et al., 2014). While Illumina instruments
historically generated short sequences of 30–100 bp, increases in the maximum read length
on the Illumina MiSeq platform (2×300 bp paired end sequencing as of this writing) allow the
sequencing of amplicons of similar length to those traditionally used in 454 pyrosequencing
studies (Caporaso et al., 2012; Kozich et al., 2013). By integrating sample-identifying
barcodes into the amplification primers, the Illumina platform, like 454 pyrosequencing, is
amenable to a high level of multiplexing, which further increases its utility for examining large
and complex sets of samples (Gloor et al., 2010)
Current sequence databases contain over a million full-length 16S rRNA sequences
spanning a broad phylogenetic spectrum than can serve as a benchmark for assessing the
bacterial taxa (also referred to as ‘phylotypes' or ‘ribotypes') present in environments
worldwide (Cole et al., 2009). However, in America, bacterial diversity analysis has only
been recorded for Lu. longipalpis and Lu. cruzi adults, based on the analysis of the 16S
gene clone library, bacterial DGGE profiles generated and metagenomic analysis of taxa,
using an unbiased high-throughput Approach (Sant’anna et al., 2012; Mccarthy et al., 2011).
The gut bacteria strains registered for these species mainly belong to the genera Serratia,
Enterobacter, Acinetobacter and Pseudomonas (Sant’anna et al., 2012; Mccarthy et al.,
2011), indicating that do not correspond to the full representation of the microbiome and
insect populations are mainly from laboratory colonies.
An alternative option to the chemical control of vectors or to the synthetic generation of
vaccines and treatments, is to understand the "intestinal microbiota" of sandflies vectors
holistically (Raffa et al., 2008). In Colombia, there are not known studies that explored the
usefulness of the intestinal microbiota of insects that transmit Leishmania spp., and for this
reason understand microbes and their potential effect on the modulation of disease
transmission is necessary.
A specific example is to know the presence of the endosymbiont Wolbachia in sand flies,
because the use of certain strains of Wolbachia is considered to be a promising alternative
for decreasing population density of Lutzomyia species and interfering with the multiplication
of parasites, and, as a result, Leishmania transmission (Azpurua et al., 2010). However,
conventional PCR traditionally used to amplify gene fragments as WSP, FTZs and 16S, only
reflects its presence or absence (Azpurua et al., 2010), while Illumina-based 16S rRNA gene
sequencing can illustrate the levels of actual infection present in natural populations, in order
thinking in future studies to reduce vector competence of insects.
The objective of this study was expanding this observation using MiSeq Illumina sequencing
technology in complete amplicons of 16S rRNA genes hypervariable region V4 in order to
determine the Eubacterial microbial community composition and to see if At this level of
resolution Wolbachia is above detection limits and if so, relative abundance over the whole
microbiome.
METHODS
Ethics statement
Sand fly collection was performed in accordance with the parameters of Colombian decree
number 1376, which regulates specimen collection of biologically diverse wild species for
non-commercial research. No specific permits were required for this study. The sand flies
were collected on private property and permission was received from landowners prior to
sampling.
Collection, processing and identification of sand flies
Sand flies were collected from two locations in the department of Sucre (Caribbean coast of
Colombia). The first location was associated with a peri-urban biotype near the Ovejas
municipality (75° 13'W, 9° 31'N; 277msnm). The second location corresponded to a jungle
biotype at the “Primates” Wildlife Experimental Station (09° 31' 48.0"N - 75° 21' 4.3" W,
220m) in the municipality of Colosó, located within the Protected Forest Reserve “Serranía
de Coraza”.
The adult specimens were collected from the two locations using Shannon-type extra-
domiciliary white light traps that remained active between 18:00h and 22:00h. The adult
sand flies that were collected were transported live to the laboratory in entomological cages
to obtain the gut and morphological structures (male genitalia and female spermathecae)
for taxonomic identification of Lu. evansi using a taxonomic key (Young and Duncan, 1994).
The guts of adult Lu. evansi specimens were removed aseptically with sterile stilettos under
a stereoscope in 1X PBS buffer. Gut pools were formed according to locality and
physiological stage; these were re-suspended in 100μL of sterile PBS, before extracting total
DNA.
16s rRNA gene amplification and sequencing
PCR amplicon libraries of the V4 region of the 16s rRNA genes were prepared.
Metagenomic DNA was extracted of guts pools from males (Colosó=COM; Ovejas=OVM),
fed females (Colosó=COFF; Ovejas=OVFF) and unfed females (Colosó=COUF;
Ovejas=OVUF) of Lutzomyia evansi of both locations. Total gut DNA was extracted using
the Ultra CleanTM Soil DNA Isolation Kit (MO BIO Laboratories, Inc., USA), according to the
manufacturer’s instructions. Final DNA aliquots were quantified using an ND-100 Nanodrop
Thermo Scientific spectrophotometer (Thermo Fisher Scientific Inc, MA). The quality of
genomic DNA was analyzed on 1% agarose gel, followed by EZ-visionTM DNA 6X STAIN
(AMRESCO).
Amplicons were obtained using the extracted metagenomic DNA as templates on
independent reaction using primers 515F [5´-GTGCCAGCMGCCGCGGTAA - 3´] and 806R
[5´-GGACTACHVGGGTWTCTAAT -3´] were used (J. G. Caporaso et al., 2012). Each 25µL
PCR reaction comprised 1X buffer, 0.3mM dNTPs, 0.5µM forward primer, 0.5µM reverse
primer, 0.04U/µL Accuzyme polymerase from Bioline and 1ng of template DNA. The PCR
cycle conditions were as follows: initial denaturation at 94°C for 3 minutes followed by 35
cycles of denaturation at 94° for 45 seconds, primer annealing at 50°C for 60 seconds and
extension at 72°C for 90 seconds. This cycles were finally followed by a last extension at
72°C for 10 minutes ( Caporaso & Lauber, 2011). Sequencing was made using MiSeq
Illumina platform and was performed at the Baylor College of Medicine from Houston, Texas
USA.
Diversity analysis
All sequence analyses were performed using QIIME 1.8.0 (Kuczynski et al., 2011) and the
Phyloseq R package 1.5.21 (McMurdie & Holmes, 2013). Initially, the complete set of
Illumina reads was filtered and split according to the barcodes for each sample. A multi-step
open-reference OTU picking workflow was performed within the QIIME system. Using this
methodology, OTUs were picked assigning the reads to species groups based on 97%
sequence similarity. This workflow combined the PyNAST alignment (Caporaso et al., 2010)
against the Greengenes core set with the RDP database project to make the OTUs
assignment and to discard chimera sequences. In the next steps, a single representative
sequence of each OTU was again realigned using PyNAST to build a phylogenetic tree
using FastTree.
Alpha and beta diversity analysis were performed with both platforms QIIME and Phyloseq
R package. Based on the OTU table generated from OTU assignment, this QIIME workflow
script computed measurements of alpha diversity and generated rarefaction plots. Phyloseq
R package was used to produce graphics representing abundances, diversity and
distribution of all phyla throughout each sample. The diversity between all the communities
(beta diversity) was analyzed by generating, in both platforms, Unifrac calculations. The
weighted and unweigthed version of Unifrac was measured by Phyloseq. This parameter,
besides measuring the differences between two collections of sequences as the amount of
evolutionary history unique to either one, accounts for differences in relative abundances
(Lozupone et al., 2011).
Using Phyloseq additional dendograms were produced out of these calculations. These
plots also allowed comparisons of the differences and similarities between the communities
between all the samples. All OTUs classified as ascribed to ribosomal sequences from
Archaea or from Eukaryotic mitochondria or plastids present and amplified in the
metagenomic DNA were eliminated and not used in subsequent analyses, as the purpose
of this study was to focus on the Eubacterial microbiome composition.
RESULTS
335.437 sequences of 250 nucleotides on average were obtained by the Illumina-MiSeq
platform, covering the region V4 of the 16S rRNA gene. Following the quality filter steps and
removal of chimeric sequences, 332.670 reads were clustered into 959 OTUs at 97%
similarity. Regarding Eubacterial diversity, OTUs recovered from all the samples were
affiliated with 15 described bacteria phyla and 1 candidate phyla.
A rarefaction analysis by Chao1 estimator values revealed a good coverage of sequencing,
suggesting that the majority of members of the associated community of all samples have a
description near complete (Fig 1). Through this analysis, it was possible to see the
differences in the richness between all samples, being OV5M and OV6UF those with the
highest number of OTUs, doubling the number contained of nearly all other samples.
Proteobacteria, Firmicutes and Bacteroidetes were the most abundant phyla in all samples.
Proteobateria represented more than 60% of the communities of all samples, with the
exception of OV5M (32%) which is also the most diverse one (Fig. 2).
The most abundant classes were Alpha, beta and gammaproteobacteria, the most abundant
OTUs were one from the genus Methylobacterium (Alphaproteobacteria) (7 to 37%) and one
from uncultured Betaproteobacteria (4 to 27%) (Fig 3). The first one being most abundant in
samples from Coloso (CO), and the second one in samples recovered from townOvejas
(OV). No drastic differences in the relative abundance were observed between male and
female communities’ samples, but the heat map is showing that each of the samples has a
group of exclusive OTUs and some other shared across all the samples, conforming with
the core microbiome concept (Fig. 4). As a general common composition, it was possible to
detect various OTUs shared among the samples and classified as Bacteroidetes and
Lactobacillus.
Fig 1. Rarefaction curve from Chao1 analysis using partial 16S rRNA gene sequences (250 pb) of guts from Lu. evansi (male/fed females/unfed females) field-collected. 16S rRNA gene sequences were grouped in to same OTUs by using 97% similarity as a cut off value. Each lane represent a guts from an pool of insect. CO: Coloso; OV: Ovejas; M: Male; FF: Feed Female; UF: Unfeed Female.
0%
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
C08M C011M C07UF C010UF C09FF C012FF OV2M OV5M OV1FF OV6UF OV3UF
Relative abundance at phylum level
Acidobacteria Actinobacteria Bacteroidetes ChlamydiaeCyanobacteria Deferribacteres Firmicutes FusobacteriaGemmatimonadetes Lentisphaerae Planctomycetes ProteobacteriaSBR1093 Tenericutes Thermi Verrucomicrobia
0%
20%
40%
60%
80%
100%
C011M C08M OV5M OV2M OV6UF C07UF C010UF OV3UF C012FF OV1FF C09FF
Relative abundance at class level
Alphaproteobacteria Betaproteobacteria Gammaproteobacteria
Bacteroidia Clostridia Actinobacteria
Bacilli Deltaproteobacteria Flavobacteriia
Planctomycetia Sphingobacteriia Acidobacteria;c__Sva0725
Phycisphaerae Chlamydiia Verrucomicrobiae
SBR1093;c__EC214 Acidobacteria;c__RB25 Mollicutes
Synechococcophycideae Acidobacteria;c__BPC102 Chloroplast
Rubrobacteria Deferribacteres Deinococci
Gemmatimonadetes;c__Gemm-3 Fusobacteria;c__Fusobacteria Gemmatimonadetes;c__Gemm-4
Lentisphaeria S15B-MN24 Oscillatoriophycideae
Erysipelotrichi Thermoleophilia Nostocophycideae
Spartobacteri Planctomycetes;c__C6 Acidimicrobiia
Gemmatimonadetes;c__Gemm-1 Cyanobacteria;c__4C0d-2 Acidobacteria
Fig 2. Classification of sequences obtained from each sample. Only Eubacterial phyla relative abundances are shown.
Fig 3. Classification of sequences obtained from each sample. Only Eubacterial phyla relative abundances are shown. Distances between communities were measured using weighted (Fig. 5a) and unweighted
(Fig. 5b) Unifrac method to see the difference based on the lineages that they contain but
also on the sum of the counts in the connecting nodes . Comparison of weighted and
unweighted Unifrac analysies and supported by what was suggested by the Chao1 estimator
reveals that, the community from the samples OV5M, OV6UF and CO9FF have a
significantly higher number of OTUs than the other samples, but the relative abundance of
those that are predominant is very similar to the other communities; which suggest that these
results are a very close description of the composition of these symbiotic communities.
Dendograms are not showing clustering by gender, origin or feeding status, which suggest
that features like these are not strictly determining the microbiome structure in the set of
samples analyzed.
Fig. 4. OTU heatmap representing all OTUs classified inside Eubacterial phyla, variation in
intensity are dependent of OTU relative abundance.
Figure 5. a) Weighted Unifrac and b) Unweighted Unifrac
DISCUSSION
In previous reports on females of sand flies bacterial communities, sequences were
retrieved and identified with standard molecular ecology techniques such as DGGE and
band sequencing, and some indications of bacterial types usually found in plants, including
some sequences of potential plant pathogens (Sant’anna et al., 2012). We have not
detected thus types bacterial as predominant in our results, however, the material used was
from individuals different, but from the same localities, and the resolution and the primers
used in this report was very different, allowing an assessment of the composition that can
be tested as representative and of several orders of magnitude in higher resolution.
Also a total metagenomic sequencing study was reported in Lutzomyia longipalpis, and the
authors claimed as unbiased (Mccarthy et al., 2012). However, as in any study, there are
many potential sources of biases; for instance, as possible source of biases there are: the
pyrosequencing technique used has a relatively high error rate, the amount of reads
obtained from a given dataset are limited and they are far from reaching a significant
coverage of the metagenomic complexity expected in a mixed community (Gloor et al.,
2010); also the assignment to a given taxonomy is always dependent of the representation
in databases and the availability of full genome sequences where not always are the
evolutionary nor taxonomical origin of the genes associated or found in them (i.e. horizontal
gene transfer content).
In that study the total body of the specimen was macerated and thus, a large variation on
microbial content due to external or internal bacteria present is also possible (Mccarthy et
al., 2012). Thus, it is understandable why we do not have as the most abundant members
of the bacterial communities the same taxonomical types as the ones they have detected,
strictly of gut from adult stages of Lutzomyia evansi.
Regarding the presence of constant OTUs shared among all the samples, notably is
Methylobacterium, a common cosmopolitan inhabitant of phyllospheres of plants
(endophytic, transporting and rhizosphere tissues) (Green, 2006), thus suggesting the
constant feeding from plants in the specimens collected.
Proteobacteria, Firmicutes, Actinobacteria and Bacteroidetes were the most abundant phyla
in all samples from Lutzomyia evansi. This result is supported by a previous study (Colman
et al., 2012; Yun et al., 2014) showing that Proteobacteria and Firmicutes were the
predominant phyla in 81 insect gut samples, comprising 57.4% and 21.7% of sequences,
respectively. Also is consistent with microbiota associated to different species of Lutzomyia
and Phlebotomus genus, as well of mosquitos (Aedes and Anophles) (Azambuja et al.,
2005). Although, the Bacteroidetes and Actinibacteria phylum shows lower abundance with
respect to our study. The dynamic variation in insect gut microbiota can be determined by
gut morphology and physicochemical conditions, such as pH, oxygen availability in the
insect gut and the type of diet (Engel and Mora, 2013). These diverse gut conditions may
cause the variation in host-specific gut microbiota in insects.
One of the main objectives of this study was to confirm in a new set of samples and
experimental means the natural presence of Wolbachia in the microbiome of the Lutzomyia
evansi specimens collected in Colombia. Members of the genus Wolbachia infect many
members of the Arthropoda (Hilgenboecker et al., 2008) and were predominant among the
heritable symbionts identified. While this is a rather restricted case study on few specimens
to resolve microbiomes at higher resolution, we could identify clear patterns of bacterial
composition characteristic of insects and more importantly, we detected OTU6118 found in
male and female speciments but distinctly found only in those coming from Ovejas. This is
higher than levels reported by previous studies (17 to 35%) for diverse insect species, based
on the PCR detection approach (Werren et al., 1995; Kikuchi and Fukatsu 2003), and higher
than a recent estimation of Wolbachia prevalence (40%) (Zug and Hammerstein, 2012).
This remarks the potential of this intracellular bacterium to be studied and considered as a
possible controlling agent (Brelsfoard et al., 2011) and allows to set new platforms and
perspectives to further expand the observations to correlate in a larger sample population
where Leishmania content is also defined on each specimen.
ACKNOWLEDGEMENTS
To Microbiomas Foundation for excellent technical and scientific support. We also thank
funding through Convocatoria 652 - 2014 EcosNord-Colciencias and through grant 1216
Microbiomas Foundation. Administrative Department of Science, Technology and
Innovation - COLCIENCIAS (Doctoral studies 528-2011). We also acknowledge the support
that Edgar D. Ortega (Biomedicas Research Group, University of Sucre) provided for the
survey of insects in the two locations in the department of Sucre.
REFERENCES
Azpurua, J., De La Cruz, D., Valderama, A., Windsor, D., 2010. Lutzomyia Sand Fly Diversity
and Rates of Infection by Wolbachia and an Exotic Leishmania Species on Barro Colorado
Island, Panama. PLoS Negl Trop Dis 4(3), e627. doi:10.1371/journal.pntd.0000627.
Azambuja P., Garcia E., Ratcliffe NA. (2005). Gut microbiota and parasite transmission by
insect vectors. Trends Parasitol 21: 568–572.
Amora, S,, Bevilaqua, C,, Feijo, F., Alves, N., Maciel, M., 2009. Control de Phlebotomine
(Diptera: Psychodidae) Leishmaniasis Vectors. Neotrop. Entomol 38(3): 303-10.
Brelsfoard, C., Dobson, S., 2011. An update on the utility of Wolbachia for controlling insect
vectors and disease transmission. AsPac J. Mol. Biol. Biotechnol 19(3), 85 - 92.
Bejarano E, Uribe S, Pérez A, Egurrola J, Dib J, Porter C. 2015. Nuevos hallazgos de
flebotomíneos (Diptera: Psychodidae) en la Sierra Nevada de Santa Marta, Colombia. Acta
biol.Colomb. doi.org/10.15446/abc.v20n1.45176.
Caporaso, G., Lauber, L., Walters, A., Berg-Lyons, D., Huntley, J., Fierer, N., Gormley, N.,
2012. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq
platforms. The ISME journal, 6(8), 1621-1624.
Cole JR, Wang Q, Cardenas E, Fish J, Chai B, Farris RJ, et al. 2009. The Ribosomal
Database Project: improved alignments and new tools for rRNA analysis. Nucleic Acids Res.
37:D141–D145.
Colman, R., Toolson, E., Takacs-Vesbach, C., 2012. Do diet and taxonomy influence insect
gut bacterial communities? Mol. Ecol. 21:5124–5137.10.1111/j.1365-294X.2012.05752.x.
Degnan, P., Ochman, H., 2012. Illumina-based analysis of microbial community diversity.
ISME J. 6(1):183-94. doi: 10.1038/ismej.2011.74. Epub 2011 Jun 16.
Engel, P., Moran, N., 2013. The gut microbiota of insects—diversity in structure and
function. FEMS Microbiol. Rev. 37:699–735. 10.1111/1574-6976.12025
Green, P 2006. Methylobacterium. In The prokaryotes pp. 257-265. Springer New York.
Gutiérrez, M., Vivero, R., Vélez, I., Porter, C., Uribe, S., 2014. DNA barcoding for the
identification of sand fly species (Diptera, Psychodidae, Phlebotominae) in Colombia. PloS
one, 9(1), e85496.
Gloor, G., Hummelen, R., Macklaim, J., Dickson, R., Fernandes, A., MacPhee, R., et al.
2012. Microbiome profiling by Illumina sequencing of combinatorial sequence-tagged PCR
products. PLoS One.5:e15406.
Guernaoui, S,, Garcia, D., Gazanion, E., Boumezzough, A., Pesson, B., Fontenille, D.,
Sereno, D., 2011 Bacterial flora as indicated by PCR-temperature gradient gel
electrophoresis (TGGE) of 16S rDNA gene fragments from isolated guts of phlebotomine
sand flies (Diptera: Psychodidae). Journal of Vector Ecology 36 (1): S144-S147.
González, C,, Cabrera, O,, Munstermann, L,, Ferro, C., 2006. Distribución de los vectores
de Leishmania infantum (Kinetoplastida: Trypanosomatidae) en Colombia. Biomédica. 26
(supl.1): 64-72.
Holland, A., Long, G., Polacco, C., Lindow, E., Hecht-Poinar, I., Elliott, J., 2002.
Methylobacterium spp.: phylloplane bacteria involved in cross-talk with the plant host?.
Phyllosphere microbiology, 125-135.
Kozich, J., Westcott, L., Baxter, T,, Highlander, S., Schloss, P., 2013. Development of a
Dual-Index Sequencing Strategy and Curation Pipeline for Analyzing Amplicon Sequence
Data on the MiSeq Illumina Sequencing Platform. Appl Environ Microbiol 79: 5112–5120.
doi: 10.1128/aem.01043-13
Lozupone, C., Knight, R., 2005. UniFrac: a new phylogenetic method for comparing
microbial communities. Applied and environmental microbiology, 71(12), 8228-8235.
McCarthy, B., Diambra, L. A., Rivera Pomar, R. V. 2011. Metagenomic Analysis of Taxa
Associated with Lutzomyia longipalpis, Vector of Visceral Leishmaniasis, Using an Unbiased
High-Throughput Approach. PLoS Neglected Tropical Diseases, 5(9), e1304.
http://doi.org/10.1371/journal.pntd.0001304
McMurdie, J., Holmes, S., 2013. phyloseq: an R package for reproducible interactive
analysis and graphics of microbiome census data.PloS one, 8(4), e61217.
Molloy, M., Bouladoux, N., Belkaid, Y., 2012. Intestinal microbiota: shaping local and
systemic immune responses. Semin Immunol 24: 58–66. doi: .1016/j.smim.2011.11.008.
Ono, M., Braig, H., Munstermann, L., Ferro, C., O’NeilL, S., 2001. Wolbachia infections of
phlebotomine sand flies (Diptera: Psychodidae).Journal of medical entomology, 38(2), 237-
241.
Rangel, E., Vilela, M., 2008. Lutzomyia longipalpis (Diptera, Psychodidae, Phlebotominae)
and urbanization of visceral leishmaniasis in Brazil. Cad. Saúde Pública 24(12): 2948-2952.
Raffa, K,, Adams, A,, Broderick, N,, Boone, C,, Cardoza, Y,, Delalibera, I,, Vasanthakumar,
A., (2008) Symbionts of invasive insects: characterization, ecological roles, and relation to
invasive potential and management strategies. Department of Entomology, University of
Wisconsin-Madison, Madison, WI 53706. USDA. Research Forum on Invasive Species p.
61-62.
Soares R., Turco, S., 2003. Lutzomyia longipalpis (Diptera: Psychodidae: Phlebotominae):
a review. Anais da Academia Brasileira de Ciências, 75(3), 301-330.
Serbus, R., Casper-Lindley, C., Landmann, F., Sullivan, W., 2008. The genetics and cell
biology of Wolbachia-host interactions. Annual review of genetics, 42, 683-707.
Sant’Anna, M. R., Darby, A. C., Brazil, R. P., Montoya-Lerma, J., Dillon, V. M., Bates, P. A.,
& Dillon, R. J. 2012. Investigation of the bacterial communities associated with females of
Lutzomyia sand fly species from South America. PloS one, 7(8), e42531.
Tang, Y., Ward, R., D. 1998. Sugar feeding and fluid destination control in the phlebotomine
sandfly Lutzomyia longipalpis (Diptera: Psychodidae). Medical and veterinary entomology,
12(1), 13-19.
Werren, H., 1997. Biology of wolbachia. Annual review of entomology, 42(1), 587-609.
Yun, H., Roha, S., Whona, T., Junga, M., Kima, M., Parkc D., 2014- Insect Gut Bacterial
Diversity Determined by Environmental Habitat, Diet, Developmental Stage, and Phylogeny
of Host . Applied and Environmental Microbiology p. 5254 –5264 doi:10.1128/AEM.01226-
14
5. ADDITIONAL RESULTS. This manuscript was submitted to Revista de
la Facultad de Ciencias Universidad NAcional de Colombia, sede Medellin.
PRESENCIA DE Wolbachia y Leishmania EN UNA POBLACION DE Lutzomyia
evansi PRESENTE EN LA COSTA CARIBE DE COLOMBIA
RESUMEN.
Lutzomyia evansi es importante en salud pública por su participación en la trasmisión de la
leishmaniasis visceral y cutánea en la costa caribe de Colombia. Diversos estudios se han
desarrollado sobre la poblaciones naturales de Lutzomyia evansi, sin embargo pocos estudios han
explorado en profundidad la detección de microorganismos simbióticos (ej. Wolbachia) y de manera
simultánea la presencia de Leishmania sp.. El endosimbionte Wolbachia ha sido propuesto en la
actualidad como control biológico de insectos vectores de diversas enfermedades tropicales. En el
presente estudio el ADN de tres especies del género Lutzomyia colectadas en el municipio de Ovejas
(Departamento de Sucre) fue evaluado para detectar la infección natural por la bacteria Wolbachia y
la presencia de parásitos del género Leishmania. El ADN total de 176 individuos adultos y 34
inmaduros (larvas y pupas) de Lu. evansi, fue utilizado para evaluar la detección de Wolbachia
mediante amplificación por PCR del gen WSP (Proteína Mayor de la Superficie de Wolbachia) y la
infección por Leishmania mediante amplificación por PCR de segmentos de los genes HPSN70
(Proteína de Choque Térmico). Se encontró un grupo de machos infectado de forma natural por
Wolbachia y nueve grupos de hembras con infección natural por Leishmania, todos pertenecientes
Lutzomyia evansi. El análisis filogenético de la secuencia del gen WSP de Wolbachia indica la
ubicación de la cepa detectada dentro del supergrupo B (haplogrupo wLeva) y su relación con
haplotipos previamente reportados de Lutzomyia evansi y Lutzomya dubitans. Una región de 418 pb
del gen HSP-70N fue secuenciada y mostró similaridad con secuencias de Leishmania luego de
realizar el análisis en BlastN. Se confirma la presencia de Wolbachia en poblaciones silvestres de
machos de L. evansi y la infección natural por Leishmania spp. en hembras de la misma especie cuya
infección por Wolbachia resulto negativa.
Palabras clave: Colombia, Lutzomyia evansi, Infección natural, Wolbachia, Leishmania.
INTRODUCCIÓN
La leishmaniasis conforma un grupo de enfermedades infecciosas que afecta la piel, la
mucosa y las vísceras (Zambrano 2014). Estas afecciones son causadas por protozoarios
del género Leishmania (Kinetoplastida: Trypanosomatidae) que infecta a humanos y
animales mediante la picadura de hembras del género Lutzomyia en América (González et
al. 2006, Zambrano 2014). Los ciclos de transmisión de la leishmaniasis perduran por efecto
de la contaminación, cambios ambientales como la deforestación, expansión de la frontera
agrícola, la construcción de presas y la urbanización, entre otros (Azpurua et al. 2010,
Martínez et al. 2010, Paternina et al. 2011; Bejarano et al. 2015).
En Colombia se registra la presencia de 164 especies de la subfamilia Phlebotominae,
siendo uno de los países con mayor diversidad a nivel mundial, con alto número de especies
(n= 13) incriminadas como vectores (Vívenes et al. 2005, Bejarano 2006, Cortés y
Fernández 2008, Contreras et al. 2012, Vivero et al. 2013, Bejarano et al. 2015). Dentro de
estas especies, Lutzomyia evansi es un reconocido vector primario de Leishmania infantum,
patógeno que genera la leishmaniasis visceral en la Costa Caribe de Colombia y otras
regiones de Latinoamerica, y también es considerado importante porque algunas de sus
poblaciones naturales han sido encontradas infectadas por parásitos causantes de
leishmaniasis cutánea (Cortés y Fernández 2008), relacionados filogenéticamente y por su
patrón de desarrollo intestinal con especies del subgénero Viannia (Montoya et al. 1996,
(Cazorla et al. 2010, Pérez-Doria et al. 2011).
Los antecedentes expuestos y la presencia de Lutzomyia evansi en áreas urbanas,
periurbanas y rurales (Pérez-Doria et al. 2011, Paternina 2012, Bejarano et al. 2015), hacen
necesario el diseño y la aplicación de medidas de intervención, diferentes a las de
tratamiento químico con insecticidas (Bejarano et al. 2003, Bejarano 2006, Cochero et al.
2007, González et al. 2006, Paternina-Gómez et al. 2011). Dentro de las medidas
alternativas se encuentra el empleo de bacterias endosimbiontes como control biológico y
genético para disminuir la población de vectores (Finney et al. 2015, Hoffmann et al. 2015).
Wolbachia es una bacteria simbionte intracelular obligada perteneciente a las α-
proteobacterias (Rickettsia), de transmisión vertical y se encuentra en glándulas salivales,
intestino y tejido reproductivo de insectos (Werren 1997, Werren et al. 2008). Algunos
fenotipos de Wolbachia generan alteraciones reproductivas y fisiológicas en sus
hospedadores dentro de las cuales se encuentran la feminización, inducción a
partenogénesis, muerte a machos, incompatibilidad citoplasmática, fecundidad, actividad
locomotora y supervivencia (Floate et al. 2006, Favia et al. 2007, Werren et al. 2008). Las
cepas de Wolbachia que infectan principalmente hospederos artrópodos se encuentran en
los supergrupos A y B (Zhou et al. 1998, González y Martínez 2010, Hoffmann et al. 2011,
Walker et al. 2011).
Es necesario indicar que los estudios que contemplan la aplicación de Wolbachia para el
biocontrol de insectos transmisores de enfermedades infecciosas, debe contemplar en
primera instancia el estatus de infección y diferenciación de las cepas de Wolbachia, como
también incluir el análisis del efecto de Wolbachia sobre especies no blanco por una
potencial transmisión horizontal que afecte la dinámica de las poblaciones naturales de
otros artrópodos (Dedeine et al. 2005, Floate et al. 2006, González E y Martínez 2010,
Hoffmann et al. 2011; Walker et al. 2011).
En este estudio se planteó como objetivo inicial detectar la bacteria Wolbachia y el parásito
Leishmania en especies del género Lutzomyia colectadas en el ambiente urbano del
municipio de Ovejas (departamento de Sucre, Costa Caribe de Colombia).
MATERIALES Y MÉTODOS
Colecta, procesamiento e identificación taxonómica de flebotomíneos.
Los insectos del género Lutzomyia fueron colectados en ambientes urbanos del municipio
de Ovejas (75°13' O; 9°31' N; 277msnm), ubicado en el departamento de Sucre. Se realizó
una exploración entomológica por dos días en noviembre de 2013, época de alta
precipitación. Esta localidad es catalogada como un ecosistema de bosque seco tropical
(Hernández et al. 1992, Holdridge 1967) ubicada en la Costa norte del Caribe de Colombia.
Se utilizaron trampas de luz blanca tipo mini CDC ubicadas en el intradomicilio y
peridomicilio de las viviendas para colectar los flebotomíneos adultos.
Los insectos adultos colectados se transportaron y almacenaron en seco usando viales de
1,5mL, conservándolos en el laboratorio a -20 ºC y se procesaron de la siguiente forma: 1)
La cabeza y los tres últimos segmentos abdominales fueron fragmentados para la
identificación de especie con claves taxonómicas (Young y Duncan 994), 2) el tórax, alas y
el resto de segmentos abdominales se almacenaron a -20°C hasta el proceso de extracción
de ADN para posterior detección y caracterización de Wolbachia y Leishmania.
Adicionalmente inmaduros de Lu. evansi, fueron recuperados en sitios de cría naturales del
ambiente urbano del municipio de Ovejas mediante extracción de sustratos y examen
directo bajo estereomicroscopio (Vivero et al. 2015). Estos inmaduros también fueron
contemplados para la detección de Wolbachia, utilizando el mismo protocolo de extracción
de ADN de adultos.
Extracción de ADN total de adultos e inmaduros.
Posterior al reconocimiento taxonómico de especies del género Lutzomyia, los machos y
las hembras se organizaron y agruparon por especies en tubos Eppendorf de 1,5 ml. Los
inmaduros fueron analizados de forma individual. El ADN se extrajo según el protocolo de
altas concentraciones de sales descrito por Collins et al. (1987). La calidad y concentración
del ADN se evaluaron mediante electroforesis en gel de Agarosa al 1%. Se cuantificó en un
Nanodrop (Thermo Scientific) y adicionalmente se amplificó por PCR un fragmento del gen
COI para evaluar la calidad del ADN y ausencia de inhibidores de la PCR (Fig. 1a). El
fragmento amplificado sirvió luego para confirmar la identidad taxonómica de grupos de
adultos que resultaron de interés por la infección de Wolbachia o Leishmania, como también
para verificar la identidad de inmaduros por la ausencia de claves morfológicas (Vivero et
al., 2015).
PCR y secuenciación parcial del gen WSP de Wolbachia.
Se utilizaron cebadores previamente descritos por Braig et al. (1998) (wsp81F-5’
TGGTCCAATAAGTGATGAAGAAAC-3’; wsp691R-5’AAAAATTAAACGCTA CTCCA-3’),
que amplifican un fragmento parcial (590 pb – 632 pb) del gen codificante de la principal
proteína de superficie de Wolbachia (WSP). La mezcla de reacción usada para la detección
de Wolbachia incluyó 2μl de ADN muestra, en un volumen final de 20 μl según las
condiciones descritas por Zhou et al. 1998 y el perfil térmico registrado en el estudio de
Werren et al. 1995. Se incluyó como control positivo de la PCR el ADN obtenido de 10 larvas
(L4) de Aedes aegypti infectadas con una cepa de referencia de Wolbachia (Grupo A, cepa
wMel) bajo condiciones de laboratorio en el insectario (PECET) (Fig. 1b-1c), que sirvió
adicionalmente para la estanadarizacion de la amplificación por PCR del gen WSP. Los
productos parciales de WSP fueron clonados y secuenciados empleando el servicio de la
Compañía Macrogen Inc. en Corea.
Identidad de cepas de Wolbachia con base en secuencias reportadas y sus relaciones
de filogenia.
Los cromatogramas obtenidos a partir de los productos del gen WSP de Wolbachia fueron
verificados y editados con Bioedit v7.2.5 (Hall 1999), para obtener la secuencia consenso
relacionadas con cada Lutzomyia. La secuencias editadas se contrastaron inicialmente con
genes de WSP de cepas de Wolbachia relacionadas principalmente con artrópodos, usando
BLAST-N (Altschul et al. 1997), para confirmar la identidad del fragmento obtenido. Se
contempló el marco de lectura del alineamiento nucleotídico reportado por Scott O'Neill
(ftp://ftp.ebi.ac.uk/pub/databases/embl/align/ Número de acceso DS42468) (Ono et al.
2001). Los algoritmos Clustal W (Higgins et al. 1992) y Muscle (Robert 2004) incorporados
en MEGA 6 (Tamura et al. 2007), fueron empleados para la obtención final del alineamiento
de las secuencias del gen WSP obtenidas en Lutzomyia y reportada en GenBank de
artrópodos. Los patrones de divergencia genética y las distancias genéticas K2P fueron
evaluadas utilizando Bioedit v7.2.5 (Hall 1999) y el software DNAsp 5.0 (Librado y Rozas
2009). Se realizó una verificación y/o validación de eventos de recombinación y presencia
de quimeras con el software RDP4 (Martin et al. 2005) para las secuencias obtenidas, con
la finalidad de garantizar la veracidad de la variabilidad nucleotídica con respecto a las
secuencias previamente reportadas en GenBank.
Para evaluar la identidad y ubicación en posibles haplogrupos con base en relaciones
filogenéticas a partir de las secuencias del gen WSP se realizó un dendograma de Neighbor
Joining construido con todas las secuencias reportadas, en el programa MEGA 6 (Fig. 2).
La única secuencia del fragmento parcial del gen WSP de Wolbachia de este estudio están
depositada en el GenBank (National Center for Biotechnology Information - NCBI) con el
número de acceso KM594548.
Amplificación por PCR del gen HSP-70N de Leishmania en grupos de hembras.
Previo a la PCR para la detección de Wolbachia se realizó PCR para la detección de
infección por Leishmania, con las condiciones térmicas y primers descritos por Fraga et al.
(2010) (HSP70-F25- 5’ GGACGCCGGCACGATTKCT-3’; HSP70-R617 5’-
CGAAGAAGTCCGATA CGAGGGA-3’) que amplifican un fragmento parcial de 593 pb del
gen HSP-70N (gen que codifica para la Proteína Citoplasmática de Choque Térmico 70)
(Fig. 1d). Se incluyó como control positivo el ADN de las especies Leishmania panamensis
(Cepa referente UA140) y Leishmania brazilie
nsis (Cepa referente UA 2903), provisto por la Unidad de Biología molecular del PECET.
Los productos parciales obtenidos de Leishmania fueron secuenciados en ambos sentidos
de la doble cadena de ADN, empleando el servicio de la Compañía Macrogen Inc. en Corea.
RESULTADOS
Identificación de ejemplares del género Lutzomyia.
Un total de 176 adultos colectados y 34 inmaduros recuperados en sitios de cría naturales, fueron
obtenidos alrededor de la zona urbana del municipio de Ovejas. El empleo de claves morfológicas y
el análisis complementario de las secuencias del gen COI, permitió confirmar la identificación
taxonómica de adultos e inmaduros (resultados no mostrados) incluidos en el estudio. Se
determinaron las especies Lu. evansi (número de individuos adultos= 160; inmaduros= 34), Lu.
panamensis (número de individuos adultos = 11) y Lu. gomezi (número de individuos adultos = 5)
(Tabla 1). La asignación taxonómica de especie y del sexo de los flebotomíneos permitió conformar
53 grupos para la detección molecular de Wolbachia y Leishmania mediante PCR.
Tabla 1: Listado de especies del género Lutzomyia y número de ejemplares identificados alrededor
de la zona urbana del municipio de Ovejas (Departamento de Sucre, Colombia) y analizados
mediante PCR para la detección de infección natural por Wolbachia y Leishmania.
Estado Especie de
flebotomíneo
Número de
grupos
analizados
Número total de
ejemplares
Grupos infectados con
Wolbachia (número de
individuos)
Grupos infectados con
Leishmania
(número de individuos) Hembra Macho
Adultos
Lu. evansi 16 143 17 1 (10) 9 (90)
Lu. panamensis 2 7 4 - -
Lu. gomezi 1 5 - - -
Inmaduros Lu. evansi 34 - - - -
Total 3 53 155 21 1 (10) 9 (90)
Detección de la infección por Wolbachia en Lu. evansi .
Se detectó la infección natural por Wolbachia en un grupo de machos de Lu. evansi (número
individuos= 10) catalogado como grupo 16 (G16) (Fig. 1c). Se denotó una correcta amplificación del
producto esperado de 600pb.
Figura 1. Geles de Electroforesis al 2% (a) PCR del gen COI para evaluar la calidad del ADN y
ausencias de inhibidores de ensayos moleculares sobre Wolbachia y Leishmania. (b) Estandarización
de la amplificación del gen WSP de Wolbachia en insectos; se realizó con larvas de Aedes aegypti
infectadas experimentalmente con la cepa wmel (PECET– ELIMINATE DENGUE). Detección de
concentraciones de ADN total que desde 974ng/ul hasta 3.1ng/ul. (c) Identificación molecular
mediante PCR del gen WSP de la infección natural por Wolbachia en pooles de Lutzomyia de Ovejas
(departamento de Sucre, Colombia). (d) Identificación molecular de infección por Leishmania en
Lu. evansi mediante PCR de un fragmento del gen HSPN-70. CN control negativo; CP: Control
positivo MP1kb: Marcador de peso molecular.
Identidad de Wolbachia detectada en machos de Lu. evansi
El producto amplificado (Tamaño de 600pb) fue óptimo para la secuenciación de gen WSP
de Wolbachia detectado en Lu. evansi (Número de acceso GenBank KM594548) El análisis
preliminar con BLAST confirmó la presencia de Wolbachia y la identidad del gen wsp con
porcentajes de similaridad del 96%. El dendrograma Neighbor Joining, generado con
secuencias parciales del gen WSP de Wolbachia de otros insectos reportados en Genbank
(Fig. 2), ilustra la ubicación del haplotipo WbLevaov16 detectado en machos de Lu. evansi,
ubicado en el supergrupo B y en el haplogrupo wLeva previamente reportado en el
municipio de Ovejas en flebotomíneos colectados durante la época seca (Vivero et al. en
prensa). Se aprecia mayor relación con los haplotipos de Wolbachia WbLevov75 y
WbLdubov43 reportados para Lu. evansi y Lu. dubitans. El haplotipo WbLevaov16
(KM594548) presenta una relación cercana con el grupo Con y otros grupos como Dei,
Crag, Unif y Prn, los cuales en su mayoría tienen cepas de Wolbachia aisladas de Mosquitos
(Fig. 2).
El análisis de la variabilidad nucleotídica de la secuencia de Wolbachia detectada revela entre 3 y 6
sitios variables, con respecto a los haplotipos reportados del haplogrupo wLeva. Los valores más
bajos de distancias genéticas pareadas de Kimura de WbLevaov16 estuvieron entre 0,007 al
compararse con WbLcyov56, WbLdubov43, WbLdubov45; 0,012 con WbLevov75, WbLdubov51 y
0,014 con el haplotipo WbLcyov59 que corresponde a otra cepa de Wolbachia detectada en Lu.
cayennensis. Las distancias genéticas del haplotipo WbLevaov16 con respecto a cepas de Wolbachia
identificadas en especies de la subfamilia Phlebotominae y ubicadas en el supergrupo A, fueron de
0,251 (wPap-Phlebotomus papatasi), 0,027 (wPrn Phlebotomus perniciosus) y 0, 171 (wWhi -
Lutzomyia whitmani, Lutzomyia shannoni). Las distancias genéticas con respecto al control positivo
de Wolbachia (Cepa wMel) ubicado en el supergrupo A fueron de 0,214.
Figura 2: Dendograma de Neighbor Joining de secuencias parciales del gen WSP, que ilustra en el
círculo rojo la ubicación de la cepa de Wolbachia encontrada en Lu. Evansi y en los triángulos
verdes cepas de Wolbachia previamente reportadas. En circulo azul control positivo de la cepa
wMel
Detección de la infección con Leishmania por PCR del gen HSP-70N.
De los 53 grupos de flebotomíneos fueron seleccionados 13 grupos conformados por hembras de la
especies Lu. evansi, Lu. gomezi y Lu. panamensis para la detección natural de Leishmania. Nueve
grupos de Lu. evansi resultaron positivos con el fragmento esperado de 590 pb del gen HSP-70N
(Fig. 1d). Sin embargo solo una secuencia editada de 418 pb del gen HSP-70N del grupo 6 de Lu.
evansi, fue obtenida de forma legible y mostró mayor similaridad con secuencias de Leishmania del
subgenero Viannia luego de realizar el análisis en BlastN. Los mayores porcentajes de similaridad
(93%) se presentaron con secuencias del gen HSP-70N Leishmania panamensis (XM_010702330.1,
CP009397.1), sin embargo el análisis de la secuencia obtenida solo permite definir su relación con el
subgénero Viannia y su separación de secuencias del gen HSP-70N pertenecientes a Leishmania
infantum (Fig. 3).
Figura 3: Dendograma de Neighbor Joining de secuencias parciales del gen HSPN-70
realizado en BLAST (Basic Local Alignment Search Tool) con secuencias disponibles en
GenBank, que ilustra en el círculo rojo la ubicación del asilamiento de Leishmania spp.,
encontrada en poblaciones naturales de Lu. evansi.
DISCUSIÓN.
La detección de la infección natural de Wolbachia por la presencia de su ADN en
poblaciones silvestres de insectos vectores presentes en áreas donde se reporta
enfermedades infecciosas, es importante porque este endosimbionte puede ser usado
como control biológico para disminuir las tasas de infección al bloquear la actividad
patogénica de diversos microorganismos (virus y parásitos) (Ono et al. 2001, Azpurua et al.
2010, Rodriguero y Marcela 2013, Wallace 2013). Este estudio reporta y confirma la
presencia de Wolbachia en un grupo de machos de Lu. evansi, especie de gran interés por
ser el vector principal de la leishmaniasis visceral en la costa caribe de Colombia y algunos
países de Centroamérica (González et al. 2006).
El hallazgo de Wolbachia sugiere revisar en futuras investigaciones la variabilidad genética
de Lu. evansi, por la capacidad de este endosimbionte para recombinarse con los genomas
mitocondriales y nucleares de los hospederos (Baldo et al. 2006, Ellegaard et al. 2013).
Algunos estudios han sugerido que Wolbachia puede promover la especiación rápida
causando incompatibilidad reproductiva entre las poblaciones (Azpurua et al. 2010,
Kittayaponga et al. 2000, Sinkins et al. 2005). Sin duda alguna esto resultaría de gran interés
epidemiológico porque variantes genéticas (haplotipos) de Lu. evansi puede reflejar
diferencias en la competencia vectorial y la dinámica de transmisión de la leishmaniasis en
diferentes áreas de influencia del parásito y de reservorios de la enfermedad.
Esta apreciación coincide con la sugerencia de Azpurua et al. (2010), sobre la necesidad
explorar de los patrones de transmisión de diferentes haplotipos de Lutzomyia trapidoi
(Azpurua et al. 2010), los cuales resultaron positivos para Wolbachia, presentaron alta
variabilidad intra-especifica del marcador mitocondrial COI y mostraros tasas diferenciales
de infección por Leishmania (Azpurua et al. 2010).
Las cepas de Wolbachia varían en forma considerable según sus hospedadores (González
y Martínez 2010, Rodriguero y Marcela 2013) y en cuanto a su dinámica de fijación o efectos
generados en el insecto como la incompatibilidad citoplasmática. Por tal motivo existe la
posibilidad en el panorama del control biológico, de que la cepas de Wolbachia
transfectadas en un nuevo hospedero (insecto vector de interés) puede verse alterada por
las cepas ya existentes de la población silvestre de insectos (Rodriguero y Marcela 2013,
Hoffmann et al. 2015). En este contexto la detección molecular de la cepa de Wolbachia en
Lu. evansi, es importante porque permite conocer su genotipo, relación con otros insectos
hospederos y estimar posibles efectos que puede tener la cepa Wolbachia, como el de
transmisión horizontal al estar presente en otras especies de Lutzomyia de la región.
El análisis de secuencias del gen WSP de nuestro estudio indica que la cepa de Wolbachia
encontrada en machos de Lu. evansi se sitúa en el supergrupos B, uno de los primeros en
ser estudiados y se corresponden con las cepas responsables de la incompatibilidad
citoplasmática, partenogénesis en huevos y feminización en los artrópodos (Werren 1997).
Dentro de este sistema de clasificación de supergrupos, se ha propuesto subdividirlos en
otros más pequeños (“grupos”, linajes o cepas) basándose en la secuencia del gen WSP.
La cepa detectada en machos de Lu. evansi tiene relación con cepas de los grupos Con,
Unif, Dei, Prn y Gel que en su mayoría han sido detectadas en dípteros, indicando que estas
cepas tienen gran capacidad de adaptación por sus hospederos y de infectividad por
diferentes órganos (Zhou et al. 1998, Ruang-Areerate et al. 2003,). Los hospederos de las
cepas Con, Unif, Dei, Prn relacionados corresponden con los dípteros Phlebotomus
perniciosus, Mansonia uniformis, Mansonia indiana, Culex sitiens, Trichograma deion,
Culex gelidus y al escarabajo Tribolium confusum principalmente (Ono et al. 2001, Azpurua
et al. 2010).
Resulta necesario indicar que la cepa de Wolbachia encontrada en Lu. evansi, tiene lejana
relación con las cepas encontradas en Lu. shannoni y Lu. whitmani (Ono et al. 2001). Esto
indica que diferentes especies de flebotomíneos han sido infectadas con diferentes cepas
de Wolbachia en distintas ocasiones (Ono et al. 2001).
Relevar el estado de infección de Leishmania y Wolbachia conjuntamente en poblaciones
del género Lutzomyia aporta información preliminar para el diseño de estrategias de control
biológico de estos insectos vectores. Dentro del grupo de especies encontradas en este
estudio, Lu. gomezi presenta antecedentes epidemiológicos por ser un vector reconocido
de leishmaniasis cutánea en la Costa Caribe y otras regiones del país tanto en zonas rurales
como en zonas urbanas (Cochero et al. 2007, Azpurua et al. 2010, Paternina-Gómez et al.
2011, Paternina 2012).
Esta especie también ha sido encontrada infectada naturalmente con diferentes especies
de Leishmania en distintos países de Suramérica (González et al. 2006, Paternina-Gómez
et al. 2011, Azpurua et al. 2010). Sin embargo en nuestro estudio no se detectó la infección
natural con Leishmania ni con Wolbachia en esta especie. El grupo de individuos de Lu.
panamensis también resulto negativo a la infección natural por Wolbachia y Leishmania, la
presencia de sus ejemplares en el área de estudio es un hallazgo de interés
ecoepidemiológico, porque esta especie es un vector reconocido de Leishmania (Viannia)
panamensis en Panamá (Christensen et al. 1972) y fue encontrada infectada naturalmente
con Leishmania (Viannia) braziliensis en Venezuela (Rodríguez et al. 1999).
Es necesario precisar que la ausencia de Wolbachia y Leishmania en estas dos especies
puede estar influenciada por el esquema de muestreo, la reducida escala geográfica al
considerase como una exploración puntual y la baja abundancia encontrada, que reduce la
posibilidadde acceder a su ADN.
A diferencia varios grupos de hembras de Lutzomyia evansi fueron encontradas positivas a
la infección por Leishmania (Viannia) spp en nuestro estudio; y es congruente con el reporte
preliminar de Bejarano et al. (2012), más sin embargo el ADN de las mismos grupos
resultaron negativos para Wolbachia, en contraste con el estudio de Azpurua et al. 2010
quien reporto co-infección por Wolbachia y Leishmania en otras especies del género
Lutzomyia. Lu. evansi es el vector principal de la leishmaniasis visceral en la costa caribe
de Colombia (Sucre, Bolívar, Córdoba) y vector secundario en ausencia de Lutzomyia
longipalpis en algunas regiones de Colombia y determinados países de Centroamérica
(González et al. 2006).
CONCLUSIÓN
Se confirma la infección natural por el endosimbionte Wolbachia en Lu. evansi y la detección
del parásito Leishmania en un grupo que carecía de la infección de Wolbachia. Se sugiere
realizar más estudios en otras localidades de la región Caribe y de Colombia para aportar
a la filogenia y distribución de Wolbachia en estos insectos vectores y relacionarlos a los
niveles de infección simultáneos de Wolbachia y Leishmania.
AGRADECIMIENTOS
Los autores agradecen el soporte financiero provisto por el Departamento Administrativo de
Ciencia Tecnología e Innovación (COLCIENCIAS Code # 357-2011 U.T EICOLEISH -
“Comprehensive Strategy for the Control of Leishmaniasis” y a la convocatoria nacional de
de Estudiantes de Doctorado Nacionales 528). Nosotros también agradecemos a los
miembros del PECET (Programa de Estudio y Control de Enfermedades Tropicales) por la
colaboración en los muestreos entomológicos por parte de los investigadores Horacio
Cadena y Andrés Vélez. Al Grupo de Investigaciones Biomédicas de la Universidad de
Sucre, por su colaboración en los muestreos entomológicos por parte de los investigadores
Luis Gregorio Estrada y Edgar Ortega. Agradecemos al Laboratorio de Biología y
Sistemática Molecular de Insectos, de la Universidad Nacional de Colombia, sede Medellín.
Las fuentes de financiación no tienen funciones en el diseño del estudio, colección de datos,
análisis, decisión para publicar y preparación del manuscrito.
REFERENCIAS
Altschul S, Madden T, Schaffer A, Zhang J, Zhang Z, Miller W, Lipman D. 1997. Gapped
BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic
Acids Research. 25 (17): 3389–3402.
Azpurua J, De La Cruz D, Valderama A, Windsor D. 2010. Lutzomyia Sand Fly Diversity and
Rates of Infection by Wolbachia and an Exotic Leishmania Species on Barro Colorado
Island, Panama. PLOS Neglected Tropical Diseases. Dis 4(3): e627.
Blanco-Tuirán P, Maingon R, Hommel M, Alcalá J. 1993. A focus of visceral and cutaneous
leishmaniasis on the northern coast of Colombia. Archives de l'Institut Pasteur de Tunis. 70:
481-8.
Bejarano E, Sierra D, Vélez I. 2003. Novedades en la distribución geográfica del grupo
verrucarum (Diptera: Psychodidae) en Colombia. Biomédica. 23 (3): 341-350.
Bejarano E. 2006. Lista actualizada de los psicódidos (Diptera: Psychodidae) de Colombia.
Folia Entomológica Mexicana. 45 (1): 47-56.
Braig HR, Zhou W, Dobson SL, O'Neill S. 1998. Cloning and characterization of a gene
encoding the major Surface protein of the bacterial endosymbiont Wolbachia pipientis.
Journal of Bacteriology. 180 (9): 2373-2378.
Bejarano E, Uribe S, Pérez A, Egurrola J, Dib J, Porter C. 2015. Nuevos hallazgos de
flebotomíneos (Diptera: Psychodidae) en la Sierra Nevada de Santa Marta, Colombia. Acta
biol.Colomb. doi.org/10.15446/abc.v20n1.45176.
Bejarano EE, Pérez-Doria A, Paternina LE, Paternina-Gómez M, Martínez L. 2012. Natural
infection of Lutzomyia evansi (Diptera: Psychodidae) with Leishmania (Viannia) spp. in
northern Colombia. Am J Trop Med Hyg.87:173.
Camacho M, Caraballo L, Barrios H, Correa I, Figueroa N. 1977. Kala-azar: un foco en el
departamento de sucre. Tribuna Médica. 56: 33-4.
Cazorla D, Oviedo M, Vívenes MA. 2010. Redescripción de la quetotaxia del cuarto estadio
larval de Lutzomyia evansi (Diptera: Psychodidae, Phlebotominae). Revista Colombiana de
Entomología. 36 (1): 76-81.
Christensen H, Herrer A, Telford S. 1972. Enzootic cutaneous leishmaniasis in eastern
Panama. II. Entomological investigations. Annals of Tropical Medicine and Parasitology, 66:
55-66.
Contreras A, Vivero R, Bejarano E, Carrillo L, Vélez I. 2012. Nuevos registros de
flebotominos (Diptera: Psychodidae) en el área de influencia del río Amoyá en Chaparral,
Tolima. Biomédica. 32 (2): 263-268.
Cochero S, Anaya Y, Días Y, Paternina M, Luna A, Paternina L, Bejarano EE. 2007.
Infección natural de Lutzomyia cayennensis cayennensis con parásitos tripanosomastídeos
(Kinetoplastida: Trypanosomatide) en los Montes de María, Colombia. Revista Cubana de
Medicina Tropical. 61 (3): 59-66.
Collins F, Mendez M, Rasmussen M, Mehaffey P, Besansky N, Finnerty V. 1987. A
ribosomal RNA gene probe differentiates member species of the Anopheles gambiae
complex. The American Journal of Tropical Medicine and Hygiene. 37 (1): 37-41.
Cortés LA, Fernández JJ. 2008. Especies de Lutzomyia en un foco urbano de leishmaniasis
visceral y cutánea en El Carmen de Bolívar, Bolívar, Colombia. Biomedica. 28: 433-40
Dedeine F, Ahrens M, Calcaterra L, Shoemaker DD. 2005. Social parasitism in fire ants
(Solenopsis spp): a potential mechanism for interspecific transfer of Wolbachia. Molecular
Entomology. 14: 1543-1548
Floate K, Kyei- Poku G, Coghlin P. 2006. Overview and relavance of Wolbachia bacteria in
biocontrol researsh. Biocontrol Science Technology. 16 (8): 767- 788.
Favia G, Ricci I, Damiani C, Raddadi N, Crotti E, Marzorati M, et al. 2007. Bacteria of the genus Asaia stably associate with Anopheles stephensi, an Asian malarial mosquito vector. Proc Natl Acad Sci USA.104: 9047–9051.
Finney C, Kamhawi S, Wasmuth J. 2015. Does the Arthropod Microbiota Impact the Establishment of Vector-Borne Diseases in Mammalian Hosts?. Plos DOI: 10.1371/journal.ppat.1004646.
Fraga J, Montalvo AM, De Doncker S, Dujardin J, Van der Auwera G. 2010. Phylogeny of
Leishmania species based on the heat shock protein 70 gene. Infection, Genetics and
Evolution. 10 (2): 238-45.
González C, Cabrera O, Munstermann L, Ferro C. 2006. Distribución de los vectores de
Leishmania infantum (Kinetoplastida: Trypanosomatidae) en Colombia. Biomédica. 26
(supl.1): 64-72.
González E, Martínez FD. 2010. Consecuencias evolutivas causadas por bacterias del
género Wolbachia en artrópodos. Boletín de la Sociedad Entomológica Aragonesa. 46:
189−202.
Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis
program for Windows 95/98/NT. Nucleic Acids Symposium Series. 41: 95–98.
Hernández J, Hurtado A, Ortiz R, Walschburger T. 1992. Unidades biogeográficas de
Colombia. Págs. 105-152 en: Halffter, G. (ed.). La Diversidad Biológica de Iberoamérica I.
CYTED-B Programa iberoamericano de ciencia y tecnología para el desarrollo. Instituto de
Ecología, A.C., [Xalapa (México)].
Higgins D, Bleasby A, Fuchs R. 1992. CLUSTAL V: improved software for multiple sequence
alignment. Comput Appl Biosci. 8: 189–191.
Hoffmann A, et al. 2011. Successful establishment of Wolbachia in Aedes populations to
suppress dengue transmission. Nature. 476: 454–457
Holdridge L. 1967. Life Zone Ecology. [San José (Costa Rica)]: Tropical Science Center.
Kittayaponga P, Milnea JR, Tigvattananontb S, Baimaia V. 2000. Distribution of the
Reproduction-modifying Bacteria, Wolbachia, in Natural Populations of Tephritid Fruit Flies
in Thailand Pattamaporn Kittayapong. Journal of the Science Society of Thailand. 26: 93-
103
Le Pape P. 1992. Écoépidémiologie de la leishmaniose a Leishmania infantum = L. chagasi
dans la plaine des caraïbes (Colombie): corrélation vecteur et réservoir canin. [Montpellier,
Francia]: Université de Montpellier I.
Librado P, Rozas J. 2009. DnaSP v5: A software for comprehensive analysis of DNA
polymorphism data. Bioinformatics. 25: 1451–145.
Luyo- Acero G, Uezato H, Oshiro M, Takei K, Kariya K, Katakura K, Gomez- Landires E,
Hashiguchi Y, Nonaja S. 2004. Sequence variation of the Cytochrome b gene of various
human infecting members of the genus Leishmania and their phylogeny. Parasitology. 128:
483-491.
Martin DP, Williamson C, Posada D. 2005. RDP2: recombination detection and analysis
from sequence alignments. Bioinformatics. 21 (2): 260-262
Martínez L, Rebollo J, Luna A, Cochero S, Bejarano E. 2010. Molecular identification of the
parasites causing cutaneous leishmaniasis on the Caribbean coast of Colombia.
Parasitology. 106: 647-652.
Ono M, Braig H, Munstermann L, Ferro C, O´ Neill S. 2001. Wolbachia Infections of
Phlebotomine Sand Flies (Diptera: Psychodidae). J Med Entomol. 38 (2): 237-241
Paternina-Gómez M, Pérez-Doria A, Paternina L, Velbel D, Martínez L, Bejarano E. 2011.
Infección natural de Lutzomyia micropyga con tripanosomatídeos en el Caribe colombiano.
Biomédica. 31 (sup.3): 209-421
Paternina L. 2012. Determinación molecular de las fuentes alimenticias de Lutzomyia spp.
(Diptera: Psychodidae) asociadas a casos de Leishmaniasis Cutánea en el departamento
de Sucre, Caribe Colombiano [tesis de maestría]. [Medellín (Colombia)]: Facultad de
Ciencias, Universidad Nacional de Colombia Sede Medellín. p. 70.
Perez-Doria A, Paternina L, Paternina M, Martínez L, Verbel-Vergara D, Bejarano E. 2011.
Infección natural de Lutzomyia evansi con especies del complejo Leishmania braziliensis
causantes de leishmaniasis cutánea en la Costa Caribe colombiana. Biomédica. 31(3): 23-
205.
Robert E. 2004. MUSCLE: multiple sequence alignment with high accuracy and high
throughput. Nucleic Acids Research. 32(5): 1792-97.
Rodriguero, Marcela S. 2013. Wolbachia, una pandemia con posibilidades. Revista de la
Sociedad Entomológica Argentina. 72: 3-4.
Ruang-Areerate T, Kittyapong P, Baimai V, O’Neill S. 2003. Molecular Phylogeny of
Wolbachia Endosymbionts in Southeast Asian Mosquitoes (Diptera: Culicidae) Based on
WSP Gene Sequences. Journal of Medical Entomology. 40 (1): 1-5.
Rodríguez N, Aguilar C, Barrios M, Barker D. 1999. Detection of Leishmania braziliensis in
naturally infected individual sandflies by polymerase chain reaction. Trans R Soc Trop Med
Hyg. 93: 47-49.
Sinkins S, et al. 2005. Wolbachia variability and host effects on crossing type in Culex
mosquitoes. Nature 436: 256-260.
Tamura K, Dudley J, Nei, M, Kumar S. 2007. MEGA 4.1: Molecular Evolutionary Genetics
Analysis (MEGA) software version 4.0. Molecular Biology and Evolution. 24: 1596–1599.
Vívenes MA, Oviedo M, Márquez JC. 2005. Desarrollo de Lesihamania mexicana y
Lesihmania amazonensis en Lutzomyia evansi (Diptera: Psychodidae, Phlebotomine).
Revista Colombiana de Entomología. 31 (1): 71-74.
Vivero R, Ortega E, Aparicio Y, Torres C, Muskus C, Bejarano E. 2013. Flebotominos
adultos e inmaduros (Diptera: Psychodidae): registros para el Caribe colombiano. Boletín
de Malariología y Salud Ambiental. 3 (2): 1-10.
Vivero R, Torres-Gutierrez C, Bejarano E, Cadena H, Estrada L, Florez F, et al. (2015) Study
on natural breeding sites of sand flies (Diptera: Phlebotominae) in areas
of Leishmania transmission in Colombia. Parasit Vectors 8 (116). doi: 10.1186/s13071-015-
0711-y.
Wallace H. 2013 Mosquitos Genéticamente Modificados: Preocupaciones Actuales. Enang
(Malasia): Third World Network. P. 98
Walker T, Johnson P, Moreira L, Iturbe I, Frentiu F, McMeniman C, Leong Y, Dong Y, Axford
J, Kriesner P, Lloyd A, Ritchie S, O´Neill S, Hoffmann A. 2011. The wMel Wolbachia strain
blocks dengue and invades caged Aedes aegypti Populations. Nature. 476: 450–453
Werren J, Zhang W, Guo, L. 1995. Evolution and phylogeny of Wolbachia: reproductive
parasites of arthropods. Proceedings of the Royal Society of London. Series B. 261: 55-63.
Werren J. 1997. Biology of Wolbachia. Annual Review of Entomology. 42: 587–609
Werren J, Baldo L, Clark M. 2008. Wolbachia: master manipulators of invertebrate biology.
Nature Reviews Microbiology. 6: 741-751.
Young G, Duncan M. Guide to identification and geographic distribution of Lutzomyia sand
flies in Mexico, the West Indies, Central and South America (Diptera: Psychodidae). Mem.
Am. Entomol. 1994; 54: 1-881.
Zambrano P. 2014. Leishmaniasis. CIUDAD: Instituto Nacional de Salud. Protocolo de
Vigilancia en Salud Pública PRO-R02.016-Versión 01
Zhou W, Rousset F, O'Neill S. 1998. Phylogeny and PCR-based classication of Wolbachia
strains using WSP gene sequences. Proceedings of the Royal Society of London. Series B.
265: 509-515.
6. GENERAL CONCLUSIONS
In this study the "culture dependent techniques" showed to be useful to identify pathogens
and commensal or mutualistic species associated to Lutzomyia species.The more recent
implemented use of "culture independent methods", was complementary for understanding
the microbial communities present in a particular “ecological niche”, in this case Lutzomyia
evansi. Within the general conclusions it is important to highlight the variations depending
the engorged condition of females and the wide variety of bacteria associated to immature
stages, the variation on engorged females and larvae, may be related to the influence of the
mammals flora composition used as blood source and physico-chemical composition of the
breeding sites for immature in each source of collection
A higher representation of Gram-negative bacteria was detected in females, males
and larvae, while in the pupal stages all bacteria were Gram-positive, which is
consistent with studies of intestinal microbiota on others insect vectors as
Anopheles, Aedes and Phlebotomus.
The dominant bacterial communities associated with Lu. evansi belong to the genera
Enterobacter, Pseudomonas, Acinetobacter and Ochrobactrum.
E. cloacae is a resident population associated to Lu. evansi, with possible
transstadial transmission.
A wide variety of entomopathogenic bacteria were isolated mainly in the guts of Lu.
evansi larvae and pupae (O. anthropi, L. soli, P. illinoisensi, B. anthracis, S.
zoogloeoides, among others).
Horizontal transmission of Wolbachia among three species (Lutzomyia dubitans,
Lutzomyia cayennensis, and Lutzomyia evansi) is pausible according the ressults.
The species Lu. evansi, Lu. dubitans, and Lu. cayennensis were found positive for
Wolbachia infection both by PCR and by sequencing of the wsp gene.
Highest percentage of growth inhibition was observed against procyclic
promastigotes with bacterial concentrations of 108 CFU/ml of E. cloacae (77.29 ±
0.6%) and P. ananatis (70.17% ± 1.1). 109
The extracts produced by the three bacterial isolates showed similar biological
activity (13mm-22mm inhibition halos) against all tested bacteria.
Proteobacteria, Firmicutes and Bacteroidetes were the most abundant phyla in all
samples of Lutzomyia evansi. Proteobateria represented more than 60% of the
communities of all samples, with the exception of OV5M (32%) which is also the
most diverse one.
The bacterial composition shared among the samples is similarly to other insect gut
microbiome reported, including the detection of several diverse OTUs of
Bacteroidetes and Lactobacillales.
The extracts produced by the three bacterial isolates showed similar biological
activity (13mm-22mm inhibition halos) against all tested bacteria.
Proteobacteria, Firmicutes and Bacteroidetes were the most abundant phyla in all
samples of Lutzomyia evansi.
7. PERSPECTIVES AND DESIRABLE FUTURE STUDIES
To study the activity of crude methanol extracts produced from other bacterial
isolates obtained in this study, against promastigotes of Leishmania and other
parasites transmitted by vectors insect (i.e. Plasmodium).
To determine and identify molecules or peptides associated with quorum sensing in
gram negative bacteria obtained from adult states Lutzomyia evansi, as a platform
to find alternative vector control or treatment of leishmaniasis.
To consider a profound study of the interaction between Wolbachia and Leishmania
in natural populations of insect vectors of leishmaniasis in Colombia, as well as
conduct studies related to its potential isolation in cell culture media for insects.
Study the colonization process and the effect of such bacteria in preventing the
Leishmania establishment.
Also study the ability of Leishmania to generate resistance towards the insect
bacterial pathogen colinization.
Study the microbiota of other potential vectors of Leishmania in Colombia, because
of the 14 species recorded, only have been studied Lutzomyia longipalpis and
Lutzomyia evansi.
Describe the microbiota associated with natural breeding sites Lutzomyia evansi and
evaluate entomopathogenic fungi and possible relationship between microbiota in
the vector species and breeding places.
APPENDIXES
Appendix A: Geographical areas for sanflies collection and sampling methods for
immature and adults.
Appendix B: Areas and collection methods of immature and adult sand flies. a) peri
urban environment of Ovejas municipality; b) Reserva Natural Primate, Coloso municipality;
c) adult searching in resting sites; d) adult collection with Shannon trap; e) Uvito tree as
natural breeding site for immature forms; f) soil sample sampling for immature search; g)
immature selection under stereoscope h) Lu. evansi larvae isolated from soil substrate; i)
Lu. evansi pupae isolated from soil substrate.
Appendix C: Lu evansi processing for guts obtention througth imature and adult dissection. A1: male; A2: gut of a male; B1:
unfed female; B2: gut of a unfed female; C1: fed female; C2: gut of unfed female; D1: fourth instar larvae recovered in natural breeding
sites; D2: gut of fourth instar larvae recovered in natural breeding sites; E1: pupa recovered in natural breeding sites; E2: gut of a pupa
recovered in natural breeding sites.
LevcovsA-40
L14 Inmaduro Levansi
LevcovsI-95
LevcovsA-24
LevcovsA-25
LevcovsI-96
LevcovsA-26
LevcovsI-c95
LevcovsA-42
Grupo 10 Adultos de Levansi
Grupo 16 Adultos de Levansi
L83 Inmaduro Levansi
L86 Inmaduro Levansi
LevcovsI-c92
Grupo 1 Adultos de Levansi
LevcovsI-10
LevcovsI-c93
LevcovsI-c175
LevcovsA-27
LevcovsI-93
LevcovsA-41
Lgomecss72
Lgomecsc14
Lgomecsc12
LgocovsI-c91
Lwb 64 Lgomezi
Lgomecsc11
Lwb 68 Lgomezi
Lgomecsc13
LgocovsA-35
Lcayecsc24
Lcayecsc40
Lwb 57 Lcayennensis
Lcayecsc25
Ldubicsc07
Ldubicsc06
Ldubicsc08
Ldubicsc09
Ldubicsc10
Lwb 51 Ldubitans
Nemspsai01
Nemspsai02
Appendix D: Neighbor-Joining dendrogram (consensus) based on DNA barcode
sequences - COI to validate taxonomic identity of immature Lutzomyia. Dendrogram
was produced by the Neighbor - Joining method using MEGA 6. Symbol of green squares
represent to groups of adults or immature in the study. Support nodes indicate the
percentage of bootstrap> 95%. *Lu. evansi and other sand flies, whose DNA was examined
for the analysis of intestinal microbiota, Wolbachia and Leishmania.
Appendix E: Bacteria Counts (CFU) in Lu. evansi guts. Obtained in media LB agar and
MacConkey.
Regarding the culture dependent approach, it must to be noted the use of non-selective
media (LB agar) to promote growth of a wide range of bacteria TD from Lu. evansi and of
the selective - differential agar MacConkey. These media promote the growth of Gram-
negative bacteria present in greater proportion in vector insects of tropical diseases.
Bacterial growth suggested differences in bacterial loads associated to the DT of larvae in
LB agar medium, with respect to the pupal stage (no growth on MacConkey agar) and adult
specimens (the number of CFU was lower). This differences may be attributed to the
constant feeding habits (coprophagous) of larvae and to the high loads of bacteria in the
different types of substrates with decaying organic matter being prevalent, used as
development sites of Lu. evansi. Unlike the pupal stage, the larval stage undergoes changes
(metamorphosis) in the structure and content of the digestive tract (the gut of the larva is
reabsorbed), as well as the secretion of antimicrobial compounds [58], implying a loss of
microorganisms previously ingested by larvae. Among adult stages, an increased bacterial
load was noted in females (best growth on MacConkey agar) compared to male Lu. evansi,
a trend that can be explained by the eating habits of adult Lu. evansi. Engorged females
containing blood from various sources (animal or human) and sugars, appeared with an
increased availability of bacteria, while for unfed males and females we can assume only
the acquisition from sugars (lower supply of microorganisms).
Mic
roorg
an
ism
s (
CF
Ux1
03
)
S a n d f lie s
Cu
ltu
re
Me
diu
m
UFO
UFC
FFO
FFC
MV
MC L
4P
P
0
1 0 0
2 0 0
3 0 0
4 0 0
5 0 0
M a c C O N K E Y
L B -A G A R
Guts of Lu. evansi
Appendix F: Morphology and phylogenetic affiliation of bacterial isolates obtained
from the guts of Lu. evansi. Proteobacteria, Firmicutes and Bacteroidetes were the most
abundant phyla in all samples of Lutzomyia evansi.
Afiliación filogenética: Bacillus anthracis
Fuente: Pupa
Afiliación filogenética: Ochrobactrum anthropi
Fuente: Larva
Afiliación filogenética: Rummeliibacillus stabekisii
Fuente: Pupa
Afiliación filogenética: Lysobacter soli
Fuente: Larva
Afiliación filogenética: Bacillus megaterium
Fuente: Larva
Afiliación filogenética: Shinella zoogloeoides
Fuente: Larva
Afiliación filogenética: Pantoea ananatis
Fuente: Larva
Afiliación filogenética: Staphylococcus agnetis
Fuente: Hembra no alimentada, Coloso
Afiliación filogenética: Brevibacterium linens
Fuente: Hembra no alimentada, Coloso
Afiliación filogenética: Streptomyces malachitospinus
Fuente: Hembra no alimentada, Coloso
Afiliación filogenética: Enterobacter cloacae
Fuente: Hembra no alimentada, Coloso
Afiliación filogenética: Acinetobacter gyllenbergii
Fuente: Larva
Afiliación filogenética: Enterobacter hormaechei
Fuente: Larva
Afiliación filogenética: Pseudomonas aeruginosa
Fuente: Larva
Afiliación filogenética: Paenibacillus illinoisensis
Fuente: Larva
Appendix G: Morphology and phylogenetic affiliation of bacterial isolates obtained
from the guts of Lu. evansi.
Afiliación filogenética: Microbacterium pseudoresistens
Fuente: Pupa
Afiliación filogenética: Streptomyces cinnabarinus Fuente: Pupa
Afiliación filogenética: Staphylococcus epidermidis
Fuente: Hembra no alimentada, Coloso
Afiliación filogenética: Acinetobacter calcoaceticus
Fuente: Hembra no alimentada, Coloso
Afiliación filogenética: Pseudomonas putida
Fuente: Hembra no alimentada, Coloso
Afiliación filogenética: Enterobacter cancerogenus
Fuente: Hembra no alimentada, Coloso
Afiliación filogenética: Enterobacter ludwiggii
Fuente: Hembra no alimentada, Ovejas
Afiliación filogenética: Enterobacter aerogenes
Fuente: Hembra alimentada, Ovejas
Afiliación filogenética: Staphylococcus sciuri
Fuente: Hembra no alimentada, Ovejas
Afiliación filogenética: Staphylococcus arlettae
Fuente: Macho, Ovejas
Appendix H: Analysis of (ITS) spacer region between the 23S and 16S ribosomal gene
(ITS) for bacterial isolates from Lutzomyia evansi guts (adults). UF: unfed females; FF:
fed females; M: males.
Staphylococcus epidermidis
Staphylococcus agnetis
Streptomyces malachitospinus
Brevibacterium linens
Pseudomonas putida
Acinetobacter calcoaceticus
Pantoea ananatis
Enterobacter cloacae
Enterobacter cancerogenus
Enterobacter ludwiggii
Enterobacter aerogenes
Staphylococcus sciuri
Pseudomonas otitidis
Staphylococcus arlettae
Appendix I: Analysis of the (ITS) spacer region between the 23S and 16S ribosomal
gene (ITS) for bacterial isolates from Lutzomyia evansi guts (immature). L4: Larvae;
PP: Pupae.
Pseudomonas aeruginosa
Lysobacter soli
Streptomyces cinnabarinus
Shinella zoogloeoides
Microbacterium foliorum
Microbacterium pseudoresistens
Bacillus megaterium
Acinetobacter gyllenbergii
Enterobacter hormaechei
Ochrobactrum anthropi
Paenibacillus illinoisensis
Bacillus anthracis
Lysobacter soli
Rummeliibacillus stabekisii
(51 entries)
ITS
100
80
60
40
ITS
FF 25 (Sample 13)
UF 26 (Sample 14)
FF 24 (Sample 13)
UF 35 (Sample 11)
UF 36 (Sample 12)
FF 30 (Sample 8)
FF 23 (Sample 13)
UF 31 (Sample 8)
UF 17 (Sample 7)
UF 34 (Sample 11)
UF 22 (Sample 11)
FF 238 (Sample 237)
M 27 (Sample 15)
UF 38 (Sample 14)
FF 37 (Sample 13)
M 19 (Sample 9)
UF 21 (Sample 11)
FF 18 (Sample 8)
UF 29 (Sample 7)
UF 33 (Sample 10)
UF 111 (Sample 84)
UF 109 (Sample 83)
L4_122 (Sample 93)
L4_208 (Sample 180)
M 245 (Sample 238)
L4_212 (Sample 176)
UF 120 (Sample 90)
L4_114 (Sample 86)
L4_121 (Sample 92)
M 32 (Sample 9)
PP_124 (Sample 95)
L4_97 (Sample 86)
L4_98 (Sample 88)
UF 99 (Sample 89)
UF 100 (Sample 90)
PP 123 (Sample 94)
B. cereus
B. cereus
UF 119 (Sample 89)
L4_205 (Sample 177)
L4_207 (Sample 175)
L4_209 (Sample 179)
L4_210 (Sample 178)
L4_117 (Sample 87)
L4_118 (Sample 88)
L4_228 (Sample 79)
L4_226 (Sample 177)
FF 247 (Sample 237)
L4_229 (Sample 176)
M 250 (Sample 238)
L4_96 (Sample 86)
MacCONKEY
MacCONKEY
MacCONKEY
Agar LB
Agar LB
Agar LB
MacCONKEY
MacCONKEY
Agar LB
Agar LB
MacCONKEY
LB-Agar
MacCONKEY
Agar LB
Agar LB
Agar LB
MacCONKEY
MacCONKEY
Agar LB
Agar LB
LB-Agar
LB-Agar
LB-Agar
LB-Agar
LB-Agar
LB-Agar
LB-Agar
LB-Agar
LB-Agar
Agar LB
LB-Agar
MacConkey
MacConkey
MacConkey
MacConkey
LB-Agar
LB-Agar
LB-Agar
LB-Agar
LB-Agar
LB-Agar
LB-Agar
LB-Agar
MacConkey
MacConkey
MacConkey
MacConkey
MacConkey
MacConkey
Appendix J: Analysis of the (ITS) spacer region between the 23S and 16S ribosomal
gene (ITS) of cultivable fraction from Lutzomyia evansi guts (immature). L4: Larvae;
PP: Pupae; UF: unfed females; FF: fed females; M: males.
Appendix K: a) Principal components analysis for the RISA quantitative matrix of
cultivable fractions from the different samples and b) individual rarefaction. L4:
Larvae; PP: Pupae; UF: unfed females; FF: fed females; M: males.
a)
b)
Appendix L: a) Analysis of the (ITS) spacer region between the 23S and 16S ribosomal
gene (ITS) of total fraction from Lutzomyia evansi guts. b) Principal component
analysis for the RISA quantitative matrix and individual rarefaction. L4: Larvae; PP:
Pupae; UF: unfed females; FF: fed females; M: males.
a)
b)
c)
Appendix M: Principal components analysis for the TTGE quantitative matrix of the total DNA from the different samples and and individual rarefaction. (FF), (UF) (M) Male, (L4) Larvae, (PP) Pupae.
LD 81 140 42 71 52 51 41 44 45 CN LD
Appendix N: PCR amplification of the a) 16S rRNA gene, b) gyrB gene, c) Spacer
Region (ITS) between the 23S and 16S ribosomal gene (ITS) and d) Wsp gene of
Wolbachia and, e) HSP-70N gene of Leishmania sp.
a)
b)
c)
d)
WbLevov75-wLeva ACT AGC TAC TAC GTT CGT TTA CAA TAC AAC GGT GAA ATT TTA CCT TTT TAT ACA AAA GTT GAT GGT ATT AAA AAT GCA AGA GAT AAA Nucleotides
L A T T F V Y N T T V K F Y L F I Q K L M V L K M Q E I K Amino acids
GAA AAG GAT AGT CCC TTA ACA AGA TCT TTT ATA GCT GGT GGT GGT GCA TTT GGT TAT AAA ATG GAT GAC ATT AGA GTT GAT GTT GAA
K R I V P L Q D L L I L V V V H L V I K W M T L E L M L K
GGG CTT TAC TCA CAA TTG GCT AAA GAT ACA GCT GTA GTA GAT ATT TCT GAA ACA AAT GTT GCA GAC AGT TTA ACA GCA TTT TCA TGC
G F T H N W L K I Q L V V I F L K Q M L Q T V L Q H F Q D
CAG GAT TGG TTA ACG TTT ATT ATG ATA TAG CGA TTG AAG ATT ATC ACT CCA TAC GTT GTT GTA GGT GTT GGT GCA GCA TAT ATC AGC
W L T F I M I M R L K I C L S L H T L V L V L V Q H I S A AAT CCT TCA AAA GCT GAT GCA GTT AAA GAT CAA AAA GGA TTT GGT TTT GCT TAT CAA GCA AAA GCT GGT GTT AGC TAT GAT GTA ACT
I L Q K L M Q L K I K K D L V L L I K Q K L V L A M M V L
CCA GAA ATC AAA CTC TTT GCT GGA GCT CGT TAT TTC GGT TCT TAT GGT GCT AGT TTT GAT AAG GCA GAT GAG GAT GAT GCT GGT ATC
Q K S N S L L E L V I S V L M V L V L I R Q M R M M L V S
CAA AAA TGT TGT TTA CAG CAC TGT
S K M L F T A L
WbLcyov59-wLcay
ACT AGC TAC TAC GTT CGT TTA CAA TAC AAC GGT GAA ATT TTA CCT TTT TAT ACA AAA GTT GAT GGT ATT AAA AAT GCA AAA GAT AAA Nucleotides
L A T T F V Y N T T V K F Y L F I Q K L M V L K M Q K I K Amino acids
GAA AAG GAT AGT CCC TTA ACA AGA TCT TTT ATA GCT GGT GGT GGT GCA TTT GGT TAT AAA ATG GAT GAC ATT AGA GTT GAT GTT GAA
K R I V P L Q D L L I L V V V H L V I K W M T L E L M L K
GGG CTT TAC TCA CAA TTG GCT AAA GAT ACA GCT GTA GTA GAT ACT TCT GAA ACA AAT GTT GCA GAC AGT TTA ACA GCA TTT TCA GGA
G F T H N W L K I Q L V V I L L K Q M L Q T V L Q H F Q D
TTG GTT AAC GTT TAT TAT GAT ATA GCG ATT GAA GAT ATG CCT ATC ACT CCA TAC GTT GGT GTT GGT GTT GGT GCA GCA TAT ATC AGC
W L T F I M I I R L K I C L S L H T L V L V L V Q H I S A AAT CCT TCA AAA GCT GAT GTA GTT AAA GAT CAA AAA GGA TTT GGT TTT GCT TAT CAA GCA AAA GCT GGT GTT AGC TAT GAT GTA ACT
I L Q K L M V L K I K K D L V L L I K Q K L V L A M M V L
CCA GAA ATC AAA CTC TTT GCT GGA GCT CGT TAT TTC GGT TCT TAT GGT GCT AGT TTC GAT AAG GTA TGT AAG TAT GAT GCT GGT ATC
Q K S N S L L E L V I S V L M V L V S I R Y V S M M L V S
AAA AAT GTT GTT TAC AGC ACT GTT
K M L F T A L L
Appendix O: Nucleotide and amino acid sequences of Wleva and Wlcay strains detected from Lutzomyia evansi and Lutzomyia cayennensis, respectively, collected in the municipality of Ovejas, department of Sucre (Colombia).
Supergroups Group Host insects (strain of Wolbachia) Accession number (GenBank) References A Mel Drosophila melanogaster (Wmel positive control, transfected in Aedes
(Stegomyia aegypti), wMelCS, wMelH), D. simulans (wCof)
AF020072-AF020063- AF020065 -
AF020064-AF020066-AF020067
Zhou et al., 1998
AlbA Aedes albopictus (wAlbA) AF020059 Zhou et al., 1998 Mors Glossina morsitans (wMors), Nasonia vitripennis (wVitA), Glossina
centralis (wCen), Ae. albotaeniatus (wAlbo), Tripterioides aranoides
(wAra), Cx. brevipalpis (wBre), Hodgesia spp. (wHod)
AF020079 - AF020081-AF020078-
AF317475- AF317476- AF317477-
AF317483
Zhou et al., 1998, Ono et
al., 2001, Ruang-Areerate
et al., 2003
Riv D. simulans (Riverside) y D. auraria (wRi) AF020070 - AF020062 Zhou et al., 1998 Uni Muscidifurax uniraptor (wUni) AF020071 Zhou et al., 1998 Haw D. simulans (Hawaii), D. sechellia (wHa), Cadra cautella (wCauA) AF020068- AF020073- AF020075 Zhou et al., 1998 Pap Phlebotomus papatasi, P. mongolensis (wPap, Turk54), P. caucasicus
(Turk54), P. perfiliewi transcaucasicus, P. kandelakii. (wPap)
AF020082 - AF237882 - AF237883-
EU780683- KC576916
Zhou et al., 1998, Ono et
al., 2001, Parvizi et al.,
2013, Parvizi et al., 2012 Aus Glossina austeni (wAus) AF020077 Zhou et al., 1998 Whi Lutzomyia whitmani, Lutzomyia shannoni (wWhi) AF237885- AF237886 Ono et al., 2001 Lop Culex (Lophoceraomyia) spp. AF317490 Ruang-Areerate et al., 2003 Eum Cx. (Eumelanomyia) spp. ( wEum) AF317480 Ruang-Areerate et al., 2003 Nov Ae. novoniveus ( wNov ) AF317484 Ruang-Areerate et al., 2003 Niv Ae. niveus (wNiv) AF317485 Ruang-Areerate et al., 2003 Sub Armigeres subalbatus (wSub) AF317488 Ruang-Areerate et al., 2003
B Con Tribolium confusum (wCon), Cx. Gelidus (wGel), Laodelphax striatellus
(wStri), Cx. Sitiens (wSit)
AF020083- AF317482 - AF020080 -
AF317491
Zhou et al., 1998, Ruang-
Areerate et al., 2003
Dei Trichogramma deion (wDei) AF020084 Zhou et al., 1998 Pip Culex quinquefasciatus, Culex pipiens (wPip), Cx. Fuscocephala
(wFus), Drosophila simulans (mauritiana) y Ephestia Kuehniella (wMa),
Drosophila simulans (Noumea) (wNo), Aedes albopictus (wAlbB), Ae.
pseudalbopictus ( wPseu), Ar. Kesseli (wKes)
AF020061, AF020060, AF317481-
AF020069 -AB024570-AF020074-
AF020059- AF317487- AF317489
Zhou et al., 1998, Ono et
al., 2001, Ruang-Areerate
et al., 2003
CauB Ephestia cautella (wCauB), Tagosodes orizicolus (wOri) AF020076 - AF020085 Zhou et al., 1998,
Prn Phlebotomus perniciosus (wPrn) AF237884 Ono et al., 2001, Dro Trichopria drosophilae, Asobara tabida (WDro) AF071910- AF124856 Zhou et al., 1998, Unif Mansonia indiana (wInd), Mn. Uniformis (wUnif) AF317492- AF317493 Ruang-Areerate et al., 2003 Crag Ae. Craggi (WCrag) AF317478, AF317479 Ruang-Areerate et al., 2003 Perp Ae. perplexus (wPerp) AF317486 Ruang-Areerate et al., 2003
Leva Lu. evansi (wLev), Lu. dubitans (wLev), Lu.cayennensis (wLeva-
wLcay)
KR907869, KR907870, KR907871,
KR907872, KR907873, KR907874
--- Outgroup Bemicia tabaci FJ404651, FJ404653 Parvizi et al., 2013
1
Appendix P: Nomenclature of Wolbachia supergroups, groups, and strains used and host insects related. These strains were used to compare genetic distances and perform phylogenetic reconstructions.
Appendix Q: Verification of recombination events and the presence of chimeras was using RDP4 (Recombination Detection Program version 4) software (Martin et al. 2005), using all sequences of wsp obtained in this study in order to ensure the accuracy of nucleotide variability with respect to previously reported sequences in GenBank.
Appendix R: Experimental Scheme for activity evaluation of found bacteria on Leishmania infantum (procyclical and
metacyclic) by co-culture techniques.
Leishmania infantum
metacyclic
6 days of growth Procyclical
6 days of growth
1. Ochrobactrum anthropi
2. Enterobacter cloacae
3. Pantoea ananatis
Reactivation, viability and fluorescence
emission
Reactivation of cell growth in 1ml liquid
médium (LB)
Centrifugation, washing the cell pellet and
resuspension in 1 ml PBS
107-8
UFC *mL
Centrifugation, washed and resuspended in 1 ml of RPMI the
promastigotes – 3 X 106
Promastigote*mL
Activity Assay -Incubation at 28 ° for 24 ours
NR=3
NR=3
NR=3 NR=3
NR=3 NR=3
PBS +
promastigotes
PBS PBS PBS
O. anthropi
Procyclic
al
Metacyclic
E. cloacae P. ananatis
PBS +
promastigotes
O. anthropi E. cloacae P. ananatis
Microscopy – cytometry -viability and counting
promastigotes
Appendix S: Ressults socialization in conferences (national and international).
American Society for Microbiology Boston, May 17-20, 2014. “Midgut bacterial
community associated to two populations of Lutzomyia evansi (Diptera:
Psychodidae) in the Caribbean region of Colombia (South America)”.
1st Host-Pathogen Interactions Meeting, 28th to 30th may 2014, FINATEC
University of Brasilia, Brazil. “OPP-7. Study on the bacterial midgut microbiota
associated to Lutzomyia evansi (Diptera: Psychodidae), present in a wild habitat of
the Caribbean region of Colombia” (Philip Davis Marsden Award- For Best Oral
Presentation)
XVI Congreso Colombiano de Parasitología y Medicina Tropical. 21 - 23 de
octubre de 2015, Quinta de San Pedro Alejandrino, Santa Marta. I Simposio
Internacional de Innovación en Medicina Tropical. “Estudio de la flora bacteriana
intestinal asociada a estados adultos e inmaduros de Lutzomyia evansi: enfoque
polifásico y ensayos de actividad in-vitro contra promastigotes de Leishmania
infantum”.
IV Congreso Colombiano De Zoología, Cartagena de Indias, Colombia –
Diciembre 1 al 5 de 2014. “Detección de infección natural por la bacteria Wolbachia
y el párasito Leishmania en especies del género Lutzomyia (Psychodidae:
Phlebotominae)”
VIII International Symposium on Phlebotomine Sandflies in Puerto Iguazu,
Argentina 2014. “Study on the bacterial midgut microbiota associated to inmature
stage of genus Lutzomyia (Diptera: Psychodidae) isolated from natural breeding
sites”.
American Society for Microbiology New Orleans, May 30-June, 2015. “Study On
The Bacterial Midgut Microbiota Associated To Immature Stage Of Lutzomyia evansi
(diptera: Psychodidae) Isolated From Natural Breeding Sites.”.
Aconteceres Entomologicos. Febrero de 2015. Universidad Nacional de
Colombia. Estudio de comunidades bacterianas asociadas al tracto digestivo de
poblaciones naturales de adultos e inmaduros de Lutzomyia evansi: vector de la
leishmaniasis visceral en Colombia.
Semana de la Ciencia. Universidad Santiago de Cali. Noviembre 2015.
Microbiomas de Enfermedades Tropicales.
REFERENCES Azambuja P., Garcia E., Ratcliffe NA. (2005). Gut microbiota and parasite transmission by
insect vectors. Trends Parasitol 21: 568–572.
Amora S, Bevilaqua C, Feijo F, Alves N, Maciel M (2009) Control de Phlebotomine (Diptera:
Psychodidae) Leishmaniasis Vectors. Neotrop. Entomol 38(3): 303-10.
Cirimotich C., Ramirez J., Dimopoulos G (2011). Native microbiota shape insect vector
competence for human pathogens. Cell Host Microbe. 10(4): 307–310.
Dillon R., Dillon V (2004). The gut bacteria of insects: nonpathogenic interactions. Annu Rev
Entomol. 49:71-92.
Favia G., Ricci I., Damiani C., Raddadi N., Crotti E., Marzorati M., Rizzi A., Urso R., Brusetti
L., Borin S., et al. (2007). Bacteria of the genus Asaia stably associate with Anopheles
stephensi, an Asian malarial mosquito vector. Proc Natl Acad Sci USA.104:9047–9051.
Finney C., Kamhawi S., Wasmuth J (2015). Does the Arthropod Microbiota Impact the
Establishment of Vector-Borne Diseases in Mammalian Hosts?. Plos DOI:
10.1371/journal.ppat.1004646.
González C., Cabrera O., Munstermann L., Ferro C. (2006). Distribución de los vectores de
Leishmania infantum (Kinetoplastida: Trypanosomatidae) en Colombia. Biomédica 26(1):
64-72.
Guernaoui S., Garcia D., Gazanion E., Boumezzough A., Pesson B., Fontenille D., Sereno
D. (2011). Bacterial flora as indicated by PCR-temperature gradient gel electrophoresis
(TGGE) of 16S rDNA gene fragments from isolated guts of phlebotomine sand flies (Diptera:
Psychodidae). Journal of Vector Ecology 36 (1): S144-S147.
Hurwitz I., Fieck A., Read A., Hillesland H., Klein N., et al. (2011) Paratransgenic control of
vector borne diseases. Int J Biol Sci 7: 1334–1344.
Hoffmann A., Ross P., Rasic G. (2015). Wolbachia strains for disease control: ecological
and evolutionary considerations. Evolutionary Applications doi:10.1111/eva.12286.
Lindh J., Terenius O., Faye I. (2005). 16S rRNA gene-based identification of midgut bacteria
from fieldcaught Anopheles gambiae sensu lato and A. funestus mosquitoes reveals new
species related to known insect symbionts. Appl Env Microbiol 71: 7217–7223.
Mccarthy C., Diambra L., Rivera R. (2011). Metagenomic analysis of taxa associated with
Lutzomyia longipalpis, vector of visceral Leishmaniasis, using an unbiased high-throughput
Approach. PLoS Neglected Tropical Diseases. 5(9): e1304.
Molloy M., Bouladoux N., Belkaid Y. (2012). Intestinal microbiota: shaping local and
systemic immune responses. Semin Immunol 24: 58–66. doi: .1016/j.smim.2011.11.008.
Oliveira S., Moraes B., Goncalves C., Giordano C., D’Almeida J., et al. (2000). Prevalence
of microbiota in the digestive tract of wild females of Lutzomyia longipalpis (Diptera:
Psychodidae). Rev Soc Bras Med Trop. 33: 319–322.
Rangel E., Vilela M. (2008). Lutzomyia longipalpis (Diptera, Psychodidae, Phlebotominae)
and urbanization of visceral leishmaniasis in Brazil. Cad. Saúde Pública 24(12): 2948-2952.
Sant’Anna M., Diaz-Albiter H., Aguiar K., et al. (2014). Colonisation resistance in the sand
fly gut: Leishmania protects Lutzomyia longipalpis from bacterial infection. Parasites &
Vectors 7:329.
Sant’anna M., Darby A., Brazil R., Montoya J., Dillon V., et al. (2012). Investigation of the
Bacterial Communities Associated with Females of Lutzomyia Sand Fly Species from South
America. PLoS ONE 7(8): e42531. doi:10.1371/journal.pone.0042531.
Shanchez-Contreras M., Vlisidou I. (2008). The Diversity of Insect-bacteria Interactions and
its Applications for Disease Control. Biotechnology and Genetic Engineering 25: 203-244.
Vargas A., Vivero R., Uribe S., Moreno C., Cadavid G. (2012). Interacción de microbiotas
bacterianas e insectos hospederos. Boletín entomológico Francisco Luís Gallego. ISSN
2027-4378, 4(3): 13-22.
Werren J., Baldo L., Clark M (2008). Wolbachia: master manipulators of invertebrate biology.
Nature Reviews Microbiology 6, 741-751 doi:10.1038/nrmicro1969
Zahner V., Lucarotti C., McIntosh D. (2008). Application of 16S rDNA-DGGE and plate
culture to characterization of bacterial communities associated with the sawfly, Acantholyda
erythrocephala (Hymenoptera, Pamphiliidae). Curr Microbiol 57: 564–569. doi:
10.1007/s00284-008-9243-4 PMID: 18769850.