11/26/2013

1

GeneticsChapter 10 and 11

Why is Genetics Important

Genetics Without Knowing What We Know

� There is a molecule called DNA.

� It carries information from one generation to the next

generation.

� DNA is made up of Nitrogenous bases:

� Gaunine (G)

� Cytosine (C)

� Thyomine (T)

� Adenine (A)

� DNA uses these letters to make proteins.

� Proteins give us traits that we inherit from our parents.

Vocabulary

� Genetics: Study of heredity

� Heredity: Passing of traits from one generation to

another.

� Most popular field of biology.

� Money driven market

� Discovering cures for genetic diseases

� Designer babies

� Making life easier for people

� Better crops

� Funnier looking dogs

Gregor Mendel

11/26/2013

2

Mendel’s Peas

What He Noticed in the Garden

� He noticed that not all pea plants were created equal:� Some were tall, others were small.

� Some had green pods, others had yellow pods.

� Some had wrinkly peas, others had round peas.

� The pea plants ion his garden were all true breeding plants� If they were allowed to self pollinate, they would produce plants

identical to themselves

� Mendel took these pea plants and cross pollinated them with one another

� He thought he would get a mix of each plant

What he found

� With cross pollination, Mendel found that some traits disappeared or were masked by other traits:

� Example:

� Round x wrinkled = round

� Green x yellow = green

Other Findings

� Tall x short

� What he thought: medium size

� What he got: 100% tall

� When he took those tall plants and breed them the results shocked him:

� What he thought: All tall

� What he got: 75% tall and 25% short

P Generation F1 Generation F2 Generation

Tall Short Tall TallTall Tall Tall Short

Section 11-1

Principles of Dominance

Go to Section:

11/26/2013

3

P Generation F1 Generation F2 Generation

Tall Short Tall TallTall Tall Tall Short

Section 11-1

Principles of Dominance

Go to Section:

P Generation F1 Generation F2 Generation

Tall Short Tall TallTall Tall Tall Short

Section 11-1

Principles of Dominance

Go to Section:

Findings

• Tall x short– What he thought: medium size– What he got: 100% tall

• Tall x Tall– What he thought: All tall– What he got: 75% tall and 25% short

• Conclusions of Mendel– First, Mendel concluded traits were passed from one

generation to the next through factors.• These factors are now known as genes.

– Second, Mendel concluded that some traits were dominant over other traits.

Principle of Dominance

• Dominant: The gene that prevents the expression of another gene.

• Recessive: The gene that is not expressed in the presence of a dominant gene.

• Some Examples:– Tall is dominant over short– Dark hair is dominant over light– Brown eyes are dominant over blue– Thin lips are recessive to broad lips– Unable to roll the tongue is recessive to being able to

roll the tongue– Free ear lobes are dominant over attached ear lobes

Seed Shape

Flower Position

Seed Coat

ColorSeed Color

Pod Color

Plant Height

Pod

Shape

Round

Wrinkled

Round

Yellow

Green

Gray

White

Smooth

Constricted

Green

Yellow

Axial

Terminal

Tall

Short

Yellow Gray Smooth Green Axial Tall

Section 11-1

Go to Section:

Vocabulary

• Chromosomes:

– Made of DNA and proteins.

– Carries the genetic information.

11/26/2013

4

Genetics

• Genes:– Sections of DNA (Chemical Factors) that determine a trait:

• ATCCGAGGATAGATCTAGGCAGTTGAC

– Two types of Genes

• Dominant– Will be expressed in the phenotype

– Will be written as a capital letter

• Recessive

– A gene that is masked by a dominant gene

» Will appear only if it is paired with another recessive gene

– Will be written as a lower case letter

– Alleles

• Different forms of a gene

– Hair

» Blond or Brown

– Eye Color

» Brown or Hazel

Vocabulary

• Monohybrid Cross: Punnett square using only one trait• Dihybrid Cross: Punnett square using two traits.• P: the parental generation• F1: the first generation produced by the parents• F2: second generation produced by the F1 generation

Letters are used to represent alleles of different genes

• Capital letters are used for the expression of dominant alleles: A, B, C, D

• Lower case letters are used for the expression of recessive alleles: a, b, c, d

• Alleles are always found in pairs– One comes from dad– One comes from mom

• The dominant allele will always come first.– BB-brown hair– Bb- brown hair– bb- light hair

Combination of Alleles

Homozygous

• Two allele pairs are the same

– Dominant: RR, BB, TT

– Recessive: rr, bb, tt

– Homozygous traits are

also known as pure traits

Heterozygous

• Two allele pairs are different

– One dominant and one

recessive paired together

– Rr, Tt, Bb

– These are also known as

hybrid traits

Genotype vs Phenotype

Genotype

• Allele pairs or genetic make up

– RR, Bb, tt

Phenotype

• Physical expression of the genotype

– Brown hair, blue eyes, thin

lips, cute little button nose

Punnett Square

• Allows scientists to determine what gene

combinations might result from two or more traits from mating organisms.

– Shows the possible gene to be passed on to

the off-spring.

– Shows the possible gene combinations that the off-spring might inherit from parents.

11/26/2013

5

Punnett Square

• A tool used, to determine genetic

crosses

• A way to determine possible combinations of alleles.

• Probability

Review

• How are genes or alleles represented?– With letters of the alphabet

• How are dominant and recessive genes represented?– Dominant genes: Capital Letter– Recessive genes: lower case letters

• How are many genes are there for each trait?– 2

• What does homozygous and heterozygous mean?– Homozygous: genes are the same

• Homozygous dominant: AA, BB, QQ

• Homozygous recessive: aa, bb, qq

– Heterozygous: genes are different• Aa, Bb, Qq

Chance of Having a Baby Girl

11/26/2013

6

Monohybrid Cross

• Single trait cross

• Eye color

• Male with Brown eyes

• Female with Blue eyes

• Brown – B-dominant

• Blue –b- Recessive

• Homozygous Dominant X

Homozygous Recessive

• Heterozygous X Heterozygous

Hobbit feet / Regular feet

• Female hobbit feet X Male regular feet

• hh X HH

• Hh X Hh

Independent Assortment

• We know alleles sort during the production of gametes.• But do alleles sort independently or are traits tied to one

another?– Does it mean that people with two big toes will always have no

thumbs?

• Mendel tested for independent assortment.– Round peas are dominant to wrinkley peas

– Yellow peas are dominant to green peas

– Cross a homozygous dominant yellow round peas with a homozygous recessive green wrinkley peas.

• All genes sort independently:– Genes from mom don’t always split with other mom genes

• Two genes or alleles are involved in a punnet square, called a Dihybrid Cross.

Incomplete Dominance

• Definition: A state where neither of the alleles is dominant nor recessive– Blending of the traits– The heterozygous phenotype is somewhere in-

between the two homozygous phenotype.

• Four O'clock Flowers– Red and White flowers– Red is not dominate over white and white is not

dominate over red– When you cross the two you get pink

• Have to use a prime (‘) letter when doing the crosses

4 O'clock flowers

11/26/2013

7

Snap Dragons Four O’Clock Flowers

Incomplete Dominance

Codominance

• Situation where both alleles contribute to the phenotype of the organism.

• Both alleles are dominant

• Both alleles are expressed in the phenotype

• Most common example is blood type;

• Cattle with both alleles are Roan, a mixture of both red and white hair

• In chickens the allele for black feathers is codominant with the allele for white feathers

– Chickens appear speckled with black feathers and white feathers

Codominance

11/26/2013

8

C0-dominance

Blood Types

• A

– IAIA, IAi

• B

– IBIB, IBi

• AB

– IAIB (codominance)

• O

– ii (no markers)

Blood Types

• AB type is the universal acceptor

– Can get blood from AB, A, B, and O

• O is the universal donner

– Can give to A, B, AB, and AO

– O type can only get from O type

11/26/2013

9

Multiple Alleles

• Two or more alleles or genes that make up

a trait or phenotype

• Example:

– Blood type: Three types

• IA A is dominant

• IB B is dominant

• i O is recessive

– Eye Color

• Blue, Brown, Hazel, Black, etc.

Polygenic Traits

• Traits that are controlled by two or more genes.

• Most traits are produced by the interaction of several different genes– Skin color

– Hair color

– Eye color

– Height

– weight

Two Cross Factor: F2

• Mendel took F1 x F1

• Question that he asked: How would the alleles segregate for the different traits?– Or are traits connected:

• Are all yellow peas wrinkley?

– Do dominant alleles stay together or separate?

• Findings:– 315 seeds were round and yellow– 32 were wrinkled and green– 209 had phenotypes that did not resemble either of

the parents.– What does this mean?

• Genes for different traits can segregate independently during the formation of gametes.

Seed Shape

Flower Position

Seed Coat

ColorSeed Color

Pod Color

Plant Height

Pod

Shape

Round

Wrinkled

Round

Yellow

Green

Gray

White

Smooth

Constricted

Green

Yellow

Axial

Terminal

Tall

Short

Yellow Gray Smooth Green Axial Tall

Section 11-1

Go to Section:

11/26/2013

10

Gene Linkage

• What does it mean?

– If you have blond hair, what color of eyes are you most likely to have?

• Thomas Hunt Morgan

– Realized that some genes were linked together.

– Gene Maps

Gene map of the Fruit fly

Dihybrid Cross• 2 trait cross

• Eye color

• Tongue rolling

• Brown X blue

• Non-tongue roller X Tongue roller

• BBtt X bbTT

• Bbtt X bbTt

Dihybrid Cross

• 2 Traits

– Eye Color

– Hobbit feet

• Hetero Brown x blue

• Homo Normal x hobbit

Meiosis• Production of sex cells or Gametes

– Happens in cells called germ cell• Body cells are referred to as somatic cells (mitosis)

• Happens in all organisms that reproduce sexually– Animals

• Insects

• Humans

– Plants• Flowers

• Trees

• Cell division that results in cells with half the usual number of chromosomes.

• Reduce by division (2 divisions)

• Reduce the number of chromosomes by dividing the cell• Diploid to haploid

Diploid vs Haploid

• Diploid (2n) Contains complete sets of

chromosomes.

• Haploid (n) Contains a half set of

chromosomes.

• Chromosomes are replicated before

meiosis begins.

11/26/2013

11

Males vs Females

• Males

– produce 4 viable sex cells

– Produce sex cells all their lives

• As males get older, the cells become less viable

• Females

– Produce one viable egg

• The other three are called polar bodies

– All the eggs a female will have are produced in their bodies before they are born.

Phases of meiosis

1st division: Homologous ChromosomesProphase IMetaphase IAnaphase ITelophase I

2nd division: Sister ChromatidsProphase IIMetaphase IIAnaphase IITelophase II

Crossing over

11/26/2013

12

11/26/2013

13

Crossing-Over

• Takes place in Prophase I of Meiosis

• Chromosomes exchange portions of their

chromatids during meiosis.

– Happens only to homologous chromosomes

• Chromosome 1 from dad and chromosome 1 from mom

• Produces new combinations of alleles.

• Diversity

11/26/2013

14

Comparing Mitosis & Meiosis

Mitosis: Somatic Cells

• Single cell division

• Results in 2 daughter cells (2n).

• Genetically identical

Meiosis: Sex Cells

• Two divisions

– Meiosis I

– Meiosis II

• Results in 4 haploid cells (n) that are genetically different.

QUIZ• Eye shape

– Round eyes = A

– Almond eyes = a

Left side - Male heterozygous x Female homo. Res.

Right side – Male Homo. Dom. X Female

heterozygous

1. Parents genotype

2. Punnett square

3. Off spring genotype

4. Offspring phenotype