CHAPTER-II CHEMICAL SYNTHESIS OF …shodhganga.inflibnet.ac.in/bitstream/10603/21621/7/07...Table. 2...
Transcript of CHAPTER-II CHEMICAL SYNTHESIS OF …shodhganga.inflibnet.ac.in/bitstream/10603/21621/7/07...Table. 2...
CHAPTER-II
CHEMICAL SYNTHESIS OF OLIGONUCLEOTIDES
INTRODUCTION
In the present work, chemical methods have been employed for
the synthesis of oligonucleotides required for structural studies
of mnt operator DNA elements and mnt operator-repressor
interactions. This chapter consists of a brief introduction to
the general principles involved in the chemical synthesis of
oligonucleotides, followed by specific methodology used for the
synthesis, purification and characterization of oligonucleotides
d ( CACGTG) , d ( CACCGTG) , d ( CACGGTG) and 3 7 base pair DNAs,
corresponding to mnt operator region of bacteriophage P22.
2.1. PRINCIPLES IN CHEMICAL SYNTHESIS OF OLIGONUCLEOTIDES:
The DNA consists of a backbone made of alternating phosphate
and sugar moieties (2 1 -deoxyribose), with two· types of
heterocyclic bases, namely the purines (adenine and guanine) and
pyrimidines (cytidine and thymine) attached to the sugars as
• 0 glycosidic side chains. The chemical synthes1s of DNA (Michelson
and Todd 1955, Bannwarth 1986, Engels and Uhlmann 1989) involves
the formation of an internucleotide phosphodiester bond between
3 1 -phosphate of a nucleotide and 5 1 -hydroxyl group of preceding
one, followed by chain extension using similar reactions. The
reverse combination of 5 1 -phosphate 3 1 -hydroxyl condensation is
possible in principle, but the former method is preferred since
it involves 5 1 -hydroxyl (primary functional group) which is more
reactive than the secondary 3 1 -hydroxyl group. Prior to c"onden-
28
sation reactions, various reactive groups such as exocyclic
amino groups of bases, sugar hydroxyls and acid groups of
phosphates are required to be protected to direct the condensa
tions in a regiospecific manner. At the end of the chain assembly
these protecting groups are removed and the desired DNA sequence
is purified by chromatographic procedures.
2.1.1. Protecting _groups in oligonucleotide synthesis:
Two kinds of groups are used for masking oligonucleotide
functional groups (Khorana 1978, Gait 1984) during synthesis;
(1) permanent protecting groups for protection of exocyclic amine
and phosphate groups, which remain attached through out the
synthesis and ( 2) temporary protecting group for protection of
5 1 -hydroxyl which is removed during each step of nucleotide
addition. These protecting groups along with methods for their
removal are depicted in table 1 (Sonveaux 1986).
2.1.2. Internucleotide bond formation:
A simplified representation of the various chemistries
involved in internucleotide bond formation is depicted in scheme
1. Phosphodiester (I), phosphotriester (II) and H-phosphonate
(III) chemistries utilise nucleotide monomers (~, ~ and 2) which
have a pentavalent phosphorous atom whereas the phosphite
triester (IV) and the related phosphoramidite (V) methods contain
phosphorous in the trivalent state (11 and 15). Although phos-
29
Table 1. Protecting groups and deprotecting conditions used in oligonucleotide synthesis
Functional group
5'hydroxyl of sugar
5'hydroxyl of sugar
Exocyclic amino (A,C)
Exocyclic amino (G)
Phosphate (phoshphotriester)
Phosphate (phosphoramidite)
Phosphite (phsophite procedure)
Protecting group
DMTR
Pyxyl
Benzoyl
Isobutryl
P/0-Cl-phenyl
_$-cyanoethyl
Methyl
Deprotecting condition
3% dichloroacetic acid or phenyl dihydrogen phosphate 2 min RT
-do-
Ammonia, 16 hrs 65°C
Ammonia, 16 hrs 65°C
Oximate, 4 hrs RT
Triethylamine or ammonia, 1 hr RT
Thiophenol, 0.5 hrs RT
phodiester chemistry (I) was extensively used by Khorana in the
synthesis of phenylalanine t-RNA gene (Brown et. al. 1 1979) 1 it
has several drawbacks for routine use. As a result it has now
been replaced by the phosphotriester chemistry and more recently
by the phosphoramidi te and H-phosphonate chemistry. The main
chemical principles of various methods are described below.
1) Phosphotriester method (II) (Letsinger and Mahadevan 1965 1 Van
Boom et.al. 1 1971)
a) In this chemistry the acid group of phosphate monomer ~ is
protected as ester by R''·
b) Condensation of .1. with an incoming nucleotide ~ gives a
triester dinucleotide .§.. This product is neutral and has
favourable solubility properties in organic solvents
enabling its easy purification.
c) But phosphorus in .§. is pentavalent and therefore requires
activation through a condensing agent for further chain
extension.
d) Arenesulphonyl triazoles and tetrazoles (Katagiri et. al. 1
197 4) were previously used as condensing agents but more
effective reagents are TPSCl and MSNT (Reese et.al. 1 1978 1
Jones et.al. 1 1980) in the presence of a catalyst N-methyl
30
imidazole or pyridine N-oxide (Effimov et.al., 1982 and
1986).
e) The method is applicable in both solution phase and solid
phase (Chaudhari et.al., 1984 and Gait 1984).
2) Phosphite triester method (IV) (Letsinger et.al., 1975)
a) This chemistry an has advantage of high reactivity of phos
phorus in trivalent state. Consequently these reactions are
fast and have to be done at low temperatures. Phosphite tri
esters are prepared in situ and used directly.
b) The product of condensation 13 retains the phosphorous which
is oxidised to pentavalent state 14 immediately after each
condensation.
c) R'' is normally a methyl group and this method is applicable
only for solid phase synthesis.
3) Phosphoramidite method (V}
a) This is an improvement over phosphite triester chemistry as
the monomer amidites have combined advantages of stability
and reactivity (Beaucage and Caruthers 1981, McBridge and
Caruthers 1983).
b) In the amidite monomer 15, R'' group is p-cyanoethyl group.
NN' diisopropylamino group on phosphorous confers stability
31
and is converted to a good leaving group in the presence of
a mild acid such as tetrazole.
c) The resulting product is oxidised in a similar way to that
of phosphite triester.
d) This is the method of choice in automated machines that are
in use.
4) H-Phosphonate method (III)
a) H-phosphonate chemistry, an old idea (Todd et.al., 1957} has
been developed recently (Froehler et.al., 1986; Garegg
et.al., 1986) for oligonucleotide synthesis. This utilises
pentavalent phosphorous compound 7 which has hydrogen
instead of hydroxyl on the phosphorous atom.
b) The reagent used for activation is pivoloyl chloride ..
c) This method has the following advantages such as ( i) no
protection of phosphate is required (ii) oxidation of P-H
is achieved by a .global oxidation at the end of the
synthesis rather than at the end of each step. ·
d) The monomers are stable and are neither hygroscopic nor
susceptible to air oxidation. The potential of H
Phosphonate chemistry is yet to be fully utilised for
routine oligonucleotide synthesis.
32
I Phosphodiester method
0
II e RO-P-0 + R'OH
I
TI Phosphotrl ester method
0
II e RO _;,_p-o +
I .. OR
4
ill Phosphonete method
0
R'OH
5
II RO -P- 0 + RbH
I H
1 8
R =Bese 1 R" =Bese 2 R-=Phosphete protection
0
TPSCl II RO-P-
1
OR' l 3
Oe
0 MSNT /TPSCL,NMI II . -~~ RO-~...;_ - - ~ - I OR
OR' 6
0
II RO-P-OR' >
I H
<;! l Global oxidation
0
II RO-P- OR'
I 10 0 6
Scheme 1. Different chemistries for oliqonucleotide synthesis (contd)
N Phosphite triester method ·
RO---. p---. Cl r
OR'"
+ R"OH ) RO-P-OR"
I OR··
1 I 12 13 0
12; 'w'eter oxidation . pfl OR" --4-) RO- -
I OR ..
3l.Phosphoremidite method 14
Tetrazole RO- P- NRR + R"OH
I ) RO-P- OR"
I OR'" OR'"
0 11 II 16
12/Weter oxidation --+} RO _p_ OR"
I OR""
1~
2.1.3. Techniques for oligonucleotide synthesis:
Solution phase synthesis:
In this method of synthesis all reactions are carried out
in homogeneous solutions (Chaudhari et.al., 1984). The first step
of condensation is followed by deprotection at the 5 1 -end. The
resulting product is purified ·by chromatography and the next
cycle is continued. This is achieved by two ways; either by
linear coupling or block coupling.
Linear coupling: 3 1 condensation 5 1 deprotection,
a) 5 1 x-B-p + HO-A HO -BpA purification
next cycle ~
Block coupling:
condensation
b) x-FpEpDp + HO-CpBpA ~ x-FpEpDpCpBpA ) etc . where X= 5 1 protecting group and p= protected phosphate group.
Solid phase synthesis:
In this methodology (Gait 1984, Gassen and Lang 1982) the 3 1-
terminal nucleoside which is pre-linked to a polymer support, is
condensed with a sui table 5 1 -protected monomer. The resulting
dinucleotide product is retained on the solid support and the
excess unreacted reagents are removed by solvent washings. Puri-
33
fication at each step is not performed but is done at the end of
the synthesis.
5 1 -deprotection
0--Ax
)(p}ApB-OH
----~ 0-A-OH
contd.
condensation 5 1 deprotection
---:')~(E}--ApBx >
The main differences in solid phase and solution phase synthesis
are described in table 2.
PRESENT WORK
In the following sections of this chapter, chemical
synthesis, purification and characterization of short oligo
nucleotides d(CACGTG), d(CACCGTG) and d(CACGGTG) by solution
phase phosphotriester chemistry and 37-mer DNAs by solid phase
phosphoramidite procedures are described.
2.2. RESULTS AND DISCUSSION
2.2.1. Preparation of protected mononucleotides:
The monomers required for the solid phase synthesis are the
protected deoxynucleotides (1-4, scheme 2) which were prepared
(Rajendrakumar et. al., 1985) by one-pot transient protection
method of Ti et. al. , ( 1982) . The unprotected deoxynucleosides
(dA, de, dG) were first treated with trimethylchlorosilane in
pyridine to mask the 5 1 - and 3 1 -hydroxyl groups, immediately
followed by reaction with benzoyl chloride (for dA, dC) or
isobutyryl chloride (for dG) to obtain N-acyl-3 1 ,5'-bis
34
Table. 2 Differences between solid phase and solution phase oligonucleotide synthesis.
Feature
Ease
Skill
Scale
Length limitations
Purity
Time
Cost
Solution phase Solid phase
Manual Semi-automatic or automatic
Organic chemistry Not essential expertise required
Large scale Yields microgram to a milligt~ Yields > mg amounts
Upto hexamer satisfactory, >100 mer possible block coupling for > 6
i)
ii)
Purification at every step-yields high purity DNA Good for structural studies by NMR, X-ray
Slow 150min/1 nucleotide
addition
Low
i) Accumulation of trun-cated sequences
ii) Ideal for molecular biology applications
Fast 12min/l nucleotide
addition
High
51
ROC:;J.H2 8
I
1 I 4
OR1
1.8= A
R
2.8= c
3. 8=
13, R, = R2= Cl
l-4withR'=H 14,R,=00,R2=N0' 8 Oame •• · '0
5- · . . -R'=H . e as 1-4. With R- -C-OH
9-12.sam . R -C-CH2-CH2 II 1-4. With -II 15-IS.same as 0 0
Scheme. 2
trimethylsilyl deoxynucleosides. The hydrolysis of silyl groups
was then effected in a few minutes with aqueous ammonia to obtain
the N-acyl-2'-deoxynucleosides (9-12) in 85-90% yields. These
were converted into their respective N-acyl,5'-0-(4,4'-dimethoxy
trityl),2'-deoxynucleocides (5-8) by treatment with 4-4'-dimeth
oxytrityl chloride in pyridine and the products were purified by
flash chromatography on silicagel H. This one-flask procedure of
preparing the N-acyl,5'-0-protected nucleosides is more
convenient and quicker than the conventional method of peracyla
tion-selective hydrolysis (Narang et.al., 1980).
The above N, 0-protected deoxynucleosides (5-8) were phos
phorylated at the 3'-hydroxyl group by the procedure of Effimov
et.al., (1982). Here the phosphorylating agent is the 4-chloro
phenyl phosphoryl pyridinium derivative (14) which is generated
in situ by simple addition of an equimolar amount of water to 4-
chlorophenyl phosphorodichloridate (11) in pyridine. The latter
reagent was prepared by reaction of 4-chlorophenyl with phos
phorous oxychloride (Owen et.al., 1974) and purified by vacuum
distillation. This procedure of phosphorylation of nucleosides is
more convenient as compared to the use of bifunctional phosphory
lating agents such as triazole or tetrazole activated 4-chloro
phenyl phosphates (Narang et.al., 1980) and yields of phospho
diesters isolated as triethylammonium salts (1-4) are
satisfactory. This method of phosphorylation is also devoid of
35
side products due to base modifications, especially o6 and o4
phosphorylations in dG. and dT respectively. The crude nucleotide
monomers were purified on a short column of silica gel and
detected as UV and trityl positive spots on TLC plates.
2.2.2. Solution phase synthesis:
d(CACGTG), d(CACCGTG), d(CACGGTG) were synthesised
(Raj endrakumar et. al. , 1987) by solution phase phosphotriester
methodolgy. Each synthetic cycle consists of three consecutive
steps; (i) Condensation (ii) deprotection and (iii) purification.
During the first step (scheme 3) a 3'-terminal block such as~ is
condensed with a 3 '-(2-chlorophenyl) phosphate ester of a 5'0
and N-protected 2 '-deoxyribonucleotide £.
used is either MSNT or TPSCl in
The condens ~ng agent
combination with N
methylimidazole (Effimov et.al., 1982). The reaction as
monitored by TLC over silica gel was essentially complete within
15min. The 5',3'-0-protected dinucleotide 1, product of the first
step is then deprotected at the ~'-position in the second step.
This is achieved by treatment of the~ dinucleotide l with a
solution of phenyl dihydrogen phosphate in chloroform-ethanol. A
deep orange colour is produced instantaneously due to the
liberated dimethoxytrityl cation. After work-up, the product ~
was taken to the third step of cycle for rapid purification over
silica gel. The column was eluted with 1-2 bed volumes of
36
chloroform to remove non-nucleotidic impurities such as
dimethoxytritanol liberated during the deprotection. The desired
product was then rapidly eluted with anhydrous THF-pyridine
(3:1) and recovered from the eluant. After drying, this was used
as the 5'-hydroxyl component for initiating the next cycle. All
reactions were conveniently monitored by TLC over silica gel. The
phosphate monomer~ added at every cycle have low rf value (0.04-
0.05) and show up as orange-red spots (trityl positive) on TLC
after acid-spray. The 5 '-hydroxy component cannot be visualised
in a similar way; however, when heated after the acid spray, it
shows up as a dark spot. The phosphate component ~ is always
taken in slight excess (1.2 equivalents) over the 5 1 -hydroxy
component to drive the reaction to completion. The solvent used
in first three cycles was acetonitrile since reactions in this
solvent are faster as compared to pyridine. Further, because of
the low solubility of the 5 1 -hydroxyl component in acetonitrile,
the solvent used was pyridine. Beyond the trinucleotide stage,
the phosphate components are taken in 1.4-equivalents excess over
the hydroxyl component to drive the reaction to completion. The
completion of the condensation is signalled by the total
disappearance of 1 and appearance of a higher rf trityl-positive
spot due to ]_. It should be mentioned that for the eventual
success of this method tha 5 1 -hydroxy component should totally
disappear at every step; otherwise it would be very difficult to
37
DHTRO~O· T H H
H · Cl
2
o=~-@ .. L
Et NHO 3
TPSCl/MSNT ,NMI
CH CN/Pyr 3
)
+
""lc(~6ibu RT, 15 min
H~
!
ibu DHTr-0~0 ·s
· H H H
0 Cl
o=~-@ -' .. 0Et3
NH
y NEXT CVCLE
DMTRD~T
0 Cl .. ~ o=P~
~Vuoa;fb" .~ "r--r OBZ
B)Ph H 0 PIn CHC1 3 2 3un ice
b)Silir:B gel Column
HO~O T H H
H
0 Cl
o=~-@ . ~~61bu
DBZ 4
Scheme 3: Solution Phase Phosphotriester method for (l(CACG TG)
separate it from the product since both have very close r f
values. The 5'-deprotection of the product ~ is done with phenyl
dihydrogen phosphate. The reaction with this reagent in addition
to being faster, seems to cause less depurination as compared to
other detri tylating agents such as benzene sulphonic acid or
dichloroacetic acid. This reaction was also easily assayed by TLC
as the trityl-positive product l. is converted into a slightly
slower moving trityl-negative product. The liberated tritanol
moves with the solvent front in the TLC. The end product of the
cycle .1 is purified by rapid column chromatography over silica
gel (Chaudhari et.al., 1984). It can be seen from table 3 that
the total time required for the first synthetic cycle is about
150 min. The four other cycles required for synthesis of a
hexamer were carried in a similar way. When the assembly is
complete the 5 1 -hydroxy end is deprotected followed by treatment
with acetic anhydride to acetylate the free hydroxy end. This
avoids the general procedure of treatment of completely
deprotected oligomer with acetic acid and thereby minimising the
losses. The acetylated oligomer was deprotected by the procedure
described in scheme 4.
The treatment of the protected oligonucleotide with oximate
reagent removes the o-chlorophenyl protecting group from all
phosphates. Concentrated ammonia deprotects all N-acyl groups on
bases and the 5'-acetyl group on sugar. The resulting product is
38
Table 3 Time required for the steps in solution phase synthesis.
Step \.ol01'k Time in (min)
Step 1 Reaction 15 Workup 15
Step 2 Reaction 10 Workup 10
Step 3 Column 60-80
Total - 150 minjcycle
Scheme 4: Deprotection procedure
d(HOC~ZA~pzC~G:~u\flbu_Bz)
~ Acetic anhydride-pyridine
d(A O-CBzABzCBz6 IbuTGibu_ 8 ) t p I' :y:2.:itrobe:zaldoxime·THG
d(AcO-CBzABzCBzGibuTGibu_Bz)
~ Cone. NH 3 , 17h, 60°C.
d(CACGTG)
d Ac ABz CBz
6 Ibu
p
= = =
= Deoxy = Acetyl
6-N-Benzoyl-2 1 -deoxyadenosine 4-N-Benzoyl-2 1 -deoxycytidine 2-N-Isobutryl-2'-deoxyguanosine
= Phosphate groups protected by 2-chlorophenyl
a completely deprotected oligonucleotide along with various non
nucleotide impurities (deprotecting agents etc.). The latter are
removed by passing the mixture over a gel filtration column
(Sephadex G-15) where the crude product elutes in void volume.
This is almost 90-95% pure and for biophysical studies, it was
further purified by FPLC (described later). Using this method
several milligrams of hexamer and heptamers were synthesised in
high purity as required for NMR and X-ray studies.
2.2.3. Solid phase synthesis:
Several 37 base operator DNAs related to P22 Mnt operator
(Fig.l) were synthesised on Pharmacia Gene Assembler by phosphor
amidite chemistry. The steps involved in the assembly of oligo-
- nucleotides (scheme 5) were carried out automatically by a micro
processor are They are: (i) condensation (ii) oxidation (iii)
capping and ( i v) 5 '-deprotection. This cycle is repeated. Each
step is interspersed with solvent washings to remove excess
reagents. A peristaltic pump delivers reagents and solvents at a
specified flow rate during specified timings. The time period of
delivery of each reagent is indicated in table 4. For successful
synthesis, some precautions are to be taken during the
synthesis. These are (i) use of absolutely dry solvents (aceto
nitrile and dichloroethane) since the internucleotide bond
formation in phosphoramidites is inhibited by even trace amounts
39
3701 3702
37C1 37C2
37!1 3712
37TI1 37U2
37.!2"1 3712:2
1 I -- . 3 TCTCAATAGGTCCACGG~GACCTGTATTGTGAGGTG ---- . ----- .
AGAGTTATCCAGGl~CCACCTGG~CATAACACTCCAC
TCTCAATA~GTCCACAGTtGGACCTGTATTGTGAGGTG AGA.GTTATCCAGGtrGTCAcCTG~ATAACACTCCAC -·-
TCTCAATAGGTCTAC~G~§_GACCTG TATTGTGAGGTG AGAGTTATCCAGATGCCACCTGGACATAACACTCCAC
TCTCAATAGGTCTACGGTAGACCTGTATTGTGAGGTG . '
AGAGTTATCCAGATGCCATCTGGACATAACACTCCAC
TCTCAATAAGTCCACGG~GGACCTGTATTGTGAGGTG
AGAGTT AT!CAGGTGCCACCTGG!ACAT AACACTCCAC
TCTCAATAA5TCCACGGTGGACATGTATTGTGAGGTG • AGAGTTATTCAGGTGCCACCTGTACATAACACTCCAC
Fig.l. 37 base pair DNA sequences synthesised for Mnt re pressorinteraction
studies. Presence of A vall restriction site is indicated by broken line. 37 base
pair DNAs differ in having number of restriction sites. 37o and 37c has 2
restriction sites, 371 and 37III have one site each and 37II and 37IV- no sites.
DMTRO~O B H . H
H . 0
I 0= P-OCH CH CN
1 . 2 2 2 N
/' R R 1 2
+
. Jl . H HO~O B
1 H - 0
s ®
Tetrezole
>
DMTRO~O B H H
H 0 I
o=P.....;oCH CH CN 1 2 2
0~0 B H H
3 H
0
~ CD
a)Iin Cl-1 CN and Weter 2 3
b) Ac 0 in Pyridine 2
c) 3%DCA
H1QB H H H
0 I
0= P- OCH CH CN 1 2 2
0~ 0
s CD
CVCLE REPEAT
Scheme 5: Solidphase synthesfs using Phosphoramidite method
Table 4 Reagent/Solvent delivery timings in solid phase synthesis
Reagent
1. Ethylenedichloride wash
2. Detrilylation 3% DCA/EDC
3. Acetonitrite wash
4. Tetrazole
5. Amidite (0.1 M soln.)
6. Tetrazole (0.5 M soln.)
7. Acetonitrite
8. Recycle during coupling
9. Acetonitrite wash
10. Capping A
11. Capping B
12. Acetonitrite wash
13. Oxidation
14. Acetonitrite
Capping solution A Capping solution B
Oxidation solution
Time Flow mljmin
1.3 2.5
2.0 2.5
1 2.5
0.1 1.0
0.1 0.5
0.1 1.0
0.2 2.0
3 2.5
0.3 2.5
0.1 X 2 0.5
0.1 X 2 0.5
0.3 2.5
0.1 2.5
1.0 2.5
6% DMAP in acetonitrite 20% Ac2o in acetonitritej collid1ne 0.01M Iodine (.50g Iodine in 130ml acetonitrite, 12ml collidine, 60ml water)
of water ( ii) high purity reagents (monomers, oxidation and
capping solutions). After the coupling and oxidation reactions
but before deprotection in each step, capping is done at the 5'
end to arrest the growth of the unreacted chains. In addition,
capping reagents also react with trace amounts of water to keep
the reaction medium dry. The coupling efficiency as monitored by
trityl assay (UV detector) was over 95% at each step. At the end
of the synthesis global deprotections are achieved by treatment
with concentrated ammonia followed by gel filtration to remove
non-nucleotidic impurities. All the 37-mer sequences shown in
figure 1 were synthesised on 0. 2 mmole scale, with an overall
yield of approximately 5 A~about 10%).
2.2.4. Purification of oligonucleotidess:
The purification of all the synthesised oligonucleotides was
performed using two procedures.
( i) Large scale purification of hexamer and heptamers on Fast
protein liquid chromatography (FPLC) using Mono Q anion
exchange column.
( ii) Small scale purification of long oligomers on denaturing
polyacrylamide gel electrophoresis (PAGE).
Mono Q column on FPLC is ideal for purification of milligram
amounts of oligonucleotides. The purification of self
complementary and G rich oligonucleotides by chromatographic
40
procedures often poses problems due to possible secondary struc
tures and aggregation behaviours. This was overcome by carrying
out separations at pH 11 at which all the hydrogen bonds (source
of secondary structures) are broken down leading to single
strands. The FPLC column, Mono Q is stable at this pH and has
good loading capacity for performing preparative separations (in
mg amounts) . Crude products obtained in the solution phase
synthesis are almost always 90-95% pure as shown by analytical
anion exchange chromatography of d(CACGTG) (Fig.2a). However, for
structural studies this material was further purified. Purified
material was checked finally by reverse phase chromatogrpahy on
FPLC (Fig. 2b). The FPLC patterns for 2 heptamer sequences are
shown in fig.3a,3b; 4a,4b. Further, these sequences were 5' end
labelled using ~32 P] ATP and analysed on denaturing
polyacrylamide gel (Fig.5) where they showed single bands.
37 base operator DNAs synthesised were purified on
preparative polyacrylamide gel electrophoresis on 1.5mm thickness
gels. The product band visualised by UV light was cut and the
oligonucleotide recovered from the excised gel. This procedure is
ideal for long oligomers and also for obtaining very pure
material.
41
0-20 I I I I I I
I I I
0-16 1-,_
I I
I - I E _) c: "t
0·12 1-,,'' -I() "'
N "' ,
"' 0 .. "' 0 , - , , (/) "' -OJ 0-08 1- , ,..-<( /
,
"' , , /
0-04 1- , / -/
"' "' /
I I I __, \..
I I 0 8 16 20 32
TIME ( min l
0-5 I I r
I I
0-4 1- :-I - I
E I c: I "t 0-3 I_ I() -· I N I
0 _J 0 ---- ------C/)
0·2 ----- -- -OJ I <( I
I
I I
I 0·1 1- I -
I I
I , \.... I
0 I 1 I I
8 16 24 32 TIME (min l
Fig.2a. FPLC analysis of d(CACGTG). Ion exchange chromatography on
Mono Q anion exchange column. Buffer A, O.OlM NaOI-I (pll II). B_.
0.0 I MNaOH (pH 11 ), 1M NaCl.
b) Reverse phase chromatography (on RPC C8 column) of purified
hexamer.Buffec A. O.lM Ammonium acetate. BufferB, O.lM Ammonium
acetate and 40% Acetonitrile.
1·0
a
0·8 1--E c v 10 C\1 0·6 1-
0. 0 -(/) m 0·4 f-<(
I
0·2 I
f- I I
I
/ I
I I
I I
I I
I I
I
I I
I I
I I
I I
I I
I I
I I
I I
I I
I I
I
f\ "\...
I I I I
10 20 30 40 TIME (min)
I ·0 .---"---------~r-----.,
-E c v 10
0·8 f-
C\1 0·6 f-0 0 -(/)
~ 0·4-
b
I
I I
I
I
I I
I I
I I
I I
I I
I I
I I
I I
I I
I I
I I
I I
I
0·21- / h ~,',' _,___.,,J \
I I I I,
10 20 30 40 TIME (min)
Fig.3. FPLC analysis of d(CACCGTG), d(CACGGTG).Ion exchange chro
matography (Mono Q anion exchange column) of · crude heptamers
a)d(CACCGTG) b) d(CACGGTG). Buffer A~ O.OlM NaOH (pi-Ill),
Buffer.B,O.OIM NaOH (pi-Ill), 1M NaCI.
0·5 0 I
I I
I
0-4 I 1- I -E
I I
I c:: I
¢ I I() I
0·3 (\J I- ,I "' 0 "' "' 0 - ~ "' / ,"'
(/)
co 0·2 4:
"' "' "'
"' "' I-"' ,
"' "' "' "' "' ~
~
"' "' ~ , 1- / __..) \ ~
~
0·1
~ ~ ,
~ I l I I _l
7 12 18 24 30. TIME (min)
Fig.4. FPLC analysis of purified heptamers.Reverse phase chromatography
on RI'C C X column-(a) d(CACCGTG) (b) d(CACGGTG). Buffer!\ O.lM
Ammonium acetate. Buffer B, O.lM Ammonium acetate 40% acetonitrile.
2 3 4 5
Fig 5. Denaturing polyacrylamide (14%) gel analysis of labelled heptarners d(CACCGTG) and d(CACGGTG). Lane one is oligo@1112-18 markers and lanes two and three are octarner markers. Lane 4 is d(CACGGTG) and lane 5 is d(CACCGTG). .
2.2.5. Characterization of oligonucleotides:
The synthesised hexamer and heptamer sequences were
characterised by NMR spectroscopy (chapter III) . This spectre-
scopy helped in identification of all the bases in the oligomers
and also their sequence along the chain. Thus no further
sequencing was necessary for hexamer and heptamer sequences.
As indicated in figure 1, operator fragments 37° to 37IV
differ in having restriction endonuclease sites for enzyme Ava
II. It can be seen that 37° and 37c have two sites 37I and 37III I
have one site each and 37II and 37IV have no sites. All the
operator DNAs are labelled in a double stranded form and hence
the two 5 1 -hydroxyl ends will have 32 P label. Ava II digesti~n of
such DNA yielded four fragments for 37° and 37c, two fragments
for 37I and 37III and no fragments for 37II and 37IV (Fig. 6).
This pattern of restriction digestion of 37 base operator DNAs
partially confirms the sequences synthesised. Further
confirmation is obtained by Maxam-Gilbert chemical modification
sequencing.
Maxam-Gilbert sequencing procedure is ideal for short oligo-
nucleotides. Figures 7 and 8 show the Maxam-Gilbert chemical
modification reactions and subsequent cleavage of such modified
DNAs to obtain the sequence information of 37 01,37 02,37 C1,37
C2 (of Fig.1). Four reactions of G,A+G,C,C+T are performed on
42
M
Fig.6. A vall restriction enzyme digestion analysis of 37 base pair DNA sequences on denaturing polyacrylamide (14%) gel. Double stranded DNA labelled on either end and used for digestion with Ava II.
GAG-TTA-
{l= cA-G-
3702
G
Fig.7. Maxam-Gilbert sequence analysis of37ol, 37o2 on denaturing polyacrylamide gel (14%) Base corresponding to each band represented on the side. Base specific reactions are indicated on top.
T A
' T c c A G G T
G ' i c
c T
A
c-
37C2
G A+G C· C+T
37CI 1- -
r-1 ----J I
G A+G C C+T
}
-T
-A
-A
Fig.8. Maxam-Gilbert sequence analysis of 37cl, 37c2. Base corresponding to each band represented on the side . Base replacements in 37cl , 37c2 corresponding to 37ol, 37o2 are indicated by arrow.
each of the DNAs. The base corresponding to each band is
represented on the side of the photograph. It should be mentioned
that dimethylsulphate reaction of G is very specific, but other
reactions of A+G, C and C+T are partly non-specific. Thus for a
given base, in addition to an intense band of corresponding
reaction, a faint band also appears for other reactions but .the
base can be identified from the intense band. Bands corr~~ponding
to all the bases in each sequence are clear except in region
bracketed in figures 7 and 8. Here three bands merge slightly
which can be read from the different exposures of the
autora~iogram. This merging is probably because of the secondary
structure possible in this region due to the self complementary
sequence. Few bases on : : 5~ - ~_. end cannot be read because of the
lack of resolution in this region. The single base difference in
different 37 base DNAs is clearly indicated by an arrow in the
figure 8.
Thus the proof of the synthesised sequences is derived from
Ava II restriction digestion and Maxam-Gilbert sequencing.
2.3. EXPERIMENTAL PROCEDURES
2.3.1. Materials:
2'de~xynucleotides,44'dimethoxytrityl chloride (DMTrCl,
2, 4, 6-triisopropyl-benzenesulphonyl chloride (TPSCl), 4-
dimethylaminopyridine and triazole were purchased from Sigma,
43
U.S.A. TPSCl was recrystallised from hexane before use.
Mesitylene sulphonyl-3-nitro-1,2,4-triazole was synthesised
according to reported procedure (Gait 1984).
Trimethylchlorosilane, phenyl dichlorophosphate, N-methyl
imidazole and dichloroacetic acid (DCA) were procured from Fluka,
Switzerland. Pyridine GR (E.Merck, India) was refluxed and
distilled over ninhydrin followed by distillation over KOH.
Dichloroethane extrapure (E.Merck, India) and acetonitrile (HPLC
grade Spectrochem, India) were refluxed over CaH2 . Silica gel H
(BDH, India) was used for column purification of monomers. Silica
gel G (BDH, India) coated plates were used for analysis of
protected nucleosides and nucleotides. Purification by column
chromatography in oligonucleotide synthesis was done using Merck
Keiselgel 60 (Art 9385) and TLC was carried out on precoated
fluorescent silica gel plates (Merck.Art 5554). Spots on TLC were
visualised using UV light and a spray of 60% perchloric acid
ethanol (3;2). In the case of trityl derivatives, perchloric
acid-ethanol spray indicated orange spots whereas in non
tritylated derivatives, black spots appeared upon heating after
acid spray.
2.3.2. Preparation of protected monomers
Preparation of N-acylnuc1eosides:
6-N-benzoyl-2'-deoxyadenosine: (9-12, Scheme 2)
2 '-Deoxyadenosine ( 1. 3g, 5mmol) dried by coevaporation with
44
pyridine was suspended in 25ml of dry pyridine and treated with
3.2ml (25mmol) of trimethylchlorosilane. The mixture was stirred
for 15min and to this was added 3. Oml (25mmol) of
benzoylchloride. The reaction mixture was maintained at room
temperature for 2hr. after which it was cooled in an ice bath and
the reaction was quenched with 10ml of water. After 5min it was
treated with 10ml of 29% aqueous ammonia at room temperature for
30min, the mixture was evaporated to dryness and the residue was
dissolved in 100ml of water. It was washed once with diethyl
ether and the aqueous layer on cooling yielded 1.5gm (90%) of 6-
N-benzoyl,2'-deoxyadenosine.
4-N-benzoyl-2'-deoxy cytidine: (10, Scheme 2)
2'-Deoxy cytidine (i.20g, 5mmol), in a reaction similar to
the above with trimethylchlorosilane (3.2ml) followed by benzoyl
chloride (3.0ml) in pyridine, (25ml) and on work-up yielded 1.5g
(Yield 92%) of 4-N-benzoyl-2'-deoxycytidine.
2-N-isobutyryl-2'-deoxyguanosine: (12, Scheme 2)
This was prepared from 2 '-deoxy-guanosine ( 0. 7g, 5mmol) ,
trimethylchlorosilane (3.2ml) and isobutyrylchloride (4.0ml) by a
procedure similar to that of above. The product was crystallised
from water to obtain 1.0g (70% yield).
45
General procedure for N-acyl-5'-0-dimethoxytrityl deoxynucleo
sides:
The N-acyl,2'-deoxynucleoside (5mmol) was dissolved in
anhydrous pyridine (15ml) and the solution was evaporated to
dryness. The solid was dissolved in pyridine (lOml) and treated
with 4,4'-dimethoxytritylchloride (1.7g, 5mmol). The mixture was
shaken in the dark for 4 hrs in a sealed flask during which
period pyridine hydrochloride separated out. TLC (silica gel)
analysis in chloroform : ethanol (9:1 vjv) showed the reaction to
be complete as trityl and UV tests showed one positive spot with
higher rf than the starting compound. Methanol (lml) was added to
the mixture and extracted with chloroform (3x40ml). The organic
layer was washed with 1M aqueous sodium bicarbonate (25ml) and
evaporated to dryness, resulting in a gummy mass. This was
chromatographed by the short column method on silica gel-H under
N2 atmosphere (1.5psi) and eluted with dichloromethane containing
1% triethylamine and increasing amounts of ethanol. The product
started eluting around 5% ethanol concentration as monitored by
TLC and the appropriate fractions were combined and concentrated.
The residue was dissolved in dichloromethane (lOml) and
precipitated by slow addition into a solution of 150ml of
ether:heptane (1:1 vjv) containing 1% triethylamine when the
trityl derivatives separated out as amorphous white powder.
46
General procedure for N-acyl-5'-0-(4,4'-dimethoxytrityl) 3'0-
(41chlorophenyl) phosphate triethylammonium salts: (1-4, Scheme 2)
N-acyl-5'-0-methoxytrityl-deoxynucleoside (lmmol) was
suspended in anhydrous pyridine (25ml) and the mixture was
evaporated to a final volume of lOml. 4-Chlorophenyl
phosphorodichloridate (5mmol) was added to pyridine (lOml)
contained in a glass reaction vessel fitted with a sintered disc
and a stopcock and while cooling, water (5mmol, 90ul) was added
into the reaction vessel. On leaving the mixture at room
temperature for lOmin, pyridine hydrochloride separated out. It
was filtered into the reaction flask containing the nucleosides
in pyridine under N2 atmosphere. The mixture was concentrated to
lOml and after 30min at room temperature, the phosphorylation was
found to be complete as shown by TLC. The reaction was stopped by
the addition of 1M triethylammonium bicarbonate (TEAB, 15ml) at
0°C. It was extracted into chloroform (2x75ml), washed with O.lM
TEAB and coevaporated to an oil with pyridine. This was then
chromatographed over silica gel-H by the short column method
using 1% triethylamine in dichloromethane and increasing amounts
of ethanol. The phosphorylated product eluted as triethyl
ammonium salt around 10% ethanol in dichloromethane. The
appropriate fractions were pooled and concentrated and the
product was precipitated as amorphous white power from
47
dichloromethane solution by adding slowly into ether:hexane (1:1
vjv).
2.3.3. Preparation of 3 1 -0-Benzoyl Guanosine (Denny et.al., 1982):
5'-0-Dimethoxytrityl N-benzoyl guanosine (3.7g, 6.9mmol) was
dissolved in dry pyridine ( 15ml) and benzoyl chloride ( 1. Olml,
llmmol) was added dropwise to the stirred solution below 10°C.
After one hour at 20°C, the mixture was poured into ice-water
(200ml) and extracted with chloroform. The solvent was evaporated
and the residue azeotroped with toluene to remove traces of
pyridine and dissolved in ice-cold 2% benzene sulfonic acid in
chloroform/methanol 7;3 v;v. After 10 minutes at o0 c the solution
was washed with 5% aqueous NaHco3 (2x100ml) followed by water.
Removal of water and crystallization of residue from ethanol gave
pure product (Yield 2g, 85%).
2.3.4. Preparation of Phenyl Dihydrogen Phosphate:
Phenol (23g, 0.12mmol) and phosphoryl chloride (62ml,
0. 64mmol) were heated together under reflux in presence of a
catalyst- anhydrous aluminium chloride (30mg). After two hours
of refluxing the products were cooled and distilled to give
phenyl phosphorodichloridate (48g, 0.1mol) b.p 84°C at 0.1torr.
Phenyl phosphorodichloridate (48g, O.lmol) was placed in a
round bottomed flask with a reflux condenser and heated to 80°C
and water (7.5ml, 0.4lmmol) was added dropwise while stirring the
48
contents. After one hour reaction, the products were evaporated
to dryness under reduced pressure and the crystalline compound
that was left was recrystallised from chloroform (11g, 60% yield
m.p 99-100°).
2.3.5. synthesis of d(CACGTG):
The general protocol of the solution phase chemical
synthesis is illustrated by the following procedure for the
chemical synthesis of d(CACGTG).
Step (1): The phosphodiester block DMT-T-p (~, 140mg, 0.18mmole)
and the 3 '-terminal nucleoside (1. HO-dG-Bz, 72 mg, o .15mmole)
were dried by coevaporation (2 times) and dissolved in dry aceto
nitrile (1ml/0.1mmole of 1.,) under anhydrous conditions and
treated with the condensing agent ( 0. 4 5mmole, TPSCl, 14 Omg or
MSNT, 133mg) and 1-methylimidazole (0.9mmole, 72ul). The reaction
mixture was stirred at room temperature. The reaction, followed
by TLC was essentially complete within lOmin. Excess reagents
were destroyed by treatment with aq. NaHC03 and the product was
extracted into chloroform (3x20ml). The chloroform layer was
washed with water (lOml) and dried (over Na2so4 ) .The organic
layer was concentrated under reduced pressure to yield a
colourless foamy material of the protected dinucleotide }_. The
total time to complete step 1 was 30min. The product was taken to
step 2 without any characterization.
49
Step (2): The material from step 1 was dissolved ~n chloroform
methanol (95:5, vjv, 6ml), cooled at 10°C and treated with solid
phenyl dihydrogen phosphate (260mg, 1.5mmole). An instantaneous
orange-red colour was produced. After 5-10min (checked by TLC)
the reaction mixture was diluted with chloroform (20ml) and
washed with . aq. NaHco 3 . The dried organic layer on evaporation
gave a foamy material which was purified by step 3 to give ~.
Step ( 3) : The material from step 2 was dissolved in chloroform
(1.5ml) and loaded uniformly over a short column (2cm i.d.) of
Merck silica gel (8g). The column was washed with chloroform
(20ml), when a pale yellow band separated and eluted out. This
was then followed by elution with anhydrous tetrahydrofuran-
pyridine (3:1, v;v, 40ml) when the desired product, was obtained
in the eluant. This was recovered after evaporation under reduced
pressure and repeatediy coevaporated with dichloromethane. The
product (TpGibu_Bz, 120 mg, 90% yield) was dried over P2o5-KOH
in a vacuum desicator and used for initiating the next cycle.
Four more cycles were carried out similarly according to the
conditions shown in table 5. After the final cycle, the product
obtained was subjected to a sequence of reactions (described
later) to yield the completely deblocked d(CACGTG).
50
Table 5 Reaction conditions for synthetic cycles in synthesis of d(CACGTG)
3' -component (mg, mmole)
d(T G61 -Bz) p (115, 0.13)
d(G\b~ ~~W.-Bz) (140, 0.1)
. ·w il.u d(c.'f d .fTpG -Bz) (140, 0.08)
5 •- component (mg, mmole)
Condensing agent
(mg, mmole)
N-Methylimidazole (ul, mmole)
n,., DMT-dG-S&. TPSCl 62; 0. 78 (140, 0.15) (117, 0.39)
DMT-dc;8z. (130, 0.14)
DMT-dj7-( 106, 0. 11)
DMT-dCiz. (72, 0.08)
TPSCl (90, 0.3)
MSNT (71, 0.24)
MSNT (45, 0.15)
48; 0.6
38; 0.48
25; 0.3
Product (mg, yield)
d(G1~TpG -Bz> (144,80%)
A:L ·t.u } '-4 d(c-p d r TpG -Bz) (140, 70%)
. ·w d( c.sz A8
z. c& G"~TpG -Bz > P r p L
(144, 70%)
2.3.6. Synthesis of d(CACCGTG), d(CACGGTG):
The above heptamer sequences were also assembled in a
similar manner. After initial two nucleotides addition to 3'
blocked guanosine, the resulting HO-GpTpG (500mg, 0.3mmole) was
divided into two halves (0.15mmole each) and further building of
heptamers was carried out. Thus one half of Ho-GpTpGBz (250mg,
0.15mmole) used for d(CpApCpCpGpTpG) and another half used for
d(CpApCpGpGpTpGp). Step wise conditions used in different steps
are in tables 6 a,b.c.
2.3.7. Deprotection of hexamer and heptamers: (scheme 4)
d(AcO-CpApCpGpTpG-Bz):
d(CpApCpGpTpG-Bz)
( 0. 6ml) and pyridine
(140mg) was treated with acetic anhydride
(1.5ml) at room temperature for 2h. The
reaction mixture was poured into ice-water and stirred for lOmin.
It was then extracted into chloroform (25ml), washed with aq.
NaHC03 and dried over Na 2so4 . The organic layer on concentration
gave a foamy acetate product (130mg; 92%).
d(CACGTG):
The acetate obtained above was dissolved in dioxane-water
(l:lvjv, lOml) and treated with syn-2-nitrobenzaldoxime (400mg)
followed by tetramethylguanidine ( 0. 27ml) . The reaction mixture
was kept at room temperature for 14h and then heated at 60°C for
3h. It was lyophilized and then treated with concentrated ammonia
51
Table 6a Reaction conditions for Trimer dbuT dbu - Bz p p
3'-component 5'-component Condensing (mg, mmole) (mg, mmole) agent
(mg, mmole)
ibu Ho-G -Bz DMT-T 452; 1.5 p
(240, 0.5) (240, 0.5)
ibu Ho-T G -Bz DMT-dbu p p
(400, 0.4) (165, 0.5) 361, 1.2
N-Methyl- Product imidazole (mg, yield) (ul, mmole)
0.2; 7.8 (T dbu_Bz) p
(450, 0.4)
74; 098 dbuT dbuBz .P p
. ibu ibu Table 6b Reaction conditions for Heptamer d(CACCGTG) from Tnmer G T G p p
3'-component (mg, mmole)
dbuT dbu_Bz p p
250, 0.15
CBzdbuT dbu_82 p -p p
250, 0.12
CBzCBzdbuT dbu82 p p p p
250, 0.098
ABzcBzcBzdbuT dbu_82 p p p p p p
180, 0.06
5'-component (mg, mmole)
DMT-Cp
184, 0.21
DMT-Cp
175, 0.204
DMT-Ap
187, 0.19
DMT-Cp
105, 0.12
Condensing agent
(mg, mmole)
TPSCI
180, 0.6
TPSCI
181, 0.61
TPSCI
181, 0.6
TPSCI
108, 0.36
N-Methylimidazole (ul, mmole)
72; 0.9
96, 1.2
96, 1.2
57.6, 0. 72
Product (mg, yield)
C dbuT db~ 6z. p p
250, 0.12
CBzCBzdbuT db~Bz.. p p p p
250, 0.098
A BzCBzcBzdbuT G -Bz p p p p p
180, 0.06
CBz A CBzdbuT G -Bz p p p p p
100, 0.025
Table 6c Reaction conditions for synthesis of he pta mer d(CACGGTG) from trimer dbuT dbu -Bz p
3'-component (mg, mmole)
Ho-dbuT dbuBz p p
250, 0.15
Ho-dbudbuT dbuBz p p p
k\O..:~BzdbuT dbu82 p p p 320, 0.105
Ho-A BzcBzdbudbuT dbuBz p p p p p
tSo,o·o!;
51-component (mg, mmole)
DMT-dbu p
241, 0.26
DMT-C82
p
199, 0.20
B% DMT-Ap
187, 0.2
DMT-C~2
88, 0.1
Condensing N-Methyl-agent imidazole
(mg, mmole) (ul, mmole)
TPSCI 145, 1.82
314, 0.45
TPSCI 112, 1.4
240, 0.816
TPSCl 112, 1.4
240, 0.8
TPSCl 96, 1.2
150, 0.5
Product (mg, yield)
HodbudbuT dbu -BZ p p p
300, 0.12
CBzdbudbuT dbuBZ p p p p
320, 0.105
B B "b "b Gibu A zC zd ud uT: -S-z..
p p p p f'
180, 0.05
CB~A B~cB:Gi~ud~ulpdb_:Is:o. 90, 0.024
(30ml) in a sealed flask for 20h at 60°C. The ammonia was evapo
rated and the product was passed through a Sephadex G-15 column
(bed volume 120ml) and eluted with 20% methanol-water. The eluted
fractions were monitored by UV detector and the major peak
eluting in the void volume was lyophilized. The residue was then
purified over FPLC to obtain d(CACGTG) (70mg, 30% overall yield).
d(CACCGTG), d(CACGGTG):
Protected heptamers d(CpApCpCpGpTpG), d(CpApCpGpGpTpG) were
subjected to deprotection steps similar to hexamer and purified
over FPLC [yield d(CACCGTG)=14mg and d(CACGGTG)=9mg].
2.3.8. Synthesis of operator DNA sequences:
37 base length DNAs which correspond to native operator and
modified operator sequences (Fig .1) were synthesised by solid
phase phosphoramidite synthesis on an automatic gene assembler.
The general scheme of synthesis is indicated in scheme 5.
The sequential ·active nucleotide' addition on to nucleoside on
solid support, solvent washings after coupling, r 2 oxidation,
capping with acetic anhydride and further 5' DMTr deprotection
was carried out under the microprocessor control which delivers
reagents using a peristaltic pump to specified timings. The
sequence of bases that are to be added from 3 '-5' end can be
programmed. The timings and sequence of reagents additionjwashing
is indicated in table 4. The most critical point in automatic
52
synthesis is the purity and dryness of solvents (acetonitrile,
dichloroethane) and mononucleotides (NN' diisopropylamino, p -
cyano-ethyl phosphoramidites). Solvents are refluxed vigorously
over CaH2 for a minimum of 24h and then freshly distilled before
synthesis and kept over activated molecular sieves 0
( 3A ) 100
gmjlit. Residual moisture in nucleotides and solvents was taken
care by keeping them over molecular sieves during synthesis.
Complete deprotection was achieved by treating with
concentrated ammonia (25%) in a sealed tube for 17hrs at 60°C.
General yields from a synthesis using 0. 2umole nucleotide as
starting material are about 5 ~of the final oligonucleotide
(overall yield of 10%)
2.3.9. Purification of oligonucleotides:
Oligonucleotides, d(CACGTG), d(CACCGTG), d(GTGGCAC} were
purified using a Mono Q an ion exchange preparative column on
FPLC ( Pharmacia) After loading sample onto an equilibrated
column, a gradient was generated using two buffers. Buffer A -
0. 01 M NaOH pH 11 and Buffer B - 0. 01M NaOH pH 11, NaCl 1M.
Figures 2 and 3 illustrate runs on the Mono Q (5/5) column. The
major peak from each was collected, neutralised to pH 7 using
dilute HCl and the resulting solution dried and desalted over
Sephadex G-15 column. The purified compounds were checked for
53
purity on an analytical reverse phase RPC column (5/5) on FPLC
and 8M urea denaturing acrylamide gel (Fig.2b and 4).
Purification of 37 base DNA's were performed using 7M urea
14% acrylamide gel (1.5mm thick) of size of sequencing gels (38cm
long). 37 base DNA approximately move with xylene cyanol so the
loading buffer contained only deionised formamide with 1mM EDTA.
Buffer containing bromophenol blue and xylene cyanol was run in
an adjacent lane to mark the migration of DNA. Samples were
electrophoresed at 1600 volts for 3-4hrs. DNA was visualised by
placing a fluorescent TLC plate under the gel and DNA viewed by
UV torch. The slowest moving band was excised taking care that
the n-1 band do not contaminate the 37-mer. The gel was crushed
and incubated with sterile water containing 5mM EDTA at 37° c
overnight. DNA was removed from gel by repeated extractions, the
extract dried and EDTA removed by passing through a spun column
(Sephadex G-25} two times. DNA were later labelled, size marked
and checked for purity. Sequences were confirmed by restriction
digestion (Fig. 6). The 37 basepair native operator DNA has two
Avail restriction sites in the 17 basepair operator.
2.3.10. Characterization of oligonucleotides
Restriction endonuclease digestion:
5 '-hydroxyl labelled double stranded 37 basepair operator
fragments (37°to 37 1 v) in medium salt concentration buffer (lOmM
54
tris, 10mM MgC1 2 , 50mM NaCl) were treated with Avaii (2 units
each) at 37°C for one hour. The reaction was stopped with 1ul of
0.5M EDTA, part of the reaction mixture (10ul) was dried ,added
to the loading dye containing formamide. This sample was heated
in boiling water for 3 min and cooled on ice and loaded onto 14%
polyacrylamide, 7M urea gel. When the bromophenol dye moved 3/4th
distance on 38cm long (0.4mm thick) gel, the gel was dried and
autoradiographed overnight.
Maxam Gilbert sequencing:
Chemical modification reactions of 3 7 base DNAs was
performed according to modified Maxam Gilbert procedure (Maxam
and Gilbert 1979 and Pharmacia user bulletin). The detailed
procedure of G, A+G, C, C+T reactions are described in table 7.
After the modification reactions and strand cleavage the samples
were dried added with formamide dye, heated in boiling water bath
for 3 min and loaded on to 14% polyacrylamide gel. When the
bromophenol blue has moved 3/4th distance on the gel 38cm long
gel ( 0. 4mm thick) , the gel was dried and autoradiographed
overnight.
Oligonucleotides d(CACGTG), d(CACCGTG), d(CACGGTG) and 37-
mers were made into duplexes and used for structural studies and
Mnt repressor interaction studies which are described in the next
two chapters.
55
Table 7: Maxam-Gilbert Sequencing reactions
~
32 P DNA 80000 cpm in Sul water OMS 160ul buffer
1ul OMS
Incubate 4S sec. at 37°C
30ul 1M NaoAC pH 4.S stop soln.
Sul (Sug) CT DNA 800ul ice cold ethanol
Chill -70°C half
Spin 1SOOO rpm 20 min 4°C
decant ethanol
Pellet+30ul water
120ul ethanol
hr
Chill -70°C half hr
Spin 1SOOO rpm 20 min, 4°C
Decant ethanol, Dry
32 P DNA 1,20000 cpm in 20ul water
32 P DNA 80000 cpm in Sul water
3ul piperidine formate 1Sul 5M Nacl (made fresh)
Incubate 12 min. at 37°C
Dry in speedvac
SOul water-dry
SOul water Dry
SOul 1M piperidine
30ul hydraz i ne h.,t"iG~~
Incubate 18 min. at 37°C
Keep in ice add SOul water
Sul CT DNA
480ul ice cold ethanol
chill -70° half hr.
Spin 15,000 rpm 20 min 4°C
decant ethanol
Pellet+30ul water
120ul ethanol
Chill -70°C half hr
Spin 1SOOO rpm 20 min, 4°C
Decant ethanol, Dry
Seal the cap with teflon tape
C+T -32P DNA 1,20000 cpm in 20ul water
30ul hydrazine·hydrate
Incubate 1Smin. at 37°C
~ILl 0 .3M NaoAC S '4.l C T D N A ( Sc.q>
420ul ice cold ethanol
Chill -70°C half hr
Spin lf,ooo rem Pellet+30ul water
120ul ethanol
PPt
Decant ethanol
Dry
Heat to 90°C for 30min on heating block with weight on the samples Dry in Savant speedvac SOul water,Dry SOul water,Dry Dissolved in formamide dye Count and loaded onto sequencing gel