Characterization of N-Myristoyltransferases in Vertebrate … · 2019. 2. 15. · distribution of...

Volume 4 • Issue 3 • 1000120J Glycomics LipidomicsISSN: 2153-0637 JGL, an open access journal

Research Article Open Access

Nakatani et al., J Glycomics Lipidomics 2014, 4:3 DOI: 10.4172/2153-0637.1000120

Characterization of N-Myristoyltransferases in Vertebrate Embryos by Using Zebrafish: Appearance of Low Molecular Weight N-Myristoyltransferase 1 in Early DevelopmentHajime Nakatani1,2, Natsuki Nukada2, Eriko Avşar-Ban2, Hisayoshi Ishikawa2, Shin’ichi Akiyama1,2 and Yutaka Tamaru2* 1Wakayama Industrial Promotion Foundation, 60 Ogura, Wakayama-shi, Japan2Department of Life Sciences, Graduate School of Bioresources, Mie University, Japan

Keywords: Zebrafish; N-myristoyltransferase; Gene expressiondevelopment

Abbreviations: NMT: Protein N-myristoyltransferase; Src: Srctyrosine kinase; Lck: Lymphoid specific cytosolic protein tyrosine kinase; MARCKS: Myristoylated alanine-rich C-kinase substrate; ARF: ADP-ribosylation factor; HIV: Human immunodeficiency virus; Amp: Ampicillin; Km: Kanamycin; E. Coli: Escherichia coli; IPTG: Isopropyl β-D-1-thiogalactopyranoside; NUS: NusA protein; GST: Glutathion S transferase; MARCKSL: MARCK-like protein; EF-1α: Elongation factor-1 alpha

IntroductionThe covalent lipid modifications on proteins are an important

aspect of its functional regulation. The acylation by long fatty acid chain on amino acid residues in proteins alters biochemical characteristic of proteins, that is, conjugation of hydrophobic group heighten its affinity to the lipid membrane structures such as organelles or plasma membrane [1,2]. The lipid modified proteins targeting to plasma membrane appears their functions by interacting to other proteins nearly located the membrane. For example, recruiting of proteins involving specific intracellular signaling on cell membrane is often achieved by lipid modifications, and the effect enables rapid and effective signal transduction depending on the external environment. Due to this function, the cells finally achieve their proper cellular functions [1,2].

Three common lipid modifications (myristoylation of N-terminus glycine residue and palmitoylation or prenylation of serine and cysteine residue) are considered to be important for cellular functions [1]. Among these, myristoylation is recently received considerable attention, because the potential target amino acid sequence for myristoylation has been found in many signaling and regulatory proteins such as pp60Src, pp56lck [3-8], cAMP-dependent protein kinase [9], MARCS [10], G-protein α subunit [11], ARF protein [12], calcineurin [13] and HIV-1 matrix protein [14]. Further, the N-myristoylation on several

proteins has been shown to be important for the biological events such as appearance of cellular functions [1,2], transformation [8] or production of the virus particles [14,15].

N-myristoyltransferases (NMTs) are group of enzyme that mediates protein amino terminal myristoylation. The NMTs recognize amino terminal consensus amino acid sequences like Gly-X-X-X-Thr/Ser and catalyze the covalent transfer of myristic acid from myristoyl-CoA to amino group of glycine residue. Orthologues are widely recorded in the database of eukaryote genome, found in the organisms including human [16], mouse [17], rat [18], bovine [19] and yeast [20]. The wide distribution of NMTs in eucaryotes suggests its importance for basic cellular function. There exist at least two genetically distinct forms but structurally similar NMTs, NMT1 and NMT2, in mammalian [16,21]. Although those two NMTs seem to exist in wide variety of vertebrates, its biochemical characteristics or functions are not much revealed. In case of mammalian, there is one report that NMT1 but not NMT2 is important for the development of mouse. However, the detail roles of NMT1during embryogenesis did not addressed in that study, because the NMT1 knockout mice died between embryonic days 3.5 and 7.5 [22].

For the first step to explore the biological characteristics of NMTs during vertebrate’s embryogenesis, we concentrated on zebrafish as a

*Corresponding author: Yutaka Tamaru, Department of Life Sciences, Graduate School of Bioresources, Mie University, 1577, Kurimamachiya, Tsu, Mie 514-8507, Japan, Tel: +81 59 231 9560; E-mail: [email protected]

Received July 14, 2014; Accepted August 13, 2014; Published August 16, 2014

Citation: Nakatani H, Nukada N, Avşar-Ban E, Ishikawa H, Akiyama S (2014) Characterization of N-Myristoyltransferases in Vertebrate Embryos by Using Zebrafish: Appearance of Low Molecular Weight N-Myristoyltransferase 1 in Early Development. J Glycomics Lipidomics 4: 120. doi:10.4172/2153-0637.1000120

Copyright: © 2014 Abbott DW. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

AbstractFor the first step to explore the biological characteristics of NMTs during vertebrate’s embryogenesis, we concentrated

on zebrafish as a useful model of higher organisms. By in silico analysis of amino acid sequences, we found that zebrafish NMT1 (zNMT1) and zNMT2 which are translated from nmt1a and nmt2 genes had high homology to human or mouse NMT1 and NMT2, respectively. Expression analysis of nmt1a and nmt2 by RT-PCR and RNA blotting revealed that both genes were expressed during early development, and nmt2 expression was major initial developmental stages. Inhibition of zNMTs by 2-hydoroxymyristic acid (2-OHMyr) at early development resulted in embryonic lethal. Morpholino antisense oligo against nmt1a caused development arrest in early epiboly stage. Those results suggest that zNMTs are necessary for development after early epiboly stage. The recombinant zNMT1 was then prepared and its N-myristoyltransferases activity was confirmed. Finally, we analyzed expression of zNMT1 proteins in embryos at several developmental stages, and found that low molecular weight zNMT1 (29 kDa), which included N-terminal part of zNMT1, appeared specifically during embryonic development. Expression of full length zNMT1 fused to myc-His tag at its C-terminal resulted in production of low molecular weight protein (35 kDa). Detection of intact NMTs in protein extract from early embryos showed that there existed low molecular weight NMTs with substrate binding activity. From these findings, we concluded that zNMTs, like mammalian one, are also essential for zebrafish development, and low molecular weight zNMT1 appeared specifically in early developmental stage. Those isoforms might play important role in developmental processes in early embryos.

Journal of Glycomics & Lipidomics


Page 2 of 10


useful model of higher organisms. This model animal has been used commonly in many researches for developmental biology. In this study, we first confirmed the existence of zebrafish NMTs (zNMTs) which has high homology to mammalian’s NMTs, and examined their gene expression during embryogenesis. We next analyzed an effect of inhibition of zNMT1 on their embryogenesis. Finally, we analyzed expression of zNMT proteins at several embryonic stages. The results suggest that zNMTs like mammalian NMT are necessary for proper embryonic development of zebrafish. It was also suggested that novel low molecular weight zNMT1 appears specifically during embryogenesis. We think that those findings would be useful information for understanding NMT’s function during development of higher organisms.

Materials and MethodsZebrafish care and collection of eggs

Adult zebrafish were purchase from local provider and maintained in aquarium under artificial condition (28ºC, light period for 14 hrs and dark period for 10 hrs). For collection of fertilized eggs, two female and three male fish were mated. Spawning was induced by switching from dark period to light period.

Cloning of zNMTs and plasmid construction for their expression in Escherichia coli

Total RNA from the zebrafish embryo at 6 hpf was reverse-transcribed with oligo-dT primer in a volume of 20 µl. Aliquots of 1 µl were used for amplification of zNMT1 or zNMT2 cDNA. Polymerase chain reaction was carried out with following forward and reveres primers: 5’-CCACCATGGCGGATGAG-3’ and 5’-TCACTGCAGAACCAATCC-3’ for zNMT1, and 5’-ATGGCGGAGGACAGCGAGTCCGC-3’ and 5’-TTACTGTAAAACAAGGCCAAC-3’ for zNMT2, respectively. Amplification was done by 35 cycles of denaturation at 95ºC for 30 sec, annealing at 50ºC for 30 sec, and extension at 72ºC for 90 sec. Amplified DNA fragments were purified by agarose gel electrophoresis and cloned into pT7Blue-T vector (Novagen, San Diego CA). The constructs (pT7blue-zNMT1 and -zNMT2) were analyzed by DNA sequencing and confirmed its identity to the sequences on public database. For expression in Escherichia coli (E. coli), the zNMT genes were amplified with primer set as described in Table 1 by polymerase chain reaction with template plasmids (pT7blue-zNMT1 and -zNMT2), and was sub-cloned into pT7Blue-T vector. Generating pT7Blue-Sal I-zNMT1-Not I, pT7Blue-Eco RI-zNMT1s (full, deltaC1, deltaC2, deltaN1, deltaN2)-Not I and pT7Blue-Eco RI-zNMT2s (full, deltaC1, deltaC2, deltaN1, deltaN2)-Not I constructs were digested with two restriction enzymes, Sal I and Not I or Eco RI and Not I (TaKaRa Otsu, Japan). Resulting DNA fragments were separated and purified by agarose gel electrophoresis and the fragments were sub-cloned between the Sal I and Not I sites of pET 50b (+) vector (Novagen, San Diego CA) or the Eco RI and Not I sites of pGEX-6p-1 (GE Healthcare UK Ltd) vector, generated pET50-zNMT1, pGEX-zNMT1s and pGEX-zNMT2s constructs. Correct insertion of those DNA fragments were confirmed by DNA sequencing.

Expression of recombinant zNMTs

E. coli BL21 strain was transformed with pET50b-zNMT1, pGEX-zNMT1 and pGEX-zNMT2 vectors and cultured on the LB plate supplemented with 50 µg/ml of kanamycin (Km) or 50 µg/ml of ampicillin (Amp) at 37ºC overnight. Several colonies were obtained, and one of them was transferred to 4 ml of LB broth with 50 µg/ml of

Km or Amp. After incubation at 37ºC for 16 hrs, aliquots of 20 µl was transferred to 2 ml of 2×YT broth, further cultured approximately for 2 hrs at 37ºC until OD600nm reached 0.6. The expression of the recombinant protein (NUS-zNMT1, GST-zNMT1s and GST-zNMT2s) in BL21 was induced by addition of 100 µM of IPTG followed by culture for 16 hrs at 20ºC or 37ºC. E.coli were then collected from the medium by centrifugation at 5000×g for 10 minutes, washed once with 1×PBS and bacterial cells were collected again by centrifugation. The target protein was extracted from the cells by ultra-sonication in 50 µl of 1% Triton-X 100 in PBS or 2×NMT reaction buffer [50 mM Tris-HCL (pH 7.5), 0.5 mM EDTA, 0.45 mM 2-mercaptoethanol, 1%TritonX-100] or direct addition of 5×SDS-PAGE loading buffer [0.1 M Tris-HCl (pH 6.8), 5% SDS, 30% glycerol, 0.06% BPB, 5% 2-mercaptoethanol]. The protein extract was then centrifuged at 15000×g for 15 min at 4ºC, and separated into soluble and insoluble fractions. Each fraction was used for further analysis.

Purification of recombinant zNMT1 and preparation of the polyclonal antibodies against zNMT1

Antibodies against zNMT1 were obtained by immunization with purified recombinant NUS-zNMT1 fusion protein. The recombinant NUS-zNMT1 fusion protein was expressed in E. coli BL21 strain as described above, and collected as insoluble fraction. NUS-zNMT1 fusion was extracted from inclusion body with 3 M urea supplemented with 1% 2-mercaptoethanol at 4°C. NUS-zNMT1 protein was purified by Ni affinity chromatography with HisTrapTM HP column (GE healthcare Amersham Place, UK). Purified NUS-zNMT1 including its degraded peptides were collected and concentrated with AmiconR Ultra-15 centrifugal filter devices (Ultracel-30k) (Millipore) until protein concentration of the sample reached to approximately 1 mg/ml. Immunization of rabbits with purified NUS-NMT1 was requested to Kerry (Wakayama Japan). As for titer check of anti-zNMT antibodies, the recombinant GST-zNMT1s and GST-zNMT2s were used. GST-zNMT1s and GST-zNMT2s were expressed as above and extracted from insoluble fraction with 5×SDS-PAGE sample buffer. The samples were accessed by SDS-PAGE, followed by immunoblotting with anti-zNMT antibodies.

Detection of NMT activity by MS analysisThe total volume of soluble fraction of E.coli protein extracts

in 2×NMT reaction buffer was adjusted to 100 µl with water, then myristoyl-CoA Li salt (Sigma) and substrate peptide (GARASVLSK-biotin: MW1113.604275, synthesized by Invitrogen) were added to the reaction samples at the final concentration of 180 µM and 90 µM, respectively. After incubation at 30ºC for 1 hour, the reacted peptide were separated and collected with AmiconR UltrfreeR-MC centrifugal filter devices 5000 NMWL filter unit (Millipore). The peptides were then absorbed and desalted with ZipTip C18 column (Millipore). The column was washed 10 times with 0.1% TFA, finally peptides were eluted and directly spotted onto MALDI-Plate with 1-2 µl of 2.5 mg/ml CHCA in 70% AC/0.1% TFA. MS spectra were acquired using a 4700 Proteomic analyzer (Applied Biosystems, Foster City, CA, USA) in positive ion reflector mode over the 700-4000 m/z mass range, with 6000 laser shots per spot and external calibration with standard peptide [Bradykinin, Angiotensin II, P14R, ACTH (18-39) and Insulin B chain]. MS/MS spectra were acquired in CID mode and externally calibrated with ACTH (18-39) degraded peptide.

Construction of the expression plasmid for myc- and His- tagged zebrafish NMT1

The nmt1a gene was amplified from pT7blue-zNMT1 template


Page 3 of 10


by polymerase chain reaction with forward and reveres primer set, EcoRINMTs (5’-CGAGAATTCCACCATGGCGGATGAG-3’) and Not INMTas (5’-ATAGCGGCCGCCTGCAGAACCAATCC-3’). The amplicon was purified and digested with Eco RI and Not I restriction enzymes, sub-cloned into pEF1-myc-his C vector (Invitrogen) which was opened by same restriction enzymes, pEF1-zNMT1-myc-his construct was generated. Then, Xenopus laevis ef1alpha promoter was amplified from pXI-EGFP [23] template by polymerase chain reaction with forward and reveres primer set, MluIpxiproF (5’-GCATACGCGTCTCGAGCAGGG-3’) and SpeIpxiproR (5’-GCATACTAGTGGATCCGTCGAGG-3’). The amplicon was purified and digested with Mlu I and Spe I restriction enzymes, sub-cloned into pEF1-zNMT1-myc-his and pEF1-myc-his C vector which were opened by same restriction enzymes, pXI pro-zNMT1-myc-his pEF and pXI pro-myc-his pEF construct were generated.

Extraction of Proteins from Zebrafish EmbryosZebrafish embryos (30 embryos) were collected and yolk was

removed by pipetting and washing in cold PBS supplemented with protease inhibitors (Nacalai Tesque Kyoto, Japan) and 0.05% Tween 20. The embryos were then lysed with 10 µl/10 embryos of SDS-PAGE sample buffer or 1% Triton-X 100 in PBS supplemented with proteinase inhibitor cocktail. After ultra-sonication, the insoluble materials were removed by centrifugation. Resultant supernatants were retained as protein extract.

Detection of the Substrate Binding of NMTsThe protein extracts prepared from embryos at 6 hpf (20 µl in

1% Triton-X 100/PBS) or purified recombinant zNMT1 (250 ng) were mixed with 16 µM biotinylated substrate peptide (HIV-1 gag1: GARASVLSGGK‐biotin, Src: GGVKSKPKELK‐biotin, MARCKS: GAQISKNGAK‐biotin, MARCKSL: GAQLTKGEATK‐biotin, EF-1α: GKEKTHINIVK‐biotin, Albumin: KWVTFLLLLF‐biotin) or myristoyl-biotinylated substrate peptide (Myr-GARALVLSK‐biotin) and 65 µM myristoyl-CoA, then the total volume was adjusted 50 µl with water. The samples were incubated for 10 minutes at 30°C, 0.5 mM　ditiobis [succinimidylpropionate] (Thermo Science) was added and the samples were further incubated for 10 minutes on ice. After stopping reaction with 20 µl of 1M Tris-HCl (pH 6.8), proteins in the samples were recovered by acetone precipitation for 1 hour at -30°C. The protein precipitate was collected by centrifugation at 15000×g for 10 minutes, resulting pellet were dissolved in 5×SDS-PAGE loading buffer. The substrate peptide linked to proteins was detected by SDS-PAGE followed by immunoblotting with anti-biotin antibody or anti-zNMT1 antibody.

Expression and Purification of zNMT1-myc-his ProteinThe pXI pro-zNMT1-myc-his pEF and pXI pro-myc-his pEF

constructs were injected into embryos at one cell stage, the embryos were incubated for 6 hours after fertilization. Protein was extracted from 60 embryos, the extract was then mixed with Ni-Sepharose beads (GE healthcare) and incubated for 15 minutes at room temperature with stirring. The beads were then collected by centrifugation at 3000×g for 3 minutes, washed three times with 30 mM imidazole/PBS solution (pH 7.0). Finally, the proteins bound to the beads were eluted with 250 mM imidazole/PBS solution (pH 7.0). The samples were analyzed by SDS-PAGE followed by immunoblotting with anti-myc antibody.

SDS-PAGE, CBB staining and immunoblotting The protein extracts were boiled with 2.5-5×SDS-PAGE loading

buffer for 5 minutes. The samples were then separated on the 10-12.5% polyacrylamide gel with Tris-glycine SDS buffer (25 mM Tris, 192 mM glycine, 0.1% SDS). For CBB staining, the gels were then stained with CoomassieR Brilliant Blue R-250 (CBB R-250 Wako Japan) for several minutes, removed excess CBB with decolorization buffer (25% methanol, 10% Acetic acid in water) until separated proteins were detected.

For immunoblotting, separated proteins by SDS-PAGE were transferred to PVDF membrane. The membranes was reacted with indicated antibodies as described previously [24]. For reaction with primary antibodies, anti-zNMT antibodies (No.1 and No.2) were diluted 1:1000 in blocking solution, respectively and used. Peroxidase conjugated anti-rabbit IgG (GE healthcare) was used as secondary antibody. Bound antibodies were detected with DAB substrate or ECL plus detection reagents (GE healthcare) and chemiluminescence was captured by Light Capture II cooled CCD camera system (ATTO Tokyo, Japan).

RT-PCR AnalysisZebrafish embryos (20 embryos) in each developmental stage

were homogenized in Qiazol (Qiagen, Valencia CA) and total RNAs were prepared according to the manufacturer’s instructions. Aliquots of total RNA (2 µg) were reverse-transcribed with using oligo dT primer in a volume of 20 µl. After heat inactivation of reverse transcriptase, aliquots of 1 µl were used for PCR. PCR amplification of zebrafish N-myristoyltransferase 1 (NM_001020480: nmt1a), zebrafish N-myristoyltransferase 2 (NM_001020480: nmt2) and zebrafish β-actin 2 (NM_181601.3 : zbac2 ) were done with following primer sets: 5’-ACTCTCGACCTAGGAAAC-3’ and 5’-GTTAATCTCCACCATCTTC-3’ for zNMT1, and 5’-GCCAAGCTCAGGAGGAACC-3’ and

DNA fragments sense primer (5' → 3') antisense primer (5' → 3')zNMT1 full (for pET50b) ATGCGTCGACGCGGATGAGAATGAGAC ATAGCGGCCGCCTGCAGAACCAATCCzNMT1 full CGAGAATTCCACCATGGCGGATGAG ATAGCGGCCGCCTGCAGAACCAATCCzNMT1 deltaC1 CGAGAATTCCACCATGGCGGATGAG ACGTAGCGGCCGCTCAGAAGGAATATGCCGCCzNMT1 deltaC2 CGAGAATTCCACCATGGCGGATGAG ACGTAGCGGCCGCTCAAGTGTACACAGCCTGAAAGzNMT1 deltaN1 GCTATGAATTCGAGGAGGCCACACGTC ATAGCGGCCGCCTGCAGAACCAATCCzNMT1 deltaN2 GCTATGAATTCGTGGAGATTAACTTTCTGTG ATAGCGGCCGCCTGCAGAACCAATCCzNMT2 full ATGCGAATTCGCGGAGGACAGCGAGTC ACGTAGCGGCCGCTTACTGTAAAACAAGGCCAACzNMT2 deltaC1 ATGCGAATTCGCGGAGGACAGCGAGTC ACGTAGCGGCCGCTCAAGTGTCAATGATGTTCzNMT2 deltaC2 ATGCGAATTCGCGGAGGACAGCGAGTC ACGTAGCGGCCGCTCAACCAGCAGTATACACzNMT2 deltaN1 GCTATGAATTCGAGCTCCTGTCCAC ACGTAGCGGCCGCTTACTGTAAAACAAGGCCAACzNMT2 deltaN2 GCTATGAATTCGTGGAGATTAACTTCTTG ACGTAGCGGCCGCTTACTGTAAAACAAGGCCAAC

Table 1: Primer set for construction of recombinant zNMTs.


Page 4 of 10


5’-GAATATGGCTATTGTCTG-3’ for zNMT2, and 5’-AGTTCAGCCATGGAT-3’ and 5’-ACCATGACACCCTGA-3’ for β-actin-2, respectively. Amplification was done by 30 cycles of denaturation at 95°C for 30 sec, annealing at 50°C for 30 sec, and extension at 72°C for 40 sec. Aliquots of the PCR products were separated on a 1.5% agarose gel and stained with ethidium bromide. Specific amplification of cDNAs was confirmed by DNA sequencing.

Challenging with 2-hydoroxymyristic acidApproximately 10 fertilized eggs were distributed in 24 well plate.

20 μM 2-hydoroxymyristic acid (MP biomidicals, LLC) or myristic acid (Sigma-Aldrich) was added to each well at several time points. The embryos were incubated at 27ºC until 24 hpf and living and dead embryos were counted under microscope.

Morpholino Experiments Antisense morpholino oligo against zNMT1 was purchased

from Gene Tools LIC (Philomath, OR). The MO sequences of zNMT1 and control were 5’-tgctgtctcattctcatccgccatg-3’ and 5’-gtaccgcctactcttactctgtcgt-3’, respectively. MOs at a concentration of 50 ng/μl were injected into embryos at the one- to two-cell stage.

RNA BlottingThe NMT1 specific sense and anti-sense digoxigenin labeled RNA

probes were prepared by in vitro transcription kid (DIG RNA labeling kid, Roche Diagnostics, Basel, Switzerland). The pT7blue vectors encoding 410-975 or 1212-1477 nucleotides region of zNMT1 cDNA and 177-443 or 912-1200 nucleotides region of zNMT2 cDNA were used as template for in vitro transcription. Total RNA was prepared from zebrafish embryos at 6 hpf and aliquots of 30 μg were dissolved in 50% formamide, denatured at 75°C for 10 minutes. After immediate cooling on ice, RNA was separated by electrophoresis on 1% agarose gel containing 2% formaldehyde in MOPS buffer [20 mM MOPS, 5 mM sodium acetate 660 mM formaldehyde (pH 7.0)] . The separated RNA was transferred to nylon membrane (Hybound-N GE healthcare) by capillary blotting with 10×SSC buffer (Sigma) for 19 hrs. The membrane with RNA was then backed at 80°C for 2hrs, then pre-hybridization was performed in hybridization buffer [750 mM NaCl, 20 mM Tris-HCl (pH 7.5), 2.5 mM EDTA, 50% formamide, 5×Denhardt solution (Wako Osaka, Japan) ] at 70°C for 2 hrs. The membrane was then hybridized with zNMT1 and zNMT2 specific sense or anti-sense RNA probe in hybridization buffer at 70°C for 19 hrs. The membrane was washed 3 times with 1×SSC buffer for 10 minutes, blocked with 2×SSC buffer containing 2% BSA and 0.05% Triton-X 100. Alkaline phosphatase conjugated anti- digoxigenin antibody (Roche Diagnostics) was diluted 1:10000 in blocking solution and added to the membrane, incubated at room temperature for 1 hour. After wash 3 times with 2×SSC containing 0.05% Triton-X 100, the membrane was incubated with BM-purple AP substrate (Roche Diagnostics) at 37°C until zNMT1 and zNMT2 RNA was detected.

ResultsIn silico analysis shows existence of zebrafish N-myristoyltransferases (zNMTs) with high homology to mammalian’s NMTs

Knock out of mouse N-myristoyltransferase 1 (NMT1) gene resulted in embryonic lethal [22], suggesting importance of NMT1 for development of mammalian. However, due to the embryogenesis of mammalian occurs in uterus, detail observation and analysis of NMTs in embryos is difficult. Thus, we have concentrated on a model animal,

zebrafish, which can easily observe and analyze their embryonic development.

When we study an organism as a model of mammalian, most important thing, however, is whether the organism has a similar gene to mammalian. To identify the zebrafish N-myristoyltransferase (zNMT) which has homology to mammalian’s one, we first searched NMTs on several databases, and found three N-myristoyltransferases (NP_001018316, NP_001156321 and NP_001186683). NP_001018316 (N-myristoyltransferase 1a) and NP_001186683 (N-myristoyltransferase 2) proteins were predicted to be orthologues of human NMT1 and NMT2, respectively. On the other hand, NP_001156321 (N-myristoyltransferase 1b) does not exist in mammalian, its orthologues proteins only exist in fish and invertebrates. We next curried out an alignment studies of the amino acid sequences of NP_001018316 (zNMT1), NP_001186683 (zNMT2) and other NMTs orthologues (human, mouse, fruit fly and yeast) which were found in protein data base. The result showed that zNMT1 and zNMT2 had high homology to human and mouse NMT1 or NMT2, respectively and also has moderate and low homology to fruit fly and yeast NMT (Figure 1). Phylogenic tree drown by identity of amino acid sequences showed that zNMT1 and zNMT2 were closely related protein to mammalian’s NMT1 and NMT2, respectively (Figure 2). Those data indicate that zebrafish can be a good tool for analyzing NMTs substitute for mammalian.

Gene expression of zNMTs in the embryos at early developmental stage

To investigate the expression of zNMT1 and zNMT2 gene on zebrafish development, we performed RT-PCR analysis and RNA blotting. In RT-PCR analysis, the expression of zNMT1 and zNMT2 was observed even in the embryos at 4 hours post-fertilization (4 hpf), both expression continued to at least 72 hpf (Figure 3A). More detail analysis of zNMTs’ expression by RT-PCR showed that expression of zNMT1 and zNMT2 was observed even after 2 hpf and the expression was kept during early development. In initial stages (1-3 hpf) nmt2 expression seems to be more evident than that of nmt1a (Supplemental Figure 1). RNA blotting with RNA from 6 hpf embryos showed that zNMT1 and zNMT2 RNA was detected as single band, suggested that both zNMT1 and zNMT2 RNA did not have splicing variants. The signal of zNMT2 RNA was weaker than that of zNMT1 RNA (Figure 3B). These data suggest that expression of zNMTs starts initial developmental stage. Therefore, zNMTs, like mammalian’s one, are suggested to play an important role in early stage of embryogenesis.

Inhibition of zNMT1 causes development arrest and decreases viability of embryos in early developmental stages

To examine a function of zNMTs during embryogenesis, we first analyzed the effects of NMT inhibitor, 2-hydroxymyristic acid (2-OHMyr) on development. The 2-OHMyr or myristic acid (Myr) was challenged to the embryos in several early developmental stages and the number of dead embryos per total embryos was analyzed at 24 hpf. The macroscopic observation of embryos treated with those fatty acids at 6 hpf revealed that most of the embryos were killed by 2-OHMyr treatment (Figure 4). The viability of 2-OHMyr challenged embryos was significantly decreased compared with that of Myr challenged one (Table 2). Especially, the challenge before 10 hpf increased the number of death, significantly (Table 2). We next performed inhibition of nmt1a mRNA translation with morpholino antisense oligo (MO) against zNMT1. As shown in Figure 5, The development of the embryos injected nmt1a (MO) was arrested at dome or early epiboly


Page 5 of 10


Figure 1: Comparison of the amino acid sequences of NMT orthologues. Amino acid sequences of zebrafish NMT1 and NMT2 (NP_001018316, NP_001186683) human NMT1 and NMT2 (NP_066565, NP_004799), mouse NMT1 and NMT2 (NP_032733, NP_032734), fruit fly NMT (NP_523969) and yeast NMT (NP_013296) were aligned by using CLUSTAL W online program. Conserved amino acids were highlighted gray and light gray.


Page 6 of 10


stage compared with no-injection or control MO injection. These data suggests that zNMT1a is essential for development of zebrafish; other NMTs (zNMT2 or zNMT1b) could not rescue the function of zNMT1a.

Recombinant zNMT1 exhibited myristoyltransferase activity

For the purpose of confirming enzymatic activity of nmt1a gene product (zNMT1), we next carried out production of recombinant zNMT1 in E. coli. As shown in Supplemental Figure 2, NUS-zNMT1 fusion protein (about 120 kDa) was induced in E. coli with IPTG. The NUS-NMT1 partially existed in soluble fraction when induced at 25ºC for 6 hrs. Up to 50% of recombinant zNMT1 were produced as soluble protein when induced at 20ºC O/N (data not shown).

We next attempted to detect the NMT1 activity in unpurified bacterial lysate (Figure 6A). Peptide substrate (GARASVLSK-biotin), E.coli lysate and myristoyl-CoA were mixed and reacted at 30ºC for 1 hour. Reacted peptide was then analyzed by MS spectrum. Mass spectrum of substrate peptide reacted with bacterial lysate containing NUS tag showed one major peak (m/z 1114.6617) derived from substrate peptide (Figure 6A). On the other hand, MS of reacted peptide with the lysate containing NUS-zNMT1 fusion protein contained another extra peak (m/z 1324.8723) corresponding to the MS of myristoyl-GARASVLSK-biotin peptide. Amino acid sequences of these peaks were further analyzed by MS/MS analysis and confirmed they were derived from substrate peptide (data not shown).

Purification of soluble zNMT1 was then attempted. However, degradation of recombinant protein was observed during purification process, small amount of zNMT1 was finally obtained (Figure 6B). With this purified protein, we attempted to detect substrate binding activity of recombinant zNMT1. As shown in Figure 6C , the recombinant protein was binding its substrate peptide without depending on the existence of myristoyl-CoA. In contrast, pre-myristoylated substrate peptide did not bind to the recombinant protein in the presence of myristoyl-CoA. These data suggest that NUS-zNMT1 has enzymatic activity characteristic of NMT, thus nmt1a gene encodes functional protein.

Low molecular weight zNMTs is produced specifically in early developmental stages

We next developed the antibody against zNMT1, the zNMT1 protein in zebrafish embryo was then determined by immunoblotting (Figure 7). To confirm the reactivity of the anti-zNMT1 serum, GST-zNMT1 (full length 1-487 aa, deltaC1 1-413 aa, deltaC2 1-273 aa, deltaN1 101-487 aa, deltaN2 234-487 aa) and GST-zNMT2 (full length 1-491 aa, , deltaC1 1-381 aa, deltaC2 1-281 aa, deltaN1 94-491 aa, deltaN2 240-491 aa) were expressed in E. coli and whole cell lysates from the bacterial cell were used for immunoblotting with the antiserum. As shown in supplemental

Figure 2: Phylogenic tree of NMT orthologues. Phylogenic tree was drown by Jalview ver. 2.6.1 soft (http://www.jalview.org/) wear, according to the amino acid identity of zebrafish NMT1 and NMT2 (NP_001018316, NP_001186683), human NMT1 and NMT2 (NP_066565, NP_004799), mouse NMT1 and NMT2 (NP_032733, NP_032734), fruit fly NMT (NP_523969) and yeast NMT (NP_013296). The position of zebrafish NMT1 and NMT2 were underlined. Protein clusters of vertebrate NMT1 and NMT2 were shown by red and green squares. Average distance of each protein was calculated and expressed.

NMT 1_human

NMT 1_zebrafish

NMT 2_zebrafish

NMT_Yeast

NMT 1_mouse

NMT 2_human

NMT 2_mouse

NMT_fruit_fly

1.82

1.82

1.13

1.13

7.19

6.07

5.50

3.68

4.98

3.29

20.26

7.05

2.73

17.53

NMT 1

NMT 2

Figure 3: Gene expression analysis of endogenous zNMT during embryogenesis. (A) Total RNA was prepared from embryos at 6 hpf and aliquots of 30 μg were separated on agarose gel containing formaldehyde. The RNA were then transferred to nylon membrane by capillary blotting, hybridized with DIG-labeled RNA probes which hybridize specifically to zNMT1 and zNMT2 mRNA. The hybridized probes were detected with AP conjugated anti-DIG antibody and BM purple AP substrate. (B) Total RNA was prepared from the embryos at indicated stages and cDNAs were reverse-transcribed. 30 cycles of PCR for zNMT1, zNMT2 and actin 2 were performed, amplification of those cDNA were analyzed by agarose gel electrophoresis followed by EtBr staining.

Myr 2-OHMyr

Addition time 2 4 6 8 10 12 14 16 hpfExperiment 2-OHMyr 5(5) 6(6) 7(6) 6(5) 7(5) n/a n/a n/a1 Myr 6(3) 5(1) 6(1) 7(1) 8(2) n/a n/a n/aExperiment 2-OHMyr 9(7) 10(9) 10(5) 10(2) 10(1) n/a n/a n/a2 Myr 10(1) 10(0) 9(1) 11(2) 11(1) n/a n/a n/aExperiment 2-OHMyr 9(7) 10(7) 11(2) 10(6) 10(4) n/a n/a n/a3 Myr 10(0) 10(1) 10(1) 10(0) 9(0) n/a n/a n/aExperiment 2-OHMyr 10(4) 10(8) 10(9) 10(7) 10(2) 11(4) 9(2) 10(3)4 Myr 10(2) 10(1) 10(5) 10(3) 10(1) 12(4) 10(4) 10(2)2-OHMyr: 2-hydorixmyristic acid Myr: myristic acid(): the number of death in total

Table 2: The number of total and dead embryos when challenged with 2-hydroxmyristic acid.


Page 7 of 10


Figure 3, anti-zNMT1 serum recognized specifically with recombinant full length zNMT1 protein, deltaC1 and deltaC2 zNMT1 mutants, indicates that the epitopes recognized by anti-zNMT1 serum exist near amino-terminal. Then, we prepared embryonic proteins extracted from 2 to 72 hpf embryos and reacted with anti-zNMT1 serum by immunoblotting. The result revealed that the approximately 29 and 65 kDa zNMT was detected specifically during early embryonic stages and approximately 50-67 kDa zNMTs were detected in 48 and 72 hpf (Figure 7A and Supplemental Figure 4). These results suggest that zNMT1 has several isoforms with different molecular weight, and that low molecular weight (29 kDa) zNMT1 isoform appeared specifically in early embryos.

Considering from the reactivity of zNMT1 antiserum, we expected that the 29 kDa zNMT1 detected in early developmental stages included an amino-terminal part of zNMT1 peptide which is probably produced from full length zNMT1 gene. Therefore, we next expressed tagged zNMT1 in early developmental stage (Figure 7B). Full length zNMT1 fused to myc-His tag at its C-terminal was expressed in the embryos at 6 hpf, the protein extracted from the embryos was purified with Ni-Sepharose beads. Immunoblotting of purified zNMT1-myc-His with anti-myc antibody revealed that its molecular weight became smaller (35 kDa) than expected from the full length zNMT1s amino acid sequence (58 kDa). Intact NMT in protein extract from 6 hpf embryos was then detected by substrate binding assay and found that main bands were detected in low molecular weight (30 kDa and 33 kDa). The NMTs in early embryo could be detected by using other potential NMT substrate peptides originated from EF-1α, MARCKS, MARCKSL, Src (Supplemental Figure 5). These findings suggest that low molecular weight zNMTs with enzymatic activity are produced specifically in early developmental stage from nmt1a gene.

DiscussionAlthough N-myristoyltransferases (NMTs) are expected to have

important roles in development of mammalian [22], its characteristics during deveFlopment have not been revealed. In previous studies, the

NMT of Saccharomyces cerevisiae was used as model for NMT and well examined biochemically, probably because the enzyme in yeast can be prepared and purified easily [6,18,20]. Those studies addressed the protein structure and biochemical characteristics of yeast NMT, provided a good understanding of a NMT enzyme [25-27]. However, the yeast NMT does not have high homology to mammalian’s one (Figure 1 and 2). Some studies described different activity of rat NMT from yeast NMT to same substrate peptide [18,28]. These facts implied distinct characteristics of mammalian’s NMTs from yeast NMT, thus it is important to study with enzyme which has close relation to mammalian’s one.

To elucidate the physiological functions of mammalian’s NMTs, the NMT1 deficient mouse was established previously and their phenotype was analyzed. The report implied that NMT1 but not NMT2 is essential for embryonic development of mouse [22]. The detail roles of NMT1 in development, however, are largely unknown because of lethality of NMT1 KO mice [22] and inaccessibility of mammalian’s embryos.

In our study, we concentrated on zebrafish as a useful model for developmental studies to elucidate the functions of NMT1 during embryogenesis. The usefulness of this model is availability of a large number of embryos at one time, external fertilization, rapid development and easier observation of their embryonic processes. In

Figure 5: Inhibition of nmt1a mRNA translation by morpholino antisense oligo. Morpholino antisense oligo against nmt1a mRNA or control morpholino was injected into the embryos at single cell stage, the development of the embryos in 6, 10, 12, 18 hpf were observed under microscope. Scale bar: 200 μm.

A NUS-zNMT 1 fusion protein

NUS tag

NUS-zNMT1 (full)

NUS-zNMT1 (partial)NUSzNMT1

100

9080

70

60

50

40

30

20

10

0

100

9080

70

60

50

40

30

20

10

01000 1100 1200 1300 15001400

1000 1100 1200 1300 1500

1.4E+4

7148.2

1400

Mass [m/z]

Mass [m/z]

% in

tens

ity%

inte

nsity

KDa

198

198 KDa11685

54

5437

29

11685

Myr-peptide

Myr-CoA

peptide

CB

A

Cell l

ysate

Affin

ity pu

rified

NUS t

ag cl

eave

d

NUS t

ag re

move

d

--

----

---

+ ++ +

+

1114

.661

7

1021

.662

7

GARASVLSK(Biotin)

Myr-GARASVLSK(Biotin)

Mono isolopic mass (MH+): 1114.604275

GARASVLSK(Biotin)Mono isolopic mass (MH+): 1114.604275

Mono isolopic mass (MH+): 1324.802645

1297

.707

0

1319

.884

8

1480

.752

2

1152

.617

3

1480

.754

3

13.2

4.87

23

Figure 4: Effect of zNMT inhibitor, 2-hydroxymyristic acid, on embryogenesis. 2-hydroxymyristic acid (2-OHMyr) or myristic acid (Myr) was added to the embryo cultures at 6 hpf. The embryos were then incubated until 24 hpf. Live and dead embryos were then investigated. Scale bar: 200 μm.

6 hpf 10 hpf 12 hpf

6 hpf 12 hpf 18 hpf

No injection

MO injection

MO injection(control)


Page 8 of 10


addition to these advantages, the information about zebrafish genome is recently available on the web site such as ZFIN or Ensembl. For the first step to investigate NMTs in zebrafish, we searched database and found three transcript of zebrafish NMTs (zNMTs) (nmt1a, NM_001020480, nmt1b, NM_001162849 and nmt2, NM_001199754). As we expected, nmt1a and nmt2 product (NP_001018316 and NP_001186683) had significant high homology to human or mouse NMT1 and NMT2, respectively (Figure 1 and Figure 2), and nmt1a product had N-myristoyltransferase activity (Figure 6). The nmt1a and nmt2 were expressed in embryos at early developmental stages (at least in 2 hpf embryos) and the expression lasted during embryogenesis (Figure 3 and Supplemental Figure 1). These data suggest that zNMTs play pivotal roles in embryonic development of zebrafish like mammalians’ one. Consequently, zebrafish can be a good substitute for mammalian studies for NMT’s roles during development. A NMT inhibitor, 2-hydroxymyristic acid (2-OHMyr) impaired the embryonic development (Figure 4 and Table 2). Inhibition of NMTs revealed that embryos in early developmental stage were affected critically; most of the embryos challenged by it at early stage become lethal (Table 2). Those results imply that zNMTs are important for basic functions, such as proliferation of cells in early developmental stage. It has not been completely cleared which gene, nmt1a or nmt2, has more contribution to the development. However, morpholino antisense oligo against mnt1a caused development arrest in dome or early epiboly stage and finally those embryos were dead (Figure 5), suggesting importance of nmt1a gene after early epiboly. From RNA blotting, expression of nmt1a in 6 hpf embryo seems to be major compared with that of nmt2 (Figure 3B). Semi-quantitative RT-PCR showed, however, that nmt2 expression could be seen even in 1 hpf embryo (Supplemental Figure 1). Therefore, mnt1a expression might be important for development after epiboly stage and mnt2 might work in initial stage.

We next attempted to analyze zNMTs protein expression during development with antibodies which recognize specifically N-terminal part of zNMT1 (supplemental Figure 3). Interestingly, the endogenous

zNMTs appears in various molecular weights by immunoblotting with anti-zNMT antibodies (Figure 7A and supplemental Figure 4). In 48 hpf, at least three zNMTs with different molecular weight (about 49 kDa, 53 kDa, 66 kDa) were detected with antiserum for zNMT1 (Figure 7A). In mammalian tissue or cell, existence of several NMT isoforms with different molecular weight (mostly>40 kDa) has been reported [19,29-32]. In database, molecular weight of zNMT1 produced from nmt1a gene are expected to be about 39 kDa and 58 kDa, and form nmt1b are 54 kDa, respectively. The nmt1b gene product, however, does not have a high homology to nmt1a product. Therefore, the antiserum against zNMT1 (immunized with nmt1a product) hardly reacts with nmt1b product. Those facts indicate that 66 kDa, 53 kDa and 49 kDa proteins might be nmt1a product. In the early developmental stages, 65 kDa and 29 kDa zNMT1 detected specifically with zNMT1 antiserum were not also consistent with the molecular weight of zNMT1 molecules recoded in database. Those NMTs are suggested to have similar amino acid sequence to amino terminal part of zNMT1, because the antiserum recognizes only N-terminal part of zNMT1 (Supplemental Figure 3). Because single band was detected by RNA blotting for nmt1a expression (Figure 3B), and because the nmt1a splicing variants registered in data base does not produce such low or high molecular weight protein, the 29 kDa and 65 kDa zNMT is not thought to be produced from the splicing variant of nmt1a. We have expressed zNMT1-myc-His protein, which had myc and His tag at the carboxyl terminal of zNMT1, and found that zNMT1-myc-His protein was detected as much smaller molecule than it was expected from the ORF (Figure 7B). These data implied that the small zNMT1 was produced from full length cDNA. One possibility for those multiple molecular weight NMTs is cleavage by specific protease or degradation of full length NMTs which can be detected as 66 kDa protein in early embryonic stages (Supplemental Figure 5). Another possibility is that multiple potential start codons exist in open reading frame (data not shown) causes translation of zNMT1 with multi-length N-terminal part. Cleavage by specific protease of mammalian NMTs has been reported and those processing would be involved in regulation of the enzymatic activity or its localization in cell. For example, bovine muscle NMT has ‘PEST’ sequence which is recognized by specific protease [33,34]. Caspases recognize NMTs and cleave them at lysine (K) box near N-terminal, result in alteration of their distribution in the cell [34,35]. It was also reported that N-terminal deletion causes increase of yeast NMT activity [36]. Multiple start codons in one open reading frame were shown in rat NMT1 [21]. These finding implied that post-translational processing might regulate NMT activity in the cell.

The next question is whether the low molecular weight zNMTs has any functions during embryogenesis of zebrafish. Detection of endogenous NMTs by using a biotinylated peptide substrate recognized by zNMT1 (Figure 6) showed that there existed 33 kDa and 30 kDa protein which could interacted with the peptide (Figure 7C and supplemental Figure 5). These results suggest that low molecular weight zNMT1 maintain its activity. Since the C-terminal part of NMTs seems to be critical for their activity [36], thus 29 kDa zNMT detected by immunoblotting with the antiserum might have low activity. On the other hand, 33 kDa zNMT, which could not be detected with the antiserum, seemed to have highest activity in protein extract from 6 hpf embryos. Expression of the zNMT1-myc-his resulted in appearance of 35 kDa zNMT1-myc-his protein (Figure 7B).

In conclusion, we have shown in this study that zebrafish NMT (zNMTs) has high homology to human or mouse NMTs and those NMTs are essential for their embryonic development like mammalians’ case. These findings clearly show that zebrafish can be a substitute

Figure 6: Enzymatic activity of nmt1a gene product. (A) The peptide substrate (GARASVLSK-biotin), myristoyl-CoA and bacterial cell lysate containing NUS-zNMT1 or NUS tag were mixed and reacted at 30 ºC for 1 hour. After collection of the reacted peptide, MS of the peptide were acquired. (B) The recombinant NUS-zNMT1 protein in E.coli lysate was purified by His tag affinity chromatography. The purified sample was reacted with HRV3C protease to removal of NUS tag. Purification of zNMT1 at each process was confirmed by SDS-PAGE followed by CBB staining. (C) The purified recombinant zNMT1 protein was reacted with substrate peptide labeled with biotin as indicated, after linkage between zNMT1 and its substrate peptide. zNMT1-substrate complex in each samples were analyzed by SDS-PAGE followed by immunoblotting with anti-biotin antibody.

zNMT1 zNMT2

S SAS AS

zNMT 1

zNMT1

zNMT2

zNMT 2

actin 2

28S

18S 28S

18S

4 6 12 24 48 72 hpf

A B


Page 9 of 10


model for mammalian when analyzing a function of NMTs during development. We have also found that N-terminal part of zNMT1 (29 kDa) appeared specifically during embryogenesis. These findings suggest that N-terminal part of zNMT1 is cleaved by post-translational processes for specific characteristics like substrate specificity. We believe our findings in this study will provide a key to analyze the characteristics of NMTs during vertebrate’s embryogenesis.

Acknowledgment

We thank Dr. Shinichi Akiyama for useful instruction and suggestion about zebrafish experiments. This work was supported by grants from the Wakayama Prefecture Collaboration of Regional Entities for the Advancement of Technological Excellence (Y.T) and SENTAN (Y.T), Japan Science and the Technology Agency and the New Energy and Industrial Technology Development Organization (02A09003d) (Y.T).

References1. Resh MD (2004) Membrane targeting of lipid modified signal transduction

proteins. Sub cell Biochem 37: 217-232.

2. Resh MD (2006) Trafficking and signaling by fatty-acylated and prenylated proteins. Nat Chem Biol 2: 584-590.

3. Marchildon GA, Casnellie JE, Walsh KA, Krebs EG (1984) Covalently bound myristate in a lymphoma tyrosine protein kinase. Proc Natl Acad Sci U S A 81: 7679-7682.

4. Semba K, Nishizawa M, Miyajima N, Yoshida MC, Sukegawa J, et al. (1986)

yes-related protooncogene, syn, belongs to the protein-tyrosine kinase family. Proc Natl Acad Sci U S A 83: 5459-5463.

5. Sukegawa J, Semba K, Yamanashi Y, Nishizawa M, Miyajima N, et al. (1987) Characterization of cDNA clones for the human c-yes gene. Mol Cell Biol 7: 41-47.

6. Towler DA, Eubanks SR, Towery DS, Adams SP, Glaser L (1987) Amino-terminal processing of proteins by N-myristoylation. Substrate specificity of N-myristoyltransferase. J Biol Chem 262: 1030-1036.

7. Glover CJ, Goddard C, Felsted RL (1988) N-myristoylation of p60src. Identification of a myristoyl-CoA:glycylpeptide N-myristoyltransferase in rat tissues. Biochem J 250: 485-491.

8. Schultz AM, Henderson LE, Oroszlan S, Garber EA, Hanafusa H (1985) Amino terminal myristylation of the protein kinase p60src, a retroviral transforming protein. Science 227: 427-429.

9. Carr SA, Biemann K, Shoji S, Parmelee DC, Titani K (1982) n-Tetradecanoyl is the NH2-terminal blocking group of the catalytic subunit of cyclic AMP-dependent protein kinase from bovine cardiac muscle. Proc Natl Acad Sci U S A 79: 6128-6131.

10. Arbuzova A, Murray D, Mc Laughlin S (1998) MARCKS, membranes, and calmodulin: kinetics of their interaction. Biochim Biophys Acta 1376: 369-379.

11. Schultz AM, Tsai SC, Kung HF, Oroszlan S, Moss J, et al. (1987) Hydroxylamine-stable covalent linkage of myristic acid in G0 alpha, a guanine nucleotide-binding protein of bovine brain. Biochem Biophys Res Commun 146: 1234-1239.

12. Johnson DR, Bhatnagar RS, Knoll LJ, Gordon JI (1994) Genetic and biochemical studies of protein N-myristoylation. Annu Rev Biochem 63: 869-914.

13. Aitken A, Cohen P, Santikarn S, Williams DH, Calder AG, et al. (1982) Identification of the NH2-terminal blocking group of calcineurin B as myristic acid. FEBS Lett 150: 314-318.

14. Gallay P, Swingler S, Aiken C, Trono D (1995) HIV-1 infection of non-dividing cells: C-terminal tyrosine phosphorylation of the viral matrix protein is a key regulator. Cell 80: 379-388.

15. Harris M (1995) The role of myristoylation in the interactions between human immunodeficiency virus type I Nef and cellular proteins. Biochem Soc Trans 23: 557-561.

16. Giang DK, Cravatt BF (1998) A second mammalian N-myristoyltransferase. J Biol Chem 273: 6595-6598.

17. Shrivastav A, Varma S, Lawman Z, Yang SH, Ritchie SA, et al. (2008) Requirement of N-myristoyltransferase 1 in the development of monocytic lineage. J Immunol 180: 1019-1028.

18. Towler DA, Adams SP, Eubanks SR, Towery DS, Jackson-Machelski E, et al. (1988) MyristoylCoA:protein N-myristoyltransferase activities from rat liver and yeast possess overlapping yet distinct peptide substrate specificities. J Biol Chem 263: 1784-1790.

19. Raju RV, Anderson JW, Datla RS, Sharma RK (1997) Molecular cloning and biochemical characterization of bovine spleen myristoylCoA:protein N-myristoyltransferase. Arch BiochemBiophys 348: 134-142.

20. Towler DA, Adams SP, Eubanks SR, Towery DS, Jackson-Machelski E, et al. (1987) Purification and characterization of yeast myristoylCoA:protein N-myristoyltransferase. ProcNatlAcadSci U S A 84: 2708-2712.

21. Rioux V, Beauchamp E, Pedrono F, Daval S, Molle D, et al. (2006) Identification and characterization of recombinant and native rat myristoyl-CoA: protein N-myristoyltransferases. Mol Cell Biochem 286: 161-170.

22. Yang SH, Shrivastav A, Kosinski C, Sharma RK, Chen MH, et al. (2005) N-myristoyltransferase 1 is essential in early mouse development. J Biol Chem 280: 18990-18995.

23. Amsterdam A, Lin S, Hopkins N (1995) The Aequoreavictoria green fluorescent protein can be used as a reporter in live zebrafish embryos. DevBiol 171: 123-129.

24. Nakatani H, Aoki N, Nakagawa Y, Jin-No S, Aoyama K, et al. (2006) Weaning-induced expression of a milk-fat globule protein, MFG-E8, in mouse mammary glands, as demonstrated by the analyses of its mRNA, protein and phosphatidylserine-binding activity. Biochem J 395: 21-30.

25. Gelb MH, Van Voorhis WC, Buckner FS, Yokoyama K, Eastman R, et al. (2003) Protein farnesyl and N-myristoyltransferases: piggy-back medicinal chemistry targets for the development of antitrypanosomatid and antimalarial therapeutics. Mol Biochem Parasitol 126: 155-163.

26. Johnson DR, Duronio RJ, Langner CA, Rudnick DA, Gordon JI (1993) Genetic and biochemical studies of a mutant Saccharomyces cerevisiaemyristoyl-CoA:protein N-myristoyltransferase, nmt72pLeu99-->Pro, that produces temperature-sensitive myristic acid auxotrophy. J Biol Chem 268: 483-494.

Figure 7: Detection of endogenous zNMTs during early development. (A) The embryos at 2-72 hpf were homogenized in 5×SDS-PAGE sample buffer and the protein in the extracts were separated by SDS-PAGE followed by immunoblotting with antiserum against zNMT1. Alternatively, the protein extracts from 6 hpf and 72 hpf were assessed by immunoblotting with antiserum against thioredoxin (Trx) as a negative control. Arrows showed specific bands detected by the antiserum. (B) The zNMT1-myc-His protein was expressed in 6 hpf embryos and total proteins were extracted. The zNMT1-myc-His was purified with Ni-Sepharose beads; the protein was assessed by immunoblotting with anti-myc antibody. (C) The protein extracts were prepared from embryos at 6 hpf. The embryonic lysate was reacted with biotinylated substrate peptide or biotinylated N-myristoylated substrate peptide in presence or absence of myristoyl-CoA (mCoA) as indicated. The substrate peptides linked to proteins were detected by SDS-PAGE followed by immunoblotting with anti-biotin antibody (asterisks).

kDa116

79

52

37

29

kDa

116

79

52

37

29

2 4 6 8 10 12 24 48 72 hpf 6 72 hpf

blot: zMMT1 blot: Trx

blot: zMMT1 blot: biotin

A

B C

- - + + - - + + - + + - - + + -- - - + - - - +

Myr-CoA

Myr-peptidepeptide

11685

55

40

30

11685

55

40

30

20

Mock

zNMT

1-myc

-his

zNMT1

http://www.ncbi.nlm.nih.gov/pubmed/15376622http://www.ncbi.nlm.nih.gov/pubmed/15376622http://www.ncbi.nlm.nih.gov/pubmed/17051234http://www.ncbi.nlm.nih.gov/pubmed/17051234http://www.ncbi.nlm.nih.gov/pubmed/6595656http://www.ncbi.nlm.nih.gov/pubmed/6595656http://www.ncbi.nlm.nih.gov/pubmed/6595656http://www.ncbi.nlm.nih.gov/pubmed/3526330http://www.ncbi.nlm.nih.gov/pubmed/3526330http://www.ncbi.nlm.nih.gov/pubmed/3526330http://www.ncbi.nlm.nih.gov/pubmed/2436037http://www.ncbi.nlm.nih.gov/pubmed/2436037http://www.ncbi.nlm.nih.gov/pubmed/2436037http://www.ncbi.nlm.nih.gov/pubmed/3100524http://www.ncbi.nlm.nih.gov/pubmed/3100524http://www.ncbi.nlm.nih.gov/pubmed/3100524http://www.ncbi.nlm.nih.gov/pubmed/3128285http://www.ncbi.nlm.nih.gov/pubmed/3128285http://www.ncbi.nlm.nih.gov/pubmed/3128285http://www.ncbi.nlm.nih.gov/pubmed/3917576http://www.ncbi.nlm.nih.gov/pubmed/3917576http://www.ncbi.nlm.nih.gov/pubmed/3917576http://www.ncbi.nlm.nih.gov/pubmed/6959104http://www.ncbi.nlm.nih.gov/pubmed/6959104http://www.ncbi.nlm.nih.gov/pubmed/6959104http://www.ncbi.nlm.nih.gov/pubmed/6959104http://www.ncbi.nlm.nih.gov/pubmed/9804991http://www.ncbi.nlm.nih.gov/pubmed/9804991http://www.ncbi.nlm.nih.gov/pubmed/3113429http://www.ncbi.nlm.nih.gov/pubmed/3113429http://www.ncbi.nlm.nih.gov/pubmed/3113429http://www.ncbi.nlm.nih.gov/pubmed/7979256http://www.ncbi.nlm.nih.gov/pubmed/7979256http://www.ncbi.nlm.nih.gov/pubmed/7160476http://www.ncbi.nlm.nih.gov/pubmed/7160476http://www.ncbi.nlm.nih.gov/pubmed/7160476http://www.ncbi.nlm.nih.gov/pubmed/7859280http://www.ncbi.nlm.nih.gov/pubmed/7859280http://www.ncbi.nlm.nih.gov/pubmed/7859280http://www.ncbi.nlm.nih.gov/pubmed/8566415http://www.ncbi.nlm.nih.gov/pubmed/8566415http://www.ncbi.nlm.nih.gov/pubmed/8566415http://www.ncbi.nlm.nih.gov/pubmed/9506952http://www.ncbi.nlm.nih.gov/pubmed/9506952http://www.ncbi.nlm.nih.gov/pubmed/18178842http://www.ncbi.nlm.nih.gov/pubmed/18178842http://www.ncbi.nlm.nih.gov/pubmed/18178842http://www.ncbi.nlm.nih.gov/pubmed/3123478http://www.ncbi.nlm.nih.gov/pubmed/3123478http://www.ncbi.nlm.nih.gov/pubmed/3123478http://www.ncbi.nlm.nih.gov/pubmed/3123478http://www.ncbi.nlm.nih.gov/pubmed/9390183http://www.ncbi.nlm.nih.gov/pubmed/9390183http://www.ncbi.nlm.nih.gov/pubmed/9390183http://www.ncbi.nlm.nih.gov/pubmed/3106975http://www.ncbi.nlm.nih.gov/pubmed/3106975http://www.ncbi.nlm.nih.gov/pubmed/3106975http://www.ncbi.nlm.nih.gov/pubmed/16538398http://www.ncbi.nlm.nih.gov/pubmed/16538398http://www.ncbi.nlm.nih.gov/pubmed/16538398http://www.ncbi.nlm.nih.gov/pubmed/15753093http://www.ncbi.nlm.nih.gov/pubmed/15753093http://www.ncbi.nlm.nih.gov/pubmed/15753093http://www.ncbi.nlm.nih.gov/pubmed/7556889http://www.ncbi.nlm.nih.gov/pubmed/7556889http://www.ncbi.nlm.nih.gov/pubmed/16401186http://www.ncbi.nlm.nih.gov/pubmed/16401186http://www.ncbi.nlm.nih.gov/pubmed/16401186http://www.ncbi.nlm.nih.gov/pubmed/16401186http://www.ncbi.nlm.nih.gov/pubmed/12615314http://www.ncbi.nlm.nih.gov/pubmed/12615314http://www.ncbi.nlm.nih.gov/pubmed/12615314http://www.ncbi.nlm.nih.gov/pubmed/12615314http://www.ncbi.nlm.nih.gov/pubmed/8416952http://www.ncbi.nlm.nih.gov/pubmed/8416952http://www.ncbi.nlm.nih.gov/pubmed/8416952http://www.ncbi.nlm.nih.gov/pubmed/8416952


Page 10 of 10


27. Rudnick DA, McWherter CA, Rocque WJ, Lennon PJ, Getman DP, et al. (1991) Kinetic and structural evidence for a sequential ordered BiBi mechanism of catalysis by Saccharomyces cerevisiaemyristoyl-CoA:proteinN-myristoyltransferase. J Biol Chem 266: 9732-9739.

28. Heuckeroth RO, Towler DA, Adams SP, Glaser L, Gordon JI (1988) 11-(Ethylthio)undecanoic acid. A myristic acid analogue of altered hydrophobicity which is functional for peptide N-myristoylation with wheat germ and yeast acyltransferase. J Biol Chem 263: 2127-2133.

29. Boutin JA, Ferry G, Ernould AP, Maes P, Remond G, et al. (1993) Myristoyl-CoA:protein N-myristoyltransferase activity in cancer cells. Purification and characterization of a cytosolic isoform from the murine leukemia cell line L1210. Eur J Biochem 214: 853-867.

30. Glover CJ, Felsted RL (1995) Identification and characterization of multiple forms of bovine brain N-myristoyltransferase. J Biol Chem 270: 23226-23233.

31. McIlhinney RA, McGlone K (1996) Immunocytochemical characterization and subcellular localization of human myristoyl-CoA: protein N-myristoyltransferase in HeLa cells. Exp Cell Res 223: 348-356.

32. McIlhinney RA, McGlone K, Willis AC (1993) Purification and partial sequencing of myristoyl-CoA:protein N-myristoyltransferase from bovine brain. Biochem J290: 405-410.

33. Raju RV, Kakkar R, Datla RS, Radhi J, Sharma RK (1998) Myristoyl-coA:protein N-myristoyltransferase from bovine cardiac muscle: molecular cloning, kineticanalysis, and in vitro proteolytic cleavage by m-calpain. Exp Cell Res 241: 23-35.

34. Selvakumar P, Sharma RK (2007) Role of calpain and caspase system in the regulation of N-myristoyltransferase in human colon cancer (Review). Int J Mol Med 19: 823-827.

35. Perinpanayagam MA, Beauchamp E, Martin DD, Sim JY, Yap MC, et al. (2013) Regulation of co- and post-translational myristoylation of proteins during apoptosis: interplay of N-myristoyltransferases and caspases. FASEB J 27:811-821.

36. Rajala RV, Datla RS, Moyana TN, Kakkar R, Carlsen SA, et al. (2000) N-myristoyltransferase. Mol Cell Biochem 204: 135-155.

http://www.ncbi.nlm.nih.gov/pubmed/2033063http://www.ncbi.nlm.nih.gov/pubmed/2033063http://www.ncbi.nlm.nih.gov/pubmed/2033063http://www.ncbi.nlm.nih.gov/pubmed/2033063http://www.ncbi.nlm.nih.gov/pubmed/3123489http://www.ncbi.nlm.nih.gov/pubmed/3123489http://www.ncbi.nlm.nih.gov/pubmed/3123489http://www.ncbi.nlm.nih.gov/pubmed/3123489http://www.ncbi.nlm.nih.gov/pubmed/8391437http://www.ncbi.nlm.nih.gov/pubmed/8391437http://www.ncbi.nlm.nih.gov/pubmed/8391437http://www.ncbi.nlm.nih.gov/pubmed/8391437http://www.ncbi.nlm.nih.gov/pubmed/7559471http://www.ncbi.nlm.nih.gov/pubmed/7559471http://www.ncbi.nlm.nih.gov/pubmed/8601412http://www.ncbi.nlm.nih.gov/pubmed/8601412http://www.ncbi.nlm.nih.gov/pubmed/8601412http://www.ncbi.nlm.nih.gov/pubmed/8452528http://www.ncbi.nlm.nih.gov/pubmed/8452528http://www.ncbi.nlm.nih.gov/pubmed/8452528http://www.ncbi.nlm.nih.gov/pubmed/9633510http://www.ncbi.nlm.nih.gov/pubmed/9633510http://www.ncbi.nlm.nih.gov/pubmed/9633510http://www.ncbi.nlm.nih.gov/pubmed/17390089http://www.ncbi.nlm.nih.gov/pubmed/17390089http://www.ncbi.nlm.nih.gov/pubmed/17390089http://www.ncbi.nlm.nih.gov/pubmed/23150525http://www.ncbi.nlm.nih.gov/pubmed/23150525http://www.ncbi.nlm.nih.gov/pubmed/23150525http://www.ncbi.nlm.nih.gov/pubmed/23150525http://www.ncbi.nlm.nih.gov/pubmed/10718634http://www.ncbi.nlm.nih.gov/pubmed/10718634

TitleCorresponding authorAbstractKeywordsAbbreviationsIntroductionMaterials and MethodsZebrafish care and collection of eggsCloning of zNMTs and plasmid construction for their expression in Escherichia coliExpression of recombinant zNMTs

Purification of recombinant zNMT1 and preparation of the polyclonal antibodies against zNMT1Detection of NMT activity by MS analysisConstruction of the expression plasmid for myc- and His- tagged zebrafish NMT1 Extraction of Proteins from Zebrafish EmbryosDetection of the Substrate Binding of NMTsExpression and Purification of zNMT1-myc-his Protein SDS-PAGE, CBB staining and immunoblotting RT-PCR AnalysisChallenging with 2-hydoroxymyristic acidMorpholino ExperimentsRNA BlottingResultsIn silico analysis shows existence of zebrafish N-myristoyltransferases (zNMTs) with high homology tGene expression of zNMTs in the embryos at early developmental stageInhibition of zNMT1 causes development arrest and decreases viability of embryos in early developmenLow molecular weight zNMTs is produced specifically in early developmental stages

DiscussionAcknowledgmentFigure 1Figure 2Figure 3Figure 4Figure 5Figure 6Figure 7Table 1Table 2References

Characterization of N-Myristoyltransferases in Vertebrate … · 2019. 2. 15. · distribution of...

Documents

Transcript of Characterization of N-Myristoyltransferases in Vertebrate … · 2019. 2. 15. · distribution of...