CD4 CD25 Foxp3 T-Regulatory Cells Produce both Gamma ... · generated in acute murine spotted fever...

INFECTION AND IMMUNITY, Sept. 2009, p. 3838–3849 Vol. 77, No. 90019-9567/09/$08.00�0 doi:10.1128/IAI.00349-09Copyright © 2009, American Society for Microbiology. All Rights Reserved.

CD4� CD25� Foxp3� T-Regulatory Cells Produce both GammaInterferon and Interleukin-10 during Acute Severe Murine

Spotted Fever Rickettsiosis�†Rong Fang,1 Nahed Ismail,1,3 Thomas Shelite,1 and David H. Walker1,2*

Department of Pathology, University of Texas Medical Branch, Galveston, Texas1; Center for Biodefense andEmerging Infectious Diseases, 301 University Blvd., Galveston, Texas 77555-06092; and Department of

Pathology, Meharry Medical College, 1005 Dr. D. B. Todd Jr. Blvd., Nashville, Tennessee 372083

Received 26 March 2009/Returned for modification 25 April 2009/Accepted 18 June 2009

Spotted fever group rickettsiae cause life-threatening human infections worldwide. Until now, the immuneregulatory mechanisms involved in fatal rickettsial infection have been unknown. C3H/HeN mice infected with3 � 105 PFU of Rickettsia conorii developed an acute progressive disease, and all mice succumbed to thisinfection. A sublethal infection induced protective immunity, and mice survived. Compared to splenic T cellsfrom sublethally infected mice, splenic T cells from lethally infected mice produced significantly lower levelsof interleukin-2 (IL-2) and gamma interferon (IFN-�) and a higher level of IL-10, but not of IL-4 ortransforming growth factor �, and there was markedly suppressed CD4� T-cell proliferation in response toantigen-specific stimulation with R. conorii. Furthermore, lethal infection induced significant expansion ofCD4� CD25� Foxp3� T cells in infected organs compared to the levels in naïve and sublethally infected mice.In a lethal infection, splenic CD4� CD25� Foxp3� T cells, which were CTLA-4high T-bet� and secreted bothIFN-� and IL-10, suppressed the proliferation of and IL-2 production by splenic CD4� CD25� Foxp3� T cellsin vitro. Interestingly, depletion of CD25� T cells in vivo did not change the disease progression, but itincreased the bacterial load in the lung and liver, significantly reduced the number of IFN-�-producing Th1cells in the spleen, and increased the serum levels of IFN-�. These results suggested that CD4� CD25� T cellsgenerated in acute murine spotted fever rickettsiosis are Th1-cell-related adaptive T-regulatory cells, whichsubstantially contribute to suppressing the systemic immune response, possibly by a mechanism involvingIL-10 and/or cytotoxic T-lymphocyte antigen 4.

Rickettsiae are gram-negative, obligately intracellular, ar-thropod-transmitted bacteria. Patients with severe, life-threat-ening human rickettsial infections, such as Rocky Mountainspotted fever and Mediterranean spotted fever, often presentwith fever, severe headache, malaise, myalgia, nausea, vomit-ing, and abdominal pain (45). Approximately 5% of infectedpersons succumb to the disease, while other people developpermanent sequelae, including amputation, neurological defi-cits, or permanent learning impairment, despite the availabilityof effective treatment (8). Although endothelial cells are themain target cells, rickettsiae can infect other cell types, such asmacrophages and dendritic cells (DCs) (10, 14).

Infection of C3H/HeN (C3H) mice with Rickettsia conorii,the agent of Mediterranean spotted fever, closely mimics life-threatening human rickettsioses; it produces similar dissemi-nated vascular injury and has dose-dependent outcomes (47).Depletion and adoptive transfer experiments have indicatedthat CD8� T cells mediate their effector function against rick-ettsiae through both gamma interferon (IFN-�) productionand cytotoxic killing of infected target cells (11, 13, 46). IFN-�is an essential defense against infection with rickettsiae, and

mice that lack this cytokine develop an overwhelming infectionand succumb to an ordinarily sublethal dose of rickettsiae (12,46). Recently, we have shown that rickettsia-infected bonemarrow-derived DCs promote the expansion of Foxp3� CD4�

T-regulatory (T-reg) cells in vitro. Expansion of T-reg cells incocultures of naïve T cells with bone marrow-derived DCs wasassociated with a suppressed Rickettsia-dependent Th1 re-sponse. Since IFN-� mediates protection against Rickettsia,these findings suggest that generation of T-reg cells might be apotential mechanism contributing to host susceptibility to se-vere spotted fever group rickettsiosis (10). However, whether asuppressed immune response is generated in severe rickettsialinfection in vivo remains unclear. Furthermore, the type ofCD4� T-cell response in lethal infections with R. conorii in vivoalso remains unclear.

Previous studies have shown that infections with variouspathogens induce development of immunosuppression, whichis usually associated with progressive and severe disease. Forexample, infection with pathogens such as Trypanosoma cruzi(40, 41), dengue virus (23), Friend murine leukemia virus (48),Mycobacterium tuberculosis (22), and Helicobacter pylori (25)give rise to immunosuppression mediated by either anergic Tcells or T-reg cells. T-reg cells have a crucial role in the controlof immune responses to both self-antigen and foreign infec-tious pathogens (27, 33) which cause acute (16, 23) and chronicinfections (3, 5, 25). In healthy humans and naïve mice, T-regcells coexpress CD25 (interleukin-2R� [IL-2R�]) antigen andrepresent 5 to 10% of the CD4� T cells (36); however, CD25

* Corresponding author. Mailing address: Department of Pathology,Center for Biodefense and Emerging Infectious Diseases, 301 Univer-sity Blvd., Galveston, TX 77555-0609. Phone: (409) 772-3989. Fax:(409) 772-1850. E-mail: [email protected].

† Supplemental material for this article may be found at http://iai.asm.org/.

� Published ahead of print on 29 June 2009.

3838

on October 31, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

is not a unique marker for T-reg cells and is also expressed onactivated effector T cells (29). Based on their origins, two typesof CD4� T-reg cells have been described: naturally occurringT-reg cells and inducible T-reg cells (32, 37). The unique tran-scription factor Foxp3 is the most specific marker of naturalT-reg cells identified so far and is required for generation ofthese cells (15). Another immune regulatory mechanism thatinfluences effector T-cell responses is mediated by cytotoxic Tlymphocyte antigen 4 (CTLA-4). Although the requirementfor CTLA-4 in regulatory cell function is still controversial,there is a strong correlation between CTLA-4 expression andthe suppressive function of CD4� CD25� T-reg cells (4, 34, 49).

The goals of this study were to determine whether immuno-suppression occurs in severe murine rickettsial infection in vivoand to further identify the regulatory immune mechanismsinvolved in this acute severe intracellular bacterial infection.This study shed substantial light on the importance of regula-tory immune mechanisms in the pathogenesis of fatal spottedfever rickettsiosis.

MATERIALS AND METHODS

R. conorii and animal infections. R. conorii (Malish 7 strain) was obtained fromthe American Type Culture Collection (ATCC VR 613). For animal inoculation,rickettsiae were cultivated in specific-pathogen-free embryonated chicken eggs.After homogenization, rickettsiae were diluted to obtain a 10% suspension insucrose-phosphate-glutamate (SPG) buffer (0.218 M sucrose, 3.8 mM KH2PO4,7.2 mM K2HPO4, 4.9 mM monosodium glutamic acid; pH 7.0). For cell stimu-lation, rickettsiae were propagated in Vero cells and purified by Renografindensity gradient centrifugation, as described previously (18). Purified viablerickettsiae were suspended in SPG buffer. The concentration of rickettsiae fromeither a yolk sac or cell culture was determined by a plaque assay and quantita-tive real-time PCR as described below (13). The rickettsial stock was stored at�80°C until it was used.

Wild-type C3H mice were purchased from Harlan Laboratories (Indianapolis,IN) and used when they were 6 to 9 weeks old. Mice were housed in a biosafetylevel 3 facility at the University of Texas Medical Branch, Galveston. All exper-iments and procedures were approved by the University of Texas MedicalBranch Animal Care and Use Committee, and mice were used according to theguidelines in the Guide for the Care and Use of Laboratory Animals (28a). C3Hmice were infected intravenously as described previously using a lethal dose of3 � 105 PFU (3 50% lethal doses) or a sublethal dose of 3 � 104 PFU (0.3 50%lethal doses) of R. conorii (13).

Negative control mice were inoculated with 100 �l of SPG buffer alone. Micewere monitored daily for signs of illness.

In vivo depletion of CD4� CD25� T-reg cells. For in vivo depletion of CD4�

CD25� cells, mice were inoculated with purified rat anti-mouse CD25 monoclo-nal antibody (MAb) PC61 (1 mg in 500 �l phosphate-buffered saline; BioXcell,West Lebanon, NH) intraperitoneally 3 days prior to infection with a lethal doseof R. conorii. The efficacy of CD25 depletion was measured by flow cytometry.

Flow cytometry. Flow cytometry was performed to characterize the lymphocytesubpopulations during the infection. Cells were suspended in FACS buffer (phos-phate-buffered saline containing 0.1% bovine serum albumin and 0.01% NaN3).Fc receptors were blocked with anti-CD16/32 (clone 2.4G2). The followingconjugated antibodies (Abs) were purchased from BD Bioscience (San Diego,CA), unless indicated otherwise: fluorescein isothiocyanate (FITC)- or peridinin-chlorophyll-protein (PercP)-Cy5-labeled anti-CD3 (clone 145-2C11), allophyco-cyanin (APC)- or APC-Cy7-labeled anti-CD4 (clone RM4-5), PercP-Cy5- orAPC-labeled anti-CD25 (clone PC 61), phycoerythrin (PE)-labeled anti-IFN-�(clone XMG1.2), PE-labeled anti-IL-4 (clone 11B11), FITC-labeled anti-IL-10(clone JES5-16E3), PE-labeled anti-CTLA-4 (clone UC10-4F10-11), FITC-la-beled anti-CD 103 (clone M290), and APC-labeled anti-IL-2 (clone JES6-5H4).The isotype control Abs included FITC-, PE-, PercP-Cy5.5-, and APC-conju-gated hamster immunoglobulin G1 (IgG1) (clone A19-3), rat IgG1 (clone R3-34), rat IgG2a (clone R35-95), mouse IgG1 (clone X40), and rat IgG2b (cloneA95-1). For intracellular cytokine staining, cells were incubated at 37°C for 6 hin complete medium in the presence of Golgi plug or Golgi stop (BD Bioscience)according to the manufacturer’s recommendations. Staining with an anti-Foxp3PE-conjugated Ab (FJK-16S) or an anti-T-bet Alexa Fluor 647-conjugated Ab

(eBio 4B10) was performed according to the manufacturer’s protocol (eBio-science). Stained cells were analyzed using the FACSCalibur or FACSCantosystem (Becton-Dickinson, BD Biosciences). For characterization of lympho-cytes, at least 20,000 events were collected. Data were analyzed with FlowJosoftware (TreeStar, San Carlos, CA).

Cell preparation, purification, and culture conditions. Spleens were removedfrom mice infected with R. conorii on day 6 postinfection. Splenic CD4� CD25�

cells were purified as described previously (21). Briefly, CD4� T cells werepurified by positive selection using anti-CD4 MAb L3T4-coated Dynal beads(Dynal & Invitrogen, Carlsbad, CA) according to the manufacturer’s instruc-tions. Purified cell preparations usually contained �90% CD4� T cells. Tofurther separate CD4� T cells into CD25� and CD25� populations, CD4� Tcells were incubated with biotin-conjugated anti-CD25 MAb 7D4 (BD Bio-sciences) for 30 min at 4°C. After washing, cells were incubated with streptavidin-coated microbeads (Miltenyi Biotec) for 30 min at 4°C. Magnetic separation wasperformed using a MACS separation column according to the manufacturer’sprotocol. The flowthrough was collected and used as CD4� CD25� T cells. Theretained cells were eluted from the column as purified CD4� CD25� T cells. Thelevels of purity of CD4� CD25� and CD4� CD25� T-cell preparations deter-mined by FACS analysis (FACSCalibur; BD Labware) were routinely �90% and92%, respectively. Purified splenic CD4� CD25� cells (5 � 104 cells) werecocultured with 5 � 105 irradiated naïve syngeneic splenocytes in the absence ofsplenic CD4� CD25� cells or in the presence of increasing numbers of splenicCD4� CD25� cells for 3 days in 96-well, round-bottom plates. Anti-CD3 (0.25�g/ml) or rickettsial antigen (multiplicity of infection [MOI], 5) was added to theculture for stimulation. Supernatants were collected from the culture of CD4�

CD25� and/or CD4� CD25� cells at 24 h (for IL-2) or 72 h (for other cytokines).Proliferation assay. Single-cell suspensions of the spleen or purified CD4�

T-cell subset (CD4� CD25�) were labeled with the tracking fluorochrome car-boxyfluorescein diacetate succinimidyl ester (CFSE) (Molecular Probes, Eugene,OR) as described previously (38). Cells were suspended in culture medium at aconcentration of 4 � 105 cells/well and stimulated with anti-CD3 (0.5 �g/ml), R.conorii (MOI, 5), or anti-CD3 (0.5 �g/ml) plus IL-2 (10 ng/ml) in the presenceof irradiated naïve splenocytes. At 60 h after stimulation, cells were harvested,washed with FACS buffer (Dulbecco’s phosphate-buffered saline without mag-nesium chloride or calcium chloride [Gibco, Burlington, VT] containing 1%heat-inactivated fetal bovine serum and 0.09% [w/v] sodium azide), and labeledwith Abs. CFSE dilution upon T-cell proliferation was measured by flow cyto-metric analysis.

In vitro splenocyte culture and cytokine ELISA. Infected mice were sacrificedon day 5 or 6 postinfection, and spleens and sera were collected. Splenocytes orpurified T-cell subsets were cultured in 96-well round-bottom plates containing8 � 105 cells/well. Cells were stimulated with R. conorii, concanavalin A (ConA)(3 �g/ml), anti-CD3, and anti-CD28 as indicated below in the presence ofirradiated naïve syngeneic splenocytes. After 24 h (for IL-2) or 72 h (for IFN-�,IL-10, and transforming growth factor � [TGF-�]), supernatants were collected.Cytokine concentrations in the culture supernatant or serum were measured byusing Quantikine enzyme-linked immunosorbent assay (ELISA) kits (R&D Sys-tems, Minneapolis, MN). The limits of detection of the ELISA for cytokinemeasurements were as follows: IL-2, 3 pg/ml; IFN-�, 20 pg/ml; IL-10, 4 pg/ml;and TGF-�, 4.6 pg/ml.

Real-time PCR quantification of rickettsial loads. To determine the rickettsialloads in infected organs, approximately 10-mg portions of liver and lung tissueswere collected on day 5 postinfection and homogenized. DNA was extractedusing a DNeasy tissue kit (Qiagen, Valencia, CA), and rickettsial burdens weredetermined using an iCycler IQ from Bio-Rad (Hercules, CA). The followingprimers (Sigma-Genosys, St. Louis, MO) and probes (Biosearch Technologies,Novato, CA) targeting R. conorii and mouse glyceraldehyde-3-phosphate dehy-drogenase (gapdh) genes were used as described previously (43): ompB forwardprimer ACACATGCTGCCGAGTTACG, ompB reverse primer AATTGTAGCACTACCGTCTAAGGT, ompB probe CGGCTGCAAGAGCACCGCCAACAA (5 6-carboxyfluorescein and 3 Black Hole Quencher 1TM), gapdh for-ward primer CAACTACATGGTCTACATGTTC, gapdh reverse primer CTCGCTCCTGGAAGATG, and gapdh probe CGGCACAGTCAAGGCCGAGAATGGGAAGC (5 6-carboxytetramethylrhodamine and 3 Black Hole Quencher2TM). The results were normalized using gapdh data for the same sample andexpressed as the number of copies per 105 copies of gapdh.

Statistical analysis. For comparison of mean values for two experimentalgroups, the two-tailed t test was used, and P values were calculated using Sigma-Plot software (SPSS, Chicago, IL). A difference in mean values was deemedsignificant if the P value was � 0.05 or highly significant if the P value was 0.01.The three experimental groups were compared using a one-way analysis ofvariance. Post hoc group pairwise comparisons were conducted using the Bon-

VOL. 77, 2009 T-REG CELLS IN RICKETTSIAL INFECTION 3839


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

ferroni procedure and an overall alpha level of significance of 0.05. We used theGLM procedure in SAS (SAS/STAT 9.1 user’s guide, SAS Institute Inc., Cary,NC) (MEANS statement with the Bonferroni option). For testing the differencein survival between different mouse groups, data were analyzed by the productlimit (Kaplan-Meier) method using GraphPad Prism software.

RESULTS

Lethally infected mice show suppressed IFN-� productionbut enhanced IL-10 production during the early stages ofinfection. As we demonstrated previously (10), C3H mice in-fected intravenously with a lethal dose of R. conorii developeda progressive, overwhelming disseminated endothelial cell in-fection that resulted in 100% mortality on day 6 or 7 postin-fection (data not shown). In contrast, C3H mice infected witha sublethal dose of R. conorii developed self-limited disease,effectively eliminating rickettsiae with 100% survival. To de-termine antigen-specific T-cell responses in sublethal and le-thal infection models, we first examined the cytokine profiles ofsplenocytes from infected and naïve mice in response to anti-gen stimulation. Surprisingly, splenocytes from naïve mice pro-duced significant amounts of IFN-� and IL-10 after stimulationwith R. conorii for 3 days in vitro (Fig. 1A), suggesting that

there was strong immunogenicity of rickettsial antigens.Splenocytes from sublethally infected mice induced a strongprotective IFN-� production type 1 immune response upon invitro stimulation with rickettsial antigens (Fig. 1A). In contrast,splenocytes from lethally infected mice produced a signifi-cantly lower level of IFN-� in response to rickettsial stimula-tion, suggesting that the type 1 immune response in lethallyinfected mice was suppressed in an antigen-specific manner.Interestingly, the suppressed Rickettsia-specific type 1 immuneresponse in lethally infected mice was associated with elevatedIL-10 production by splenocytes restimulated in vitro withRickettsia (Fig. 1A). It is noteworthy that spontaneous produc-tion of IL-10 was also detected in culture supernatant of un-stimulated immune splenocytes from lethally infected mice.

No significant level of TGF-� was detected in the superna-tants from the spleen cell cultures stimulated with Rickettsia,suggesting that TGF-� was not associated with a suppressedtype 1 immune response (data not shown). To assess whetherlocal cytokine profiles in the spleens of infected mice wereconsistent with systemic cytokine levels in vivo, we determinedthe levels of IFN-� and IL-10 in the sera of both sublethally

FIG. 1. Inhibition of IFN-� production, but enhancement of IL-10 production, in lethally infected mice compared with uninfected andsublethally infected mice. On day 5 postinfection, uninfected and infected mice were sacrificed. (A) Splenocytes were isolated from mice andstimulated with R. conorii (MOI, 5) or medium. The IFN-� and IL-10 in the supernatant were assayed using an ELISA after 3 days of culture.(B) Sera were collected, and the IFN-� and IL-10 in the sera were assayed using an ELISA. The data represent the results of two similarindependent experiments in which there were three mice per group. The bars and error bars indicate the means and standard deviations of theresults for three individual mice (�, P 0.01; ��, P 0.05). Post hoc group pairwise comparisons were conducted using the Bonferroni procedure(alpha � 0.05). uninfect, uninfected.

3840 FANG ET AL. INFECT. IMMUN.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

and lethally infected mice. Lethal rickettsial infection was as-sociated with lower levels of IFN-� but higher levels of IL-10 inthe spleen (local site of infection) and sera (systemically) com-pared to the levels associated with sublethal infection (Fig.1B). These results suggested that lethal infection resulted inlocal and systemic suppression of the type 1 T-cell immuneresponse, which was associated with enhanced production ofIL-10 in an antigen-specific manner.

Lethal infection results in suppressed CD4� T-cell prolif-eration and IL-2 production. To determine the regulatorymechanisms that contribute to the suppressed type 1 immuneresponse in a fatal infection, we first examined CD4� T-cellproliferation using CFSE staining in response to anti-CD3 orrickettsial stimulation. On day 5 postinfection, CFSE-labeledCD4� T cells from sublethally infected mice exhibited evidentproliferation in response to in vitro polyclonal or antigen-specific stimulation (Fig. 2A). In contrast, lethal rickettsialinfection induced suppressed CD4� T-cell proliferation in re-sponse to a T-cell receptor stimulus compared to the prolifer-ation in uninfected and sublethally infected mice. SplenicCD4� T cells from a lethal infection showed a lack of respon-siveness or anergy to antigen-specific stimulation as subse-quent in vitro rickettsial stimulation for 60 h did not result inany detectable cell proliferation. The suppressed CD4� T-cellproliferation in lethal infections was linked with the failure toproduce IL-2. Splenocytes from lethally infected C3H miceproduced a significantly lower concentration of IL-2 than

splenocytes from sublethally infected mice in response to poly-clonal stimulation with ConA or anti-CD3 plus anti-CD28(Fig. 2B). To determine whether suppression of CD4� T-cellproliferation in lethally infected mice was due to the absenceor consumption of IL-2 by T-reg cells, we measured T-cellproliferation in response to polyclonal stimulation in the pres-ence of IL-2. Our data showed that the suppressed prolifera-tion of splenic CD4� T cells in lethally infected mice was notrestored by addition of IL-2 (Fig. 2A). The unresponsive stateof CD4� T cells in lethally infected mice was also not due todeletion of T cells because the spleens and livers of lethallyinfected mice consistently contained levels of CD4� T cellscomparable to those detected in naïve and sublethally infectedC3H mice (Fig. 3A). These results suggested that lethal infec-tion induces CD4� T-cell unresponsiveness or anergy, whichmay contribute to suppressed protective immunity againstRickettsia.

Expansion of CD4� CD25� T cells in infected sites inducedby lethal infection with R. conorii. To further investigate if theCD4� unresponsiveness and suppressed type 1 response inlethal infections with R. conorii are possibly mediated by T-regcells, we next examined the frequencies of total CD4� CD25�

and natural CD4� Foxp3� T cells at sites of infection, the liver,and the spleen. On day 5 postinfection, the percentages ofCD4� CD25� cells in CD4� T cells from the liver in lethallyand sublethally infected mice were significantly greater thanthe percentages in uninfected mice (Fig. 3B). Although we

FIG. 2. Proliferation of antigen-specific CD4� T cells and IL-2 production by splenocytes due to a lethal infection were markedly suppressedcompared to the results for a sublethal infection. Splenocytes were isolated from uninfected, sublethally infected, or lethally infected mice on day5 postinfection. (A) Splenocytes were labeled with CFSE and stimulated with anti-CD3 (0.5 �g/ml), R. conorii (MOI, 5), or anti-CD3 (0.5 �g/ml)plus IL-2 (10 ng/ml) in the presence of irradiated naïve splenocytes. After 60 h, cells were collected, and the proliferation of CD4� T cells wasexamined by CFSE dilution on gated CD4� CD3� T cells by flow cytometric analysis. (B) Splenocytes were stimulated with ConA (3 �g/ml),anti-CD3 (1 �g/ml) plus anti-CD28 (1 �g/ml), or medium for 24 h. Supernatants were collected for measurement of IL-2 secretion by ELISA. Eachgroup included three mice, and the data are representative of data from three independent experiments in which similar results were obtained.The error bars indicate standard deviations. �, statistically significantly different (P 0.05, as determined using a two-tailed t test). uninfect,uninfected.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

observed expansion of CD4� CD25� cells in spleens of suble-thally and lethally infected mice compared to spleens of unin-fected mice, the expansion was not statistically significant. Bothlethally and sublethally infected mice had significantly lowerpercentages of CD4� Foxp3� T-reg cells in their spleens butnot in their livers than uninfected mice. Kinetic analysis dem-onstrated that there was a progressive decrease in the percent-age of CD4� Foxp3� T cells compared to CD4� CD25� Tcells in the spleens of lethally infected mice with the develop-ment of disease (Fig. 3C), which could have been due to eitherdeletion or migration of CD4� Foxp3� T-reg cells to periph-eral sites of infection. The possibility of migration of Foxp3�

T-reg cells to the liver is less likely because the numbers ofFoxp3� cells in the liver were comparable in lethally and sub-lethally infected mice (Fig. 3B). Since no significant differenceswere observed in the total numbers of splenic CD4� T cellsbetween lethally and nonlethally infected mice (Fig. 3A), ourdata suggested that the majority of splenic CD4� CD25� Tcells in lethally infected mice might be Foxp3� T cells, which isconsistent with the presence of either inducible T-reg cells oreffector T cells.

Antigen-specific CD4 T-cell responses in lethally infectedmice are characterized by suppressed IFN-� production butincreased IL-10 production. To further characterize the phe-

FIG. 3. R. conorii induced substantial expansion of CD4� CD25� T cells, but not CD4� Foxp3� T cells, in infected sites compared to the resultsfor uninfected and sublethally infected mice. Mice were inoculated intravenously with a lethal or sublethal dose of R. conorii. (A) The absolutenumbers of CD4� T cells in livers or spleens from uninfected and infected mice were analyzed on day 6 postinfection by flow cytometry and werecalculated by multiplying the percentage of CD4� T cells by the total number of live splenocytes. (B) The frequencies of CD4� CD25� T cells andCD4� Foxp3� T cells in spleens and livers were determined by flow cytometry on day 5 postinfection. (C) Percentages of splenic CD4� Foxp3�

and CD4� CD25� T cells at the indicated time points. Each mouse group included three mice. The bars and error bars indicate the means andstandard deviations for three mice in each group (*, P 0.05; **, P 0.01). Post hoc group pairwise comparisons were conducted using theBonferroni procedure (alpha � 0.05). uninfect, uninfected.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

notype of the suppressed antigen-specific type 1 immune re-sponse in lethally infected mice, we analyzed the frequencies ofRickettsia-specific IL-2-, IL-4-, IFN-�-, and IL-10-producingCD4� T cells in the spleens of both groups of infected mice byflow cytometry. Splenocytes were harvested from infected mice

and cultured in vitro with naïve syngeneic splenocytes in thepresence or absence of rickettsial antigen. On day 5 postinfec-tion, a high frequency of IFN-�-producing CD4� T cells wasobserved in sublethally infected mice directly ex vivo (Fig. 4A).More importantly, sublethal infection resulted in a significantly

FIG. 4. Antigen-specific-, IFN-�-producing CD4� T cells were suppressed in lethally infected mice. Mice were inoculated with different dosesof R. conorii as described in Materials and Methods. Splenocytes were cultured with or without rickettsiae for 12 h in the presence of naïvesyngeneic splenocytes and treated with Golgi stop for the last 6 h. Cells were collected, and intracellular production of IFN-� and IL-10 (A) andIL-2 (B) by CD4� T cells was examined by flow cytometry. The numbers in the dot blots are percentages (means � standard deviations for twoor three mice in each group) (*, P � 0.05; **, P � 0.06). The experiments were repeated two times with similar results. uninfect, uninfected.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

higher level of IFN-�-producing CD4� T cells after antigenrestimulation in vitro than lethal infection (P � 0.05) (Fig. 4A).In other words, a limited or inhibited IFN-�-producing CD4�

T-cell response, as measured directly ex vivo or following invitro antigen stimulation, was observed in lethally infectedmice compared to sublethally infected mice. A negligible num-ber of IL-4-producing CD4� T cells were detected in bothsublethally and lethally infected mice (data not shown). Theseresults suggested that lethal rickettsial disease was not due tobias of the immune response toward the Th2 phenotype, butrather was due to a suppressed protective CD4� Th1 response.Interestingly, the suppressed CD4� Th1-cell response in thelethal infection was associated with a higher percentage ofIL-10-producing CD4� T cells (P � 0.06) (Fig. 4A) and a lowerpercentage of IL-2-producing CD4� T cells compared to thepercentages in sublethally infected mice (Fig. 4B), as measuredafter in vitro antigen restimulation. These results suggestedthat a low or sublethal dose of R. conorii initiated a protective,substantial, antigen-specific Th1-type CD4� T-cell responsethat resulted in bacterial clearance, while a high or lethal doseof R. conorii induced a suppressed CD4� Th1 response andenhanced IL-10 production, which correlated with progres-sively increased bacterial propagation.

Lethal R. conorii infection-induced CD4� CD25� T-reg cellshave a suppressive function but also produce IFN-� and IL-10in vitro. To further investigate the mechanisms involved inimmunosuppresssion in fatal rickettsiosis, we next examinedwhether R. conorii-induced CD4� CD25� cells in a lethal in-fection were suppressive T-reg cells. Since we found a sup-pressed type 1 immune response and inhibited proliferation ofCD4� T cells with T-cell receptor stimulation in a lethal in-fection but not in a sublethal infection, we characterized onlythe suppressive activity of CD4� CD25� T cells from a lethalinfection in vitro. We purified CD4� CD25� and CD4�

CD25� cells from the spleens of lethally infected mice on day6 postinfection. Purified CD4� CD25� T cells underwent sig-nificant proliferation after stimulation with anti-CD3 alone, asassessed using CFSE dilutions; however, the proliferation wassuppressed by addition of CD4� CD25� T cells (see Fig. S1 inthe supplemental material). Furthermore, IL-2 production bypurified anti-CD3-stimulated CD4� CD25� T cells, CD4�

CD25� T cells, and a mixture of the two populations wasmeasured by ELISA. The presence of CD4� CD25� cellsinhibited production of IL-2 by CD4� CD25� cells even at aratio of CD25� cells to CD25� cells of 10:1 (Fig. 5A). Theinhibitory function of CD4� CD25� cells was not dose depen-dent as similar inhibition of IL-2 production by CD4� CD25�

cells was observed at a ratio of CD25� cells to CD25� cells of4:1 or 1:1. The suppressive effects of CD4� CD25� T cells oncocultured CD4� CD25� T cells were consistent with de-creased IL-2 production by splenocytes (Fig. 2B), IL-2 intra-cellular staining (Fig. 4B), and suppressed CD4� T-cell prolif-eration (Fig. 2A) in lethally infected mice.

To further determine the phenotype of CD4� CD25� T-regcells and whether these cells suppress rickettsia-specific cyto-kine production by effector CD4� CD25� T cells, we examinedIFN-� and IL-10 production by purified splenic CD4� CD25�

cells stimulated with rickettsiae and irradiated accessory cellsin the presence or absence of CD4� CD25� T cells. Interest-ingly, CD4� CD25� T cells produced significantly higher levels

FIG. 5. Purified CD4� CD25� T cells from lethally infected C3Hmice suppressed IL-2 production by CD4� CD25� cells but were alsothe major cells that produced IFN-� and IL-10. Splenocytes werecollected from lethally infected C3H mice on day 6 postinfection.CD4� CD25� and CD4� CD25� cells were purified as described inMaterials and Methods. CD4� CD25� cells were cocultured withCD4� CD25� cells at ratios of 1:0, 10:1, 4:1, 1:1, and 0:1 in thepresence of anti-CD3 (0.25 �g/ml) and irradiated syngeneic spleno-cytes for 18 h. (A) IL-2 concentration in the supernatant measured byELISA. Purified CD4� CD25� cells were cocultured with CD4�

CD25� cells at ratios of 1:0, 10:1, and 0:1 and then stimulated with R.conorii (MOI, 5) for 3 days. The supernatants were collected forELISA of IFN-� (B) and IL-10 (C). The bars and error bars indicatethe means and standard deviations for triplicate cultures. *, statisticallysignificant difference (P 0.01, as determined using a two-tailedt test).



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

of both IFN-� and IL-10 than CD4� CD25� cells in responseto rickettsial stimulation (P 0.05) (Fig. 5B and C). Our datasuggest that CD4� CD25� cells are the major source of bothIFN-� and IL-10. Regardless of whether the IFN-�- and IL-10-producing CD4� CD25� T cells represent a heterogeneouspopulation containing both effector T cells and inducible reg-ulatory cells, it is likely that higher levels of IL-10 productionby CD4� CD25� T cells than by CD4� CD25� T cells play acritical role in antigen-specific suppression of the immune re-sponse in lethally infected mice.

Phenotypic characteristics and cytokine profiles of CD4�

CD25� T-reg cells induced by R. conorii infection in vivo. Tofurther characterize the phenotype of the heterogeneousIFN-�- and IL-10-producing CD4� CD25� T-cell populationin lethally infected mice, we examined multiple markers ofeffector and regulatory cells, such as T-bet (expressed in effec-tor Th1 cells), Foxp3, CD103, and CTLA-4, as well as intra-cellular cytokine production directly ex vivo. Consistent withthe data described above, both lethally and sublethally infectedmice had lower but comparable percentages of Foxp3� CD4�

CD25� T cells in the spleen than uninfected mice. However,splenic CD4� CD25� T cells from lethally infected mice ex-pressed higher levels of T-bet, CD103, and CTLA-4, particu-larly intracellular CTLA-4, than splenic CD4� CD25� T cellsfrom uninfected and sublethally infected mice (Fig. 6A). Anal-ysis of intracellular cytokines in CTLA-4� Foxp3� CD4�

CD25� T cells from lethally infected mice revealed that themajority of IFN-�- and IL-10-producing cells were members ofthe CD4� CD25� cell population and that a small fraction ofIFN-� or IL-10 was produced by CD4� CD25� cells (Fig. 6B).More importantly, only similar small percentages of CD4�

CD25� T cells were producers of both IFN-� and IL-10 insublethally (0.8%) and lethally (0.7%) infected mice (Fig. 6C).This observation suggested that IFN-� and IL-10 were pro-duced by different CD4� CD25� T cells in both groups ofinfected mice, with a very high ratio of IFN-� to IL-10 ( 5:1)in sublethally infected mice but a low ratio of IFN-� to IL-10(1:1) in lethally infected mice. These results were consistentwith the characteristics of CD4� CD25� T cells observed invitro (Fig. 5B and C), which suggested that suppressive CD4�

CD25� T cells from lethally infected mice were composed oftwo T-cell subsets: a low number of IFN-�-producing Th1effector cells and a high number of IL-10-producing adaptiveT-reg cells.

Depletion of CD25� T cells prior to lethal challenge did notchange the disease progression but enhanced the systemic type1 immune response. To further identify the contribution ofCD4� CD25� cells to the suppressive immune responseagainst R. conorii in vivo, we depleted CD25� cells in lethallyinfected mice by using anti-CD25 MAb. More than 90% de-pletion of CD4� CD25� T cells was achieved in uninfectedmice, compared to 60% in infected mice, 8 days after anti-CD25 was administered (Fig. 7A). However, partial depletionof CD25� T cells did not significantly increase or decrease thesurvival rate (Fig. 7B), but it did result in significantly in-creased bacterial burdens in the lungs and liver (Fig. 7C) com-pared to the bacterial burdens in nondepleted lethally infectedmice. Interestingly, although anti-CD25 MAb-mediated deple-tion of CD25� T cells significantly decreased the percentage ofantigen-specific IFN-�-producing CD4� T cells in the splenic

site of infection (Fig. 7D), it significantly increased the sys-temic level of IFN-�, but not the level of IL-10, compared tothe levels in nondepleted lethally infected mice (Fig. 7E).

DISCUSSION

Our recent in vitro study demonstrated that rickettsiae cantarget DCs to promote T-reg cell expansion, resulting in sup-pressive adaptive immunity in susceptible C3H mice (10). Untilnow, there have been no reported studies of the role of CD4�

T cells and the phenotypes of CD4� T cells that develop in ahost defense against rickettsial infection and the mechanismsby which immunosuppression is generated and maintained in afatal murine model of spotted fever rickettsiosis in vivo. On thebasis of the inability of spleen cells to secrete IL-2 upon stim-ulation with mitogen, immunosuppression was suggested tooccur during infection of C3H mice with a lethal dose of R.conorii (47). The animal models that we used in this studymimic the pathogenesis of severe and mild human rickettsialinfection and provided valuable materials for mechanistic in-vestigation (47). The results presented in this study indicate forthe first time that marked antigen-specific suppression of thesplenic CD4� T-cell response and the suppressed type 1 im-mune response account for the impaired immune response inacute murine severe spotted fever rickettsiosis.

Acute severe human rickettsial diseases have been charac-terized as diseases that stimulate a dominant type 1 immunityand unresponsiveness or suppression of CD4� T cells withtransient immune dysregulation (6, 7, 26). Our study providesstrong evidence that supports the hypothesis that there is asuppressed CD4� Th1-cell response during lethal rickettsialinfection in mice, including (i) inhibition of IFN-� productionby spleen cells in response to rickettsial stimulation comparedto the production in sublethally infected mice (Fig. 1A); (ii) aserum level of IFN-� significantly lower than that in sublethallyinfected mice (Fig. 1B); (iii) suppressed or unresponsive pro-liferation of CD4� T cells in response to anti-CD3 or specificantigen stimulation (Fig. 2A) and inhibition of IL-2 productionby splenocytes (Fig. 2B); and (iv) a lower frequency of antigen-specific IFN-�-producing CD4� T cells and CD4� CD25� Tcells than that in sublethally infected mice (Fig. 4A and 6B).The immunosuppression induced by a high dose of rickettsiaemay account for the uncontrolled bacterial burden, systemicdissemination, and overwhelming infection.

The suppressed immune response observed in mice infectedwith a lethal dose of R. conorii was associated with substantial,significantly greater expansion of CD4� CD25� Foxp3� T-regcells in the infection sites. Our previous in vitro study showedthat DCs from susceptible C3H mice promote the expansion ofFoxp3� CD4� T cells in a DC–T-cell coculture system inresponse to R. conorii infection and in the presence of a highconcentration of IL-2 (10). IL-2 is essential for development ofnatural Foxp3� T-reg cells (35). Thus, the decline in the num-ber of Foxp3� T-reg cells in the spleen in vivo could be due tothe low level of IL-2 in lethally infected mice produced byeffector CD4� T cells (Fig. 2B and 4B). Very recently, Ertelt etal. indicated that selective priming proliferation of Foxp3�

CD4� T cells is a distinguishing feature of acute bacterialinfection (9), which is consistent with our observation.

A lethal rickettsial infection induced a heterogeneous CD4�



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

FIG. 6. Splenic CD4� CD25� T-reg cells induced by a lethal dose of R. conorii were CTLA-4high Foxp3� T-bet� IFN-�� IL-10�. Mice were inoculated withdifferent doses of R. conorii as described in Materials and Methods. On day 5 postinfection, spleen cells were collected and analyzed for surface expression ofCD4 and CD25. (A) Cells were stained with anti-CD103 on the membrane and with anti-CTLA-4, anti-Foxp3, and anti-T-bet intracellularly. The histogramsshow expression profiles of gated CD4� CD25� cells from uninfected and infected spleens. The numbers indicate the percentages of cells expressing theregulatory markers. (B) Expression levels of CD25, IFN-�, and IL-10 on gated splenic CD4� T cells. (C) Production of IFN-� and IL-10 in gated splenic CD4�

CD25� cells. Splenocytes were pooled from three mice in each group. The results are representative of two independent experiments with similar designs.uninfect, uninfected.

3846


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

CD25� Foxp3� T-cell population consisting of IL-10-produc-ing adaptive T-reg cells and IFN-�-producing T-effector cells.In response to an infectious pathogen, adaptive T-reg cells inperipheral lymphoid tissues are frequently Foxp3� (31, 36).The splenic CD4� CD25� T-reg cell population in a lethal R.conorii infection is different from the Th1-like T-reg cell pop-ulation due to the absence of Foxp3 expression (39) and dif-

ferent from IFN-�- and IL-10-producing or multifunctionalCD4 T cells described previously for microbial infections inhumans and in mice (1, 17, 20, 30, 42). However, some IL-10-producing T-reg 1 cells that develop from conventional T cellsalso produce IFN-� (32, 42, 44), and their induction is depen-dent on IL-10. Other studies have shown that murine T-reg 1cells rarely secrete IFN-� (2). Whether the induction and the

FIG. 7. Depletion of CD25� cells prior to lethal challenge with R. conorii did not improve survival but enhanced the systemic type 1 immuneresponse. As described in Materials and Methods, 1 mg of rat anti-mouse CD25 MAb was inoculated intraperitoneally into mice 3 days beforeinfection with a lethal dose of R. conorii to deplete CD25� cells in vivo. (A) Flow cytometric data showing the frequency of splenic CD4� CD25�

T cells from uninfected and infected mice on day 8 after anti-CD25 MAb treatment. Nondepleted mice served as controls. The data are the datafrom one experiment with three mice per group. (B) Survival of mice inoculated with a lethal dose of R. conorii and treated with anti-CD25.(C) Bacterial loads in tissues from lethally infected mice with or without Ab treatment on day 5 postinfection as determined by quantitativereal-time PCR. The bars and error bars indicate the means and standard deviations for three mice in each group. (D) Frequency of antigen-specificIFN-�- and IL-10-producing splenic CD4� T cells as determined by flow cytometry following in vitro stimulation with rickettsial antigens. Thefrequency of antigen-specific cytokine-producing CD4� T cells was determined by subtracting the percentage of cytokine-producing CD4� T cellsin cultures with medium only from the percentage of cytokine-producing CD4� T cells in cultures with rickettsial antigen stimulation. (E) Serumconcentrations of IFN-� and IL-10 in untreated or Ab-treated mice measured on day 5 after infection with a lethal dose of R. conorii. The dataare the means and standard errors of the means for the results obtained from three mice per group. *, P � 0.05. uninfect, uninfected; GAPDH,glyceraldehyde-3-phosphate dehydrogenase gene copies.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

suppressive function of IL-10-producing adaptive CD4� CD25�

T-reg cells in acute severe murine spotted fever rickettsiosis aredependent on IL-10 in vivo requires further investigation. Takentogether, the data indicate that splenic CD4� CD25� T-reg cellsinduced by a lethal infection with R. conorii may represent a novelphenotype of adaptive cells that are Th1-like.

Partial depletion of CD25� T-reg cells in vivo in a lethalinfection with R. conorii did not change the disease progressionbut resulted in a significantly increased bacterial burden, de-creased the local IFN-�-producing CD4� Th1 cell response,and enhanced the systemic type 1 immune response. These datasuggest that CD4� CD25� T-reg cells not only contributegreatly to suppressing the systemic type 1 immune responseagainst rickettsial infection but also contribute to local bacte-rial control. We propose the following possibilities that explainthe role of CD4� CD25� T-reg cells in a lethal infection withR. conorii. (i) CD4� CD25� T cells are the IFN-�-producingT-effector cells, as well as suppressive T-reg cells in infectionsites. Anti-CD25 MAb depleted the whole population ofCD4� CD25� T cells, including IFN-�-producing T-effectorcells, which could explain the increased rickettsial burden inliver and lungs in Ab-treated mice compared to the burden incontrol mice group. (ii) CD4� CD25� T-reg cells may directlyinhibit other IFN-�-producing cells, such as CD8� T cellsand/or NK cells, in response to rickettsial infection, which mayexplain the enhanced systemic type 1 immune response afterdepletion. (iii) CD4� CD25� T-reg cells may control traffick-ing of IFN-�-producing effector cells to the sites of infection,such as the spleen, through production of chemokines. Inter-estingly, a recent study suggested that CD25� T-reg cells fa-cilitate early immune responses to local viral infection, at leastin part by regulating homing of immune effector cells to sites ofinfection via mediating production of CCL2 and CCR5 che-mokines (24). Further experiments that examine the effect ofCD25� cell depletion on local and systemic chemokine pro-duction and migration of other effector cells, such as IFN-�-producing CD8� T cells and NK cells, to peripheral sites ofinfection in lethally infected mice could distinguish betweenthese possibilities. Finally, (iv) CD4� CD25� T-reg cells maybe partially responsible for immunosuppresssion, while otherimmune regulatory molecules or cells, such as CD8� T-regcells, are also involved. Protective immunity against Rickettsiais associated simultaneously with an increased level of IFN-�and a reduced level of IL-10 in the serum (Fig. 1A). Antibody-mediated CD25� T-reg cell depletion neither enhanced theIL-10-producing CD4 T-cell response nor reduced the IL-10concentration in the serum (Fig. 7D and E), which suggeststhat IL-10 may contribute greatly to the immune regulatorymechanisms independent of CD4� CD25� T-reg cells. Thus, itis possible that IL-10-producing antigen-presenting cells, suchas DCs, are involved in the immunosuppression, in addition tothe suppression mediated by CD4� CD25� T-reg cells. In-deed, there is accumulating evidence that interactions betweenDCs and T-reg cells, rather than T-reg cells alone, play acrucial role in the balance between an efficient immune re-sponse and tolerance (19, 28). The latter conclusion is sup-ported by our in vitro data showing greater production of IL-10by DCs from susceptible C3H mice than by DCs from resistantB6 mice (data not shown). In addition, our previous in vitrostudy showed that rickettsia-infected DCs are the cells that

induce the suppressive CD4� Th1-cell response (10). Furtherevidence for the potential role of other immune regulatorymechanisms in the immunosuppression includes the findingthat suppressed proliferation of CD4� T cells was not reversedby addition of a high concentration of IL-2 in lethally infectedmice (Fig. 2), which suggests that the suppressed proliferationand function of T cells are not just due to the competition forIL-2 by T-reg cells with T effector cells. CTLA-4 has beendemonstrated to correlate with the suppressive function ofCD4� CD25� T-reg cells (4, 34, 49). It is possible that CD4�

CD25� T-reg cells mediated the immunosuppression viaCTLA-4 in lethal infections with R. conorii.

Taken together, the data obtained in this study demon-strated that immunosuppression developed in an acute severeinfection caused by the intracellular bacterium R. conorii. Thisintracellular pathogen induced a novel phenotype of suppres-sive T-reg cells that produced both IFN-� and IL-10, wereCD4� CD25� T-bet� Foxp3� CTLA-4high, and were com-posed of different subsets, including effector and inducibleregulatory T cells. Our studies provided strong evidence thatthis novel T-reg cell population contributed greatly to theprofound immunosuppression via as-yet-unidentified mecha-nisms that may involve IL-10 production, CTLA-4, or an indi-rect process via an influence on DC functions. Understandingthe mechanisms by which immunosuppression is generated andmediated would increase our understanding of the pathogen-esis of rickettsial infection. Our results also emphasize theconclusion that when designing a safe and protective vaccine orimmunotherapeutic strategies against rickettsiae, workersshould avoid immunosuppressive mechanisms.

ACKNOWLEDGMENTS

This work was supported by grant AI021242 from the NationalInstitute of Allergy and Infectious Diseases.

We thank Lynn Soong for helpful discussions, Doris Baker andSherrill Hebert for their excellent secretarial assistance, and James J.Grady for his contribution of statistical expertise. We also express ourgratitude to Emily Crossley, Thomas Bednarek, Donald Bouyer, andPatricia Crocquet-Valdes for their support and assistance during thisproject.

We have no financial conflict of interest.

REFERENCES

1. Anderson, C. F., M. Oukka, V. J. Kuchroo, and D. Sacks. 2007. CD4�

CD25� Foxp3� Th1 cells are the source of IL-10-mediated immune sup-pression in chronic cutaneous leishmaniasis. J. Exp. Med. 204:285–297.

2. Battaglia, M., S. Gregori, R. Bacchetta, and M. G. Roncarolo. 2006. Tr1cells: from discovery to their clinical application. Semin. Immunol. 18:120–127.

3. Belkaid, Y., and B. T. Rouse. 2005. Natural regulatory T cells in infectiousdisease. Nat. Immunol. 6:353–360.

4. Birebent, B., R. Lorho, H. Lechartier, S. de Guibert, M. Alizadeh, N. Vu, A.Beauplet, N. Robillard, and G. Semana. 2004. Suppressive properties ofhuman CD4� CD25� regulatory T cells are dependent on CTLA-4 expres-sion. Eur. J. Immunol. 34:3485–3496.

5. Cabrera, R., Z. Tu, Y. Xu, R. J. Firpi, H. R. Rosen, C. Liu, and D. R. Nelson.2004. An immunomodulatory role for CD4� CD25� regulatory T lympho-cytes in hepatitis C virus infection. Hepatology 40:1062–1071.

6. Cillari, E., S. Milano, P. D’Agostino, F. Arcoleo, G. Stassi, A. Galluzzo, P.Richiusa, C. Giordano, P. Quartararo, P. Colletti, G. Gambino, C. Mocciaro,A. Spinelli, G. Vitale, and S. Mansueto. 1996. Depression of CD4 T cellsubsets and alteration in cytokine profile in boutonneuse fever. J. Infect. Dis.174:1051–1057.

7. de Sousa, R., N. Ismail, S. D. Nobrega, A. Franca, M. Amaro, M. Anes, J.Pocas, R. Coelho, J. Torgal, F. Bacellar, and D. H. Walker. 2007. Intrale-sional expression of mRNA of interferon-gamma, tumor necrosis factor-alpha, interleukin-10, nitric oxide synthase, indoleamine-2,3-dioxygenase,and RANTES is a major immune effector in Mediterranean spotted feverrickettsiosis. J. Infect. Dis. 196:770–781.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

8. Dumler, J. S., and D. H. Walker. 2005. Rocky Mountain spotted fever—changing ecology and persisting virulence. N. Engl. J. Med. 353:551–553.

9. Ertelt, J. M., J. H. Rowe, T. M. Johanns, J. C. Lai, J. B. McLachlan, and S. S.Way. 2009. Selective priming and expansion of antigen-specific Foxp3�

CD4� T cells during Listeria monocytogenes infection. J. Immunol. 182:3032–3038.

10. Fang, R., N. Ismail, L. Soong, V. L. Popov, T. Whitworth, D. H. Bouyer, andD. H. Walker. 2007. Differential interaction of dendritic cells with Rickettsiaconorii: impact on host susceptibility to murine spotted fever rickettsiosis.Infect. Immun. 75:3112–3123.

11. Feng, H., V. L. Popov, G. Yuoh, and D. H. Walker. 1997. Role of T lympho-cyte subsets in immunity to spotted fever group rickettsiae. J. Immunol.158:5314–5320.

12. Feng, H. M., V. L. Popov, and D. H. Walker. 1994. Depletion of gammainterferon and tumor necrosis factor alpha in mice with Rickettsia conorii-infected endothelium: impairment of rickettsicidal nitric oxide productionresulting in fatal, overwhelming rickettsial disease. Infect. Immun. 62:1952–1960.

13. Feng, H. M., and D. H. Walker. 1993. Interferon-gamma and tumor necrosisfactor-alpha exert their antirickettsial effect via induction of synthesis ofnitric oxide. Am. J. Pathol. 143:1016–1023.

14. Feng, H. M., and D. H. Walker. 2000. Mechanisms of intracellular killing ofRickettsia conorii in infected human endothelial cells, hepatocytes, and mac-rophages. Infect. Immun. 68:6729–6736.

15. Fontenot, J. D., J. P. Rasmussen, L. M. Williams, J. L. Dooley, A. G. Farr,and A. Y. Rudensky. 2005. Regulatory T cell lineage specification by theforkhead transcription factor foxp3. Immunity 22:329–341.

16. Gazzinelli, R. T., M. Wysocka, S. Hieny, T. Scharton-Kersten, A. Cheever, R.Kuhn, W. Muller, G. Trinchieri, and A. Sher. 1996. In the absence ofendogenous IL-10, mice acutely infected with Toxoplasma gondii succumb toa lethal immune response dependent on CD4� T cells and accompanied byoverproduction of IL-12, IFN-gamma and TNF-alpha. J. Immunol. 157:798–805.

17. Gerosa, F., C. Nisii, S. Righetti, R. Micciolo, M. Marchesini, A. Cazzadori,and G. Trinchieri. 1999. CD4� T cell clones producing both interferon-gamma and interleukin-10 predominate in bronchoalveolar lavages of activepulmonary tuberculosis patients. Clin. Immunol. 92:224–234.

18. Hanson, B. A., C. L. Wisseman, Jr., A. Waddell, and D. J. Silverman. 1981.Some characteristics of heavy and light bands of Rickettsia prowazekii onRenografin gradients. Infect. Immun. 34:596–604.

19. Hubert, P., N. Jacobs, J. H. Caberg, J. Boniver, and P. Delvenne. 2007. Thecross-talk between dendritic and regulatory T cells: good or evil? J. Leukoc.Biol. 82:781–794.

20. Jankovic, D., M. C. Kullberg, C. G. Feng, R. S. Goldszmid, C. M. Collazo, M.Wilson, T. A. Wynn, M. Kamanaka, R. A. Flavell, and A. Sher. 2007. Con-ventional T-bet� Foxp3� Th1 cells are the major source of host-protectiveregulatory IL-10 during intracellular protozoan infection. J. Exp. Med. 204:273–283.

21. Jiaxiang, J., J. Masterson, J. Sun, and L. Soong. 2005. CD4� CD25� reg-ulatory T cells restrain pathogenic responses during Leishmania amazonensisinfection. J. Immunol. 174:7147–7153.

22. Kursar, M., M. Koch, H. W. Mittrucker, G. Nouailles, K. Bonhagen, T.Kamradt, and S. H. Kaufmann. 2007. Cutting edge: regulatory T cells pre-vent efficient clearance of Mycobacterium tuberculosis. J. Immunol. 178:2661–2665.

23. Luhn, K., C. P. Simmons, E. Moran, N. T. Dung, T. N. Chau, T. N. Quyen,T. T. Thao le, T. Van Ngoc, N. M. Dung, B. Wills, J. Farrar, A. J. McMichael,T. Dong, and S. Rowland-Jones. 2007. Increased frequencies of CD4�

CD25high regulatory T cells in acute dengue infection. J. Exp. Med. 205:979–985.

24. Lund, J. M., L. Hsing, T. T. Pham, and A. Y. Rudensky. 2008. Coordinationof early protective immunity to viral infection by regulatory T cells. Science320:1220–1224.

25. Lundgren, A., E. Suri-Payer, K. Enarsson, A. M. Svennerholm, and B. S.Lundin. 2003. Helicobacter pylori-specific CD4� CD25high regulatory T cellssuppress memory T-cell responses to H. pylori in infected individuals. Infect.Immun. 71:1755–1762.

26. Mansueto, P., G. Vitale, G. Di Lorenzo, F. Arcoleo, S. Mansueto, and E.Cillari. 2008. Immunology of human rickettsial diseases. J. Biol. Regul.Homeost. Agents 22:131–139.

27. Mills, K. H. 2004. Regulatory T cells: friend or foe in immunity to infection?Nat. Rev. Immunol. 4:841–855.

28. Murphy, M. L., S. E. Cotterell, P. M. Gorak, C. R. Engwerda, and P. M.

Kaye. 1998. Blockade of CTLA-4 enhances host resistance to the intracel-lular pathogen, Leishmania donovani. J. Immunol. 161:4153–4160.

28a.National Research Council. 1996. Guide for the care and use of laboratoryanimals. National Academy Press, Washington, DC.

29. Ortega, G., R. J. Robb, E. M. Shevach, and T. R. Malek. 1984. The murineIL 2 receptor. I. Monoclonal antibodies that define distinct functionalepitopes on activated T cells and react with activated B cells. J. Immunol.133:1970–1975.

30. Pohl-Koppe, A., K. E. Balashov, A. C. Steere, E. L. Logigian, and D. A.Hafler. 1998. Identification of a T cell subset capable of both IFN-gammaand IL-10 secretion in patients with chronic Borrelia burgdorferi infection.J. Immunol. 160:1804–1810.

31. Qiao, M., A. M. Thornton, and E. M. Shevach. 2007. CD4� CD25� [cor-rected] regulatory T cells render naive CD4� CD25� T cells anergic andsuppressive. Immunology 120:447–455.

32. Roncarolo, M. G., S. Gregori, M. Battaglia, R. Bacchetta, K. Fleischhauer,and M. K. Levings. 2006. Interleukin-10-secreting type 1 regulatory T cells inrodents and humans. Immunol. Rev. 212:28–50.

33. Sakaguchi, S. 2005. Naturally arising Foxp3-expressing CD25� CD4� reg-ulatory T cells in immunological tolerance to self and non-self. Nat. Immu-nol. 6:345–352.

34. Sansom, D. M., and L. S. Walker. 2006. The role of CD28 and cytotoxicT-lymphocyte antigen-4 (CTLA-4) in regulatory T-cell biology. Immunol.Rev. 212:131–148.

35. Setoguchi, R., S. Hori, T. Takahashi, and S. Sakaguchi. 2005. Homeostaticmaintenance of natural Foxp3� CD25� CD4� regulatory T cells by inter-leukin (IL)-2 and induction of autoimmune disease by IL-2 neutralization. J.Exp. Med. 201:723–735.

36. Shevach, E. M. 2006. From vanilla to 28 flavors: Multiple varieties of Tregulatory cells. Immunity 25:195–201.

37. Shevach, E. M., R. A. DiPaolo, J. Andersson, D. M. Zhao, G. L. Stephens,and A. M. Thornton. 2006. The lifestyle of naturally occurring CD4� CD25�

Foxp3� regulatory T cells. Immunol. Rev. 212:60–73.38. Smith, P., C. M. Walsh, N. E. Mangan, R. E. Fallon, J. R. Sayers, A. N.

McKenzie, and P. G. Fallon. 2004. Schistosoma mansoni worms induceanergy of T cells via selective up-regulation of programmed death ligand 1 onmacrophages. J. Immunol. 173:1240–1248.

39. Stock, P., O. Akbari, G. Berry, G. J. Freeman, R. H. Dekruyff, and D. T.Umetsu. 2004. Induction of T helper type 1-like regulatory cells that expressFoxp3 and protect against airway hyper-reactivity. Nat. Immunol. 5:1149–1156.

40. Tarleton, R. L. 1988. Trypanosoma cruzi-induced suppression of IL-2 pro-duction. I. Evidence for the presence of IL-2-producing cells. J. Immunol.140:2763–2768.

41. Tarleton, R. L. 1988. Trypanosoma cruzi-induced suppression of IL-2 pro-duction. II. Evidence for a role for suppressor cells. J. Immunol. 140:2769–2773.

42. Trinchieri, G. 2001. Regulatory role of T cells producing both interferongamma and interleukin 10 in persistent infection. J. Exp. Med. 194:F53–F57.

43. Valbuena, G., W. Bradford, and D. H. Walker. 2003. Expression analysis ofthe T-cell-targeting chemokines CXCL9 and CXCL10 in mice and humanswith endothelial infections caused by rickettsiae of the spotted fever group.Am. J. Pathol. 163:1357–1369.

44. Vieira, P. L., J. R. Christensen, S. Minaee, E. J. O’Neill, F. J. Barrat, A.Boonstra, T. Barthlott, B. Stockinger, D. C., Wraith, and A. O’Garra. 2004.IL-10-secreting regulatory T cells do not express Foxp3 but have comparableregulatory function to naturally occurring CD4� CD25� regulatory T cells.J. Immunol. 172:5986–5993.

45. Walker, D. H., and N. Ismail. 2008. Emerging and re-emerging rickettsioses:endothelial cell infection and early disease events. Nat. Rev. Microbiol.6:375–386.

46. Walker, D. H., J. P. Olano, and H. M. Feng. 2001. Critical role of cytotoxicT lymphocytes in immune clearance of rickettsial infection. Infect. Immun.69:1841–1846.

47. Walker, D. H., V. L. Popov, J. Wen, and H. M. Feng. 1994. Rickettsia conoriiinfection of C3H/HeN mice. A model of endothelial-target rickettsiosis. Lab.Investig. 70:358–368.

48. Zelinskyy, G., A. R. Kraft, S. Schimmer, T. Arndt, and U. Dittmer. 2006.Kinetics of CD8� effector T cell responses and induced CD4� regulatory Tcell responses during Friend retrovirus infection. Eur. J. Immunol. 36:2658–2670.

49. Zheng, Y., C. N. Manzotti, M. Liu, F. Burke, K. I. Mead, and D. M. Sansom.2004. CD86 and CD80 differentially modulate the suppressive function ofhuman regulatory T cells. J. Immunol. 172:2778–2784.

Editor: W. A. Petri, Jr.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

CD4 CD25 Foxp3 T-Regulatory Cells Produce both Gamma ... · generated in acute murine spotted fever...

Documents

Transcript of CD4 CD25 Foxp3 T-Regulatory Cells Produce both Gamma ... · generated in acute murine spotted fever...