A

cmcaFtcdRn©

K

1

afocaasRpfcnt

0d

Virus Research 123 (2007) 128–137

Characterization of an early gene encoding fordUTPase in Rana grylio virus

Zhe Zhao, Fei Ke, Jianfang Gui, Qiya Zhang ∗State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences,

Graduate School of the Chinese Academy of Sciences, Wuhan 430072, China

Received 17 May 2006; received in revised form 18 August 2006; accepted 18 August 2006Available online 20 September 2006

bstract

dUTPase (DUT) is a ubiquitous and important enzyme responsible for regulating levels of dUTP. Here, an iridovirus DUT was identified andharacterized from Rana grylio virus (RGV) which is a pathogen agent in pig frog. The DUT encodes a protein of 164aa with a predicted molecularass of 17.4 kDa, and its transcriptional initiation site was determined by 5′RACE to start from the nucleotide A at 15 nt upstream of the initiation

odon ATG. Sequence comparisons and multiple alignments suggested that RGV DUT was quite similar to other identified DUTs that functions homotrimers. Phylogenetic analysis implied that DUT horizontal transfers might have occurred between the vertebrate hosts and iridoviruses.urthermore, its temporal expression pattern during RGV infection course was characterized by RT-PCR and Western blot analysis. It begins

o transcribe and translate as early as 4 h postinfection (p.i.), and remains detectable at 48 h p.i. DUT-EGFP fusion protein was observed in the

ytoplasm of pEGFP-N3-Dut transfected EPC cells. Immunofluorescence also confirmed DUT cytoplasm localization in RGV-infected cells. Usingrug inhibition analysis by a de novo protein synthesis inhibitor (cycloheximide) and a viral DNA replication inhibitor (cytosine arabinofuranoside),GV DUT was classified as an early (E) viral gene during the in vitro infection. Moreover, RGV DUT overexpression was shown that there waso effect on RGV replication by viral replication kinetics assay.

2006 Published by Elsevier B.V.

gene;

nc2

isudtvplD

eywords: Rana grylio virus (RGV); Iridovirus; DUTPase (DUT); Early viral

. Introduction

Rana grylio virus (RGV) has been recognized as a pathogenicgent, because it led to high mortality of 90% in the cultured pigrog (Rana grylio) (Zhang et al., 1996). Based on the previ-us studies on morphogenesis, cellular interaction, antigenicityomparison, restriction fragment length polymorphism (RFLP)nd major capsid protein (MCP) sequence analysis (Zhang etl., 1999, 2001, 2006), RGV has been identified as an iridovirusimilar to Frog virus 3 (FV3), the type species of the genusanavirus in the family Iridoviridae. Up to the present, 11 com-lete genomic sequences of iridoviruses have been determinedrom various species (Williams et al., 2005), and a number of

ellular protein homologues that may be mostly involved inucleotides metabolism, such as ribonucleotide reductase (RR),hymidine kinase (TK), thymidylate synthase (TS), and purine

∗ Corresponding author. Tel.: +86 27 68 780 792; fax: +86 27 68 780 123.E-mail address: zhangqy@ihb.ac.cn (Q. Zhang).

iaePsth

168-1702/$ – see front matter © 2006 Published by Elsevier B.V.oi:10.1016/j.virusres.2006.08.007

Protein synthesis inhibitor; DNA replication inhibitor

ucleoside phosphorylase (PNP), have been revealed from theomplete genomic sequences of iridoviruses (Tidona and Darai,000; Williams et al., 2005; Iyer et al., 2006).

dUTPase (deoxyuridine triphosphatase, DUT; EC3.6.1.23)s also a key nucleotide metabolism enzyme. It provides theubstrate for the de novo synthesis of dTTP and preventsracil incorporation into DNA by efficiently decreasing theUTP/dTTP ratio (Dauter et al., 1999). DUT was widely dis-ributed in eukaryotes, eubacteria, archaea and a number ofiruses. The presence of viral DUT suggests that DUT shouldlay a critical role in virus replication by controlling local dUTPevels. It has been confirmed that deletion or mutation of viralUT leads to substitutions in the virus genome and reductions

n viral productive infection, neurovirulence, neuroinvasivenessnd reactivation from latency (Lichenstein et al., 1995; Oliverost al., 1999; Pyles et al., 1992; Pyles and Thompson, 1994;

ayne and Elder, 2001; Turelli et al., 1996, 1997). Owing to theignificant role in virus infection and pathogenicity, many atten-ions have been paid to the DUT in mammalian viruses, such aserpesviruses, poxviruses, adenoviruses, asfarviruses and retro-

searc

vWseYavdiiau

2

2

wstp

2d

TvwcClaewetuw1Rc

Tapip2P9fwDwa

2a

dfeeELwtbNp

2

PDsce(

TP

P

DDDDDDDAA

Z. Zhao et al. / Virus Re

iruses (Broyles, 1993; Elder et al., 1992; Oliveros et al., 1999;ohlrab and Francke, 1980; Weiss et al., 1997). However, few

tudies have been done on the gene of aquatic animal virusesxcept for shrimp white spot syndrome virus (WSSV) (Liu andang, 2005). The open reading frames (ORF) encoding DUTre present in the genomes of Frog virus 3 (FV3), Tiger frogirus (TFV), Ambystoma tigrinum virus (ATV), Grouper iri-ovirus (GIV), Singapore grouper iridovirus (SGIV) and Chiloridescent virus (CIV) (Williams et al., 2005), but its functionn iridoviruses remains to be elucidated. In this study, we arettempting to clone and characterize the RGV DUT, and tonderstand its role in iridoviruses.

. Materials and methods

.1. Virus isolates and cells

Three RGV isolates (RGV9506, RGV9807 and RGV9808)ere maintained in our lab and RGV9506 was used in this

tudy. Epithelioma papulosum cyprini (EPC) cells were usedo propagate the virus. Cell cultures and virus propagation wereerformed as described previously (Zhang et al., 1999, 2006).

.2. Gene cloning and transcriptional initiation siteetermination

Based on genome sequences of the Frog virus 3 (FV3),iger frog virus (TFV) and salamander Ambystoma tigrinumirus (ATV), an open reading frame that encodes DUT proteinas revealed by computer-assisted analysis. According to the

onserved DUT sequence, a pair of primers (5′-ATCGTTTTA-TTTGATGCCGT-3′, 5′-TCATACTATATTGGCAGTACC-3′)

ocating in the 5′ and 3′ flanking regions of DUT was designednd used to amplify RGV DUT from the genomic DNA. Toxplore the transcriptional initiation site of RGV DUT, 5′RACEas performed by 5′ full RACE core set (Takara). Total RNA was

xtracted from RGV-infected cells with a multiplicity of infec-ion (MOI) of approximately 0.1 at 24 h postinfection (h p.i.)sing Trizol Reagent (Invitrogen). After the first strand cDNA

as synthesized by 5′RACE primer (Table 1) by incubation forh with 5.5 �g of total RNA at 50 ◦C, RNA was degraded byNase H for 1 h at 37 ◦C. The released cDNA was ligated to cir-ular DNA by incubation with T4 RNA ligase for 18 h at 16 ◦C.

rDci

able 1rimer sequences used for in this study (enzyme cleavage site was underlined)

rimers Primers sequence (5′–3′)

ut-P1 GAATTCAGAAACATGCACGGAAAC (EcoR I)ut-P2 AAGCTTCTCAGACAAAACTCTCCT (Hind III)ut-P3 GGATCCGACAAAACTCTCCTTAAG (BamH I)ut-P4 AAGCTTACCATGCACGGAAAC (Hind III)ut-P5 GAATTCTCAGACAAAACTCTCC (EcoRI)ut-P6 TGGTCCCCTCCTTTGGCAGut-P7 ACCCCTGTCGGTAGAGTCCActin-F CACTGTGCCCATCTACGAGctin-R CCATCTCCTGCTCGAAGTC

h 123 (2007) 128–137 129

he junction fragment was amplified with Dut-S1/A1 primersnd then a nest-PCR was followed with two specific internalrimers Dut-S2/A2 (Table 1). The PCR reaction was performedn a volume of 25 �l, containing 1 �l cDNA, 0.2 �M of eachrimer, 0.5U of Taq polymerase (MBI), 0.5 �l of 10 mM dNTP,.5 �l of 10× Taq buffer and 2.5 �l of 25 mM MgCl2 (MBI).CR was carried out under the following conditions: 4 min at4 ◦C for 1 cycle; 30 s at 94 ◦C, 30 s at 50 ◦C and 30 s at 72 ◦C,or 27 cycles; 8 min at 72 ◦C for 1 cycle. The nest-PCR productsere cloned into pMD-18T vector (Takara) and transformed intoH5� competent cells, and three positive clones was sequencedith M13 forward primer. The sequence data were compiled and

nalyzed by DNAstar Software.

.3. Amino acid sequence comparisons and phylogeneticnalysis

The peptide sequences homologous to the RGV DUT wereug by computer-assisted analysis from the National Centeror Biotechnology Information (NCBI) blast server (Altschult al., 1997). FV3 DUT and other three DUT members fromquine infectious anaemia virus (EIAV) (Dauter et al., 1999),scherichia coli (ECOL) (Cedergren-Zeppezauer et al., 1992;arsson et al., 1996) and human (HSAP) (Mol et al., 1996)hose crystal structures have been known were selected for mul-

iple alignments. Phylogenetic analysis was performed on theasis of 36 DUT sequences (Table 2) by SEQBOOT, PROTDIST,EIGHBOR and CONSENSE programs from the PHYLIPackage (Felsenstein, 1995).

.4. Construction of different constructs

The ORF of RGV DUT was, respectively, amplified byCR from RGV genomic DNA using the designed primersut-P1/P2, Dut-P1/P3 and Dut-P4/P5 with restriction enzymes

ites (Table 1). The amplified fragments were, respectively,loned into prokaryotic vector pET28a-c (+) (Novagen), andukaryotic vectors pEGFP-N3 (Clontech) and pcDNA3.1 (+)Invitrogen) that were previously cleaved by corresponding

estriction enzymes. These different constructs, named pET28a-UT, pEGFP-N3-DUT, pcDNA3.1-DUT, were respectively

onfirmed by restriction enzyme digestion and DNA sequenc-ng.

Primers Primers sequence (5′–3′)

MCP-F GACTTGGCCACTTATGACMCP-R GTCTCTGGAGAAGAAGAAICP18-F AAGCCTACCTGTGCGACTCICP18-R CCGTCAGTCTCCAGGTTTTDut-RACE pGGCTGTCCACCTCCADut-S1 GGCAACCTCGGCGTCATACDut-A1 GGAGCCACCCTGCCGTAGADut-S2 AAGAGGGGCGACAGGATAGCDut-A2 CAAAGGAGGGGACCACGAC

130 Z. Zhao et al. / Virus Research 123 (2007) 128–137

Table 2Abbreviations and accession no. of 36 DUT from different species

Abbreviation Species Accession no. Organism

FV3 Frog virus 3 AAT09723 IridovirusTFV Tiger frog virus AAL77806 IridovirusATV Ambystoma tigrinum virus AAP33220 IridovirusGIV Grouper iridovirus AAV91051 IridovirusSGIV Singapore grouper iridovirus AAS18064 IridovirusCIV Chilo iridescent virus AAK82298 IridovirusHSAP Homo sapiens AAB71394 Eukaryote (animal)MMUS Mus musculus AAH53693 Eukaryote (animal)RAT Rattus norvegicus P70583 Eukaryote (animal)TNIG Tetraodon nigroviridis CAF99850 Eukaryote (animal)DRER Danio rerio AAH83489 Eukaryote (animal)ATHA Arabidopsis thaliana NP 190278 Eukaryote (plant)OSAT Oryza sativa XP 469212 Eukaryote (plant)LYCES Lycopersicon esculentum P32518 Eukaryote (plant)CANAL Candida albicans CAA54897 Eukaryote (unicellular)SCER Saccharomyces cerevisiae P33317 Eukaryote (unicellular)ORFV orf virus strain D1701 AAD03407 PoxvirusVARV Variola virus P33826 PoxvirusVACCV Vaccinia virus YP 232923 PoxvirusSHPOV sheeppox virus NP 659591 PoxvirusSWPOX Swinepox virus NP 570173 PoxvirusFADVD Fowl adenovirus D NP 050279 AdenovirusFADV1 Fowl adenovirus 1 AAR29345 AdenovirusPADV5 Porcine adenovirus 5 AAK00135 AdenovirusASFV African swine fever virus NP 042823 AsfvirusPBCV Paramecium bursaria Chlorella virus 1 O41033 PhycodnavirusSENPV Spodoptera exigua nucleopolyhedrovirus NP 037815 BaculovirusMCNPV Mamestra configurata nucleopolyhedrovirus AAQ11093 BaculovirusECOL Escherichia coli P06968 EubacteriaHINF Haemophilus influenzae P43792 EubacteriaPAER Pseudomonas aeruginosa PAO1 NP 254008 EubacteriaCOXBU Coxiella burnetii Q45920 EubacteriaBMS

2p

(ptfi(buda

2

veRDpt

tPoTTw6Tsa

pdefp

2D

PT5 Enterobacteria phage T5JAN Methanocaldococcus jannaschii

IRV Archaeal virus

.5. Prokaryotic expression, purification and antibodyreparation

pET28a-DUT plasmid was transformed into E. coli BL21DE3), and the E. coli BL21 (DE3) containing pET28a-DUTlasmid was induced by IPTG (0.5 mM) at 28 ◦C for expressinghe recombinant protein. The recombinant protein was puri-ed according to the protocol of the HisBind Purification KitNovagen). To obtain antibody of RGV DUT, the purified recom-inant DUT protein (about 400 �g) was mixed with equal vol-me of Freund’s adjuvant (Sigma) to immunize rabbit by hypo-ermal injection once in 10 days, and the antiserum was collectedt the 7th day after the fourth immunization.

.6. RT-PCR and Western blot analysis

To examine DUT transcriptional courses in infected cells initro, total RNA was isolated from the infected cells at differ-nt times (0, 4, 8, 12, 16, 24, 36, and 48 h p.i.) using Trizol

eagent (Invitrogen). After RNA was digested with RNase-freeNase, the first strand cDNA was synthesized using randomrimers and MMLV reverse transcriptase (Promega) by incuba-ion for 1 h with 2 �g of RNA at 37 ◦C. RT-PCR was performed

ir

O48500 BacteriophageQ58502 ArchaealAAC15873 Archaeal virus

o analyze transcriptional courses of DUT with specific primers6/P7 (Table 1). The PCR reaction was performed in a volumef 25 �l, containing 1 �l cDNA, 0.2 �M of each primer, 0.5U ofaq polymerase (MBI), 0.5 �l of 10 mM dNTP, 2.5 �l of 10×aq buffer and 2.5 �l of 25 mM MgCl2 (MBI). PCR conditionsere as follows: 4 min at 94 ◦C and then 30 s at 94 ◦C, 30 s at0 ◦C, 40 s at 72 ◦C for 29 cycles, followed by 72 ◦C for 8 min.he amplification of �-actin gene with actin-1/actin-2 (Table 1)erved as an internal control and PCR procedure was the sames DUT except for anneal temperature at 56 ◦C.

Simultaneously, Western blot was also performed on therotein extracts from the samples collected at the same timesescribed above. Equivalent amounts of the cell extracts werelectrophoresed in 12% SDS-PAGE and subsequently trans-erred to PVDF membrane (Millipore). The followings wereerformed as described previously (Zhang et al., 2006).

.7. Drug inhibition of de novo protein synthesis and viralNA replication

Cycloheximide (CHX), as de novo protein synthesisnhibitor, and cytosine arabinofuranoside (AraC), as viral DNAeplication inhibitor, were selected as inhibition drugs. Firstly,

searc

taecspwco5w1wppt(twR

2

EEastsFcap1ifngbitfic3

2

cG(paril

aitu

3

3

mgCliiportHootrssmDFG

3a

DiDweats1

fDgotws

Z. Zhao et al. / Virus Re

he suitable concentrations of CHX and AraC were estimatedccording to the previous report (Lua et al., 2005). Preliminaryxperiments showed that 800 �g/ml of AraC had no signifi-ant effect on viability of EPC cells after treatment of 48 h,o 100 �g/ml of AraC was used here to treat the cell sam-les. Moreover, 50 �g/ml of CHX for 6 h short time treatmentas revealed to have no significant effect on viability of EPC

ells. Briefly, EPC monolayer cells were pretreated by CHXr AraC for 1 h prior to and throughout the RGV infection. A0 �g/ml CHX-pretreated cells were mock-infected or infectedith approximately 0.1 MOI RGV and then harvested at 6 h p.i.00 �g/ml AraC-pretreated cell were mock-infected or infectedith approximately 0.1 MOI RGV and then harvested at 48 h.i. RNA isolation and DUT transcription RT-PCR analysis wereerformed following above mentioned approaches. As control,wo known temporal kinetic genes including immediate-earlyIE) transcription gene ICP18 (Willis et al., 1984) and late (L)ranscription gene MCP (major capsid protein) (Mao et al., 1996)ere also selected to perform transcription program analysis byT-PCR.

.8. Subcellular localization

Subcellular localization of RGV DUT was performed byGFP fusion protein expression and immunofluorescence. ForGFP fusion protein expression, EPC cells were cultured oncoverslip in the 6-well plates and transfected with con-

truct pEGFP-N3-DUT by GeneJuiceTM (Novagen) followinghe instructions. After 48 h incubation, the cells were fixed andtained with DAPI as described previously (Du et al., 2004).or immunofluorescence localization, EPC cells, grown on aoverslip in 6-well plates, were either mock or infected withpproximately 1 MOI RGV for 16 h and then fixed as describedreviously (Du et al., 2004). After the cells were blocked in0% normal goat serum at room temperature for 1 h, they werencubated with anti-RGV DUT serum in 1% normal goat serumor 2 h, rinsed three times for 10 min with PBS containing 1%ormal goat serum, and then incubated with FITC-conjugatedoat anti-rabbit antibodies (Pierce). Nuclei were visualizedy staining with 4 �g/ml DAPI. All samples were exam-ned under a Leica DM IRB fluorescence microscope. GFP-ransfected and FITC-stained cells were visualized with a bluelter block (excitation range 450–480 nm), while DAPI-stainedells were visualized with a UV filter block (excitation range40–380 nm).

.9. Viral replication kinetics assay

To obtain cells with stable over-expression RGV DUT, EPCells were transfected with the pcDNA3.1-DUT plasmid byeneJuiceTM, and then were selected with 400 �g/ml G418

Amersco). The stable transfected cell line was designated EPC:cDNA3.1-DUT and confirmed by RT-PCR and Western blot

nalysis. To detect the effect of DUT in RGV-infected cells, viraleplication kinetics were evaluated based on RGV proliferationn EPC: pcDNA3.1-DUT and EPC: pcDNA3.1. The cell mono-ayers were grown in 24-well plates for 24 h and infected with

Rlth

h 123 (2007) 128–137 131

pproximately 1.4 MOI RGV. Cell lysates were collected at thendicated times (0, 2, 4, 6, 8, 10, 12, 16, 24, 36, and 48 h p.i.), andhen the titers of the lysates were determined by plaque-formingnit assay.

. Results

.1. Cloning of RGV DUT

To obtain complete DUT sequence, a 613 bp DNA frag-ent was firstly amplified, cloned and sequenced from RGV

enomic DNA by the designed primers (5′-ATCGTTTTA-TTTGATGCCGT-3′, 5′-TCATACTATATTGGCAGTACC-3′)

ocating in the 5′ and 3′ flanking regions of DUT. As shownn Fig. 1, the sequenced fragment includes a 67 bp 5′ flank-ng region, a 495 bp DUT open reading flame (ORF) encoding aolypeptide of 164 amino acids with a predicted molecular massf 17.4 kDa, and a 51 bp 3′ flanking region. Further 5′RACEevealed that the RGV DUT transcription was initiated fromhe nucleotide A at 15 nt upstream of the initiation codon ATG.owever, the canonical TATA box was not found in upstreamf the transcription initiation site. As having been noted previ-usly by Goorha and Granoff (1974) at the ends of FV3 mRNAs,wo 10 bp palindromic repeat sequences (AGAATAGTCT) wereevealed to locate at 4 and 19 nt downstream of the translationtop codon, and each repeat sequence can fold into a moderatelytable hairpin that may serve as a signal for transcriptional ter-ination. Moreover, no poly[A] tail was observed in the clonedUT sequence, which is consistent with previous report thatV3 message RNAs lack detectable poly[A] tails (Willis andranoff, 1976).

.2. Molecular characterization and phylogenetic treenalysis of RGV DUT

Homologous search in NCBI databases revealed numerousUTs with high scores from different species. To character-

ze the DUT molecules, RGV DUT, FV3 DUT and other threeUT members whose crystal structures have been analyzedere selected for multiple alignments. As shown in Fig. 2, there

xisted five conserved motifs (McGeoch, 1990) in the DUTs,nd there were 17 invariant residues within the defined motifs inhe total of 21 invariant residues. Moreover, the invariant tyro-ine in motif III is the substrate-binding residue (Larsson et al.,996; Mol et al., 1996).

Table 2 lists the abbreviations and accession no. of 36 DUTsrom different species. To better understand the position of RGVUT in the evolutionary history, a neighbor-joining (NJ) phylo-enetic tree was constructed with overall amino acid sequencesf 36 known DUTs including RGV DUT. As shown in Fig. 3,he DUTs of RGV and other members in the genus Ranavirusere clustered within a monophyletic clade with a 100% boot-

trap. Interestingly, the DUT of SGIV, a tentative species of

anavirus, was grouped with GIV which is a species of Mega-

ocytivirus with a 100% bootstrap (Chinchar et al., 2005), andhey were further clustered with many vertebrate DUTs withigh bootstrap (93%).

132 Z. Zhao et al. / Virus Research 123 (2007) 128–137

F UT isT ic ref depos

3

wte

esFig. 4, the 293 bp RGV DUT-specific fragment was detected at

Fpsi

ig. 1. Nucleotide sequence and the deduced amino acid sequence of RGV Dhe transcriptional initiation site is bolded and underlined. Two 10 bp palindrom

ragment are indicated by gray background. The RGV GUT sequence has been

.3. Expression pattern of RGV DUT in the infection course

Furthermore, the temporal expression pattern of RGV DUT

as characterized by detecting its transcript and protein levels in

he host cells during the infection course by RT-PCR and West-rn blot analysis. For the purpose, the total RNAs and proteins

4cc

ig. 2. Multiple amino acid sequence alignment of RGV DUT and selected membeosition relative to the N terminus of each DUT. Five conserved motifs are named asequences are indicated over a black background and 21 invariant residues are also mmportant Tyr residues that is substrate-binding residue. Abbreviations are listed in T

olated from RGV genome DNA. The start codon and stop codon are bolded.peat sequences are bolded and italicized. The primers for amplifying the DNAited into GenBank under accession number DQ116942.

xtracted from the host cells at different infection times wereubjected to RT-PCR and Western blot detections. As shown in

h postinfection by the specific primers P6/P7 (Table 1), and itsontent increased to high level at 16 h p.i. At protein level, a spe-ific protein band was also observed from 4 h p.i. and increased

rs of the DUT family. Numbers between parentheses indicate the amino acidmotifs I to V at the top of the alignment. The highly conserved residues in allarked by a pound symbol under the alignment. Empty triangle shows the very

able 2.

Z. Zhao et al. / Virus Research 123 (2007) 128–137 133

Fig. 3. Phylogenetic tree of the DUTs based on 36 DUT amino acid sequences frcorresponding branches determined by bootstrapping (100 replicates) and only bootstrAbbreviations and accession numbers are listed in Table 2.

FEct

ig. 4. RT-PCR and Western blot detections of DUT expression in the infectedPC cells during RGV infection course. �-Actin was amplified under the sameonditions as a positive control. Hours postinfection (h p.i.) are indicated abovehe lanes. DNA and protein markers are in lane M on the left.

ttm

3

ktswaiatPtit

om different species. The numbers indicate the statistical confidence of theaps greater than 50% were shown at the nodes of the branches for convenience.

o high level at 16 h p.i. The data indicate that RGV DUT beginso transcribe and translate as early as 4 h p.i., and suggest that it

ight be an early viral gene.

.4. Identification of RGV DUT as an early viral gene

To verify RGV DUT as an early (E) transcription gene, twonown temporal kinetic genes including immediate-early (IE)ranscription gene ICP18 (Willis et al., 1984) and late (L) tran-cription gene MCP (major capsid protein) (Mao et al., 1996)ere simultaneously selected for drug inhibition and RT-PCR

nalysis. Using the de novo protein synthesis inhibitor cyclohex-mide (CHX) and the viral DNA replication inhibitor cytosinerabinofuranoside (AraC), DUT, ICP18 and MCP were, respec-ively, confirmed to be E, IE and L transcription genes by RT-

CR. As shown in Fig. 5, the DUT transcript was detected in

he sample treated with 100 �g/ml AraC for 48 h, and its contents less than that in the untreated sample, but not in the samplereated with 50 �g/ml of CHX for 6 h, indicating that DUT tran-

134 Z. Zhao et al. / Virus Researc

Fig. 5. RT-PCR detection of DUT transcripts under drug treatments. Lane 1,CHX-treated uninfected at 6 h p.i.; lane 2, CHX-treated RGV-infected at 6 hpla

snIravpdtv

3

DiwoflfstttrDcdcisma

3

icesancriApTftpcbepfEcaidE

4

tu51cAtft3sgaadC

ib

.i.; lane 3, RGV-infected at 6 h p.i.; lane 4, AraC-treated uninfected at 48 h p.i.;ane 5, AraC-treated RGV-infected at 48 h p.i.; lane 6, RGV-infected at 48 h p.i.;nd lane M, DL2000 ladder.

cription was dependent on de novo protein synthesis, and wasot blocked by viral DNA replication inhibitor. As expected,CP18 gene was expressed in all RGV-infected cell samplesegardless of the absence or presence of CHX and AraC, becausen IE gene was not dependent on de novo protein synthesis oriral DNA replication. MCP transcription was inhibited in theresence of CHX or AraC, because L gene transcription requirese novo protein synthesis and viral DNA replication. Therefore,he data confirmed that DUT is an E viral gene during the initro infection.

.5. Subcellular localization of RGV DUT

Subcellular localization of RGV DUT was determined byUT-EGFP fusion protein expression and anti-DUT antibody

mmunofluorescence. Firstly, the pEGFP-N3-DUT constructas transfected into EPC cells, and green fluorescence wasbserved mainly in cytoplasm of the transfected cells under auorescence microscope (Fig. 6A), indicating that DUT-EGFPusion protein was localized in the cytoplasm. While the con-truct contained only EGFP was transfected into EPC cells,he EGFP protein was distributed in both the cytoplasm andhe nucleus, and mainly in the nucleus (Fig. 6C). Secondly,he anti-DUT antibody immnunofluorescence gave the sameesult. When RGV-infected cells were immunostained by anti-UT antibody, the FITC green fluorescence was scattered in the

ytoplasm (Fig. 6E), whereas no any fluorescence signal wasetected in the mock-infected cells (Fig. 6G). Moreover, some

ompartments were not immunostained by anti-DUT antibodyn the cytoplasm of RGV infection cells (Fig. 6E), but they weretained by DAPI (Fig. 6F). The compartments might be viro-atrix in which a large number of RGVs were replicated and

ssembled (Huang et al., 2006).

aaaaw

h 123 (2007) 128–137

.6. No effect of DUT overexpression on RGV replication

To determine whether DUT overexpression enhances ornhibits RGV replication, two kinds of stably transfected EPCells with pcDNA3.1-DUT and alone pcDNA3.1 were firstlystablished. Both RT-PCR (Fig. 7A) and Western blot analy-is (Fig. 7B) confirmed DUT overexpression at its transcriptnd protein levels in the EPC: pcDNA3.1-DUT cells, whereaso DUT products was observed in the control EPC: pcDNA3.1ells. Then, the two kinds of stably transfected EPC cells were,espectively, infected by RGV, and their RGV replication kinet-cs curves were measured and compared in the infection courses.s shown in Fig. 7C, the replication kinetics of RGV in EPC:cDNA3.1-DUT is quite similar to that in EPC: pcDNA3.1.he RGV titers in two stably transfected EPC cells decrease

rom inoculation to 2 h p.i., and then increase slowly from 4o 8 h p.i. The titers increase at a rapid rate from 8 to 24 h.i., and then tend to stable after 24 h p.i. Moreover, the DUTontents during the RGV infection course were determinedy Western blot. As shown in Fig. 7D, the DUT protein isxpressed from the initiation of RGV infection in the stably EPC:cDNA3.1-DUT cells, whereas the RGV DUT is expressedrom 4 h p.i. and to high level at 16 h p.i. both in the controlPC: pcDNA3.1 cells and the stably EPC: pcDNA3.1-DUTells, and the DUT content expressed by pcDNA3.1-DUT isbout half of that expressed by the infected RGV. The datandicated that the DUT protein expressed ahead of scheduleid not appear to have effect on RGV replication in subculturePC cells.

. Discussion

Structural features of iridovirus early genes have been illus-rated from FV3 studies (Chinchar, 2002). Generally, short,nstructured, and AU-rich sequences were widely observed in′ non-coding regions of the early viral genes (Beckman et al.,988; Mao et al., 1996; Willis et al., 1984). RGV DUT 5′ non-oding region contains only 15 bp in length, consists of 60%U content, and no TATA box was not found in upstream of the

ranscription initiation site, which are highly consistent with theeatures. For the DUT 3′ non-coding region, we also attemptedo clone the transcriptional stop site by 3′RACE with oligo dT-sites adaptor primer, but no positive result was obtained througheveral attempts. The possible reason may be that the early viralene DUT lacks detectable polyA tail in the 3′ non-coding regionnd tends to end in the regions of palindromic repeats, whichre consistent with previous reports in early viral genes of iri-oviruses (Goorha and Granoff, 1974; Willis and Granoff, 1976;hinchar, 2002).

The evolutionary origin of viral DUT has been well stud-ed, and the evidence for horizontal transfers has been revealedetween hosts and DNA viruses (Prangishvili et al., 1998; Baldond McClure, 1999; Liu and Yang, 2005). Here, phylogenetic

nalysis not only revealed a monophyletic clade of RGV DUTnd other three iridovirus DUTs in the genus Ranavirus, butlso observed that SGIV DUT was grouped with GIV, and theyere further clustered with many vertebrate DUTs (Fig. 3). The

Z. Zhao et al. / Virus Research 123 (2007) 128–137 135

F GFPo of DUm etecte

db

rtfie2ittpabvtaw

sbdturidFDdire

ig. 6. Subcellular localization of RGV DUT: (A and B) expression of DUT-Ef EGFP protein in pEGFP-N3 transfected EPC cells; (E and F) expressionock-infected EPC cells as control and no immunofluorescence signals were d

ata implicated that horizontal transfers might have occurredetween the vertebrate hosts and iridoviruses.

Iridoviruses have been revealed to display a complex geneegulation strategy in which genes are expressed at three mainemporal kinetics stages, and the expressed genes were classi-ed into three classes: IE genes, E genes, and L genes (D’Costat al., 2001; Chinchar, 2002; Williams et al., 2005; Lua et al.,005). IE genes are expressed immediately in the nucleus afternfection. They are catalyzed by host RNA polymerase II and sohe transcripts cannot be inhibited in the presence of protein syn-hesis inhibitors. E genes are expressed later by activation of IEroducts and include enzymes involved in viral DNA replicationnd nucleic acid metabolism. Hence, E gene transcription cane blocked by protein synthesis inhibitors, while not blocked by

iral DNA polymerase inhibitors. L genes are expressed afterhe onset of viral DNA replication (Lua et al., 2005; Williams etl., 2005). In this study, CHX (50 �g/ml) and AraC (100 �g/ml)as used to identify the kinetic class of RGV DUT. The results

nbm

fusion protein in pEGFP-N3-Dut transfected EPC cells; (C and D) expressionT in RGV-infected EPC cells by immunofluorescence detection; (G and H)

d. In panels E and F, the arrows indicate viromatrix.

howed that the DUT transcript was not blocked by AraC, butlocked by CHX. It confirmed that RGV DUT was an early geneuring the in vitro infection. And that temporal analysis showedhat RGV DUT transcript was detected at 4 h p.i. and contin-ously expressed with virus propagation until 48 h p.i. Theseesults suggested that RGV DUT might play a surveillance rolen fidelity of the RGV DNA synthesis by maintaining a highTTP/dUTP ratio to prevent uracil incorporation into viral DNA.urthermore, DUT-EGFP fusion protein expression and anti-UT antibody immunofluorescence confirmed the cytoplasmistribution of RGV DUT in the transfected cells and RGV-nfected cells. Previously, Vilpo and Autio-Harmainen (1983)eported that dUTPase was nearly exclusively a cytoplasmicnzyme.

As described above, iridoviruses encode a number ofucleotides metabolism enzymes, such as RR, TK, TS, and PNPesides DUT. Iridoviruses, therefore, might exhibit a nucleotideetabolism pathway which is independence from the host sys-

136 Z. Zhao et al. / Virus Researc

Fig. 7. Viral replication kinetics curves in stably transfected cells: (A and B)confirmation of EPC: pcDNA3.1-DUT by RT-PCR and Western blot; (C) RGVreplication kinetics in EPC: pcDNA3.1-DUT and EPC: pcDNA3.1 cells. Virust(E

tnstpeiEark

A

BSo

R

A

B

B

B

C

C

C

D

D

D

E

F

G

H

I

L

L

L

L

M

M

M

O

8934–8943.

iters at different times were determined by PFU (plaque-forming unit) assay;D) comparison of the amount of DUT protein in EPC: pcDNA3.1-DUT andPC: pcDNA3.1 cells during corresponding infection course.

em for deoxyribonucleotide synthesis to fulfill its specificeeds. The RGV DUT might play a more important role inecuring the efficient and precise replication of the genome inhe infection. However, the replication kinetics of RGV in EPC:cDNA3.1-DUT and EPC: pcDNA3.1 showed that RGV DUTxpressed ahead of schedule had no effect on virus replicationn subculture EPC cells. The possible reason is that DUT is an

gene and is expressed from 4 h p.i. so that the expression timend amount have sufficiently met the requirement for the RGVeplication. Further studies on the gene are needed to utilize genenockdown or knockout techniques to understand its function.

cknowledgements

This work was supported by grants from the National Majorasic Research Program (2004CB117403), the National Naturalcience Foundation of China, and the Innovation group projectf Hubei Province (2004ABC005).

eferences

ltschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W.,Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation ofprotein database search programs. Nucleic Acids Res. 25, 3389–3402.

P

P

h 123 (2007) 128–137

aldo, A.M., McClure, M.A., 1999. Evolution and horizontal transfer ofdUTPase-encoding genes in viruses and their hosts. J. Virol. 73, 7710–7721.

eckman, W., Tham, T., Aubertin, A.M., Willis, D.B., 1988. Structure and regu-lation of the immediate-early frogvirus 3 gene that encodes ICR489. J. Virol.62, 1271–1277.

royles, S.S., 1993. Vaccinia virus encodes a functional dUTPase. Virology 195,863–865.

edergren-Zeppezauer, E.S., Larsson, G., Nyman, P.O., Dauter, Z., Wilson, K.S.,1992. Crystal structure of a dUTPase. Nature 355, 740–743.

hinchar, V.G., 2002. Ranaviruses (family Iridoviridae): emerging cold-bloodedkillers. Arch. Virol. 147, 447–470.

hinchar, V.G., Essbauer, S., He, J.G., Hyatt, A., Miyazaki, T., Seligy, D.,Williams, T., 2005. In: Fauqet, C.M., Mayo, M.A., Maniloff, J., Dessel-berger, U., Ball, L.A., (Eds.), Iridovirade. Virus Taxonomy, VIIIth Reportof the International Committee on Taxonomy of Viruses. Academic Press,London, pp.163–175.

auter, Z., Persson, R., Rosengren, A.M., Nyman, P.O., Wilson, K.S.,Cedergren-Zeppezauer, E.S., 1999. Crystal structure of dUTPase fromequine infectious anaemia virus: active site metal binding in a substrateanalogue complex. J. Mol. Biol. 285, 655–673.

’Costa, S.M., Yao, H., Bilimoria, S.L., 2001. Transcription and temporal cas-cade in Chilo iridescent virus infected cells. Arch. Virol. 146, 2165–2178.

u, C.S., Zhang, Q.Y., Li, C.L., Miao, D.L., Gui, J.F., 2004. Induction of apopto-sis in a carp leucocyte cell line infected with turbot (Scophthalmus maximusL.) rhabdovirus. Virus Res. 101, 119–126.

lder, J.H., Lerner, D.L., Hasselkus-Light, C.S., Fontenot, D.J., Hunter, E.,Luciw, P.A., Montelaro, R.C., Phillips, T.R., 1992. Distinct subsets of retro-viruses encode dUTPase. J. Virol. 66, 1791–1794.

elsenstein, J., 1995. PHYLIP (Phylogeny Inference Package) Version 3.572c.Computer program distributed by the University of Washington, Seattle.

oorha, R., Granoff, A., 1974. Macromolecular synthesis in cells infected withfrog virus 3 II. Evidence for post-transcriptional control of a viral structuralprotein. Virology 60, 251–259.

uang, X.H., Huang, Y.H., Yuan, X.P., Zhang, Q.Y., 2006. Electron microscopicexamination of the viromatrix of Rana grylio virus in a fish cell line. J. Virol.Methods 133, 117–123.

yer, L.M., Balaji, S., Koonin, E.V., Aravind, L., 2006. Evolutionary genomicsof nucleo-cytoplasmic large DNA viruses. Virus Res. 117, 156–184.

arsson, G., Svensson, L.A., Nyman, P.O., 1996. Crystal structure of theEscherichia coli dUTPase in complex with a substrate analogue (dUTP).Nat. Struct. Biol. 3, 532–538.

ichenstein, D.L., Rushlow, K.E., Cook, R.F., Raabe, M.L., Swardon, C.J.,Kociba, G.J., Issel, C.J., Montelaro, R.C., 1995. Replication in vitro andin vivo of a equine infectious anemia virus mutant deficient in dUTPaseactivity. J. Virol. 69, 2881–2888.

iu, X.Q., Yang, F., 2005. Identification and function of a shrimp white spotsyndrome virus (WSSV) gene that encodes a dUTPase. Virus Res. 110,21–30.

ua, D.T., Yasuike, M., Hirono, I., Aoki, T., 2005. Transcription program ofred sea bream iridovirus as revealed by DNA microarrays. J. Virol. 79,15151–15164.

ao, J., Tham, T.N., Gentry, G.A., Aubertin, A.M., Chinchar, V.G., 1996.Cloning, sequence analysis, and expression of the major capsid protein ofthe iridovirus frogvirus 3. Virology 216, 431–436.

cGeoch, D.J., 1990. Protein sequences, comparisons show that the ‘pseu-doproteases’ encoded by poxviruses and certain retroviruses belong to thedeoxyuridine triphosphatase family. Nucleic Acids Res. 18, 4105–4110.

ol, C.D., Harris, J.M., McIntosh, E.M., Tainer, J.A., 1996. Human dUTPpyrophosphatase: uracil recognition by a beta hairpin and active sites formedby three separate subunits. Structure 4, 1077–1092.

liveros, M., Garcia-Escudero, R., Alejo, A., Vinuela, E., Salas, M.L., Salas,J., 1999. African swine fever virus dUTPase is a highly specific enzymerequired for efficient replication in swine macrophages. J. Virol. 73,

ayne, S.L., Elder, J.H., 2001. The role of retroviral dUTPases in replicationand virulence. Curr. Protein Pept. Sci. 2, 381–388.

rangishvili, D., Klenk, H.P., Jakobs, G., Schmiechen, A., Hanselmann, C.,Holz, I., Zillig, W., 1998. Biochemical and phylogenetic characteriza-

searc

P

P

T

T

T

V

W

W

W

W

W

Z

Z

Z

lethal syndrome. Dis. Aquat. Org. 48, 27–36.

Z. Zhao et al. / Virus Re

tion of the dUTPase from the archaeal virus SIRV. J. Biol. Chem. 273,6024–6029.

yles, R.B., Sawtell, N.M., Thompson, R.L., 1992. Herpes simplex virus type 1dUTPase mutants are attenuated for neurovirulence, neuroinvasiveness, andreactivation from latency. J. Virol. 66, 6706–6713.

yles, R.B., Thompson, R.L., 1994. Mutations in accessory DNA replicatingfunctions alter the relative mutation frequency of herpes simplex virus type1 strains in cultured murine cells. J. Virol. 68, 4514–4524.

idona, C.A., Darai, G., 2000. Iridovirus homologues of cellular genes—implications for the molecular evolution of large DNA viruses. Virus Genes21, 71–78.

urelli, P., Petursson, G., Guiguen, F., et al., 1996. Replication properties ofdUTPase-deficient mutants of caprine and ovine lentiviruses. J. Virol. 70,1213–1217.

urelli, P., Guiguen, F., Mornex, J.F., Vigne, R., Querat, G., 1997. dUTPase-minus caprine arthritis-encephalitis virus is attenuated for pathogenesis andaccumulates G-to-A substitutions. J. Virol. 71, 4522–4530.

ilpo, J.A., Autio-Harmainen, H., 1983. Uracil-DNA glycosylase and deoxyuri-dine triphosphatase: studies of activity and subcellular location in human

normal and malignant lymphocytes. Scand. J. Clin. Lab. Invest. 43, 583–590.

eiss, R.S., Lee, S.S., Prasad, B.V., Javier, R.T., 1997. Human adenovirus earlyregion 4 open reading frame 1 genes encode growth-transforming proteinsthat may be distantly related to dUTP pyrophosphatase enzymes. J. Virol.71, 1857–1870.

Z

h 123 (2007) 128–137 137

illiams, T., Barbosa-Solomieu, V., Chinchar, V.G., 2005. A decade of advancesin iridovirus research. Adv. Virus Res. 65, 173–248.

illis, D.B., Granoff, A., 1976. Macromolecular synthesis in cells infected byfrogvirus 3.V. The absence of polyadenylic acid in the majority of virus-specific RNA species. Virology 73, 543–547.

illis, D.B., Foglesong, D., Granoff, A., 1984. Nucleotide sequence of animmediate-early FV3 gene. J. Virol. 53, 905–912.

ohlrab, F., Francke, B., 1980. Deoxyribopyrimidine triphosphatase activityspecific for cells infected with herpes simplex virus type 1. Proc. Natl. Acad.Sci. U.S.A. 77, 1872–1876.

hang, Q.Y., Li, Z.Q., Jiang, Y.L., Liang, S.C., Gui, J.F., 1996. Preliminarystudies on virus isolation and cell infection from disease frogs Rana grylio.Acta Hydrobiol. Sin. 20, 390–392.

hang, Q.Y., Li, Z.Q., Gui, J.F., 1999. Studies on morphogenesis and cellularinteractions of Rana grylio virus in an infected fish cell line. Aquaculture175, 185–197.

hang, Q.Y., Xiao, F., Li, Z.Q., Gui, J.F., Mao, J.H, Chinchar, V.G., 2001. Char-acterization of an iridovirus from the cultured pig frog Rana grylio with

hang, Q.Y., Zhao, Z., Xiao, F., Li, Z.Q., Gui, J.F., 2006. Molecular characteri-zation of three Rana grylio virus (RGV) isolates and Paralichthys olivaceuslymphocystis disease virus (LCDV-C) in iridoviruses. Aquaculture 251,1–10.