Chapter 8 Microbial Genetics part A. Life in term of Biology –Growth of organisms Metabolism is...

Chapter 8

Microbial Genetics

part A

Life in term of Biology

– Growth of organisms

• Metabolism is the sum of all chemical reactions that occur in living organisms to maintain life.

– determined by the enzymes present in the cells

– DNA carry the information for enzymes synthesis

– Multiplication of organisms -increase number of the population

• Heredity – save the characteristics of the species

• DNA hold the information to build and maintain the cells and pass genetic traits to offspring

How DNA carry information?

• DNA molecules in the cells exist as a double-stranded helix;

– Two molecules form the double helix• A hydrogen bonds with T (2 hydrogen bonds)

• C hydrogen bonds with G (3 hydrogen bonds)

• Four bases A,T,C, and G – the four letters of genetic language

• The linear sequence of bases

provides the actual information

DNA - double helix structure - Chromosome• A chromosome is an organized structure of DNA and protein that is found

in cells.– It is a single piece of coiled DNA – Contain DNA-bound proteins, which serve to package the DNA and control its

functions.

• In eukaryotic - linear molecules associated with histones and various proteins that regulate genetic activity

– Different organisms have different number of chromosomes (2n)• Human – 46, Yeast - 32, Dog – 78

• In bacteria - one chromosome which is circular structure, associated with different proteins (no histones)

• The chromosome of E. coli, for example, contains

about 4 million base pairs and is approximately 1000

times longer than the cell.

What genes are ?

• A gene is the basic unit of heredity in a living organism.

• A gene specifies a trait of the organism - thousands of basic biochemical processes that comprise life

• Gene - Segment of DNA (sequence of bases) that encodes a functional product - A protein

- Functional RNA – an RNA molecule that is not

translated into a protein

- Transfer RNA (tRNA)

- Ribosomal RNA (rRNA),

- Smal RNAs (siRNA)

Gene Structure

• Gene - contains both: – "coding" sequences that determine what the gene does (sequences that are

transcribed into mRNA molecule)

– "non-coding" sequences that determine when the gene is active (expressed)

• Not all of the DNA encode genes

Promoter Regulatory region

DNA

Gene

Non–coding sequences Coding sequence

Terminology• Genetics: The study of what genes are, how they carry information, how

information is expressed, and how genes are replicated.

• Chromosome: Structure containing DNA that physically carries hereditary information; the chromosomes contain the genes

• Gene: A segment of DNA that encodes a functional product, usually a protein

• Genome: All the genetic information in a cell (entire DNA)

• Genotype: All genes of an organism. The genetic composition of an organism.

• Phenotype: The expression of the genes, the proteins of the cell and the properties they confer on the organism

Insert Fig 8.2

Parent cell

DNA

expression

Genetic information is used within a cell to produce the proteins needed for the cell to function.

Transcription

Translation

recombination

Genetic information can betransferred between cellsof the same generation.

New combinations of genes

Cell metabolizes and grows Recombinant cell Daughter cells

replication

Genetic information canbe transferred betweengenerations of cells.

The Flow of Genetic Information

Insert Fig 8.2

Parent cell

DNA

expression


Transcription

Translation

recombination




replication



Vertical flow of genetic information

•Replication - The DNA in a cell is duplicated before the cell divides, so each daughter cell receives the same genetic information

Replication

DNA DNA

Vertical flow of genetic information (Replication) is the basis for biological inheritance

• The process starts with one double-stranded DNA molecule and produces two identical copies of the molecule.

• Each strand of the original double-stranded

DNA molecule serves as template for the

production of the complementary strand

• Because each daughter double-stranded DNA molecule contains one original and one new strand, the replication process is

called semi conservative

1 DNA molecule 2 identical DNA molecules

Replication

DNA polymerase

Figure 8.3b

DNA• Polymer of nucleotides: Adenine,

Thymine, Cytosine, and Guanine

• "Backbone" is deoxyribose-phosphate

• Strands are held together by hydrogen bonds between

A-T and C-G

• Strands are antiparallel

5’…..AAGCTTA…. 3’ 3’…..TTCGAAT…. 5’

Figure 8.4

DNA replication5’ end

3’ end

3’ end

5’ end

5’ end

5’ end

3’ end

3’ end

Enzyme – DNA polymerase – add nucleotides in 5’ 3’ direction

DNA replication

Figure 8.6

DNA replication

• DNA replication begins when enzyme helicase unwinds a segment of the DNA and breaks the hydrogen bonds between the two complementary strands of DNA.

• Replication fork - the junction where the double-stranded DNA splits apart into 2 single strands

• DNA is copied by enzyme DNA polymerase in the 5 3 direction

– Leading strand synthesized continuously

– Lagging strand synthesized discontinuously • Initiated by an RNA primer

• Okazaki fragments

• RNA primers are removed and Okazaki fragments joined by a DNA polymerase and DNA ligase

• DNA polymerase makes mistakes with frequency 10-9 bases - mutation

Bacterial DNA replication

• Bacterial chromosome is circular

• Replication is initiated at a particular sequence in a genome - origin of replication.

• Forms two replication forks• DNA replication proceed in two directions – Bidirectional

Figure 8.7Figure 8.6b

Insert Fig 8.2

Parent cell

DNA

expression


Transcription

Translation

recombination




replication



Flow of genetic information within a cell – when a gene is expressed:

• DNA is transcribed to produce RNA (mRNA, rRNA, tRNA, siRNA)

• mRNA is then translated into proteins.

DNADouble stranded

RNASingle stranded

ProteinChain of amino acids

Transcription Translation

1. Transcription

DNA RNA

• DNA transcription is a process that involves the transcribing of genetic information from DNA to RNA– DNA gene sequence is a template for synthesis of RNA

• RNA polymerase - enzyme responsible for the transcription of DNA

• Only genes are transcribed

RNA polymerase mRNAtRNArRNAsiRNA

RNA AUG……………………………

Transcription

GENE sequence

Promoter sequence coding sequence terminator sequenceDNA

• Transcription begins when RNA polymerase binds to the specific DNA sequence of the gene - promoter

• Transcription proceeds in the 5 3 direction of RNA sequence

• Complementary base are A-U (UTP) and G-C• Only one of the DNA strands is transcribed DNA 3’….. AATTACGACCCAATTGAGGC …. 5’ antisense strandRNA 5’AUGUGGGUUAACUCCG….. 3’DNA 5’…. TTAATGTGGGTTAACTCCG……3’ sense strand

• Transcription stops when it reaches the terminator sequence

Eukaryotic mRNA• Transcription - in the nucleus

• Coding sequence of eukaryotic genes consist of:

– Exons – code for amino acids order in proteins

– Introns – no coding sequence • mRNA is synthesize as a precursor (exons + introns) and undergo

splicing (processing, introns are deleted and exons are connected)– One mRNA – more then one protein

– Variability• One gene → more than one mRNA→

more than one protein

Nucleus

Bacterial mRNA

• Bacterial genes don’t have introns

• Bacterial mRNA does not undergo splicing

• One bacterial mRNA could carry sequences for more then one protein (usually with related metabolic functions)

• One promoter - One mRNA Promoter sequence coding sequence terminator sequence

mRNA AUG……..….AUG…………..AUG………..

protein1 protein2 protein3

(enzyme1) (enzyme2) (enzyme3)

DNA

Gene expression and genetic language• DNA – gene with specific sequence of bases (DNA letters) A, T, G, C

• RNA – complementary to the DNA with bases (RNA letters) A, U, G, C

• Protein – sequence of amino acids ( only 20 amino acids) • Genetic code

• –Variability 4, 42=16, 43=64

• Codon - three-base segments of mRNA that specify amino acids.

Tra

nsc

rip

tion

Tra

nsl

atio

n

Genetic code

• All organisms have the same codons to specify the particular amino acid

• The genetic code is degenerate; – most amino acids are coded for by more than

one codon. • Of the 64 codons:

– 61 are sense codons (which code for amino acids), – 3 are nonsense codons (which do not code for amino acids)

are stop signals for translation.• The start codon, AUG, codes for methionine.

Protein Met - Phe -Ser - Arg……ValmRNA AUGUUUUCCAGG…GUGUGA Start Stop

Figure 8.9

One codon: Met, Trp. Two codons: Asn, Asp, Cys, Gln, Glu, His, Lys, Phe, Tyr, Three codons: Ile, STOP ("nonsense"). Four codons: Ala, Gly, Pro, Thr, Val. Five codons: none. Six codons: Arg, Leu, Ser.

Translation• Translation is the process in which the information in the nucleotide

base sequence of mRNA (codons of mRNA) is converted to the order of amino acid sequence of a protein.

• Transfer RNA (tRNA) - a small RNA, each containing about 80 nucleotides. – A tRNA molecules has two functional sites:

• Recognize a specific codon (anticodon sequence)– For each sense codon these is a tRNA with complementary antisense codon

• Binds to a specific amino acid (at 3’ end)

– Transport the required amino acid to the ribosomes

• The site of translation is the ribosome.

Figure 8.2

Figure 8.9, step 1

• mRNA

• Ribosomal subunits

• Met-tRNA

• Amino acid

Translation 1. Initiation of translation – AUG codon – Met tRNA2. Elongation – protein synthesis3. Termination – Stop codon

Translation• In Eukaryotic cells:

– Transcription – nucleus

– Translation – EPR

• In Bacterial cells there is no nucleus

– The transcription and translation processes go simultaneously.

mRNA AUG……..UAA… AUG…….…UAA AUG.……UAA..

protein1 protein2 protein3

(enzyme1) (enzyme2) (enzyme3)

Gene expression and cell energy• Genes, through transcription and translation, direct the synthesis of proteins,

many of which serve as enzymes • The very enzymes used for cellular metabolism.

• Protein synthesis requires a tremendous expenditure of energy• The regulation of protein synthesis is important to the cell’s energy economy.

The cell conserves energy by making only those proteins needed at a particular time

• There are 2 classes of genes – Structural genes

• genes that code for any protein or RNA molecules that are required for normal enzymatic or structural functions in the cell

– Regulatory genes • genes that code for protein and RNA molecules whose function is to regulate the expression of other genes

The Operon model of gene expression

DNA

• GENE sequence

Promoter Operator Coding sequence (regulatory region)

AUG……..Stop….AUG…..Stop…..AUG……Stop protein1 protein2 protein3 (enzyme1) (enzyme2) (enzyme3)Bacteria

non–coding sequences

• In bacteria - a group of coordinately regulated structural genes with related metabolic functions is organized as a unit - Operon – Promoter (sequence), operator (sequence) and structural genes ( sequence) are called an operon.

• The promoter and operator are sites that control structural gene transcription.• Structural genes are expressed as a single messenger RNA.

•

Operon

mRNA

The Operon model of gene expression• Promoter is the site to which RNA binds• Expression of structural genes is regulated by a regulatory protein - repressor

protein• In the operon model a regulatory gene codes for the repressor protein• The repressor protein acts by binding to a site on the DNA.• The site on the DNA to which the repressor protein binds is called an Operator.• Activity of the repressor protein depends on the presence or absence of an Effector

substance.

Figure 8.14.1

Lac Tryptophan

Learning objectives

• Define genetics, genome, chromosome, gene, genetic code, genotype, phenotype, and genomics.

• Describe how DNA serves as genetic information.• Describe the process of DNA replication.• Describe protein synthesis, including transcription,

RNA processing, and translation.• Describe the operon model of gene expression

Chapter 8 Microbial Genetics part A. Life in term of Biology –Growth of organisms Metabolism is...

Documents

Transcript of Chapter 8 Microbial Genetics part A. Life in term of Biology –Growth of organisms Metabolism is...