cGMP/ISO-17025-2005 CLIA Experience Unsurpassed Qualitytraditional biochemical and phenotypic...

Polyphasic Microbial Identification & DNA Fingerprinting

Microbial Contamination Tracking & Trending

Experience Unsurpassed Quality

Cert. No. 2254.01

cGMP/ISO-17025-2005

CLIA

Microbial Identification and DNA

Fingerprinting of Microorganisms

Recovered as Potential Sterility Test

Positives

Jaspreet Sidhu, Ph.D.

Molecular Epidemiology, Inc

MEI ©2010

OverviewOverview

�� Regulatory, Guidance and Economic Issues Regulatory, Guidance and Economic Issues

�� Microbial Identification in the Pharmaceutical IndustryMicrobial Identification in the Pharmaceutical Industry

�� Methodologies and Tools for Microbial IdentificationMethodologies and Tools for Microbial Identification

�� Case Studies linking Microbial ID, DNA Fingerprinting Case Studies linking Microbial ID, DNA Fingerprinting

to demonstrate specific needs for to demonstrate specific needs for PolyphasicPolyphasic

Approach to Microbial IdentificationApproach to Microbial Identification

�� Root Cause Investigation AnalysisRoot Cause Investigation Analysis

MEI ©2010

Microbial ID in the Microbial ID in the

Pharmaceutical IndustryPharmaceutical Industry

�� The identification of microbes recovered from The identification of microbes recovered from

the pharmaceutical (manufacturing) environment the pharmaceutical (manufacturing) environment

is of critical concernis of critical concern

�� Regulatory requirementRegulatory requirement

�� Process requirementProcess requirement

�� Implications for product safety and efficacyImplications for product safety and efficacy

MEI ©2010

Concerns regarding Concerns regarding

MisMis--identified Microbeidentified Microbe

�� Product RecallProduct Recall

�� Economic LossEconomic Loss

�� Regulatory IssuesRegulatory Issues

�� Patient SafetyPatient Safety

�� Public RelationsPublic Relations

MEI ©2010

Microbial Identification and DNA Microbial Identification and DNA

Fingerprinting: Fingerprinting:

The Regulatory PerspectiveThe Regulatory Perspective

MEI ©2010

“At minimum the program should require genus

(or, where appropriate, species) identification of

microorganisms in ancillary environments at frequent

intervals to establish a valid, current database of

contaminants present in the facility during processing

(and to demonstrate that cleaning and sanitization

procedures continue to be effective)”

FDA Guidance for Industry -September 2004

Sterile Drug Products Produced by Aseptic Processing

Current Good Manufacturing Practice

MEI ©2010

Recent Ph. Eur. RecommendationsRecent Ph. Eur. Recommendations

““While routine microbiological/biochemical identification While routine microbiological/biochemical identification

techniques can demonstrate that 2 isolates are not identical, techniques can demonstrate that 2 isolates are not identical,

these methods may not be sufficiently sensitive or reliable these methods may not be sufficiently sensitive or reliable

enough to provide unequivocal evidence that 2 isolates are enough to provide unequivocal evidence that 2 isolates are

from the same source. More sensitive tests, for example from the same source. More sensitive tests, for example

molecular typing with RNA/DNA homology, may be necessary molecular typing with RNA/DNA homology, may be necessary

to determine that microto determine that micro--organisms are clonally related and organisms are clonally related and

have a common originhave a common origin”” Ph Eur. 6.3 5.1.9 Guidelines for using Ph Eur. 6.3 5.1.9 Guidelines for using

the test for sterilitythe test for sterility

MEI ©2010

Microbial Identification and DNA Microbial Identification and DNA

Fingerprinting: Fingerprinting:

Pharmaceutical PerspectivePharmaceutical Perspective

MEI ©2010

Pharmaceutical Companies require Pharmaceutical Companies require

their own policy on level of their own policy on level of

identification requiredidentification required

MEI ©2010

Level of Microbial Characterization and IDLevel of Microbial Characterization and ID

�� Gram Stain and cell morphology:Gram Stain and cell morphology: EM in ISO 7/8, EM in ISO 7/8,

excipient derived excipient derived isolatetsisolatets, finished product, below alert , finished product, below alert

level EMlevel EM

�� ID to Genus:ID to Genus: EM in ISO 5/6 with number below alert EM in ISO 5/6 with number below alert

levellevel

�� ID to Species:ID to Species: EM in ISO 5 areas; alert and/or action EM in ISO 5 areas; alert and/or action

level isolates from all excipient, finished product, EM and level isolates from all excipient, finished product, EM and

water monitoringwater monitoring

�� Strain Typing:Strain Typing: Significant product failures, e.g. media fill, Significant product failures, e.g. media fill,

sterility teststerility test and microbial limit test. Significant adverse and microbial limit test. Significant adverse

trends in EM and water monitoringtrends in EM and water monitoring

MEI ©2010

Categories of Microbiology Categories of Microbiology

ID Test SystemsID Test Systems

�� GrowthGrowth--basedbased

�� ViabilityViability--basedbased

�� Artifact or components basedArtifact or components based--e.ge.g. Fatty Acid . Fatty Acid

and MALDI TOF MS Micro IDand MALDI TOF MS Micro ID

�� Nucleic acid MethodsNucleic acid Methods

MEI ©2010

Categories of Microbiology ID Systems: Categories of Microbiology ID Systems:

Industry StandardsIndustry Standards

�� API and API and VitekVitek 1/21/2

�� BioLogBioLog

�� MIDIMIDI--FAMEFAME

�� MicroSeqMicroSeq

MEI ©2010

Comparison of Phenotypic Comparison of Phenotypic

and Genotypicand Genotypic

�� GenotypicGenotypic

�� DNA sequence basedDNA sequence based

�� StableStable

�� Found in all organismsFound in all organisms

�� Independent of Independent of

environmental factorsenvironmental factors

�� Independent of protein Independent of protein

expressionexpression

�� PhenotypicPhenotypic

�� Protein/enzyme basedProtein/enzyme based

�� Expression variabilityExpression variability

�� Absent in some Absent in some

organismsorganisms

�� Environment and Environment and

growth dependentgrowth dependent

�� Lack of functional Lack of functional

expressionexpression*Footnote-case studies

MEI ©2010

How far has microbial ID evolvedHow far has microbial ID evolved……..

�� Classification of bacteria based on:Classification of bacteria based on:

•• Cellular morphologyCellular morphology

•• Staining reactions (Gram, spore etc. )Staining reactions (Gram, spore etc. )

•• Physiological requirements e.g. oxygen, pH, salt Physiological requirements e.g. oxygen, pH, salt

tolerance etc.tolerance etc.

•• Biochemical (substrate utilization, metabolic Biochemical (substrate utilization, metabolic

profiles)profiles)

�� BergeyBergey’’ss Manual of Determinative Bacteriology Ed. 9Manual of Determinative Bacteriology Ed. 9 --

now an in depth phylogenetic understanding of bacterial now an in depth phylogenetic understanding of bacterial

taxonomy: taxonomy: BergeyBergey’’ss Manual of Systematic Bacteriology, Manual of Systematic Bacteriology,

Ed. 2Ed. 2

MEI ©2010

Microbial Taxonomy: Microbial Taxonomy:

New names for old bacteriaNew names for old bacteria

�� What was once a Pseudomonas is now:What was once a Pseudomonas is now:

•• RalstoniaRalstonia pickettiipickettii

•• BurkholderiaBurkholderia cepaciacepacia

•• StenotrophomonasStenotrophomonas maltophiliamaltophilia

•• NitromonasNitromonas

•• ComomonasComomonas

�� Genus Bacillus has been reGenus Bacillus has been re--classified into 7classified into 7--9 new 9 new

GeneraGenera

Adapted from Dr. Adapted from Dr. GuilfoyleGuilfoyle--FDA, PDA/FDA Sep 2005FDA, PDA/FDA Sep 2005

Database, database, databaseDatabase, database, database……....

MEI ©2010

Genotypic IDGenotypic ID--BenefitsBenefits

�� ““Genotypic methods have been shown to be more accurate and Genotypic methods have been shown to be more accurate and precise than traditional biochemical and phenotypic techniques. precise than traditional biochemical and phenotypic techniques. These methods are especially valuable for investigations into These methods are especially valuable for investigations into failures (e.g., failures (e.g., sterility test; media fill contaminationsterility test; media fill contamination). ). However, appropriate biochemical and phenotypic methods However, appropriate biochemical and phenotypic methods can be used for routine identification of isolatescan be used for routine identification of isolates””

FDA Guidance for Industry FDA Guidance for Industry -- September 2004September 2004

Sterile Drug Products Produced by Aseptic ProcessingSterile Drug Products Produced by Aseptic Processing

Current Good Manufacturing PracticeCurrent Good Manufacturing Practice

This reflects general acceptance that changes in Microbial This reflects general acceptance that changes in Microbial Taxonomy have been made as a result of advances in Taxonomy have been made as a result of advances in PhylogeneticsPhylogenetics and therefore genetic speciation is now considered and therefore genetic speciation is now considered the the ““Gold StandardGold Standard””

MEI ©2010




level EMlevel EM

�� ID to Genus:ID to Genus: EM in ISO 5/6 with number below alert EM in ISO 5/6 with number below alert

levellevel





sterility test and microbial limit test. Significant adverse sterility test and microbial limit test. Significant adverse


MEI ©2010

To Identify or not and at what To Identify or not and at what

level?level?

�� Identify using purely phenotypic methodologyIdentify using purely phenotypic methodology

�� Identify all isolates per genotypic methodology Identify all isolates per genotypic methodology

�� Identify some isolates using both phenotypic and Identify some isolates using both phenotypic and

genotypicgenotypic--””polyphasicpolyphasic”” approachapproach

�� Identify all isolates and DNA fingerprint to determine Identify all isolates and DNA fingerprint to determine

commonality or source of contamination since the commonality or source of contamination since the

guidance recommendation is to do precisely thisguidance recommendation is to do precisely this

MEI ©2010

Genotypic MethodsGenotypic Methods

�� DNA SequencingDNA Sequencing--ID (16S/23S/28S highly conserved ID (16S/23S/28S highly conserved

across organisms but also divergent amongst species)across organisms but also divergent amongst species)

�� Pulsed Field Gel Electrophoresis of whole chromosomal Pulsed Field Gel Electrophoresis of whole chromosomal

DNADNA

�� Southern blotting and Restriction Fragment Length Southern blotting and Restriction Fragment Length

Polymorphism (RFLP)Polymorphism (RFLP)

�� PCRPCR--based locusbased locus--specific RFLPspecific RFLP

�� Random Amplified Polymorphic DNARandom Amplified Polymorphic DNA

�� RepRep--PCRPCR

�� Amplified Fragment Length PolymorphismAmplified Fragment Length Polymorphism

MEI ©2010

““Level of Level of PolyphasicPolyphasic IDID””

�� Genetic ID aloneGenetic ID alone

�� Genetic ID plus minimal PhenotypicGenetic ID plus minimal Phenotypic

�� SpecializedSpecialized--Genetic ID plus customized PhenotypicGenetic ID plus customized Phenotypic

�� Professional/Expert IDProfessional/Expert ID

�� Taxonomic Assignment/ReassignmentTaxonomic Assignment/Reassignment--extensive extensive

research basedresearch based

MEI ©2010

“So we know the ID”

“Now What?”

MEI ©2010

““Microbial Contaminant MappingMicrobial Contaminant Mapping””

�� Goal is to link effective Microbial Identification with Goal is to link effective Microbial Identification with

Microbial Tracking and Trending Microbial Tracking and Trending

�� Complete picture of potential contamination sources by Complete picture of potential contamination sources by

matching genetic fingerprints to process flow throughout matching genetic fingerprints to process flow throughout

production (area, operators, raw materials, supply chain production (area, operators, raw materials, supply chain

and inventory), packaging and postand inventory), packaging and post--marketmarket

�� Using a Using a ““risk based approachrisk based approach”” to problem solving before to problem solving before

problem escalates and production is impacted or worse problem escalates and production is impacted or worse

still, actual finished product is discardedstill, actual finished product is discarded

MEI ©2010

Genetic Genetic SubtypingSubtyping

�� Unique marker(s) to differentiate similar Unique marker(s) to differentiate similar

isolates or group the same clones togetherisolates or group the same clones together

�� Biotype or Biotype or BiogroupBiogroup: biochemical or : biochemical or

physiological profilesphysiological profiles

�� Serology: somatic & Serology: somatic & flagellarflagellar

�� Toxin production: sub groupingsToxin production: sub groupings

�� Genetic Genetic ““fingerprintfingerprint””:: ribotypingribotyping, PFGE, , PFGE,

Southern BlotSouthern Blot

MEI ©2010

Concepts of Microbial Source Tracking/ Concepts of Microbial Source Tracking/

Forensic Epidemiology?Forensic Epidemiology?

�� Tracing or Tracking unique clones to demonstrate linkage: TypinTracing or Tracking unique clones to demonstrate linkage: Typing g or Subtypingor Subtyping

�� Demonstrate physical linkage to environmental site or sourceDemonstrate physical linkage to environmental site or source

�� Demonstrate temporal linkage Demonstrate temporal linkage

�� Demonstrate lack of associationDemonstrate lack of association

MEI ©2010

Addressing Addressing PolyphasicPolyphasic ApproachApproach

�� Using a Using a PolyphasicPolyphasic approach that combines Phenotypic approach that combines Phenotypic

and Genetic ID (and Genetic ID (rRNArRNA Gene Sequence) together with Gene Sequence) together with

DNA Fingerprinting (Genetic Subtyping)DNA Fingerprinting (Genetic Subtyping)

�� Reduce the burden of Reduce the burden of mismis--Identification as well as Identification as well as

incomplete IDincomplete ID

�� Complete the analysis of finding source of potential Complete the analysis of finding source of potential

contaminationcontamination

MEI ©2010

Aerobic/Anaerobic

Pure Isolate

Gram Stain

MEI ©2010

Phenotypic Testing DNA Sequencing

Basic Biochemical Test

Gram Stain

Spore

Motility

Antibiotics

Lysis

PCR

PCR sequencing

Electropherogram

Pure Isolate

(biochemical taxonomic ID)

MEI ©2010

Salmonella typhimurium

(Electropherogram)

MEI ©2010

EM Sample

(Mixed Electropherogram)

MEI ©2010

Phenotypic Corroboration

Polyphasic Identification

ID confirmation

Data analysis

Database match

ID (assignment)

MEI ©2010

The Requirement for Polyphasic Microbial

Identification and Strain Characterization of

Escherichia coli (E. coli) ATCC® 8739™

MEI ©2010

MEI ©2010

Escherichia coli (E. coli) ATCC® 8739™

GGCTTTTCTGCGGGTACGTCATGAGCAAAGGTATAACTTTACTCCCTTCC

TCCCCGCTGAAAGTACTTTACAACCCGAAGGCCTTCTTCATACACGCGGC

ATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCT

CCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGGTCATCCTC

TCAGACCAGCTAGGGATCGTCGCCTAGGTGAGCCGTTACCCCACCTACTA

GCTAATCCCATCTGGGCACATCCGATGGCAAGAGGCCCGAAGGTCCCCCT

CTTTGGTCTTGCGACGTTATGCGGTATTAGCTACCGTTTCCAGTAGTTAT

CCCCCTCCATCAGGCAGTTTCCCAGACATTACTCACCCGTCCGCCACTCG

TCAGCAAAGAAGCAAGCTGCTTCCTGTTACCGTTCGACTTGCATGTGTTA

GGCCTGCCGCCAGCGTTCAATCTGAGCAGGATCAAAACTCAAA

MEI ©2010

16S rRNA Sequence: Escherichia coli (E. coli) ATCC® 8739™

MEI ©2010

16S based ID is only possible to Family Level

MEI ©2010

Genetic Similarity Comparison of select Enterobacteriaceae

Potential brand new organism as member of family

MEI ©2008

Polyphasic ID for MEI 35065 ATCC® 8739™ Source:

ATCC

MEI ©2010

DNA sequencing alone is very insufficient- Vitek based supplemental

Analysis supports species level ID

MEI ©2010

DNA sequencing alone is very insufficient- Vitek based supplemental

Analysis supports species level ID

MEI ©2010

DNA sequencing alone is very insufficient

B. cereusB. cereus

MEI ©2010

B. Cereus Plate

MEI ©2010

Polyphasic approach is critical to provide differentiation

between very closely related species of B. cereus group

MEI ©2010

MEI ©2010

DNA sequencing alone is very insufficient- supplemental

Mycology analysis supports species level ID

MEI ©2008


Mycology analysis supports species level ID

Limitations of Commercial Databases-

Differences between phenotypic and genotypic

MEI ©2010

Why Microbiological expertise is essential

MEI ©2010

This isolate presented as suspect Bordetella sp. via Vitek

MEI ©2010

Why Microbiological expertise is essential

MEI ©2010

Why Microbiological expertise is essential- the following

Case study shows that even when a phenotypic and

genotypic system match up, microbiological expertise is

still necessary to differentiate between closely related species

and avoid pathogen misidentification (genotypic alone presents

an issue here)

MEI ©2010

MEI ©2010


phenotypic analysis still needed to support species level ID

Dendrogram analysis demonstrates the phylogenetic

similarity and dissimilarity associated with these

closely related organisms

MEI ©2010

This isolate presented as suspect Burkholderia pseudomallei

via API and Vitek; in fact a Genus Novus

MEI ©2010

“So we know the ID”

“Now What?”

MEI ©2010

Concepts of Microbial Source Tracking/ Concepts of Microbial Source Tracking/

Forensic Epidemiology?Forensic Epidemiology?

�� Tracing or Tracking unique clones to demonstrate linkage: TypinTracing or Tracking unique clones to demonstrate linkage: Typing g or Subtypingor Subtyping

�� Demonstrate physical linkage to environmental site or sourceDemonstrate physical linkage to environmental site or source

�� Demonstrate temporal linkage Demonstrate temporal linkage

�� Demonstrate lack of associationDemonstrate lack of association

MEI ©2010

Optimization of analysis forOptimization of analysis for

Gram Pos organism withGram Pos organism with

five distinct restriction five distinct restriction endonucleasesendonucleases

MEI ©2010


�� Gram Stain and cell morphology:Gram Stain and cell morphology: EM in ISO 7/8, excipient derived EM in ISO 7/8, excipient derived isolatetsisolatets, finished product, below alert level EM, finished product, below alert level EM

�� ID to Genus:ID to Genus: EM in ISO 5/6 with number below alert levelEM in ISO 5/6 with number below alert level

�� ID to Species:ID to Species: EM in ISO 5 areas; alert and/or action level isolates from all EM in ISO 5 areas; alert and/or action level isolates from all excipient, finished product, EM and water monitoringexcipient, finished product, EM and water monitoring




Remember!!Remember!!�� ““Genotypic methods have been shown to be more accurate and precisGenotypic methods have been shown to be more accurate and precise than e than

traditional biochemical and phenotypic techniques. These methodtraditional biochemical and phenotypic techniques. These methods are especially s are especially valuable for investigations into failures (e.g., valuable for investigations into failures (e.g., sterility test; media fill sterility test; media fill contaminationcontamination). ). However, appropriate biochemical and phenotypic methods However, appropriate biochemical and phenotypic methods can be used for routine identification of isolatescan be used for routine identification of isolates””

FDA Guidance for Industry FDA Guidance for Industry -- September 2004September 2004

Sterile Drug Products Produced by Aseptic ProcessingSterile Drug Products Produced by Aseptic Processing

Current Good Manufacturing PracticeCurrent Good Manufacturing Practice

MEI ©2010

Sterility Failure Investigation-

contaminant recovered during testing

Smoking gun

Smoking gun

Positive

Positive

EM from

Manufacturer

EM from

Manufacturer

MEI ©2010

A

B

C

D

F

E

G

H

Bacillus Cereus

Bacillus Cereus

Bacillus Cereus

Bacillus Cereus

Bacillus Cereus

Bacillus Cereus

Bacillus Cereus

Bacillus Cereus

Post-Sanitization

MEI ©2010


�� Gram Stain and cell morphology:Gram Stain and cell morphology: EM in ISO 7/8, EM in ISO 7/8, excipient derived excipient derived isolatetsisolatets, finished product, below alert , finished product, below alert level EMlevel EM

�� ID to Genus:ID to Genus: EM in ISO 5/6 with number below alert levelEM in ISO 5/6 with number below alert level

�� ID to Species:ID to Species: EM in ISO 5 areas; alert EM in ISO 5 areas; alert and/or action level isolates from all and/or action level isolates from all excipient, finished product, EM and water excipient, finished product, EM and water monitoringmonitoring

�� Strain Typing:Strain Typing: Significant product failures, e.g. media fill, Significant product failures, e.g. media fill, sterility test and microbial limit test. Significant adverse sterility test and microbial limit test. Significant adverse trends in EM and water monitoringtrends in EM and water monitoring

MEI ©2010

Genetic ID put this unequivocally as a potential “Thermophile”-

More thorough evaluation demonstrates the anomaly is due to

exclusive reliance on monophasic DNA sequence analysis alone

MEI ©2010

Microbial ID Report

MEI# 27519

EM Isolate was DOA and as such yielded

False positive Gram Stain- DNA based ID

MEI ©2010

Comparison of typical EM strains

vs Suspect thermophiles: Source was not sterilization

or manufacturing related

MEI ©2010




level EMlevel EM�� ID to Genus:ID to Genus: EM in ISO 5/6 with number below alert levelEM in ISO 5/6 with number below alert level







MEI ©2010

ConclusionsConclusions

�� PolyphasicPolyphasic ID:ID: Case for due diligence in Case for due diligence in

ascribing the correct ID. DNA sequencing ascribing the correct ID. DNA sequencing

coupled with a myriad of phenotypic analysiscoupled with a myriad of phenotypic analysis--

automation is very usefulautomation is very useful

�� DNA Fingerprinting:DNA Fingerprinting: Determining source of Determining source of

potential sterility positive. Allows for root cause potential sterility positive. Allows for root cause

analysis of peripheral processes e.g. media analysis of peripheral processes e.g. media

prep; sterilization (prep; sterilization (BIsBIs), personnel; other ), personnel; other

materials as well as EM/PM from manufacturing, materials as well as EM/PM from manufacturing,

fill, and finally the actual sterility testfill, and finally the actual sterility test

MEI ©2010

cGMP/ISO-17025-2005 CLIA Experience Unsurpassed Qualitytraditional biochemical and phenotypic...

Documents

Transcript of cGMP/ISO-17025-2005 CLIA Experience Unsurpassed Qualitytraditional biochemical and phenotypic...